In Vitro Propagation Using Transverse Thin Cell Layer Culture and Homogeneity Assessment in...
-
Upload
gyan-singh -
Category
Documents
-
view
220 -
download
3
Transcript of In Vitro Propagation Using Transverse Thin Cell Layer Culture and Homogeneity Assessment in...
![Page 1: In Vitro Propagation Using Transverse Thin Cell Layer Culture and Homogeneity Assessment in Ceropegia bulbosa Roxb.](https://reader035.fdocuments.net/reader035/viewer/2022081202/57509f151a28abbf6b1688ea/html5/thumbnails/1.jpg)
In Vitro Propagation Using Transverse Thin Cell Layer Cultureand Homogeneity Assessment in Ceropegia bulbosa Roxb.
Richa Dhir • Gyan Singh Shekhawat
Received: 10 March 2014 / Accepted: 7 May 2014
� Springer Science+Business Media New York 2014
Abstract Ceropegia bulbosa is an endangered medicinal
plant used traditionally in the treatment of various diseases.
Our aim is to develop a rapid and a competent procedure
for direct and indirect organogenesis from transverse thin
cell layer (tTCL) explants of C. bulbosa. Optimum
response to direct adventitious shoot bud induction from
tTCLs was observed on medium augmented with 8.8 lM
6-benzyladenine (BA) producing 15.6 ± 0.31 shoots per
responsive explant. Best callusing response (95 %) was
observed with tTCL explants in medium containing
4.5 lM 2,4-dichlorophenoxyacetic acid and 2.2 lM BA.
High frequency shoot regeneration (75 %) was observed
from tTCL derived calli. Medium containing 8.8 lM BA
and 0.27 lM a-naphthalene acetic acid produced
22.2 ± 0.64 shoots with shoots acquiring an average length
of 4.6 ± 0.12 cm. In vitro rooting was recorded on �strength Murashige and Skoog medium, producing
10.9 ± 0.23 roots with a length of 4.24 ± 0.16 cm. Plants
were successfully transferred to the field with a survival
rate of 89 %. The clonal nature of the regenerants was
assessed using Inter-simple sequence repeat markers.
Keywords Ceropegia bulbosa � Transverse thin cell
layer � Ascelpidaceae � Organogenesis � ISSR analyses �Conservation
Introduction
In vitro culture techniques are of great significance for the
collection, conservation, propagation, and storage of plant
germplasm especially in plant species that do not propagate
effectively in natural conditions (Dhir and Shekhawat 2014).
Ceropegia bulbosa Roxb., is a slender fleshy twining medic-
inal herb that belongs to the family Ascelpidaceae. The plant
generally grows in comparatively drier parts of the country,
shows slight succulence and features C4 photosynthesis
(Ziegler and others 1981). The tubers of Ceropegia are a
source of pyridine alkaloid cerpegin, which are relatively rare
in nature (Nadkarni 1976). The tubers are edible (Mabberley
1987) and contain starch, sugars, gum, albuminoids, carbo-
hydrates, fats, and crude fibers. Reports suggest that the plant
can be used as a cure against diarrhea, migraines, urinary
problems, skin disorders, fertility problems, stroke, piles,
tuberculosis, menstrual problems, jaundice, wounds, and
poison bites (Kirtikar and Basu 1975; Jain and Defillips 1991).
However, due to over utilization of the plant from the natural
growing areas C. bulbosa is threatened. Naturally the plant
propagates through perennial tubers. However, the starchy
tubers are prone to fungal infections thus leading to decay of
tubers as a major problem in its cultivation and maintenance.
Consequently, it is necessary to develop an efficient regen-
eration process in C. bulbosa.
Thin cell layer culturing offers an in vitro system that
can be used as an efficient tool for mass propagation in
C. bulbosa. Originating in 1974 (Van Tran Thanh 1974), the
concept of ‘‘Thin Cell Layer Culture’’ has developed from
an innovative idea into an actual field of experimentation and
research. In thin cell layer culturing, very small longitudinal
(lTCL) or transverse (tTCL) sections are excised from dif-
ferent plant organs (Silva 2003). Longitudinal TCLs usually
contain a single tissue type for example, a monolayer of
R. Dhir
Department of Bioscience and Biotechnology, Banasthali
University, Banasthali 304022, Rajasthan, India
G. S. Shekhawat (&)
Department of Botany, Jai Narain Vyas University,
Jodhpur 342001, Rajasthan, India
e-mail: [email protected]
123
J Plant Growth Regul
DOI 10.1007/s00344-014-9432-2
![Page 2: In Vitro Propagation Using Transverse Thin Cell Layer Culture and Homogeneity Assessment in Ceropegia bulbosa Roxb.](https://reader035.fdocuments.net/reader035/viewer/2022081202/57509f151a28abbf6b1688ea/html5/thumbnails/2.jpg)
epidermal cells, but sometimes two tissue types may also be
found. Transverse TCLs are comprised a few cells from
diverse tissue types such as epidermal, cambium, cortical,
medullar, and parenchyma cells (Van Tran Thanh 1980).
TCL explants have resulted in successful propagation of
species such as Lilium longiflorum (Nhut and others 2001),
Panax ginseng (Langhansova and others 2012), and Talinum
triangulare (Swarna and Ravindhran 2013). TCLs have been
used for both shoot regeneration and somatic embryogenesis,
and have proved to be superior to any other method of
propagation in terms of the number of plantlets produced
(Lakshmanan and others 1995; Teixeira da Silva and Do-
branszki 2013). Phenotypic, cytological, and genetic
anomalies commonly known as somaclonal variations
(Larkin and Scowcroft 1981) are regularly encountered in
tissue-cultured plants. Hence, production of true-to-type
plants is an important feature of micropropagation. Devel-
opment of molecular biology techniques like random
amplified polymorphic DNA (RAPD) and inter-simple
sequence repeat (ISSR) has helped in assessment of genetic
fidelity of micropropagated plants.
In an attempt to attain quick and efficient plant propa-
gation, tTCL culture technique has been used for regen-
eration of C. bulbosa, also the clonal homogeneity of the
regenerants was confirmed using ISSR analyses.
Materials and Methods
Collection of Plant Material and Explants Preparation
Healthy plants of C. bulbosa were gathered from Udaipur
city, Rajasthan, India and grown in the Botanical garden,
Faculty of Biotechnology, Banasthali University. Young
and tender nodal segments were collected from the plants
just before inoculation. Explants were washed in running
tap water for 30 min, followed by washing with a few
drops of Tween-20 and 2 % (v/v) Cetrimide for 5–10 min
to get rid of surface impurities like dust and microbes.
Explants were then treated with freshly prepared HgCl2(0.1 % w/v) for 3–5 min, inside a laminar airflow hood.
Finally, they were washed with sterilized distilled water for
a few times. tTCL sections 1–4 mm in thickness were
excised from the sterilized nodal segments and were used
for regeneration and callus induction.
Growth Medium and Culture Conditions
Murashige and Skoog’s (MS) medium was used for culture
of tTCL segments (Murashige and Skoog 1962). The growth
medium was comprised of MS salts, vitamins, 3 % (w/v)
sucrose, and the pH of the medium was adjusted to 5.6 prior
to the addition of 0.8 % (w/v) agar. Plant growth regulators at
different concentrations were added to the basal medium.
Medium (40 ml) was poured into 100-ml Erlenmeyer flasks
and autoclaved at 121 �C for 15 min. The cultures were
provided a 16/8 h (light/dark) photoperiod; the temperature
was maintained at 25 ± 2 �C and humidity at 50 ± 5 %.
Shoot Induction
For shoot proliferation from tTCL, the tTCL nodal segments
were inoculated on MS medium containing different
concentrations of cytokinins 6-benzyladenine (BA)
(2.2–13.3 lM) or kinetin (Kin) (2.3–13.9 lM)). The effect
of BA along with Kin or a-naphthalene acetic acid (NAA)
was analyzed by culturing tTCLs on MS medium containing
optimized concentration of BA (8.8 lM) and different con-
centrations of Kin (0.46–4.65 lM) or NAA (0.54–5.37 lM).
Data were recorded on percentage shooting and total number
of shoots per explant at the end of 4 weeks.
Callus Induction and Shoot Regeneration
After surface sterilization, explants were inoculated onto
medium supplemented with auxins like 2,4-dichloropehnoxy-
acetic acid (2,4-D) (2.26–13.6 lM) or NAA (2.69–16.1 lM)
for callus induction. The induced callus was proliferated on
medium containing optimized concentrations of auxin 2,4-D
(4.5 lM) in conjunction with different concentrations of
cytokinin BA (2.2–8.8 lM) or Kin (2.3–9.2 lM). Data on
percentage callogenesis, and nature of callus were recorded
after 4 weeks. For shoot bud initiation, the nodular callus was
gently cut into small fragments and transferred onto fresh
medium containing BA (2.2–8.8 lM) or a combination of
8.8 lM BA and auxins (NAA (0.054–0.53 lM), indole-3-
acetic acid (IAA) (0.057–0.57 lM), and indole-3-butyric acid
(IBA) (0.049–0.49 lM)). Data on percentage shooting, number
of shoots/explant and shoot length were recorded at the end of
6 weeks of culture.
Rooting and Hardening of Shoots
Rooting was performed in root induction medium by
excising the regenerated shoots (3–5 cm). Root induction
medium was comprised of MS salts at � strength or full
strength, concentration, along with 3 % sucrose (w/v). Full
strength MS medium with auxins like IAA (5.7–11.4 lM)
and IBA (4.9–9.8 lM) was also used for initiation of roots.
The mean number of roots/shoot and root length were
recorded. Healthy plants were isolated from the culture
tubes and washed in running tap water. They were planted
in paper cups containing sterile vermiculite and soil in the
ratio 1:2. The plants were then enclosed in transparent
polythene bags to maintain high relative humidity and
prevent desiccation. The plants were initially maintained at
J Plant Growth Regul
123
![Page 3: In Vitro Propagation Using Transverse Thin Cell Layer Culture and Homogeneity Assessment in Ceropegia bulbosa Roxb.](https://reader035.fdocuments.net/reader035/viewer/2022081202/57509f151a28abbf6b1688ea/html5/thumbnails/3.jpg)
25 ± 2 �C and 16 h photoperiod. At the end of 4 weeks,
the plants were transferred to clay pots filled with garden
soil and placed in the shade. Fully grown hardened plants
were planted in the field under sunlight.
Preparation and Amplification of Template DNA
Genomic DNA was isolated using N,N,N0,N0 cetyl-trimethyl
ammonium bromide (CTAB) method (Doyle and Doyle
1990). Young leaves obtained from the mother and regener-
ated plants (15 individuals selected randomly) were used for
DNA extraction. Leaf samples (1 g) were ground in liquid
nitrogen. DNA was precipitated using ethanol and finally
suspended in 1X TE buffer. Samples were diluted to a con-
centration of 25 ng/ll for final use. ISSR was performed using
10 primers. Polymerase chain reaction (PCR) was carried out
in a final volume of 25 ll, containing 25 ng of genomic DNA,
200 lM dNTPs, 1X PCR buffer, 1U Taq DNA polymerase,
and 1 lM primer (all reagents from Genei, Banglore, India).
PCR was programed for an initial denaturation step at 94 �C
for 4 min, followed by 40 cycles of three steps each; dena-
turation at 94 �C for 1 min, annealing at the specific annealing
temperature for 1 min and extension at 72 �C for 2 min. Final
extension was carried out at 72 �C for 10 min (Gene Amp
9600, Perkin-Elmer, Norwalk, USA). The PCR products were
analyzed on 2 % agarose gel and stained with ethidium bro-
mide. Number of bands obtained and the size of the amplifi-
cation products were estimated using medium range DNA
ruler (Genei, Banglore, India). Three amplification reactions
were carried out with all ISSR primers.
Statistical Analysis
Experiments were performed in three replicates, with 15
explants in each replicate. Results have been reported as
mean ± SE of three experiments. Data were subjected to
analysis of variance (ANOVA) and statistically analyzed by
SPSS software (version 16). Significant difference among
means was tested using Tukey’s multiple range tests. For ana-
lysis of ISSR data, reproducible bands were scored for their
presence and absence. The data were analyzed using the NTSys
PC version 2.11 V statistical package. Similarity coefficients
were estimated, and cluster analysis was performed using the
unweighted pair group method with arithmetic means.
Results
Effect of Growth Regulators on Direct Shoot
Multiplication from tTCLs
MS medium in the absence of any type of growth regulator
did not produce any shoot buds from the tTCL nodal
segments of C. bulbosa. However, when growth regulators
were added to the growth medium, multiple shoots were
obtained from tTCL segments. The first shoots emerged on
the edges of the explant after 2 weeks of culture (Fig. 1b).
Subsequently, shoot buds arose from the basal region of the
explant (Fig. 1c) and finally a clump of shoots could be
observed (Fig. 1d). The pattern of shoot induction was
similar on most of the medium combinations used, but the
induction frequency varied according to the growth regu-
lators that were added. Medium supplemented with BA
was superior for multiple shoot induction in comparison to
medium containing Kin (Fig. 2). Medium containing
8.8 lM BA was most effective in terms of number of
shoots produced. On medium with 8.8 lM BA, 90 % of
explants were induced to produce shoots and the average
number of shoot buds produced per responsive explants
was 15.6 ± 2.3 (Fig. 2). In further experiments, to increase
the number of shoot buds, BA was used in conjunction with
Kin or NAA. The maximum number of shoots was pro-
duced on medium supplemented with 8.8 lM BA alone
and addition of Kin (0.46–4.65 lM) or NAA (0.54–
5.37 lM) to the medium did not have any positive effect
on shoot multiplication (Table 1).
Influence of PGRs on Callus Induction
Callus was induced successfully from tTCL nodal segment
explants of C. bulbosa. Callus was first induced at the cut
ends of the tTCLs and eventually extended all over the
explant. Type and concentration of PGR used influenced
the frequency of callus induction, and the texture of the
callus was obtained from tTCL explants. When using 2,4-D
(4.52 lM) for callus induction, the callus obtained was
light green, nodular, and fast growing in nature (Fig. 3a, b;
Table 2). Callus induction occurred on 2,4-D, but prolif-
eration of callus could not be obtained on the same med-
ium. The primary callus obtained on medium with 2,4-D
was subsequently transferred to medium containing the
cytokinins BA and Kin (Table 3). Callus proliferated well
on the medium containing a combination of 2,4-D and BA,
and optimum callus growth was obtained on medium
containing 4.5 lM 2,4-D and 2.2 lM BA. The callus
obtained was green in color and nodular in texture.
Regeneration of Shoots from Callus
The morphogenic callus generated from tTCL segments
using different PGRs showed varied results when trans-
ferred onto shoot induction medium. Shoot regeneration
was promoted when the callus was transferred to medium
containing a cytokinin–auxin combination (Fig. 3c). When
cytokinin was used individually, 8.8 lM BA was an
effective concentration for shoot regeneration with a
J Plant Growth Regul
123
![Page 4: In Vitro Propagation Using Transverse Thin Cell Layer Culture and Homogeneity Assessment in Ceropegia bulbosa Roxb.](https://reader035.fdocuments.net/reader035/viewer/2022081202/57509f151a28abbf6b1688ea/html5/thumbnails/4.jpg)
frequency of 78 % and an average of 11.1 ± 0.52 shoots
(Table 4). Shoot induction in the presence of BA was
enhanced by the addition of auxins. Among all the auxins
used in conjunction with cytokinin BA, optimum results
were obtained with NAA. NAA at higher concentrations
led to rapid proliferation of callus rather than regeneration.
Hence, a very low concentration (0.27 lM) was used in
combination with BA for shoot bud formation. The com-
bined effect of BA (8.8 lM) and NAA (0.27 lM) resulted
in 22.2 ± 0.64 shoots and 4.6 ± 0.12 cm mean shoot
length (Table 4).
Rooting of Shoots and Acclimatization
The best rooting response was observed on medium with-
out any growth regulators, with � strength MS being the
most efficient. Full strength MS medium produced
6.76 ± 0.21 roots with a length of 3.9 ± 0.19 cm (Fig. 4).
However, higher in number (10.9 ± 0.23) and longer roots
(4.2 ± 0.15 cm) were obtained on � strength MS medium
(Fig. 4). Auxins (IAA and IBA) caused root induction, but
� strength MS has proved to be superior for root induction,
in terms of number of roots obtained. Plantlets with roots
Fig. 1 Direct plant
regeneration from transverse
thin cell layer (tTCL) nodal
segments of C. bulbosa.
a Inoculated tTCL nodal
segments. b Adventitious shoot
buds emerging from the edge of
the explants. c Shoot buds
developing from the base of the
explant. d Adventitious shoot
buds developing into a clump.
e Shoot multiplication from
tTCL nodal segments on
8.8 lM BA. f Rooting of
microshoot. g Well-hardened
plant of C bulbosa. h Plants
transferred to garden soil
J Plant Growth Regul
123
![Page 5: In Vitro Propagation Using Transverse Thin Cell Layer Culture and Homogeneity Assessment in Ceropegia bulbosa Roxb.](https://reader035.fdocuments.net/reader035/viewer/2022081202/57509f151a28abbf6b1688ea/html5/thumbnails/5.jpg)
were successfully planted in soil and a survival rate of
89 % was observed. The regenerants grew well when
transferred to garden soil. All the plants established ex vitro
were uniform in appearance and did not demonstrate any
visible morphological variations or abnormalities (Figs. 1h,
3g).
Clonal Fidelity of Regenerated Shoots
Inter-simple sequence repeat profiles were similar among
the micropropagated and the mother plants, indicating the
true-to-type nature of these plants. Nine out of the 10 ISSR
primers used during the experimentation produced sharp
and reproducible bands. Annealing temperature for each
primer was different and the optimum temperature varied
in the range of 50 to 62.4 �C (Table 5). For all the primers
used, a total of 38 discrete and scorable bands were pro-
duced and the size of the bands varied from 200 to
1,000 bp. Three to six scorable bands were produced by
each primer with a mean number of 4.2 bands/primer.
Banding profiles produced from the in vitro cultured plants
were monomorphic and comparable to those of the mother
plant. The clonal nature of the regenerated shoots could be
established by the similarity observed in the ISSR banding
profiles (Fig. 5) of the mother plant DNA and the DNA
obtained from the regenerated shoots. Genetic similarity
has been calculated for 16 individuals using the data gen-
erated through ISSR analysis. The value of the similarity
coefficient ranged from 0.86 to 1.0 and a mean value of
0.93 was obtained. A dendrogram was drawn by means of
cluster analysis using the unweighted pair group method
with arithmetic mean (UPGMA) based on Jaccard’s coef-
ficient. The dendrogram indicated high genetic similarity
among the regenerants and the mother plants (Fig. 6).
Discussion
The study demonstrates the feasibility of regenerating
plantlets using tTCL nodal segments, via both direct and
indirect organogenesis by applying different auxins and
cytokinins. Likely advantages of using tTCL nodal seg-
ments as explants may include the ability to induce higher
numbers of shoots and better regeneration frequency. PGRs
are regularly used in in vitro cultures for shoot induction.
tTCL explants were cultured on different combinations of
Fig. 2 Effect of cytokinins on
shoot proliferation from tTCL
nodal segments of C. bulbosa.
Values are mean ± SE of three
independent experiments. Data
were recorded after 4 weeks of
culture on shoot-multiplication
medium. Mean values having
the same letter are not
significantly different at
P \ 0.05 (Tukey’s test)
J Plant Growth Regul
123
![Page 6: In Vitro Propagation Using Transverse Thin Cell Layer Culture and Homogeneity Assessment in Ceropegia bulbosa Roxb.](https://reader035.fdocuments.net/reader035/viewer/2022081202/57509f151a28abbf6b1688ea/html5/thumbnails/6.jpg)
PGRs, and medium containing 8.8 lM BA was most
effective in terms of number of shoots produced. Similar
results have also been observed in the case of Spilanthes
acmella, where BA alone has been used for induction of
shoots (Singh and others 2009). BA has earned the repu-
tation of being the most efficient cytokinin for the initiation
and consequent proliferation of axillary buds in many plant
species (Sahai and Shahzad 2013). The structural stability
of BA and the ability of the plant cells to easily assimilate
the compound makes this particular cytokinin stand out
among others in most of the cases (Ahmad and others
2013). Direct shoot bud induction using nodal segments
has been reported earlier in C. bulbosa (Patil 1998; Britto
and others 2003; Goyal and Bhadauria 2006; Dhir and
Shekhawat 2013), but in the present investigation tTCLs
prove to be the better explants in terms of higher numbers
of shoots produced.
Optimum callus induction has been observed on med-
ium containing 2,4-D (4.52 lM). We observed that the
concentrations of 2,4-D played a critical role in callus
induction. Similar observations have been made in
Ceropegia pusilla (Kondamudi and others 2010) and
Digitaria sanguinalis (Le and others 1997). 2,4-D is pri-
marily involved in callus induction (Prem and others 2005)
Fig. 3 Indirect shoot
regeneration from transverse
thin cell layer (tTCL) derived
callus cultures of C. bulbosa.
a Callus initiation from tTCL
explants. b Proliferating callus
on 2,4-D and BA containing
medium. c Shoot bud initiation
from callus on MS medium
supplemented with BA
(8.8 lM). d Multiple shoot
regeneration on medium
augmented with 8.8 lM BA and
0.268 lM NAA. e Rooting of
shoots on 1/2 strength MS
medium. f Hardening of plants.
g Fully grown callus-derived
plant, in field conditions
J Plant Growth Regul
123
![Page 7: In Vitro Propagation Using Transverse Thin Cell Layer Culture and Homogeneity Assessment in Ceropegia bulbosa Roxb.](https://reader035.fdocuments.net/reader035/viewer/2022081202/57509f151a28abbf6b1688ea/html5/thumbnails/7.jpg)
in many species. Numerous reports suggest that 2,4-D
influences various physiological and molecular processes
leading to callus induction. Metabolism of endogenous
IAA, induction of specific proteins, and control of DNA
methylation are some predicted strategies involved in the
control of callus induction by 2,4-D (Pan and others 2010).
Callus induction has been observed on medium containing
2,4-D, but proliferation of callus did not occur on the same
medium. During the course of the study, it was observed
that callus proliferation occurred on medium containing an
auxin–cytokinin combination. Similar results have been
reported in Elymus sibiricus (Lee and others 2012). Pro-
liferating callus was transferred to cytokinin containing
medium, and BA has been the most effective cytokinin for
shoot induction. BA has been used for shoot induction in
other species like Portulaca grandiflora (Safdari and
Kazemitabar 2010) and Mucuna pruriens (Lahiri and oth-
ers 2012).
To increase the number of shoots, a combination of
cytokinin and auxin was tested, and BA in conjunction
with NAA has proven to be the best in terms of numbers
of shoots produced from the proliferating callus. Shoot
initiation on BA and NAA containing MS medium has
been well documented in plants such as Brassica napus
(Ghnaya and others 2008) and Ceropegia spiralis (Sri
Ram Murthy and Kondamudi 2011). Indirect regeneration
from callus obtained using epicotyl segments has already
been reported in C. bulbosa (Phulwaria and others 2013).
However, seeds of C. bulbosa show poor viability and
germination, which can limit the number of available
explants. Conversely, tTCL explants can easily be
obtained from different organs of the plants and can be
used for plant regeneration.
The best rooting response has been observed on �strength MS medium. Rooting in vitro was clearly influ-
enced by the strength of the MS medium. Similar results
have been reported in C. candelabrum (Beena and others
2003) and Huernia hystrix (Amoo and others 2009). The
auxins IAA and IBA have been used in combination with
MS medium; however, our studies suggest that � MS was
more effective in root induction. A relatively low salt
concentration in the medium is known to enhance rooting
of shoots (Tripathi and Kumari 2010). Rooted plantlets
were acclimatized and transferred to the field. Regenerated
C. bulbosa performed well on transfer to field conditions.
Incidence of genetic variations is a grave setback in
micropropagation of plants because of their random nature.
Assessment of genetic homogeneity of micropropagated
plants is of utmost importance, and the utility of DNA-
based markers for the same has been well acknowledged
(Aggarwal and others 2010; Kumar and others 2011).
Banding profiles produced from the in vitro cultured plants
were monomorphic and similar to the mother plant. Similar
Table 1 Effect of BA in combination with other plant growth
regulators on shoot proliferation
Growth regulators
(lM)
Frequency of response
(%) (mean ± SE)
Number of shoots
(mean ± SE)
BA Kin NAA
8.8 0.46 93.33 ± 1.67e 8.9 ± 0.06d
8.8 2.32 94.33 ± 0.67e 8.6 ± 0.1d
8.8 4.65 81.66 ± 1.67d 7.5 ± 0.26c
8.8 0.54 73 ± 1.53c 3.2 ± 0.15b
8.8 2.69 62.33 ± 1.45b 2.8 ± 0.15b
8.8 5.37 51 ± 0.57a 2.1 ± 0.03a
Mean values within the column followed by the same letter in
superscript are not significantly different at P \ 0.05 (Tukey’s test)
Table 2 Effect of different concentrations of auxins (2,4-D and
NAA) on callus induction from tTCL nodal segment explants
Plant growth
regulators
(lM)
Callogenesis
(%)
Nature of callus Order of
callus
initiation
2,4-D NAA
2.26 78.4 White, compact VII
4.52 100 Light green, nodular I
6.78 100 Light green, friable II
9.04 89.7 White, friable IV
11.31 65.3 White, friable VI
13.57 57.1 White, friable VIII
2.69 –
5.37 90.9 Green, friable III
8.05 80.2 White, friable V
10.74 48.5 White, friable IX
13.43 31.3 Green, friable X
16.11 20.1 Green, friable XI
Table 3 Effects of BA and Kin with optimized concentration of
2,4-D on callus proliferation
Plant growth regulators
(lM)
Callogenesis (%) Nature of callus
2,4-D BA Kin
4.5 2.2 95 Green, nodular
4.5 4.4 95 Green, nodular
4.5 6.6 68 Light green, friable
4.5 8.8 53 Light green, friable
4.5 2.32 45 White, friable
4.5 4.65 60 White, friable
4.5 6.97 42 White, friable
4.5 9.29 35 White, friable
J Plant Growth Regul
123
![Page 8: In Vitro Propagation Using Transverse Thin Cell Layer Culture and Homogeneity Assessment in Ceropegia bulbosa Roxb.](https://reader035.fdocuments.net/reader035/viewer/2022081202/57509f151a28abbf6b1688ea/html5/thumbnails/8.jpg)
results have been obtained in Solanum aculeatissimum
(Ghimire and others 2012) and Simmondsia chinensis
(Kumar and others 2011).
In conclusion, plant regeneration through transverse thin
cell layer explants has been established for the first time in
C. bulbosa. The present study demonstrates a quick and
dependable system for shoot regeneration through tTCL.
The successful propagation system described here provides
an effective means for the conservation, within a short
time, for threatened C. bulbosa. The increased multiplica-
tion rate, cost effective, and easy acclimatization process
make this protocol highly advantageous. Thus, the
Table 4 Effect of various plant
growth regulators on shoot
proliferation from tTCL nodal
segment-derived callus
Mean values within the column
followed by the same letter in
superscript are not significantly
different at P \ 0.05 (Tukey’s
test)
Growth regulator (lM) Percentage
response (%)
Number of shoots
(mean ± SE)
Shoot length
(mean ± SE)BA IAA 1BA NAA
2.2 55 3.7 ± 0.15a 1.3 ± 0.12a
4.4 63 6.6 ± 0.3cd 2.5 ± 0.13c
6.6 75 7.5 ± 0.29cde 3.6 ± 0.34d
8.8 78 11.1 ± 0.52gh 2.4 ± 0.23c
8.8 0.057 49 4.3 ± 0.33ab 1.4 ± 0.09ab
8.8 0.143 54 6.3 ± 0.12cd 1.9 ± 0.06abc
8.8 0.285 78 16.1 ± 0.53i 2.5 ± 0.15c
8.8 0.57 56 8.9 ± 0.52ef 2.4 ± 0.06c
8.8 0.049 59 5.6 ± 0.29abcd 1.4 ± 0.18ab
8.8 0.123 62 3.8 ± 0.34a 1.7 ± 0.12abc
8.8 0.246 65 5.5 ± 0.24abc 2.2 ± 0.1bc
8.8 0.492 60 7.5 ± 0.26de 2.3 ± 0.12c
8.8 0.054 77 6.1 ± 0.35bcd 2.5 ± 0.08c
8.8 0.134 74 10.5 ± 0.29fg 3.5 ± 0.17d
8.8 0.268 75 22.2 ± 0.64j 4.6 ± 0.12e
8.8 0.537 68 12.8 ± 0.6 h 4.1 ± 0.05de
Fig. 4 Effect of growth
regulators on root induction in
in vitro regenerated shoots
of C. bulbosa after 4 weeks of
culture. Mean values having the
same letter are not significantly
different at P \ 0.05 (Tukey’s
test)
J Plant Growth Regul
123
![Page 9: In Vitro Propagation Using Transverse Thin Cell Layer Culture and Homogeneity Assessment in Ceropegia bulbosa Roxb.](https://reader035.fdocuments.net/reader035/viewer/2022081202/57509f151a28abbf6b1688ea/html5/thumbnails/9.jpg)
Table 5 List of primers, their
sequences, number and size of
the amplified fragments
generated by inter-simple
sequence repeat (ISSR) primers
Serial
No.
Primers 50-30 sequence Annealing
temperature
(�C)
Number of
scorable bands/
primer
Range of
amplification
(bp)
1 IS-01 GAGAGAGAGAGAGAGAC 50 4 200–500
2 IS-02 ACACACACACAC ACACT 55 4 200–500
3 IS-03 ACACACACACACACACG 55 5 200–900
4 IS-04 AGAGAGAGAGAGAGAGTT 50 5 300–1000
5 IS-05 GAGAGAGAGAGAGAGACC 62.4 6 200–800
6 IS-06 ACACACACACACACACTT 54 3 200–400
7 IS-07 CTCCTCCTCCTCCTCCTC 60 4 300–900
8 IS-08 GAAGAAGAAGAAGAAGAA – – –
9 IS-09 GGGTGGGGTGGGGTG 62 3 200–600
10 IS-10 ACTTCCCCACAGGTTAACACA 58 4 200–500
Total 38
Fig. 5 Polymerase chain
reaction (PCR) amplification
products obtained with inter-
simple sequence repeat (ISSR)
primer (IS-05). Lane M
represents Medium range DNA
ruler (100–5,000 bp), lane 15
represents the mother plant and
lanes 1–15 represent in vitro-
raised clones derived from
C. bulbosa
Fig. 6 Dendrogram illustrating similarities among 15 regenerated plants (1 to 15) and the mother plant (MP) of C. bulbosa by the UPGMA
cluster analysis calculated from 38 ISSR bands generated with 9 primers
J Plant Growth Regul
123
![Page 10: In Vitro Propagation Using Transverse Thin Cell Layer Culture and Homogeneity Assessment in Ceropegia bulbosa Roxb.](https://reader035.fdocuments.net/reader035/viewer/2022081202/57509f151a28abbf6b1688ea/html5/thumbnails/10.jpg)
procedure described here could be useful for competent
large-scale production and genetic transformation of this
species.
Acknowledgments G. S. Shekhawat acknowledges financial sup-
port from Department of Science and Technology (Raj.) and also
thankful to University Grants Commission (New Delhi) for the sup-
port provided through Center for Advance Study.
References
Aggarwal D, Kumar A, Reddy MS (2010) Shoot organogenesis in
elite clones of Eucalyptus tereticornis. Plant Cell Tissue Organ
Cult 102:45–52
Ahmad N, Javed SB, Khan MI, Anis M (2013) Rapid plant
regeneration and analysis of genetic fidelity in micropropagated
plants of Vitex trifolia: an important medicinal plant. Acta
Physiol Plant 35:2493–2500
Amoo SO, Finnie JF, Van Staden J (2009) In vitro propagation of
Huernia hystrix: an endangered medicinal and ornamental
succulent. Plant Cell Tissue Organ Cult 96:273–278
Beena MR, Martin KP, Kirti PB, Hariharan M (2003) Rapid in vitro
propagation of medicinally important Ceropegia candelabrum.
Plant Cell Tissue Organ Cult 72:285–289
Britto SJ, Natarajan E, Arockiasamy DI (2003) In vitro flowering and
shoot multiplication from nodal explants of Ceropegia bulbosa
Roxb. var. bulbosa. Taiwania 48(2):106–111
Dhir R, Shekhawat GS (2013) Production, storability and morpho-
genic response of alginate encapsulated axillary meristems and
genetic fidelity evaluation of in vitro regenerated Ceropegia
bulbosa: a pharmaceutically important threatened plant species.
Ind Crops Prod 47:139–144
Dhir R, Shekhawat GS (2014) Ecorehabilitation and biochemical
studies of Ceropegia bulbosa Roxb.: a threatened medicinal
succulent. Acta Physiol. doi:10.1007/s11738-014-1512-1
Doyle JJ, Doyle LL (1990) Isolation of plant DNA from fresh tissue.
Focus 12:13–15
Ghimire BK, Yu CY, Chung I-M (2012) Direct shoot organogenesis
and assessment of genetic stability in regenerants of Solanum
aculeatissimum Jacq. Plant Cell Tissue Organ Cult 108:455–464
Ghnaya AB, Charles G, Branchard M (2008) Rapid shoot regener-
ation from thin cell layer explants excised from petioles and
hypocotyls in four cultivars of Brassica napus L. Plant Cell
Tissue Organ Cult 92:25–30
Goyal D, Bhadauria S (2006) In vitro propagation of Ceropegia
bulbosa using nodal segments. Indian J Biotechnol 5:565–567
Jain SK, Defillips R (1991) Asclepidaceae. In: Algonae MI (ed)
Medicinal plants of India. Reference Publications Inc, Michigan
Kirtikar KR, Basu BD (1975) Indian medicinal plants. Bishen Singh
Mahendra Pal Singh, Dehradun
Kondamudi R, Vijayalakshmi V, Sri Rama Murthy K (2010)
Induction of morphogenetic callus and multiple shoot regener-
ation in Ceropegia pusilla Wight and Arn. Biotechnology
9(2):141–148
Kumar S, Mangal M, Dhawan AK, Singh N (2011) Assessment of
genetic fidelity of micropropagated plants of Simmondsia
chinensis (Link) Schneider using RAPD and ISSR markers.
Acta Physiol Plant 33:2541–2545
Lahiri K, Mukhopadhyay MJ, Desjardins Y, Mukhopadhyay S (2012)
Rapid and stable in vitro regeneration of plants through callus
morphogenesis in two varieties of Mucuna pruriens L.—an anti
Parkinson’s drug yielding plant. Nucleus 55:37–43
Lakshmanan P, Loh CS, Goh CJ (1995) An in vitro method for rapid
regeneration of a monopodial orchid hybrid Aranda Deborah
using thin section culture. Plant Cell Rep 14:510–514
Langhansova L, Marsik P, Vanek T (2012) Regulation of tissue
differentiation by plant growth regulators on TCLs of Panax
ginseng adventitious roots. Ind Crops Prod 35:154–159
Larkin P, Scowcroft N (1981) Somaclonal variation—a novel source
of variability from cell for plant improvement. Theor Appl Genet
60:197–214
Le BV, Thao DMN, Gendy C, Vidal J, Van KTT (1997) Somatic
embryogenesis on thin cell layers of a C4 species, Digitaria
sanguinalis (L.) Scop. Plant Cell Tissue Organ Cult 49:201–208
Lee KW, Chinzorig O, Choi GJ, Kim KY, Ji HC, Park HS, Lee SH
(2012) Callus induction and plant regeneration from mature
seeds of Siberian wildrye grass (Elymus sibiricus L.). J. Anim
Plant Sci 22(2):518–521
Mabberley DJ (1987) The plant book. Cambridge University Press,
Cambridge
Murashige T, Skoog F (1962) A revised medium for rapid growth and
bioassays with tobacco tissue cultures. Physiol Plant 15:473–497
Nadkarni KM (1976) Indian materia medica. Popular Prakashan,
Bombay
Nhut DT, Le BV, Teixeira da Silva JA, Aswath CR (2001) Thin cell
layer culture system in Lilium: regeneration and transformation
perspectives. In Vitro Cell Dev Biol Plant 37:516–523
Pan Z, Zhu S, Guan R, Deng X (2010) Identification of 2,4-D-
responsive proteins in embryogenic callus of Valencia sweet
orange (Citrus sinensis Osbeck) following osmotic stress. Plant
Cell Tissue Organ Cult 103:145–153
Patil VM (1998) Micropropagation studies in Ceropegia spp. In Vitro
Cell Dev Biol Plant 34:240–243
Phulwaria M, Shekhawat NS, Rathore JS, Singh RP (2013) An
efficient in vitro regeneration and ex vitro rooting of Ceropegia
bulbosa Roxb.—a threatened and pharmaceutical important
plant of Indian Thar Desert. Ind Crops Prod 42:25–29
Prem D, Singh S, Gupta PP, Singh J, Kadyan SPS (2005) Callus
induction and de novo regeneration from callus in Guar
(Cyamopsis tetragonoloba). Plant Cell Tissue Organ Cult
80:209–214
Safdari Y, Kazemitabar SK (2010) Direct shoot regeneration, callus
induction and plant regeneration from callus tissue in mose rose
(Portulaca grandiflora L.). Plant Omics J 3:47–51
Sahai A, Shahzad A (2013) High frequency in vitro regeneration
system for conservation of Coleus forskohlii: a threatened
medicinal herb. Acta physiol Plant 35:473–481
Silva JAT (2003) Thin cell layer technology in ornamental plant
micropropagation and biotechnology. Afr J Biotechnol
2:683–691
Singh SK, Rai MK, Asthana P, Sahoo L (2009) An improved
micropropagation of Spilanthes acmella L. through transverse
thin cell layer culture. Acta physiol Plant 31:693–698
Sri Ram Murthy K, Kondamudi R (2011) Rapid shoot regeneration
from thin cell layer explants of an endangered medicinal
asclepiad Ceropegia spiralis L. Plant Tissue Cult Biotechnol
21(1):63–73
Swarna J, Ravindhran R (2013) In vitro organogenesis from leaf and
transverse thin cell layer derived callus culture of Talinum
triangulare (Jacq.) Willd. Plant Growth Regul 70:79–87
Teixeira da Silva JA, Dobranszki J (2013) Plant thin cell layers: a
40-year celebration. J Plant Growth Regul 32:922–943
Tripathi M, Kumari N (2010) Micropropagation of a tropical fruit tree
Spondias mangifera Willd. through direct organogenesis. Acta
Physiol Plant 32:1011–1015
Van Tran Thanh K (1974) Direct flower neoformation from
superficial tissue of small explants of Nicotiana tabacum L.
Planta 115:87–90
J Plant Growth Regul
123
![Page 11: In Vitro Propagation Using Transverse Thin Cell Layer Culture and Homogeneity Assessment in Ceropegia bulbosa Roxb.](https://reader035.fdocuments.net/reader035/viewer/2022081202/57509f151a28abbf6b1688ea/html5/thumbnails/11.jpg)
Van Tran Thanh K (1980) Control of morphogenesis by inherent and
exogenously applied factors in thin cell layers. Int Rev Cytol
32:291–311
Ziegler H, Batanouny KH, Sankhla N, Vyas OP, Stichler W (1981)
The photosynthetic pathway types of some desert plants from
India, Saudi Arabia, Egypt, and Iraq. Oecologia 48:93–99
J Plant Growth Regul
123