Retrospective Theses and Dissertations Iowa State University Capstones, Theses andDissertations

1993

In vitro analysis of the self-cleaving satellite RNA ofbarley yellow dwarf virusStanley Livingstone SilverIowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/rtd

Part of the Biochemistry Commons, Molecular Biology Commons, and the Plant PathologyCommons

This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State UniversityDigital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State UniversityDigital Repository. For more information, please contact digirep@iastate.edu.

Recommended CitationSilver, Stanley Livingstone, "In vitro analysis of the self-cleaving satellite RNA of barley yellow dwarf virus " (1993). Retrospective Thesesand Dissertations. 10274.https://lib.dr.iastate.edu/rtd/10274

_ U M I

MICROFILMED 1993 |

INFORMATION TO USERS

This manuscript has been reproduced from the microfilm master. UMI

films the text directly from the original or copy submitted. Thus, some

thesis and dissertation copies are in typewriter face, while others may

be from any type of computer printer.

The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins,

and improper alignment can adversely affect reproduction.

In the unlikely event that the author did not send UMI a complete

manuscript and there are missing pages, these will be noted. Also, if

unauthorized copyright material had to be removed, a note will indicate

the deletion.

Oversize materials (e.g., maps, drawings, charts) are reproduced by

sectioning the original, begiiming at the upper left-hand corner and continuing from left to right in equal sections with small overlaps. Each

original is also photographed in one exposure and is included in

reduced form at the back of the book.

Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6" x 9" black and white

photographic prints are available for any photographs or illustrations

appearing in this copy for an additional charge. Contact UMI directly to order.

University Microfilms International A Bell & Howell Information Company

300 North Zeeb Road, Ann Arbor, Ml 48106-1346 USA 313/761-4700 800/521-0600

Order Number 9335023

In vitro analysis of the self-cleaving satellite RNA of barley yellow dwarf virus

Silver, Stanley Livingstone, Ph.D.

Iowa State University, 1993

U M I 300 N. ZeebRd. Ann Arbor, MI 48106

In vitro analysis of the self-cleaving satellite RNA of

barley yellow dwarf virus

by

Stanley Livingstone Silver

A Dissertation Submitted to the

Graduate Faculty in Partial Fulfillment of the

Requirements for the Degree of

DOCTOR OF PHILOSOPHY

Department: Plant Pathology Interdepartmental Major; Molecular, Cellular, and

Developmental Biology

Approved:

In Charge of Major Work

or/the InterdeHartmental Major

For the

De^rtapiept

dM^^Co^ege

Iowa State University Ames, Iowa

1993

Signature was redacted for privacy.

Signature was redacted for privacy.

Signature was redacted for privacy.

Signature was redacted for privacy.

ii

DEDICATION

This dissertation is dedicated to my parents,

Stewart and Jean Silver

iii

TABLE OF CONTENTS

Page GENERAL INTRODUCTION 1

Group I Intron Splicing 1 Ribonuclease P; The First True RNA Enzyme 4 Group II Intron Splicing 6 Nuclear, Pre-mRNA Splicing 6 Small Catalytic RNAs 8 Reaction Mechanism 15 Target-specific Ribozymes 16 Barley Yellow Dwarf Virus 19 Satellite RNAs 20 Satellite RNA of Barley Yellow Dwarf Virus 2 6 Project Goals 27 Explanation of Dissertation Format 27

PAPER I. ALTERNATIVE TERTIARY STRUCTURE ATTENUATES SELF-CLEAVAGE OF THE RIBOZYME IN THE SATELLITE RNA OF BARLEY YELLOW DWARF VIRUS 3 0

ABSTRACT 32

INTRODUCTION 33

MATERIALS AND METHODS 38

Synthesis of wildtype and mutant self-cleavage structures 38

Self-cleavage assays 39 Synthesis of end-labeled RNA 41 Nuclease digestion 42

RESULTS 43

Self-cleavage of wildtype and mutant RNAs 43 Nuclease sensitivity 46

iv

Page

DISCUSSION 53

Effects of mutations on self-cleavage rate 53 Nuclease sensitivity 54 Comparison with other hammerheads 57

REFERENCES 61

PAPER II. NONCONSENSUS BASES IN THE sBYDV (+) RNA RNA AFFECT THE RATE OF HAMMERHEAD FORMATION AND SELF-CLEAVAGE EFFICIENCY 64

INTRODUCTION 66

MATERIALS AND METHODS 70

Synthesis of wildtype and mutant self-cleavage structures 70

Self-cleavage assays 72 Synthesis of end-labeled RNA and nuclease digestion 73

RESULTS 74

Self-cleavage of mutant RNAs 74 Nuclease sensitivity 79

DISCUSSION 84

Effects of mutations on self-cleavage rate 84 Nuclease sensitivity 86 Other hammerheads 88

REFERENCES 91

PAPER III. REPLICATION OF TRANSCRIPTS FROM A cDNA CLONE OF BARLEY YELLOW DWARF VIRUS SATELLITE RNA IN OAT PROTOPLASTS 94

ABSTRACT 96

INTRODUCTION 97

V

Page

Self-cleavage of dimeric sBYDV RNA 100 Dependence of sBYDV RNA replication on BYDV

genomic RNA 100 Replication of both strands of sBYDV RNA by a rolling

circle mechanism 105

REFERENCES 109

PAPER IV. BIMOLECULAR CLEAVAGE REACTION AND THE DESIGN OF TARGET-SPECIFIC RIBOZYMES 113

INTRODUCTION 115

MATERIALS AND METHODS 123

Construction of ribozymes 123 In vitro transcriptions and cleavage assays 126

RESULTS AND DISCUSSION 129

Bimolecular cleavage 129 Gene targeted ribozymes 132

REFERENCES 138

GENERAL SUMMARY

LITERATURE CITED

140

143

1

GENERAL INTRODUCTION

A ribozyme is defined as an RNA molecule that has the

inherent ability to catalyze cleavage or ligation of covalent

bonds (Kruger et al., 1982). The term ribozyme was coined

initially to describe the mechanism by which the intervening

sequence (IVS) of Tetrahymena thermophilia processes the

pre-rRNA to form mature rRNA. However, the IVS RNA is not

truly an enzyme since it does not exhibit turnover ability or

remain unchanged during the splicing reaction. Since the

initial discovery of ribozymes in 1982, many other RNAs have

been observed to exhibit autocatalysis. Such varied RNAs as

Group II mitochondrial introns, pre- tRNAs, nuclear mRNA

introns, several small, pathogenic RNAs, transcripts of

Neurospora plasmid DNA, and transcript II from newt all

demonstrate the capability of autocatalysis.

Group I Intron Splicing

Group I introns were the first RNA molecules demonstrated

to have at least quasi-catalytic activity (Kruger et al.,

1982). The splicing mechanism involves two

transesterifications (Cech et al., 1981; Fig. 1). The first

involves a free guanosine or a 5'- phosphorylated form of

guanosine serving as the nucleophile that attacks the

phosphorous atom at the 5' splice site, resulting in the

2

A. Group I intron splicing pQqh

Exon Intron Exon

B. RNase P cleavage

5—J 1—3" iWtRNA

i Ujp —Gpi ? < UIOH + pQp—Qp[

i V|P| k + pQp—QQH Excised intron

- c{ ̂5- _0H J L_3'

C. Group II intron self-splicing, nuclear pre-mRNA splicing

r~ IpQU A PI J I I OH ^A^p[ C3,

D. Self-cleaving, small pathogenic RNAs

—p §• SL A+ OH 2'-3'-cyclic phosphate

A^p Lariat structure

3'

Figure l. Four major types of RNA-catalyzed RNA cleavage. The rectangles with one jagged end represents a less-than-full- length exon. The pre-mRNA and Group II intron splicing mechanisms are shown together; even though both RNAs most likely use a different mechanism to form an efficient cleavage structure (Symons, 1991b).

3

formation of a 3' 5' phosphodiester bond between the

nucleotide cofactor and the 5' end of the intron. The free 3'

OH of exon 1 then attacks the 3' end splice site displacing

the intron and ligating exon 1 and 2 (Cech, 1990).

Efficient Group I intron splicing, in addition to the

nucleotide cofactor, requires specific secondary and tertiary

interactions within the RNA. The secondary structure consists

of a complex of nine stem-loops collectively called the

Michel-Davies model (Davies et al., 1982; Michel et al.,

1982) . Molecular modelling analysis, sequence comparisons,

mutational analysis, and enzymatic probing have verified

several of the proposed secondary features of the IVS RNA

(Been & Cech, 1986; Cech, 1988; Ehrenmann et al., 1989). The

tertiary structure is believed to form a cavity which

facilitates GTP binding, whereas the primary structure of the

IVS RNA confers RNA specificity via an internal guide sequence

located near the splice site (Davies et al., 1982; Waring

et al., 1986). In addition to RNA secondary and tertiary

interactions, proteins called mRNA maturases enhance RNA

splicing in Neurospora crassi (Garriga & Lambowitz, 1986) and

yeast mitochondria (Lazowaska et al., 1980).

Finally, the IVS RNA also undergoes a secondary

reaction that involves the cleavage of 19 nucleotides from the

5' end to form the molecule L-19 IVS (Zaug et al., 1986). The

4

L-19 IVS has recently spurred great interest in the concept of

using RNA molecules as target-specific endonucleases.

Ribonuclease F: The First True RNA Enzyme

Ribonuclease P (RNase P) was the first and only RNA

molecule shown thus far to have true catalytic activity

without prior modification (Zaug et al., 1986). In

prokaryotes a single gene may code for several copies of a

tRNA; therefore, excision of a single, mature tRNA requires an

endoribonucleolytic cleavage on both the 5' and 3' sides of

each pre-tRNA. This discussion will be limited only to the

events involved with the 5' pre-tRNA cleavage since the

enzymes(s) involved in 3' processing have not been identified

clearly. The 5' pre-tRNA sequence that undergoes cleavage is

not conserved and thus, RNase P must recognize a structure

common to all tRNA molecules. After recognition, the enzyme

specifically cleaves the RNA by base hydrolysis to produce the

5' terminus (Fig. IB). The RNase P holoenzyme consists of one

basic protein with a molecular mass of 14 kilodaltons (kD) and

one single-stranded RNA of 377 nts in Escherichia coli (Baer

et al., 1990) or 401 nts in Bacillus subtilis (Pace & Smith,

1990). Absence of either the protein or RNA component of

RNase P inhibits pre-tRNA cleavage under physiological

conditions (Baer et al., 1990). At high ionic strength,

however, the RNA component alone can efficiently cleave the

5

pre-tRNA. This observation led to the suggestion that the RNA

acts as the catalytic subunit and the protein serves to

stabilize RNA/tRNA interactions (Baer et al., 1990).

Using phylogenetic comparison of RNase P from B.

megaterium and E. coli, the putative secondary structure was

determined (Altmann, 1987). Structures within the RNA

component of RNase P include a pseudoknot (Pace & Smith, 1990)

and several nucleotides dispersed throughout the RNA that act

collectively to provide the RNA secondary structure required

for efficient pre-tRNA cleavage. Mutagenic analysis

identified specific regions within the RNA that associate with

the protein component (Shiraishi & Shimura, 1988). Finally,

UV-cross-linking experiments have revealed two widely

separated regions within RNase P that interact during the tRNA

splicing reaction (Burgin & Pace, 1990).

RNase P specificity for the pre-tRNA comes from an

external guide sequence (E6S) composed of the 3' sequence of

the tRNA acceptor stem (Fig. IB). The EGS of the pre-tRNA

binds RNase P adjacent to the cleavage site (Forster &

Altmann, 1990). For efficient cleavage, the EGS and a second

conserved sequence within the pre-tRNA -NCCA- must reside on

opposite strands. It has been proposed that a ribonuclease

that will cleave RNA in a site-specific manner could be

designed by modifying the EGS (Forster & Altmann, 1990).

6

Group II Intron Splicing

Group II intron splicing has been observed only in the

organelles of fungi and plants. To date, 70 Group II introns

have been characterized (for review see Michel et al., 1989).

Similar to pre-mRNA splicing. Group II intron splicing

involves a two-step transesterification (see discussion

below). Group I and Group II intron splicing differ with

respect to the chemical species that initiates the first

transesterification. A 3' OH from a free guanosine initiates

group I intron splicing, whereas, Group II intron splicing

results from an attack by a 2' OH from an adenosine located

within the intron (Fig. IC; Jacquier, 1990). The result of

the first nucleophilic attack in Group II intron processing is

a lariat structure consisting of the intron and exon 2. The

3' OH of exon 1 then attacks the 5' end of exon 2 resulting in

release of the intron and ligation of exon 1 and 2.

Currently, Group II intron splicing is believed the result of

specific folding of the RNA without a requirement for

proteins, trans-acting factors or adenosine (for review see

Michel et al., 1989).

Nuclear, Pre-mRNA Splicing

To translate active proteins from an mRNA template, cells

must have a highly specific mechanism to excise introns and

ligate the resulting exons. The mechanism evolved to perform

7

this function is both the most complex and least understood of

all the known RNA splicing reactions. Pre-mRNA splicing

involves formation of a lariat intermediate and proceeds via a

two-step transesterification reaction similar to Group II

intron splicing (Cech, 1990; Jacquier, 1990; Fig. IC). In the

pre-mRNA reaction, sequences adjacent to the 5' and 3' splice

sites and the branch point are required but not sufficient for

splicing (Ruby & Abelson, 1991). In addition to sequence

requirements, several small, nuclear RNAs (snRNAs) called Ul,

U2, U4, US, and U6 associate with the pre-mRNA along with

trans-acting factors and other proteins in a temporally and

spatially specific manner (for review see Ruby & Abelson,

1991; Zieve & Sauterer, 1990). ATP is also a required

component for the protein/nucleic acid interaction.

Presently, many other as yet unidentified proteins and

splicing factors are believed to be required for efficient

pre-mRNA processing (Ruby & Abelson, 1991).

It has been proposed that pre-mRNA splicing evolved from

the less complex Group II intron splicing mechanism (Jacquier,

1990). In pre-mRNA processing, the snRNAs are believed to

facilitate the folding of the pre-mRNA into a structure

capable of splicing. Group II introns, on the other hand, do

not require proteins for correct folding of the RNA (Jacquier,

1990). Determination of whether or not pre-mRNA processing

evolved from the Group II intron splicing reaction, will

8

require an answer to the question: is pre-mRNA splicing an

RNA- or protein- catalyzed reaction.

Small Catalytic RNAs

Another type of ribozyme, first observed in a small

pathogenic RNA of tobacco (Prody et al., 1986) results in the

production of RNA fragments with 2'-2' cyclic phosphate and 5'

OH termini (Fig. ID). The self-cleavage reaction occurs most

efficiently at pH 7.5 in the presence of MgClg and is

independent of a protein requirement (Prody et al., 1986).

There are four distinct classes of this small ribozyme based

on the primary and secondary structure at the cleavage site.

The first class of ribozyme was first observed in the

satellite RNA of tobacco ringspot virus (sToBRV RNA) (for

review of satRNAs see below). Terminal analysis of sToBRV RNA

cleavage fragments revealed the presence of a 5' hydroxyl and

a 2'-2' cyclic phosphate instead of the 5' phosphate and 3' OH

termini observed in Group I intron splicing. Since different

termini result from the small catalytic ribozyme, the cleavage

mechanism responsible for self-cleavage most likely uses a

different reaction pathway than either Group I intron or

pre-tRNA splicing. Furthermore, Mg'^^, which is specifically

required for Group I intron cleavage, can be replaced with

Mn^^, Pb®^, Zn^^, or even spermidine in the sToBRV cleavage

reaction. Finally, unlike Group I intron splicing, sToBRV RNA

9

cleavage occurs efficiently without GTP (Prody et al., 1986).

The mechanism proposed for sToBRV RNA cleavage involves a

phospho-transfer reaction (Fig. 2) using the ribosyl 2' OH on

the 5' side of the cleavage site as the nucleophilic species

that attacks the partially positive phosphate center (Prody et

al., 1986).

Figure 2. Phospho-transfer mechanism proposed for the small, catalytic ribozyme cleavage reaction (Symons, 1991b).

Comparison of six virusoid sequences and one satellite

RNA sequence revealed a highly conserved region that folded

into a hammerhead-shaped structure (Forster & Symons, 1987).

Table 1 lists all the known RNAs that form the hammerhead

motif. The hammerhead contains three helical domains (I, II

and III) and a central core of eleven highly conserved, mainly

single-stranded nucleotides (Forster & Symons, 1987) (Fig.

3A). Mutational analysis of the eleven conserved nucleotides

t o o

Table 1

Small RNAs capable of self-cleavage in vitro

RNA and cleavage structure Size SNA. strand Reference

I. Cleavage bj the hammerhead A. Viroid# Avocado sunblotch viroid (ASBVd) Carnation stunt associated viroid (CarSAVd) Peach latent mosaic viroid (PLHVd)

246--251 275 337 1

1 1 Hutchins et al., 1986

Hernandez et al., 1992 Hernandez, 1992

B. Encapsidated linear satellite RNAs of: Barley yellow dwarf virus (sBYDV) Tobacco ringspot virus (sToBRV) Arabis mosaic virus (sArBV)

359 322 -360 300

(+)/{-) (+) {+)

Miller et al., 1991 Prody et al., 1986 Bruening, 1989

C. Encapsidated circular satellite RNAs of: Lucerne transient streak virus,(vLTSV) Solanum nodlflorum mottle virus (vSNHV) Subterranean clover mottle virus (vSCMoV) Velvet tobacco mottle virus (vVTMoV)

324 378

3325388 366

(+)/(-) (+) (+) ( + )

Forster & Symons, 1987 Symons, 1989 Davies et al., 1990 Symons, 1989

D. RNA transcript of newt satellite II DNA 300 (+) Epstein & Gall, 1987

II. cleavage by hairpin/bent paperclip Encapsidated linear satellite RNA of ToBRV 359 -360 (-) Breuning, 1989

III. cleavage not fully defined Hepatitis delta virus RNA (HDV RNA) 1700 (+)/{-) Perotta S Been, 1990

IV. Cleavage by completely undefined structure Neurospora, linear and circular mitochondrial 800 (+) Saville & Collins, 1990 RNAs

11

A. ConMHMN hamtiMrtiMd OlMVIM

5 Œi'

NNNNN-

B. Htlrp(ne«ttlytlomocM

Catalytic RNA \

ciMvae* Substrats RNA

u AIM AC A QUO du uu cuoau m AOUC 40 JOAC euauu CO / U 1 111 II II nut 1 III 1*1111

CO /

CAO CA AO OACW

IV III II

c. HDV Moondary Mnielur*

S'— u

Figure 3. Structures of the three partially-characterized self-cleavage sites of small, pathogenic RNAs. (A) Hammerhead motif employed by the majority of small, self-cleaving RNAs. Nucleotides conserved among the known hammerheads are in boxes. (B) The hairpin structure at the cleavage site of sToBRV (-) strand RNA. (C) The proposed structure of the catalytic site of HDV.

12

demonstrated that all are critical for efficient ribozyme

activity (Ruffner et al., 1990; Sheldon & Symons, 1989). From

these observations the conserved nucleotides are believed to

be directly involved in the formation of the correct secondary

and tertiary structure required for cleavage. Mutations

involving the non-conserved bases of the hammerhead decreased

the cleavage rate by inducing hammerhead instability (Ruffner

et al., 1990). Mutation analysis of the hammerhead

corroborates the prediction that as the stability of the

hammerhead increases, so does the transition state stability

with the end result being a faster cleavage rate (Ruffner et

al., 1989; Ruffner et al., 1990). However, recent studies of

an intermolecular-type ribozyme reaction suggested the

possibility that the transition state, i.e. the hammerhead,

should be sufficiently unstable to decrease the activation

energy needed for cleavage (Fedor & Uhlenbeck, 1992).

Therefore, the fastest cleaving RNAs will form a hammerhead

with the least amount of energy.

A second type of ribozyme was observed in the sToBRV RNA

(-) strand (Table 1). This class utilizes a "hairpin"

structure to achieve efficient site-specific cleavage (Hampe1

et al., 1990; Fig. 3B). Site-directed mutagenesis identified

the nucleotides instrumental in hairpin structure (Hampe1

et al., 1990; Haseloff & Gerlach, 1989). Two discrete regions

of RNA are required for efficient sToBRV (-) strand cleavage.

13

One region maps to a 12 nucleotide sequence in the proximity

of the cleavage site, whereas the second maps to a position

approximately 124 bases downstream of the cleavage site

(Haseloff & Gerlach, 1989). The hairpin motif contains four

helical domains that, when disrupted, result in loss of

activity (Hampel et al., 1990). Sequences within the sToBRV

RNA basepair to form the four helices that permit efficient

self-cleavage. In addition to the sToBRV (-), the nucleotides

of the pre-mRNA splicing component U6 snRNA can be envisioned

to fold into the hairpin structure. Whether or not U6 snRNA

catalyzes the cleavage step in pre-mRNA splicing will require

further study (Tani et al., 1992).

Hepatitis delta virus (HDV) (+) and (-) sense RNA

represents a third class of ribozyme associated with a small,

pathogenic RNA (Table 1). The HDV RNA is approximately 1700

nts in length and by far larger than any of the self-cleaving

RNAs that infect plants. The only requirements for cleavage

are a neutral pH and Mg^^ (Kuo et al., 1989; Sharmeen et al.,

1988).

Computer modelling and mutation analysis of the

full-length HDV RNA indicated four helical domains form

during the cleavage reaction (Been et al., 1992; Fig. 3C).

Mutations that partially disrupt the helical domains result in

decreased cleavage rates. A putative tertiary interaction

involves the formation of a pseudoknot between stem I and stem

14

II that may facilitate HDV RNA cleavage (Perrotta & Been,

1991). Deletions of the HDV RNA demonstrated that a minimum

of 88 nts was sufficient for cleavage (Wu et al., 1990).

Further deletions of the HDV RNA made using an alkaline

degradation method showed an even smaller molecule could

self-cleave in vitro. The minimum sequence required for

cleavage includes one nucleotide upstream of the cleavage site

and the 84 nts downstream of the cleavage site (Perrotta &

Been, 1991) (Fig. 3C). This shortened version of the HDV RNA

still has the potential to fold into a structure with two

stem-loops. Using HDV RNA molecules of varying lengths,

site-directed mutagenesis and computer modelling experiments

provide equivocal data on the relative importance of the

helical structures and single-stranded regions (Perrotta &

Been, 1991; Thill et al., 1991; Wu et al., 1989; Wu et al.,

1992) . The helices possibly serve indirectly in the formation

and stability of the cleavage structure under various in vivo

conditions (Perrotta & Been, 1991).

The last known type of small catalytic RNA was isolated

from mitochondria of the Varkud-lc strain of Neurospora

(VSRNA). VSRNA is approximately 800 nts in length and exists

in either a circular and/or linear form (Saville & Collins,

1990; Table 1). Both forms exist as long multimers in vivo.

RNA transcribed from a VSDNA clone and incubated in the

presence of Mg'^^ at neutral pH underwent a site-specific

15

cleavage with the formation of 5' OH and a 2'-3' cyclic

phosphate fragments (Saville & Collins, 1990). A search of

the VSRNA did not uncover any conserved sequences present in

the other small, self-cleaving RNAs motifs. Presently, the

secondary and tertiary interactions required for efficient

Neurospora VSRNA self-cleavage are unknown.

Reaction Mechanism

The one underlying theme of all RNAs that undergo

self-cleavage is the importance of secondary and tertiary

interactions that permit a particular phosphodiester bond to

become sufficiently labile to cleave in the absence of a

protein catalyst. Thus far, proteins involved in

RNA-catalyzed RNA cleavage reactions seem to serve as

stabilizers for the RNA secondary structure required for

cleavage. RNAs that self-cleave using the hammerhead motif do

so by a phospho-transfer mechanism similar to base hydrolysis

(Fig. 2). Computer modelling studies of the hammerhead

suggest: (i) the base at the cleavage site does not interact

with other bases, (ii) the ribose-phosphate backbone at the

cleavage site makes a sharp turn and (iii) the conformation of

the ribose at the cleavage site becomes 2' endo (Mei et al.,

1989). Collectively, these changes ensure that a specific

phosphodiester bond is cleaved via an "in-line" attack by the

16

2' OH of the ribose on the 3' P to form the products with 2',

3' P, and 5' OH termini (Mei et al., 1989).

The role plays in RNA-catalyzed RNA cleavage is still

unclear. In Group I introns and the hammerhead ribozymes, Mg^*

coordinates with one specific Pro-R oxygen (Dahm & Uhlenbeck,

1991; Slim & Gait, 1991; Uchimaru et al., 1993). By changing

which Pro-R oxygen Mg^"*" binds, Uchimaru

et al. (1993) observed cleavage of normally resistant

phosphodiester bonds. Therefore, it seems RNA secondary and

tertiary structure determines which Pro-R oxygen Mg^^ binds and

ultimately specifies which phosphodiester bond is cleaved.

Whether Mg^"*" serves a similar role in the hammerhead-type

ribozyme cleavage will require further study.

Target-specific Ribozymes

Soon after RNA molecules were shown to self-cleave in

vitro, the concept of targeting the catalytic portion of these

self-cleaving molecules against a given substrate RNA was

proposed (Haseloff & Gerlach, 1988; Uhlenbeck, 1987; Zaug

et al., 1986). Of the known RNA ribozymes, the hammerhead

type is by far the smallest and best characterized.

Subsequently, the hammerhead ribozyme currently is most widely

used for targeting cleavage of a specific RNA. The first step

in constructing a target-specific ribozyme was to determine

whether or not the catalytic domain of the hammerhead would

17

function in an intermolecular fashion. The first

intermolecular reaction involved the sequences from the

avocado sunblotch viroid (ASBV) hammerhead (Uhlenbeck, 1987).

The ribozyme (Rz) was composed of all the conserved hammerhead

nts with the exception of the sequence GAAA and the U at the

cleavage site which were made part of the substrate RNA (S)

(Uhlenbeck, 1987; Fig. 4A). When the S and Rz were combined

at neutral pH in the presence of Mg^"*", cleavage of the

substrate RNA was observed. This result proved conclusively

that the hammerhead ribozyme could effectively cleave RNA in a

bimolecular manner if a minimum sequence (in this case only 43

nts) which contained all 11 conserved nts of the hammerhead

motif were present (Uhlenbeck, 1987).

Haseloff and Gerlach (1988) constructed a similar

bimolecular system to test the Rz sequence from the sToBRV (+)

strand hammerhead. In their system, the substrate sequence

had only one conserved base from the hammerhead and the

CUGANGA and GAAA sequences were part of the Rz (Fig. 4B).

Target arms complementary to the substrate RNA were then

combined with the catalytic domain of sToBRV to produce the

complete ribozyme. When targeted against the chloramphenicol

acetyltransferase (CAT) mRNA, they observed specific and

efficient cleavage (Haseloff & Gerlach, 1988). Since this

initial account, many ribozymes have been successfully

targeted against a host of RNAs (for review see Symons,

18

A. C C G

Substrate

pppGÇGÇÇ® hoC Q C G G ^ gAGCUCGGppp

U4® Ribozyme

B.

5> Substrate xxxxxx

I

3' xxxxx

f

II

C-G U AU G'C G'C

A G G U

3' lyyyyOxxxxxx xxxxxx

Ribozyme

Figure 4. (A) Division of the ASBV hammerhead into substrate and catalytic domains (adapted from Uhlenbeck, 1987). Conserved bases of hammerhead are in bold italics. Arrow indicates cleavage site. (B) Gene-targeted ribozyme as proposed by Haseloff and Gerlach (1988). (I) indicates the one conserved nt in the substrate RNA. (II) identifies the target-arms which give specificity to the ribozyme. (Ill) is the catalytic domain of the ribozyme. Arrow indicates cleavage site, (adapted from (Haseloff & Gerlach, 1988).

19

1991b). RNAs successfully cleaved in vivo by a gene-targeted

ribozyme include U7 snRNA, c-fos mRNA, HIV-1 RNA and the

a-sarcin domain of 28S RNA (Gotten et al., 1989; Sarver

et al., 1990; Saxena & Ackerman, 1990; Scanlon et al., 1991).

Unfortunately, many of the gene-specific ribozymes, when

tested in vivo, do not cleave their substrate RNA effectively.

Parameters such as in vivo reaction conditions, length and

composition of the ribozyme target arms and alternative

conformations within the target arms all can dramatically

affect the ribozyme's ability to cleave in vivo (see Section

IV for further details). Further work will be required in

order to design a rational approach to ribozyme design.

Barley Yellow Dwarf Virus

Barley yellow dwarf virus (BYDV), the type member of the

luteovirus group of plant viruses, was classified as a new

virus in 1951 (Oswald & Houston, 1951). From the historical

record, however, symptoms of the virus were observed as early

as the late 1800s. BYDV is now recognized as the most

destructive virus capable of infecting small grains including

oats, barley, and wheat (Plumb, 1983). In fact, grain yield

losses observed from intentional BYDV infections of some wheat

varieties have been greater than 60%. Even naturally

occurring infections can result in a greater than 25% grain

yield loss (Yamani & Hill, 1991). Symptoms of BYDV infection

20

include yellowing of plant tissue, moderate to severe stunting

of the plant and, in severely affected plants, heads with many

blasted or sterile spiklets. BYDV is phloem-limited and

aphid-transmitted in a circulative and persistent manner. The

virus particle consists of approximately 180 subunits of the

22kd coat protein (CP) arranged as an icosahedron with a

diameter of 24 to 30 (nm). Five different serotypes of BYDV

have been classified according to aphid specificity and

serological characteristics (Rochow, 1970). These serotypes

can be grouped into two subgroups based on their genome

organizations, cytopathological effects, and serological

relatededness. BYDV serotypes MAV, PAV and SGV belong to

subgroup I and RMV and RPV belong to subgroup II. The

complete nucleotide sequence of an Australian isolate of

BYDV-PAV was determined and the genome organization deduced

(Fig. 5A; Miller et al., 1988). The BYDV genome consists of a

single (+) sense RNA approximately 6kb long. Gene expression

strategies used by BYDV include a -1 ribosomal frameshift

(Brault & Miller, 1992), subgenomic RNA synthesis, and an

internal initiation and readthrough event (Dinesh-Kumar

et al., 1992).

Satellite RNAS

Several types of RNA exist that either by themselves or

with the aid of a helper virus, can infect plants and cause

disease. A short summary of each type is given below.

21

Frameshift

Readthrough

CP

mm# 39K

22KK ̂I7K

5* Leaky Scanning

6.7K

3'

•sgRNM sgRNA2

B 71K j 22K

m 72mmmm 17K

5' 3'

Figure 5. Genome organization of BYDV. Panel A is the genome organization of BYDV-PAV of subgroup I. Panel B depicts the genome organization of BYDV-RPV of subgroup II. Open reading frames are depicted by rectangles with the molecular mass of the putative translation product inside, abbreviation; sgRNA, subgenomic RNA (Miller et al., 1988; Vincent et al., 1991).

22

1. Satellite viruses are defective viruses that encode

the genetic information for their own coat protein. They

require a helper virus for replication.

2. Defective interfering RNAs (DI RNA) are viral RNAs

that have lost a portion of the virus genome. Replication

requires the presence of a full-length copy of the virus. DI

RNAs, by definition, interfere with normal virus replication.

3. Viroids are unencapsidated RNA molecules ranging from

246 to 375 nts in length that do not require a helper virus

for replication. Viroids exist as covalently closed,

circular molecules that have a high degree of basepairing and

thus are quite stable.

4. Satellite RNAs (satRNA) are defined as (i) completely

dependent on a helper virus for replication, encapsidation and

spread, (ii) having no known sequence homology with the plant

or viral genomes, and (iii) not being required by the helper

virus. SatRNAs range from 300 to over 1400 nts in length.

5. Virusoids are a type of satRNA that vary in size from

324 to 388 nts and are encapsidated primarily as circular

molecules. Thus far only the sobemovirus group of plant

viruses demonstrate the ability to support virusoid

replication.

6. Satellite-like RNAs are molecules that have qualities

of a satRNA but do not fit completely the classical definition

of a satRNA.

23

For the purpose of this discussion, only the satRNAs will

be discussed in detail.

SatRNAs can be divided into two groups based on their

length and coding capacity (Table 2). Large satRNAs

associated with the nepovirus group of plant viruses have the

ability to direct protein translation (Roossinck et al.,

1992). At present, the role if any these proteins play in

satRNA biology is unknown. The second group of smaller

molecular weight RNA molecules does not direct translation of

proteins in vivo.

The first small satRNA was found associated with tobacco

ringspot virus (sToBRV RNA) (Schneider, 1969). Further study

of sToBRV RNA revealed the presence of both multimeric and

circular forms in vivo (Schneider, 1977). Since the initial

discovery of sToBRV RNA, small satRNAs of the sobemovirus

(virusoids) and luteovirus groups have been found which also

form multimeric and circular molecules in vivo (Francki, 1985;

Keese & Symons, 1987; Miller, et al., 1991). These

observations led to the proposal that these RNAs replicate via

a rolling circle pathway (Branch & Robertson, 1984; Hutchins

et al., 1985). A general outline of the rolling circle

mechanism is depicted in Figure 6. After the virion enters

the plant, the satRNA is uncoated. The (+) strand then

circularizes followed by replication via the virally-encoded

RNA-dependent RNA polymerase to produce long multimers of (-)

24

Table 2

Summary of satellite RNAs. This list contains known RNAs that

fit the classical definition of a satellite RNA.

Abbreviations; NR. no report; <-) no translation products

detected; helper virus abbreviation in parentheses; kP.

kilodaltons ^adapted from Roossinck. et al.. 19921.

Mol Mass of Helper Virus # nts encoded proteins (kD)

Large satRNAs

Tomato blackring virus (TBRV) 1375 Chickory yellow mottle (CYMV) 1145 Arabis mosaic virus (ArMV) 1104 Strawberry latent ringspot (SLRV) 200 Myrobalan latent (MLRV) 1400 Grapevine Bulgarian latent (GBLV) 1500 Grapevine fanleaf (GFLV) 1114 Pea enation (PEMV) 900

Small saRMAs Cucumber mosaic virus (CMV) Peanut stunt virus (PSV)

Tobacco mosaic virus (ToBRV) Arabis mosaic virus (ArBV)

Barley yellow dwarf (BYDV)

333-342 369-393

359 300

322

Virusolds Velvet tobacco mottle (VTMoV) 365 Solanum nodiflorum mottle (SNMV) 377 Lucerne transient streak (LTSV) 324 Subterranean clover mottle

48 40 39 38 45 NR 37 NR

2-3.9

NR

NR

(SCMoV) 332, 388 NR

25

strand satRNA. In sBYDV RNA, the (-) strand multimer cleaves

into monomers that act as templates for (+) strand synthesis.

Similar to the (-) strand, the (+) strand multimers undergo

cleavage to form the encapsidated monomer.

(•)

(•)

• • ##IW*av#g#

Virus partcle

(+)

\ (+)

(•)

- ©

• •

Figure 6. Rolling circle replication model. Arrows indicate cleavage sites (adapted from Symons, 1991a).

Demonstration of the autocatalytic capabilities of Group

I intron RNA (Kruger et al., 1982) and the ability of RNase P

to cleave pre-tRNA into a mature tRNA (Guerrier-Takada et al.,

1983) led Hutchins et al. (1985) to propose that these small,

pathogenic RNAs cleaved in a manner analogous to the

26

RNA-catalyzed RNA cleavage of Tetrahymena Group I introns.

Evidence for the autocatalytic cleavage of the multimeric

satRNA into monomers was provided by Prody et al. (1986), who

demonstrated the ability of sToBRV to cleave in vitro

(discussed previously).

Satellite RNA of Barley Yellow Dwarf Virus

Some isolates of BYDV-RPV contain a satellite RNA (Miller

et al., 1991). Labeled cDNA of sBYDV RNA hybridized to a

multimeric series of bands from purified virion RNA but not to

genomic BYDV-RPV RNA. The smallest and most abundant band

corresponded to an approximately 320 nt long RNA believed to

be the monomer. Detection of a multimeric series as well as

circular forms of RNA suggest the RNA replicates by a rolling

circle mechanism (Miller et al., 1991). The RNA sequence was

first determined by sequencing several overlapping cDNA

clones. Most clones contained a 321 base pair repeat,

consistent with the size estimated for the monomer by

electrophoresis. Direct RNA sequencing revealed an A residue

at the 3' end of the monomer that was absent from these

clones. Thus the satRNA is actually 322 nts long.

Several of these same clones were tested for cleavage

ability by in vitro transcription. The clones that contained

the extra adenosine cleaved efficiently, while those that

lacked the A cleaved poorly. Both the (+) and (-) strands of

27

the RNA have the conserved hammerhead self-cleavage motif at

the site of cleavage. Closer examination of the (+) strand

cleavage site revealed several sequence differences relative

to the other known hammerheads (see Fig. 7A).

In addition, the sequence at the (+) strand cleavage site

predicted a novel secondary structure which included a

putative pseudoknot due to basepairing between nts 6-10 and

34-30 (Fig. 7B).

Project Goals

This project addressed three major goals. The first goal

was to demonstrate the presence or absence of the proposed

alternative structure at the sBYDV RNA cleavage site, and

determine the significance of the nonconsensus bases present

in the sBYDV RNA hammerhead. The second goal was to prove

that the small molecular weight RNA associated with BYDV-RPV

is in fact a satRNA. The third goal of the project was to

design, construct, and test gene-targeted ribozymes predicted

to cleave BYDV genomic RNA.

Explanation of Dissertation Format

This dissertation contains three papers either published

or in preparation for publication and one manuscript not

expected to be submitted for publication at the present time.

Paper I contains work performed by myself and W. A. Miller.

28

dMvagt •ito

310 S20_ Tl AO F UAUUUC QUQQAB ̂ACAQ *0 > I I I .i.W I I I I a 3' MJOMa^CAOSilj^ iiniir>. a

daavagi •ity

110 »0_ Tl 6* UWUUÇ Quao ACAQ ÙàÙCi

y-AXg

I i I I i I Mill, 3' AUOAAOqC^CUI

B Hammerhead

*g:§ Aj®-0 ,^-Cao

.>3

stacked helices (pseudoknot)

Figure 7. Alternative structures for the self-cleaving ribozyme in sBYDV (+) strand RNA. Panel A is sBYDV (+) RNA folded in the hammerhead motif. Panel B is sBYDV folded as the alternative structure when basepairing occurs between nts 6-10 and 30-34. Boxed bases are conserved among all hammerheads. Bases that differ from consensus are shown in outlined text. Numbering of nucleotides is based on the full-length satellite RNA (Miller & Silver, 1991).

29

Even though Miller is the principal author of Paper I, it was

included in my dissertation since the work is so closely

related to Paper II.

Specifically, Miller constructed mutants Ml, M19, and

M20, and I constructed mutants M2, Ml/2, M/19/20, and M5.

Miller performed cleavage assays on all the mutant transcripts

with the exception of MS. All nuclease sensitivity analysis

was done by Miller.

Papers I and II are formatted for publication in Nucleic

Acids Research. Paper III is a paper submitted to the journal

Virology. Finally, Paper IV reports on research performed by

myself but not ready for publication. References cited in the

INTRODUCTION and the GENERAL SUMMARY are listed in the

LITERATURE CITED section that follows the GENERAL SUMMARY.

30

ALTERNATIVE TERTIARY STRUCTURE ATTENUATES SELF-CLEAVAGE OF THE RIBOZYME IN THE SATELLITE RNA OF BARLEY YELLOW DWARF VIRUS

31

Alternative tertiary structure attenuates self-cleavage of the ribozyme in the satellite RNA of barley yellow dwarf virus

Miller W.A., Ph.D.

Silver, S.L., M.S.

From the Department of Plant Pathology, Iowa State University, Ames, lA 50011

32

ABSTRACT

A self-cleaving satellite RNA associated with barley-

yellow dwarf virus (sBYDV) contains a sequence predicted to

form a secondary structure similar to catalytic RNA molecules

(ribozymes) of the "hammerhead" class (17). However, this RNA

differs from other naturally occurring hammerheads both in its

very slow cleavage rate, and in some aspects of its structure.

One striking structural difference is that an additional helix

is predicted that may be part of an unusual pseudoknot

containing three stacked helices. Nucleotide substitutions

that prevent formation of the additional helix and favor the

hammerhead increased the self-cleavage rate up to 400-fold.

Compensatory substitutions, predicted to restore the

additional helix, reduced the self-cleavage rate by an extent

proportional to the calculated stability of the helix.

Partial digestion of the RNA with structure-sensitive

nucleases supported the existence of the proposed alternative

structure in the wildtype sequence, and formation of the

hammerhead in the rapidly-cleaving mutants. This tertiary

interaction may serve as a molecular switch that controls the

rate of self-cleavage and possibly other functions of the

satellite RNA.

33

INTRODUCTION

Some viruses in the nepo-, luteo-, and sobemovirus groups

contain small satellite RNAs that replicate via a rolling

circle mechanism (reviewed in 1,2). Circular and multimeric

forms of these RNAs undergo self-cleavage at a specific site

to generate the monomeric form that predominates in the virus

particle. This self-cleavage is catalyzed by a subset of the

satellite RNA sequence (ribozyme) flanking the cleavage site

that is predicted to fold into a hammerhead-shaped structure

(3, 4; reviewed in 5). One viroid, avocado sunblotch viroid

(ASBV, 6), and the transcripts of satellite 2 DNA of newt also

self-cleave at a hammerhead structure (7). The consensus

hammerhead structure consists of three short helices, whose

sequences are not conserved, joined together by short single-

stranded regions, most of which are conserved at the primary

structure (sequence) level. In contrast, the loops connecting

the distal portions of the helices can be varied in sequence

(8), or removed altogether (9, 10), without loss of ribozyme

activity. Much effort has been devoted to elucidation of the

structure-function relationships of hammerhead ribozymes,

including mutagenesis of the helices and the conserved single-

stranded bases (11-16).

34

A self-cleaving satellite RNA was recently reported

associated with the RPV serotype of barley yellow dwarf virus

(sBYDV, [17] GenBank Accession number M63666). This is the

first known satellite of a member of the luteovirus group.

Encapsidated sBYDV RNA is a predominantly linear monomer, 322

nucleotides (nt) long, and it encodes no long open reading

frames. In being a linear molecule it more closely resembles

the satellite RNA of tobacco ringspot virus (sTobRV, 2) than

the satellites of the sobemoviruses (also known as virusoids)

in which the circular monomer is the most abundant form.

The (-) strands of some but not all of the self-cleaving

satellite RNAs also self-cleave, indicating variations in the

rolling circle mechanisms (1, 2). Both the encapsidated (+)

strand and the (-) strand of sBYDV RNA self-cleave (17). The

(-) strand self-cleaves extremely rapidly and contains a

perfect consensus hammerhead sequence flanking the self-

cleavage site (5, 14). The sequence flanking the cleavage

site in the encapsidated (+) strand of sBYDV fits most of the

consensus rules for formation of a hammerhead structure.

However, the (+) polarity sBYDV hammerhead differs from other

naturally occurring hammerheads in at least three features

(Fig. 1). First, the trinucleotide at the 5' side of the

cleavage site is AUA, instead of GUC, which is found in all

naturally occurring hammerheads except that of lucerne

transient streak virus satellite (sLTSV) that cleaves at GUA

35

320, dMvage

%-sli 9' AÛàÀAàoCÂCCW^ I'lni'ie. Q

310 f UAUUucouaaA 11 1111 II III

c-a A-U

rou-A A-U

s::%a c-a CigHli

""QQ"

Hammerhead

dMvac

310 ILSa S20_ tllidU '̂Q-C 5* UAUuucauaaA^ACAa^c-3' ÀÙÔÀMtC^ ®-

L2c

ik 1-1®

-CSG A"

B

'̂ 1

Stacked helices (pseudoknot)

Figure l. Proposed alternative structures for the self-cleaving ribozyme in sBYDV (+) strand RNA. Boxed bases are conserved among all hammerheads (5). Bases that differ from consensus are shown in outlined text. Numbering of nucleotides is based on the full-length satellite RNA (17). Numbering of the three major helices (HI, H2, H3) of the hammerhead is as in (4, 5). Single-stranded regions (loops) are prefixed with L. The individual helices and loops within compound stem-loop 2 are labeled as lettered subsets. Bases in loops LI and L2a expected to form the additional helix are in italics. Cleavage structure is drawn as a hammerhead (A) without Ll-L2a base pairing, and in the alternative conformation (B), in which LI and L2a base pair without disruption of other helices to form a pseudoknot with three stacked helices. Because of difficulties in two dimensional representation, lines indicating phosphodiester bonds have been added as necessary. Note the coaxial alignment of three helices in B with the helix derived from LI and L2a in the center.

36

(4). However, functional hammerheads have been constructed

with many variations from GUC (7, 14). Second, an unpaired

cytosine (C-24) is present immediately 3' to the conserved

single-stranded CUGANGA sequence, and an unpaired adenine

(A-73) occurs immediately 5' of the conserved GAAAN sequence.

In almost all other cases, bases in these positions are

hydrogen bonded to form the first pair of the vertical helix 2

(5, 14). No others have an unpaired base analogous to A-73.

The third and most striking, unusual feature is the

subject of this paper: the "loop" (LI) connecting strands of

helix 1 (HI) would be expected to pair with a sequence (L2a),

which is drawn as a single-stranded loop in the hammerhead

conformation in compound helix 2 (Fig. 1). The calculated

stability of the helix formed by Ll-L2a base pairing

(AG = -10.1 kcal/mol) is the strongest in the entire satellite

RNA. Thus, structures containing the Ll-L2a helix may be

energetically preferred, and loops LI and L2a would not be

expected to remain single-stranded as shown in the hammerhead

conformation in Fig. lA. Because the formation of the Ll-L2a

helix does not replace any of the base pairing involved in

hammerhead formation, it may be possible for all helices to

remain intact, giving the unusual pseudoknot-like structure

shown in Fig. IB. This structure contains an interesting set

of three coaxially stacked helices, the central one being the

37

Ll-L2a helix. Although such a structure may not be possible

due to torsional constraints, we sought to determine if it

could form by observing the effects of mutagenesis of the

putative Ll-L2a helix on the self-cleavage rate, and on

overall secondary and tertiary structure.

38

MATERIALS AND METHODS

Synthesis of Wildtype and Mutant

Self-cleavage Structures

RNA molecules were synthesized by in vitro transcription

of sequences in phagemid pGEM3Zf(-) (Promega, Madison, WI).

Mutations were introduced by the method of Kunkel (18), using

a kit from Biorad (Richmond, CA). Plasmid pSSl contained the

wildtype (+) strand sBYDV hammerhead sequence: bases 310-322

and 1-89 of the satellite sequence (Fig.s 1 and 2). Cleavage

occurs between bases 322 and 1. pSSl was derived from the

slightly larger plasmid pPCSl (17) by site-directed

mutagenesis with the primer:

5' GTTATCCACGAAATAGGA'ICCTATAGTGAGTCGTATTAC 3'. Bases 5' of

the apostrophe are complementary to satellite RNA sequence.

The complement of the T7 RNA polymerase promoter is shown in

italics. This resulted in deletion of 25 vector-derived bases

and 11 satellite RNA bases not involved in formation of the

hammerhead structure. Transcripts of Xjbal-linearized pSSl

and mutants contained vector bases G6A and CUCUAG at the 5'

and 3' ends, respectively. The following plasmids containing

mutant sBYDV self-cleavage structures were constructed with

39

the indicated primers. (See maps and sequence alterations in

Fig. 2.)

pMl: 5' CGTCGTCAGACAGTAGGGCCTCTGTTATCCACGAA 3';

pM2: 5' CCAGCCTTCTAGTCCGGCCCGATACGTCGTCAGAC 2';

pM19; 5' AGACAGTACGAGCTCTGTTATC 3'; pM20; 5'

TTCTAGTCCGCTCGGATACGTCG 3'; pM5: 5'

GGATTTCTGTATCTATT'GATACGTCGTCAGAC 3'. Underlining indicates

base changes, and the apostrophe indicates site of deletion.

All plasmids were sequenced in the transcribed regions by the

dideoxy method with Taq polymerase (Promega). In our

nomenclature, a plasmid and its transcript are named similarly

except that the "p" of the plasmid name is omitted in

designating the transcript.

Self-cleavage Assays

[a-^'pjUTP-labeled RNAs were transcribed in vitro as

described previously (17) from XJbal-linearized plasmids.

Uncleaved transcripts were purified by elution (19) after

electrophoresis of transcription products on an 8%

polyacrylamide, 7M urea gel. Self-cleavage reactions

contained approx. 10,000 cpm gel-purified, uncleaved

transcription product, 1 mg/ml tRNA, 50 mM Tris, pH 7.5, and

10 mM MgClg. Reactions were started by addition of the MgCl^.

To stop the reaction, 5 /il aliquots were removed at designated

time points, added to an equal volume of 7 M urea, 30 mM EDTA

40

pSSI and mutant leti I and II

aawaga product!: ' le ; j 101

PM5 , f — 77 aio T LI M Xbm\

nzzzzzzzzzB^ OMwaga , products; is 07

B 881

(wlldtyp*)

Au/y_yoii!i LC

M19/20

?• ~2000

NA kcalAnol 11 mln

Figure 2. A. Maps of inserts in transcription plasmids. Large bold box represents sBYDV RNA sequence; shaded regions (flanking bases 310 and 89) are not required for hammerhead formation. Horizontal arrow marks the transcription start site; vertical arrowhead indicates self-cleavage site. Expected cleavage products of transcripts generated by T7 polymerase-catalyzed transcription of XJbal-linearized DNA are shown as bold lines below map. Sizes of transcripts (in nt) are indicated below each one. Specific changes in LI and L2a (shaded with diagonal lines) in mutant sets I and II are shown in panel B. Dashed lines indicate region (bases 30-63) of pSSl that was deleted in pM5. B. Schematic representations of mutants with base changes (outlined text) in the putative Ll-L2a helix. Mutants are grouped into sets I and II as described in the text. Only the sequences of LI and L2a are shown. Their positions in the hammerhead are shown in SSI (wildtype) at left. Empty box in mutant M5 represents deletion of L2a sequence. The name of each mutant (above) and free energies (below) of potential Ll-L2a helices are indicated. Helices were identified and free energies calculated by using the RNA Structure Editor (RNASE) computer program (23) which used the parameters in (40). NA = not applicable. The bottom line shows the half-lives (tj/a) of uncleaved RNAs calculated from graphs in Fig. 3.

41

and immediately frozen at -SO^C. Samples were thawed and

denatured by boiling for one min immediately prior to

electrophoresis on 8% polyacrylamide, 7 M urea sequencing-type

gels. Bands were cut out and radioactivity determined by

liquid scintillation counting.

Synthesis of End-labeled RNA

Each of the steps below was terminated by making

solutions 50 mM in EDTA, extracting once with phenoliCHClg

(1:1), and ethanol precipitation in 2M ammonium acetate pH

6.2. Step 1: Unlabeled transcripts were synthesized as

described above except that the reactions contained: 5 -

15 mg of linearized template, 0.5 mM of all four NTPs, 100

units RNasin, in a 100 ml final reaction volume. Step 2:

Transcription products were treated with 5 units calf

intestinal phosphatase for 10 min in the absence of magnesium

as in (20). Step 3: End-labeling reactions (50 ml) contained

dephosphorylated transcript, 40 units RNasin, 100 mCi

[a-®^P]ATP (3000 Ci/mmole), 10 units polynucleotide kinase, 50

mM Tris, pH 8.0, 10 mM MgClg. To minimize self-cleavage

during labeling, MgClg was added last and reactions were

incubated only 5 to 10 min before addition of EDTA to stop the

reaction. Step 4: Uncleaved transcripts were purified by gel

electrophoresis as already described.

42

Nuclease Digestion

All nucleases except VI (Pharmacia, Milwaukee, WI) were

from BRL (Gaithersberg, MD). Nuclease digestions were under

the same conditions of temperature and solution used in the

self-cleavage assays. Reactions (5 fxl) contained approx.

10,000 cpm per reaction of gel-purified, end-labeled uncleaved

RNA, 1 mg/ml tRNA, 50 mM Tris, pH 8.0, 10 mM MgClg, and either

0.2 units VI nuclease, 0.1 units T2 nuclease, 0.2 units T1

nuclease, or water. Nuclease treatment was initiated 20 to 50

s after addition of MgClg. After 5 min at 37°C, reactions were

terminated by adding an equal volume of 7M urea, 30 mM EDTA

and freezing at -SO^C. Products were separated on 12%

polyacrylamide gels containing 7M urea. Sequencing reactions

(T1 and 0 M nucleases) under denaturing conditions (21, 22)

and ladder formation by partial alkaline hydrolysis were

performed by using a kit from BRL.

43

RESULTS

Self-cleavage of Wildtype and Mutant RMAs

Transcripts from a plasmid (pPCSl) spanning the (+)

strand cleavage site were shown previously to self-cleave

(17). However, the rate of cleavage and the effects of a

large number of extraneous bases were unknown. To allow

transcription of an RNA that contained the hammerhead sequence

with minimal vector-derived bases, 36 bases were deleted from

pPCSl to create pSSl (Fig 2). The RNA transcript (SSI) from

Xjbal-linearized pSSl contained only 3 vector-derived bases at

the 5' end and at most 6 at the 3' end (Figs. 2A, 5). Optimal

conditions for self-cleavage of SSI were 50 mM Tris-HCl, pH

7.5, 10 mM MgClg, at 37°C. The reaction showed a broad

magnesium optimum, and little sensitivity to temperature or

denaturation treatments such as boiling and snap cooling (4)

prior to addition of Mg'^^ (data not shown) . The cleavage

products of all the transcripts were as expected: a 120 nt

full-length fragment, a 101 nt 3' fragment, and a 19 nt 5'

fragment (Fig. 3). The intensity of the full-length band

decreased as the intensities of the fragments increased with

time.

Transcript SSI cleaved with an approximate half-life of

1500 to 2500 min as calculated by extrapolation of several

44

SS1 M1 MS M1/M2 SSI

0 30 60 90 120 150 IBO 210 140 270 jOO

SSI I\/I19 M20 M19/20 min (•—•) 0 60 120 180 240 jOO J60 420 480 540 600 1.00 a-" ' ^ MM M V SSl

0.50 va

il -a

0.10

MÎ9/20

M 20

( 1

10 15 20 25 30 35

min.(

SS1 MS

F

3'

• • ••• 5*

Figure 3. Self-cleavage of wildtype and mutant RNAs. Left: Autoradiographs of transcripts after incubation in self-cleavage conditions for times shown in graphs at right, and denaturing polyacrylamide gel electrophoresis. Mobilities of full-length (F) transcript, and 3' and 5' fragments are indicated. Right: Semilog plots of fraction of full-length transcript that remains uncleaved were calculated from radioactivity in bands of autoradiographs at left. In the middle graph, note that M19 and M20 are plotted against a different scale (bottom) than are SSI and M19/20 (top scale). SSI was included as a standard in all assays.

45

separate experiments (Figs. 2, 3). To determine if the slow

rate of cleavage was due to formation of the alternative base

pairing (Ll-L2a; Fig. 1), the potential to form this helix was

disrupted by mutagenesis. Two three-membered sets of mutants

were constructed (Fig. 2). Each set included transcripts with

alterations to LI, L2a, or to LI and L2a on the same molecule

such that potential base pairing, but not wildtype sequence

was restored in the double mutant. In an additional mutant

(M5), bases 30-63, including the L2a region, were deleted

(Fig. 2). This prevented formation of the Ll-L2a helix, and

resulted in a hammerhead similar in size to those of the

sobemovirus satellites (virusoids), sTobRV (5), and sBYDV RNA

(-) strand (17).

Mutant set I (mutants Ml, M2, and Ml/2), was designed to

conserve the 100% G+C content of LI and L2a. Three bases were

changed in either LI or L2a, or both LI and L2a. The half-

lives of mutant RNAs Ml and M2, in which the proposed Ll-L2a

base pairing was disrupted, were 310 and 48 min, respectively

(Figs. 2, 3). The double mutant Ml/2 did not self-cleave

detectably. In contrast to mutant set I, set II was chosen

after exhaustive computer searches (23) of many sequences

containing different mutations predicted that this set of

mutations should form no significant unintended base pairing.

Mutant set II (M19, M20 and M19/20) was constructed by

introducing only a single base change in either LI or L2a, or

46

both LI and L2a. Each of the single mutants, M19 and M20,

cleaved hundreds-fold more efficiently than wildtype (Figs. 2,

3). Seventeen percent of M19 RNA remained uncleaved after 10

hr, presumably because this proportion of the molecules folded

into an inactive conformation. The double mutant M19/20

cleaved 24- to 36-fold more slowly than either of the single

mutants, but at least 10-fold faster than wildtype. Mutant MS

also cleaved quite rapidly (Figs. 2, 3). The full-length

transcript (86 nt) and the 2' (67 nt) and 5' (19 nt) fragments

migrated as expected.

Nuclease Sensitivity

The next set of experiments employed structure-sensitive

nucleases to determine whether the overall tertiary structure

exists as predicted in Fig. IB. 5' end-labeled transcripts

were partially digested with nucleases T2 (cuts all single-

stranded bases [24]), T1 (cuts single-stranded guanosine

nucleotides), or VI (cuts double-stranded and some base-

stacked regions [25,26]), under conditions identical to those

used in the cleavage assays. To avoid misleading secondary

cleavages, enzyme concentrations were adjusted so that the RNA

was cleaved less than once per molecule, on average. The

digestion times were short enough (5 min) to allow analysis of

the RNA structure before it self-cleaved. The possibility

that the nuclease digestion reveals structures of the cleavage

47

products is eliminated in all bands greater than 19 nt long,

because self-cleavage of the 5' end-labeled RNA would remove

label from the 2' product. Products of nucleolytic digestions

of the wildtype and all the mutant transcripts were separated

on denaturing gels alongside cleavage products obtained with

nucleases T1 and ^ M (cuts after A and U residues) under fully

denaturing conditions (Fig. 4). A wide variation in nuclease

susceptibility of phosphodiester bonds under self-cleavage

conditions relative to denaturing conditions indicated regions

of strong structure. Nuclease T2 cut single-stranded G

residues only weakly, compared to its activity on the other

three bases. The prominent 19 base band in all samples

(including those lacking nuclease) except Ml/2, that were

digested in self-cleavage conditions is the 5' self-cleavage

fragment. It migrated exactly as expected on the basis of the

T1 and <p M sequencing ladders. Some minor nonspecific

degradation is visible in the untreated lanes (e.g., M19, M5)

that cause misleading bands that are not a result of nuclease

digestion in the nuclease-treated lanes.

The sites and frequency of nuclease cutting in all the

RNA molecules are shown in Fig. 5. In all transcripts,

predicted helix 3 was cleaved strongly by nuclease VI and not

by nucleases T1 or T2. Phosphodiester bonds in putative helix

1 were susceptible to both single- and double-strand-specific

nucleases in all instances. In contrast, loop LI was much

Figure 4. Autoradiographs after incubation of wildtype and mutant RNAs with the indicated nucleases. Products were analyzed on 12% polyacrylamide, 7M urea gels. Lanes are labeled for the enzyme treatment, except that lanes marked N had no enzyme added and L indicates partial alkaline hydrolysis ladder, f indicates fM digest which cut A residues slightly more strongly than U's. SEQ indicates nuclease digestions under denaturing (sequencing) conditions. Other digests were in self-cleavage conditions. Products of the VI digest ran one base more slowly than those in the other lanes due to the absence of a 3' phosphate (25,41). Readable sequences of SSI and M5 are indicated alongside the autoradiographs. Positions of bases in LI (lower set) and L2a (upper set) are indicated along side each autoradiograph. These helices are labeled beside the SSI autoradiograph only. Bands in lanes N and VI of M19 are shifted to the left slightly at the intense 19 nt cleavage product due to tearing of the gel.

' tn , • ; I i : i ( i H f î j s

* I » »•• • DoeoD fioocacî

«•I « (;

%

a »«UUttllll|lUBUKI ooooc) 60^00

Hi CO ' m

• I

### M'W# « til #*«' M # • I I I # 4

• I f I I I ( I I I U j l ' I II I » \ Hit l«

I X V V V V W V V V W ' A W V W V W . m . V A v v V V , ooeoo

i l

if 00^00

Oj Co .rccoocoo>c»o>o>ooQoooncococo>ao>ooc>co»^<n>oo>o»:^''

: • «•«•.1111%

00000

^ Co c>^ccnoccxa>c»o>o>ooooo^ooDcoco>OD>oc>c:>caoooonoc»ooD^

M U) < I Hf

I'.'. { u

J III11 M e #*#####«**#####

00000 00000

• ' *$% * It » « . I • 1

I I I 1 1 1 t I I I I II II t nn(IIiir.'!(iiumr.ît!i!Ri

I : lilt I I t l i llllf o@gSc^

1 It

vo

* « . ' # # * # I I t I V :

ti I 11 n mt m . 0 •••III •• • •»

/ t I t I I : M : i i : -u t i l t ê I I t « 4 $ I II I ' lilt II lltlftli th ^

^000 ^o@^

ft- /• /

têfi / // t Ê

t ! t I I • • f I i ll Hi iiitimitiiiiiiaiiiii • « tttt • • tit lit I s

0@S2)C^ @0g)5)0

Figure 5. Locations and relative susceptibilities of nuclease cleavage sites derived from Fig. 4. V = VI site, T = T1 or T2 site. The size of the V or T is proportional to the intensity of the band at that site. Because the digestion pattern of helix 3 was virtually identical in all constructs, it is shown only for wildtype (SSI) RNA. Mutant sets I and II are indicated. Vector-derived bases are in lower case. Mutations are in outlined font. For ease of comparison, the sequences are drawn as hammerheads regardless of whether nuclease sensitivity supported the existence of this structure.

51

Ï1.VV pcuagaaaugaa<^caccua

CpA

:s-c

f i Ac-Q^ c-q y:

^U-AÔÏ c-q c-g o

c a u râ

JÂ"

SSI

% °- ;

°*%s-^

& M1

/uaWI? s

...ua a -ê a

"a

JÂ" A g

@

c-g c-q

V M2

a "a

B JQ.

%# c%

..aua

..ua

L ^c : %C.Q°

8:g

c-q c-g

Mig

i

i V

/\ - t '^AC.G°

8:2

c-q c-q

V M20

m ..MA ...UÀ

a-u \-u:

iê:k

~8# G-% _C U-AÛO c-q c-q

<& Mig/20

u-%, Q.

t c-q' c-q,

Ml/2

..auaW'''̂

..aja juf -a

•s.,. s-

% M5

52

more susceptible to single-strand-specific nucleases in most

of the single mutants in which Ll-L2a base pairing was

expected to be disrupted (M2, M19, M20, M5), than in those in

which Ll-L2a base pairing was predicted (SSI, Ml/2, M19/20).

This is especially noticeable when the T1 digests under

cleavage and denaturing conditions are compared across all the

RNAs (Fig. 4). Concomitantly, in the double mutants,

nucleotides in L2a were digested somewhat more readily by

nuclease VI than were the L2a bases in the single mutants. In

all RNAs, loops L2b, L2c, and L2d were highly susceptible to

single-strand-specific nucleases. Predicted helix H2a was

generally more susceptible to VI, with the exception of Ml in

which it appeared highly single-stranded. H2b and H2c were

not cleaved well by any nucleases, except for H2b in M2 and

Ml/2 which were cleaved unexpectedly by single strand-specific

nucleases. The conserved CUGANGA loop was sensitive to

single-stranded nucleases in all but Ml. Thus, the nuclease

cleavage pattern of Ml RNA was radically different from that

expected, unlike the patterns generated by the other

transcripts.

53

DISCUSSION

Effects of Mutations on Self-cleavage Rate

By showing that disruption of the potential Ll-L2a helix

dramatically increased self-cleavage activity and that

restoration of the potential helix with a new sequence reduced

activity, we have provided strong evidence for the existence

of the helix in the self-cleavage structure of sBYDV (+)

strand RNA. Because disruption of this base pairing is

predicted to favor formation of a hammerhead RNA, the results

also support the proposal (3,4) that the hammerhead is indeed

the self-cleavage structure. That different disruptions to

the Ll-L2a helix have different cleavage rates implies that

other unpredicted folding may be taking place.

It is noteworthy that the rates of cleavage of SSI and

mutants Ml/2 and M19/20 are inversely proportional to the

calculated stability of helix Ll-L2a (Fig. 2). Thus, we

propose that an equilibrium exists between the self-cleaving

hammerhead and the noncleaving stacked helix structure. Even

if the latter is favored, any brief formation of the

hammerhead would allow irreversible cleavage. This explains

the slow but steady rates of cleavage of SSI and M19/20. In

Ml/2, apparently the helix is so strong that the hammerhead

54

never forms. The situation is somewhat analogous to the self-

cleavage structure of hepatitis d virus (HDV) RNA. Although

HDV RNA shows no evident relationship to a hammerhead, it

seems to form a structure in which one helix inhibits self-

cleavage (27) . Denaturing conditions such as <1 mM Mg^"*", high

temperature, or presence of urea or formamide accelerate the

cleavage rate (28). However, unlike HDV RNA, the rate of

sBYDV RNA cleavage does not increase at elevated temperatures

such as 50°, nor does it increase at low magnesium

concentrations, or after boiling and snap-cooling. Perhaps

this is because the Ll-L2a helix is the most stable in the

molecule, and helices required for hammerhead formation (e.g.,

HI) would denature before Ll-L2a. Of the known hammerheads

(5), only the (+) and (-) strands of sLTSV have potential base

pairing between the distal loops of helices 1 and 2 like (+)

sBYDV. However, in that case, such base pairing is not

predicted to be as stable as that involved in hammerhead

formation.

Nuclease Sensitivity

The self-cleavage assays of wildtype and mutant sequences

do not distinguish between the following two possibilities:

(i) the three stacked helices form as proposed in the wildtype

ribozyme with no disruption of the hammerhead (HI, H2, H3)

helices (Fig. lb), and (ii) the Ll-L2a base pairing causes

55

major disruption of the hammerhead by preventing one or more

of the hammerhead helices from forming and perhaps allowing

many new helices to form. To distinguish between these

possibilities, the RNAs were probed with structure-sensitive

nucleases.

Nuclease sensitivity of the wildtype self-cleavage

structure (SSI, Fig. 5) is, for the most part, consistent with

the proposed structure. However, other than H3, predicted

helices are not clearly shown by VI digestion. This may be

due to the wide variation in ability of nuclease VI to act on

certain helical regions (25, 26, 29). Certain regions (e.g.,

putative helices H2b, H2c) were not cleaved by VI nuclease,

presumably due to steric hindrance in which the enzyme could

not interact with nucleotides in the interior of the RNA

molecule (30). In addition, some regions predicted to be

single stranded were partially cut by VI, perhaps due to the

ability of VI to cut at nonpaired but stacked bases (26, 29).

Helix HI was cleaved by single- and double-strand-specific

nucleases, perhaps because it "breathes" during the nuclease

treatment owing to its low stability (AG = -5.3 kcal/mol).

Thus the structural information derived from the VI digests is

somewhat limited.

Single-strand-specific nuclease digestions gave more

clear-cut results than the VI digestions. The observation

that loops L2b, L2c, L2d, and the conserved CUGANGA loop (with

56

one exception) remained sensitive to nucleases T1 and T2

provides strong evidence that the entire vertical stem-loop 2

region forms as in the proposed structures (Fig. 1).

Unexpected alterations to structures of RNAs in mutant set I

were observed (Fig. 5). The most unexpected changes were in

Ml which explains why it cleaves so much more poorly than the

other mutants that disrupt Ll-L2a base pairing. Indeed, a

computer search (23) revealed that many new helices may form

as a result of the three base changes in both Ml and M2 (not

shown), perhaps explaining why neither mutant cleaved as well

as M19 or M20. Although the nuclease sensitivity results do

not support the structure of Ml as drawn, the functional assay

shows that disruption of Ll-L2a still allowed the RNA to form

a functional cleavage structure at least a portion of the

time, causing it to cleave more readily than wildtype. Unlike

Ml, the nuclease sensitivity of M2 supports the existence of a

functional hammerhead. Note the striking increase in

sensitivity to single-stranded nucleases of loop LI in M2

versus SSI. The disrupted helix H2b in M2 is not predicted to

be essential for a functional hammerhead. Thus, it is not

surprising that this RNA cleaves much more rapidly than Ml.

The base changes in mutant set II resulted in no

significant changes in nuclease sensitivity outside the

predicted regions, with the exception of slight unexpected

cuts in LI by VI in M19 and M20. Finally, M5, in which most

57

of the entire vertical stem including L2a was deleted, behaved

as predicted. This is the first use of structure-sensitive

nucleases to show that hammerhead ribozymes indeed fold as

predicted by the model of Forster and Symons (4).

Comparison with Other Hammerheads

Even the fastest-cleaving mutants do not cleave as

rapidly as conventional hammerhead ribozymes such as sBYDV (-)

strand (17) or sTobRV (+) strand (8). This may be due to the

other deviations from consensus (Fig. 1). The AUA instead of

a GUC at the 5' side of the cleavage site is not likely to

significantly reduce the rate of cleavage relative to other

hammerheads. Ruffner et al. (14) showed that replacement of

the G or the C of the GUC with As at either position had only

minimal effect on cleavage by an ASBV-derived ribozyme.

However, when the bases of the proximal base pair of helix 2

were changed to C and A, analogous to C-24 and A-73 in sBYDV

RNA, cleavage by the ASBV-derived ribozyme was reduced over

one hundred-fold. Given this and similar observations with

sLTSV mutagenesis (15), it is perhaps surprising that mutants

M19, M20, and M5, all of which contain unpaired bases C-24 and

A-73, cleave as well as they do.

The results do not prove the existence of the three

stacked helices, but they support this model (Fig. IB). This

structure fits the definition of a pseudoknot (31) ; however.

58

it has three instead of the usual two coaxially stacked

helices. It is possible that helix HI would be pulled apart

due to torsional constraints when the Ll-L2a helix forms, but

the nuclease sensitivity does not correlate with this. It is

possible that yet another conformation exists within the

context of the full-length satellite RNA. Other examples of

alternative conformations for hammerhead domains have been

reported. The self-cleavage sequences in the (+) and (-)

strands of sLTSV may exist in equilibrium between the

hammerhead and as part of the rod-shaped full-length molecule

(4). The self-cleavage sites in newt satellite 2 transcripts

(32) and ASBV RNA (33) may fold differently in the context of

a dimer of the full satellite RNA, compared to the sequence

context of the isolated hammerhead. These RNAs have an

extremely short (2 or 3 base pair) helix 3. In the minimal

hammerhead context, cleavage can occur by a bimolecular

double-hammerhead structure (34), whereas dimeric satellite

RNA self-cleaves mostly via single-hammerheads (32, 33).

Thus, it will be interesting to determine the cleavage rate of

dimeric sBYDV RNA. However, the sBYDV situation is quite

different from the newt and ASBV in that we observed intra-

hammerhead conformational changes rather than inter-hammerhead

base pairing. Due to the length of helix 3, we have no reason

to invoke a bimolecular double-hammerhead mechanism (35). The

sLTSV alternative conformation is also unlike sBYDV in that it

59

involves base pairing to regions outside the hammerhead domain

(4). Finally, alternative conformations have also been

observed when the ribozyme and substrate are located on

separate molecules (13, 16). Because the Ll-L2a helix is the

strongest uninterrupted helix in the entire satellite, and the

strands are in such close proximity, we predict that the helix

exists even in the context of full-length and multimeric RNAs.

The biological role of the stacked-helix structure is

unknown. An intriguing possibility is that the Ll-L2a helix

may form left-handed Z-RNA (reviewed in 36). It contains the

alternating G-C sequence required for Z-RNA. Also, torque may

be imposed by the strands of the distal end of putative helix

HI on helix Ll-L2a because these strands would be expected to

join LI at opposite sides of the one-half turn, 5-base Ll-L2a

helix. This may confer negative supercoiling that is known to

favor Z-DNA (37) . Z-RNA has been shown to exist in living

cells (38, 39), but its identity and biological role are

unknown. Regardless of whether Z-RNA forms, it is possible

that the stacked helix structure performs a function different

from self-cleavage. Nearly half (153 nt) of the 322 nt sBYDV

RNA is involved in formation of either the (+) strand or

complement of the (-) strand cleavage structure. This leaves

only 169 nucleotides divided into two tracts of 104 and 65

bases (17) to perform all the other functions of the satellite

RNA, including an origin of replication, an origin of assembly

60

and probably other functions. Thus, it could be envisioned

that sequences within the self-cleavage structure contribute

to one of these other functions, compromising the ability to

self-cleave in the process. The stacked-helix may serve as a

molecular switch to modulate the transition between these two

functions.

61

REFERENCES

1. Symons, R. H. (1991) Molec. Plant-Microbe Interact. A, 111-120.

2. Bruening, G., Passmore, B. K., van Toi, H., Buzayan, J. M., & Feldstein, P. A. (1991) Molec. Plant-Microbe Interact. A, 219-225.

3. Forster, A. C., & Symons, R. H. (1987) Cell 50, 9-16.

4. Forster, A. C., & Symons, R. H. (1987) Cell 49, 211-220.

5. Bruening, G. (1989) Methods Enzvmol. 180, 547-558.

6. Hutchins, C. J., Rathjen, P. D., Forster, A. C., & Symons, R. H. (1986) Nucleic Acids Res. 14, 3627-3640.

7. Epstein, L. M., & Gall, J. G. (1987) Cell 48, 535-543.

8. Haseloff & Gerlach (1989) Gene 82, 43-52.

9. Uhlenbeck, O. C. (1987) Nature 328, 596-600.

10. Haseloff, J., & Gerlach, W. L. (1988) Nature 334, 585-591.

11. Koizumi, M., Iwai, S., & Ohtsuka, E. (1988) FEES Letters 228, 228-230.

12. Ruffner, D. E., Dahm, S. C., & Uhlenbeck, O. C. (1989) Gene 82, 31-41.

13. Fedor, M. J., & Uhlenbeck, O. C. (1990) Proc. Natl. Acad. Sci. USA 87, 1668-1672.

14. Ruffner, D. E., Stormo, G. D., & Uhlenbeck, 0. C. (1990) Biochemistry 29, 10695-10702.

15. Sheldon, C. C., & Symons, R. H. (1989) Nucleic Acids Res. 14, 5679-5685.

16. Heus, H. A., Uhlenbeck, O. C., & Pardi, A. (1990) Nucleic Acids Res. 18, 1103-1108.

18

19

20

21

22

23

24.

25.

26 .

27.

2 8 .

29.

30.

31.

32.

33.

62

Miller, W. A., Hercus, T., Waterhouse, P. M., & Gerlach, W. L. (1991) Virology 183, 711-720.

Kunkel, T. A., Roberts, J. D., & Zakour, R. A. (1987) Methods Enzvmol. 154, 367-382.

Sambrook, J., Fritsch, E. F., & Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Second edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor.

Conway, L., & Wickens, M. (1989) Methods Enzvmol. 180, 369-379.

Donis-Keller, H., Maxaiti, A. M., & Gilbert, W. (1977) Nucleic Acids Res. 8, 3133-3142.

Simoncsits, A., Brownlee, G. G., Brown, R. S., Rubin, J. R., & Guilley, H. (1977) Nature 269, 833-836.

Cedergren, R., Gautheret, D., Lapalme, G., & Major, F. (1988) CABIOS 4, 143-146.

Vary, C. P. H., & Vournakis, J. N. (1984) Nucleic Acids Res. 12, 6763-6778.

Lockard, R. E., & Kumar, A. (1981) Nucleic Acids Res. 9, 5125-5140.

Lowman, H. B., & Draper, D. E. (1986) J. Biol. Chem. 261, 5396-5403.

Perotta, A. T, & Been, M. D. (1991) Nature 350, 434-436.

Rosenstein, S. P., & Been, M. D. (1990) Biochemistry 29, 8011-8016.

Puglisi, J. D., Wyatt, J. R., & Tinoco Jr, I. (1988) Nature 331, 283-286.

Knapp, G. (1989) Methods Enzymol. 180, 192-213.

Pleij, C. W. A., Rietveld, K., & Bosch, L. (1985) Nucleic Acids Res. 13, 1717-1731.

Epstein, L. M., & Pabon-Pena, L. M. (1991) Nucleic Acids Res. 19, 1699-1705.

Davies, C., Sheldon, C. C., & Symons, R. H. (1991) Nucleic Acids Res. 19, 1893-1898.

63

34. Forster, A. C., Davies, C., Sheldon, C. C., Jeffries, A. C., & Symons, R. H. (1988) Nature 334, 265-267.

35. Sheldon, C. C., & Symons, R. H. (1989) Nucleic Acids Res. 14, 5665-5677.

36. Tinoco Jr., I., Davis, P. W., Hardin, C. C., Puglisi, J. D., Walker, G.T., & Wyatt, J. (1987) Cold Spring Harbor Svmp. Quant. Biol. 52, 135-146.

37. Singleton, K., Klysik, J., Stirdivant, S. M., & Wells, R. D. (1982) Nature 299, 312-316.

38. Zarling, D. A., Calhoun C. J., Hardin, C. C., & Zarling, A. H. (1987) Proc. Natl. Acad. Sci. USA 84, 6117-6121.

39. Zarling, D. A., Calhoun C. J., Feuerstein, B. G., & Sena, E. P. (1990) J. Mol. Biol. 211, 147-160.

40. Freier, S. M., Kierzek, R., Jaeger, J. A., Sugimoto, N., Caruthers, M. H., Neilson, T., & Turner, D. H. (1986) Proc. Natl. Acad. Sci. USA 83, 9373-9377.

41. Schulz, V. P., & Reznikoff, W. S. (1990) J. Mol. Biol. 211, 427-445.

64

PAPER II. NONCONSENSUS BASES IN THE sBYDV ( + ) RNA AFFECT THE RATE OF HAMMERHEAD FORMATION AND SELF-CLEAVAGE EFFICIENCY

65

Nonconsensus bases in the sBYDV (+) RNA affect the rate of hammerhead formation and self-cleavage efficiency

Silver, S.L., M.S. Miller, W.A., Ph.D.

From the Department of Plant Pathology, Iowa State University, Ames, lA 50011

66

INTRODUCTION

Self-cleavage of a small molecular weight RNA was first

observed in the satellite of tobacco ringspot virus (sToBRV)

(+) strand (Prody et al., 1986). The self-cleavage reaction

has a requirement for Mg^"^, and unlike cleavage by RNase P

(Baer et al., 1990) and pre-mRNA splicing (Ruby & Abelson,

1991), does not require protein at physiological conditions.

Demonstration of self-cleavage in the satellite RNAs of luteo-

and sobemoviruses (Bruening, et al., 1991; Symons, 1991b), in

avocado sunblotch viroid (ASBVd; Hutchins et al., 1986), peach

latent mosaic viroid (Hernandez & Flores, 1992; PLMVd) and

carnation stunt associated viroid or satellite RNA (CarSAV;

Hernandez et al., 1992) and in the transcripts of satellite II

DNA of newt (Epstein & Gall, 1987) indicate the broad

occurrence of this phenomenon. These self-cleaving RNAs are

believed to replicate by a rolling circle mechanism which

results in long multimers that cleave into circular and/or

linear monomers (Bruening, et al., 1991; Symons, 1991a). The

nucleotides spanning the cleavage site of the above RNAs fold

into a structure referred to as a hammerhead. The hammerhead

consists of three helices, whose sequences are not conserved

and a central, predominately single-stranded region composed

67

of highly conserved bases (Forster & Symons, 1987b; Forster &

Symons, 1987c). Extensive mutagenic analysis of the

hammerhead confirmed the importance of the conserved

nucleotides and the structure during cleavage (Miller &

Silver, 1991; Ruffner et al., 1989; Ruffner et al., 1990;

Sheldon & Symons, 1989).

The first satellite RNA of a luteovirus was recently

discovered associated with barley yellow dwarf virus, serotype

RPV (sBYDV RNA) (Miller et al., 1991). sBYDV RNA is a 322

nucleotide long RNA that is encapsidated primarily as a linear

molecule. Both the (+) and (-) strands of sBYDV RNA contain

the hammerhead motif (Miller et al., 1991). The (-) strand

cleavage site closely resembles the hammerhead of the sToBRV

(+) strand cleavage site (Bruening, 1989); whereas, the sBYDV

(+) strand hammerhead has several additional structural

features not present in most other hammerheads (Fig. 1).

First, AUA is the trinucleotide on the 5' side of the cleavage

site in sBYDV (+) RNA, while all but one other known

hammerhead structure has the sequence GUC. The one exception

is the virusoid of lucerne transient streak virus (sLTSV),

which has the trinucleotide GUA in this position. Mutagenic

analysis, however, revealed that the trinucleotide need not be

totally conserved for efficient cleavage (Ruffner

et al., 1990; Sheldon & Symons, 1989). Second, mutagenic

analysis and nuclease sensitivity probing of sBYDV (+) RNA

68

demonstrated that stems-loops I and II of the hammerhead have

the potential to basepair and form an alternative structure

containing three coaxially stacked helices (Miller & Silver,

1991).

310

dMvags

5* uauuucquaqapâacaa^c I I I I I I I I I I t TC I I I I % 9' lloiie. P

K

dMvaaa rou-A

310 iLia aaa e UAUUUCaUQQA 3' AUdAAO^CACCU

& "UqqU

B Hammerhead

C_Q|G=SI

il® Wo-Ç

iM\

lAZPU-AlUQal

Stacked helices (pseudoknot)

Figure 1. Proposed alternative structure for the self-cleaving ribozyme in sBYDV (+) strand RNA. Boxed bases are conserved among all hammerheads (Bruening, 1989) . Bases that differ from consensus are shown in outlined text. Numbering of nucleotides is based on the full-length satellite RNA. The three major helices of hammerhead are labeled HI, H2, and H3. Loops present in the hammerhead are prefixed with L. Bases in loops LI and L2a expected to form the additional helix are in italics. Panel A is the hammerhead of sBYDV (+) RNA drawn without the putative basepairing between LI and L2a. Panel B is the alternative structure that forms when LI and L2a interact.

69

The third structural feature of sBYDV (+) RNA not

generally found in hammerhead ribozymes, and the one addressed

by the current study, is the occurrence of one unpaired

cytosine (C-24) immediately 3' to the conserved

single-stranded CUGANGA sequence and an unpaired adenine

(A-73) directly 5' of the conserved GAAAN sequence. Only two

other self-cleaving RNAs have unpaired nucleotides

corresponding to bases 24 or 73 of sBYDV RNA (+) hammerhead.

In sLTSV the (+) strand hammerhead has a uracil corresponding

to C-24 (Forster & Symons, 1987b) and recently the CarSAVd (-)

strand was found to have an unpaired cytosine and adenine

located at exactly the same sites within the hammerhead as the

sBYDV (+) RNA (Hernandez et al., 1992). This study determined

the effects of deleting nucleotides C-24 and A-73 on the rate

of cleavage and hammerhead formation. The data are consistent

with the hypothesis that formation of alternative structures

at the cleavage site disrupt the integrity of the hammerhead,

thus regulating the rate of cleavage.

70

MATERIALS AMD METHODS

Synthesis of Hildtype and Mutant

Self-cleavage Structures

RNA molecules were synthesized by in vitro transcription

of sequences in pGEM3Zf(-) (Promega, Madison, WI). Plasmid

pSSl contained the wildtype (+) strand sBYDV hammerhead

sequence: bases 310 to 322 and 1 thru 89 of the satellite

sequence (Figs. 1 & 2). Cleavage occurs between bases 322 and

1. Vector bases GGA and CUCUAG were present at the 5' and 3'

ends, respectively of wildtype and mutant transcripts from

Xbal-linearized pSSl. Each mutation was introduced by the

two-step PGR method of Herlitze and Koenen (1990). The

following derivatives of pSSl were made with the indicated

primers that are complementary to the satellite RNA (+)

sequence. pM3; 5' CGCGGATAC_*TCGTCAGACAG 3'; pM4:5'

GTGGATTTC_*GTATCTATTTG 3' and pM20: 5' TTCTAGTCCGCTCGGATACTCG

3'. Underlining indicates base changes and * indicates base

deletion. The first PGR involved 25 cycles of amplification

(Amplitaq, Perkin-Elmer-Cetus) using the M13 reverse primer

and the mutagenic oligomer. The purified double-stranded PGR

product and the M13 forward primer were used for the second

PGR using the same target DNA (pSSl). Products from the

71

T7

Cleavage

products:

310

-fl

19

i LI L2a 80 Xbal

%

101 .3'

Figure 2. Maps of inserts in transcription plasmids. Large bold box represents sBYDV RNA sequence; shaded regions (flanking bases 310 and 89) are not required for hammerhead formation. Horizontal arrow marks the transcription start site; vertical arrowhead indicates self-cleavage site. Expected cleavage products of transcripts generated by T7 polymerase-catalyzed transcription of Xbal-linearized DNA are shown as bold lines below the map. Sizes of transcripts (in nt) are indicated below each one. LI and L2a are indicated by hatched regions. Sites of mutations are indicated.

second PGR were digested with BamHI/Hindlll, gel-purified and

ligated into BamHI/Hindlll-cut pSSl. Synthesis of the double

mutant pM3/4 proceeded by first constructing pM3 followed by a

second PGR mutagenesis that used pM3 instead of pSSl as the

target DNA. The triple mutant, pM3/4/20, was synthesized

using pM3/4 as the target DNA. All base deletions and

alterations were confirmed by double-stranded DNA sequencing

(Promega). During the sequencing of the mutations, we

discovered a non-templated addition of an adenosine at the 5'

side of the site to which M20 annealed. The PCR-generated

conversion was circumvented by using "Hot Tub" DNA polymerase

(Amersham) for the first PGR amplification and Taq polymerase

72

for the second amplification. Generally, 50-75% of resulting

clones had the correct mutation without the base conversion.

In our nomenclature, a plasmid and its transcript are named

similarly except that the "p" of the plasmid name is omitted

in the transcript.

Self-cleavage Assays

[a-^^P] GTP-labeled RNA was transcribed from Xbal-

linearized plasmid DNA as described by Milligan and Uhlenbeck

(1989). Approximately 0.1 mg/ml of T7 RNA polymerase isolated

as described previously was used per standard transcription

(Grodberg & Dunn, 1988; Zawadski & Gross, 1991). Full-length

transcripts were purified from an 8% polyacrylamide, 7M urea

gel (Sambrook et al., 1989). Self-cleavage assays (80 ̂ ll)

contained approximately 20,000 counts per minute (cpm) of

gel-purified, uncleaved transcript, SOmM Tris, pH 7.5 and lOmM

MgClg. The assay was initiated by addition of the MgClg. The

reaction was incubated at 37° C and at indicated time points, 8

/il aliguots were taken and added to an equal volume of

"solution D" (10 M urea and 30 mM EDTA; BRL). Samples were

denatured by boiling for one minute immediately prior to

electrophoresis. Bands corresponding to the uncleaved

transcript and cleavage products were quantified using

Phosphorimage analysis (Molecular Dynamics). The half-life

(T.) of the uncleaved transcript was determined by computing

73

the slope of the best-fit line of the cleavage data and

solving for the X-intercept using the software CoPlot and

CoStat.

Synthesis of End-labeled RNA

and Nuclease Digestion

End-labeled uncleaved transcripts were prepared and

gel-purified as described previously (Conway & Wickens, 1989;

Miller & Silver, 1991) with the following modifications.

Unlabeled RNA was transcribed according to Milligan (1989)

with T7 RNA polymerase isolated in our laboratory and products

treated with 5 units of calf intestinal phosphotase for 20

minutes. Nuclease digestion was performed essentially as

described previously (Miller & Silver, 1991) with the

following changes. Nuclease digestion assays contained 20,000

cpm per reaction of gel-purified, end-labeled uncleaved RNA, 1

mg/ml tRNA, 50 mM Tris, pH8.0, 10 mM MgClg and either 0.1 U VI

nuclease, 0.1 U T1 nuclease, 0.1 U T2 nuclease or water. The

nuclease reaction was initiated by MgClg, incubated for 10

minutes and quenched by addition of solution D. For each

reaction, the RNA was denatured by boiling for 1 min and then

separated by electrophoresis on a 12% polyacrylamide, 7 M urea

gel. Cleavage products were visualized by autoradiography.

74

RESULTS

Self-cleavage of Mutant RNAs

RNA transcribed from Xbal-linearized pSSl (Miller &

Silver, 1991) produced a 120 nt long molecule that in the

presence of 10 mM MgClg and 50 mM Tris, pH 7.5, self-cleaves

to form a 101 nt 2' fragment and 19 nt 5' end fragment. The

Tx/2 of the uncleaved transcript determined from three separate

assays ranged from 1400 to 2100 min (Fig. 3). Similar rates

of cleavage were observed previously (Miller & Silver, 1991).

The unpaired cytosine (C-24) or the unpaired adenosine (A-73)

were deleted from pSSl resulting in pM3 and pM4, respectively.

The Ti/2 of M3 and M4 calculated from three separate assays

were not significantly different from the T1/2 of SSI (Fig. 3 &

4). The double mutant M3/4, however, had a much shorter T^/g

(39 min) than either of the single mutants or the wildtype

sequence (Fig. 3 & 4). In all transcripts with the M4

mutation, an unexpected C-83 to A-83 transversion was induced

by the PGR mutagenesis. The location of the transversion is

in stem III which is the most stable and least likely affected

of the three helices. Exhaustive computer searches revealed

little potential for alternative basepairing due to the

transversion.

Figure 3. Self-cleavage of wildtype and mutant RNAs. Left: Autoradiographs of transcripts after incubation in self-cleavage conditions for times shown in graphs at right, and after denaturing polyacrylamide gel electrophoresis. Mobilities of full-length (F) transcript, and 3' and 5' fragments are indicated. Right; Plots of fraction of full-length transcript that remained uncleaved were calculated from radioactivity in bands of autoradiographs at left.

Ê

• • " f f 5 Wii

fraction uncleaved

Figure 4 . Autoradiographs after incubation of wildtype and mutant RNAs with the indicated nucleases. Products were analyzed on 12% polyacrylamide, 7 M urea gels. Lanes are labeled for the enzyme treatment, except that lanes marked N had no enzyme added and L indicates partial alkaline hydrolysis ladder. ̂ indicates ̂ M digest which cut A residues slightly more than U's. SEQ indicates nuclease digestions under denaturing (sequencing ) conditions. Other digests were in self-cleavage conditions. Readable sequences of SSI are indicated alongside the autoradiographs. Left side of gel contains position of the CUGANGA region; whereas, the right side of gel, positions of bases in LI (lower set) and L2a (upper set) are indicated.

uouoy. çuoup

orà k. •riHT'rT""!'!'!!'!' V • r Spp.'l ) i 'M ' I I I I M I III 9 V;i # ## #*#' III 2Ë| I •• I## « '

' • ' ' • M II l»l I I #

CO H .

ypui^ (juDi^ RtMiMiililillinini I II •«

m tiinii! iiini i • / I I I

m um iflONH I I'll I %\\\ I*## III I • > n M 191 II

î ; ! "t

00

Mill z

a ^jdC^y jjuoi^

â w wwwv \ \ un » « ' *•'

1 • ; 1 I I I I * * f • MmU' I I II t #•« ' ( • ( ' I ! - Il II III M •

0<DU<OOUOWOWX50U<OU<OOUOOSVOOUOVO<0<U<0<OODOLO:

i mmninnnn i ti n I 1 I II l !

I l l I I I I #*##

«Il I II M III '

I

I I I llir 1

SJD<(^ DUOUO

r" 1 • • i—MmimBinwmmmi ii w# f t-1 Hi 0 I t t I I I ! I I I I I # # I t £11)) n i^J) )j J J 1111 I I I E f ' # I i'tÊ t: f ' I it mi >^i , ». 1,1 ,, #

youoy ououo •••••Mfinmn • M «» • » • M9 I Mill I# I I nil I II II# #

III lillU III I III I _ II I T 'i#y 11 « M •« ' t*-< «41 'I# *## ' »«'

» •

79

To look further at how the mutants M20 and M3/4 act to

enhance hammerhead formation by disrupting inactive,

alternative structures, the triple mutant M3/4/20 was

constructed. The first attempt at constructing the mutant by

PGR using pM3/4 DNA resulted in an unintended G to A

transition at G-44. The half-life of the resulting M3/4/20a

transcript was approximately 570 min which is significantly

faster than SSI but not nearly as fast as would be expected

from earlier M20 and M3/4 cleavage data. A modified PGR

mutagenesis protocol which uses "Hot Tub" polymerase resulted

in the M20 mutation without the PGR-generated transition. The

M3/4/20 transcript had a half-life of approximately 6 min

which is not significantly different from the 5 min half-life

of the M20 transcript determined previously (Miller & Silver,

1991).

Nuclease Sensitivity

To determine the tertiary structure of each RNA during

cleavage, structure-sensitive nucleases were employed. 5'

end-labeled transcripts were partially digested with nucleases

T2 (cuts all single-stranded nucleotides; Vary & Vournakis,

1984), T1 (cuts single-stranded guanosine nucleotides), or VI

(cuts double-stranded and some base-stacked regions; Lockard &

Kumar, 1981). For each enzyme, the reaction was performed in

standard cleavage conditions (10 mM MgGlg and 50 mM Tris,

80

pH 7.5 at 37° C). The digestion times were sufficiently short

(10-15 min) to study the RNA structure before complete

cleavage. Products of nucleolytic digestions of the wildtype

and all the mutant transcripts were separated on denaturing

polyacrylamide gels along with the products obtained from

nucleases T1 and ^ M (cuts after A and U bases) performed in

denaturing conditions. Products were visualized by

autoradiography (Fig. 4). The prominent 19 base band in all

samples carried out in self-cleavage assay conditions

(including the no enzyme control) with the exception of SSI

and M4, is the 5'-end cleavage product. It migrated as

expected on the basis of the T1 and 0 M sequencing ladders.

Minor, nonspecific RNA hydrolysis was detected in the no

enzyme control lane; none of which was as significant as the

nuclease-specific products.

A compilation of all sites and frequency of nuclease

digestion was constructed for each RNA (Fig. 5). In all

transcripts, including ones containing the PCR-generated base

conversion at position 88, helix 3 has a strong degree of

double-stranded character as shown by the frequency of VI

cutting and the absence of either T1 or T2 digestion. Helix

I, on the other hand, showed a high degree of single-stranded

character as evidenced by the frequency of T1 and T2

digestions. When all transcripts are compared at the sites

corresponding to LI and L2a, mutations expected to directly

81

disrupt basepairlng (M3/4/20 and M3/4/20a) show a higher

degree of single-strandedness than transcripts expected to

maintain this helix (SSI, M3, M4, and M3/4). Furthermore, M3

and M3/4 have an intermediate level of susceptibility to Tl

and T2 digestion in these loops (Fig 4, 5). In all the

mutants, loop L2d was highly susceptible to single strand-

specific nucleases. Loop L2c was generally observed as

single-stranded in the mutants with the exception of M3/4/20

and M3/4/20a which showed insensitivity to all enzymes. Loop

L2b was highly susceptible to single-strand-specific nucleases

in all the mutants but M3. Helices H2a and H2c were generally

not susceptible to nuclease Tl or T2; whereas this region was

highly susceptible to these enzymes in both M3/4/20 and

M3/4/20a. The conserved CUGANGA single-stranded region was

cut as expected, with the exception of M3/4/20 and M3/4/20a

which became highly resistant to nuclease digestion. Clearly,

the most significant change in cleavage pattern when all

mutants were compared occurred in the CUGANGA region

(Fig. 4 & 5).

Figure 5. Locations and relative susceptibilities of nuclease cleavage sites derived from Fig. 4. V = VI site, T = T1 or T2 site. The size of the T or V marker is proportional to the intensity of the band at that site. Helix III digestion pattern is nearly the same for all transcripts; therefore, it is shown only with the SSI map. The sequences are drawn as hammerheads regardless of whether nuclease sensitivity supported the existence of the structure. Base conversions are in italics. Base deletions are depicted by empty rectangles.

ve/tftn

-w'OOO

S.Vl' '(

n!°n at/*lt\/i

gW-n

D-OL

Ow nao

l^vXS >/' 't

Jf ovo-0

''iTi y?

. .oyoyvnv ' 'f

)

"tf ga

4 /%

m

I O', ff m w

BM

es

Q-0_

4̂ 5

1

M& 8-|<

îV'^-n

J)-0_

ISS

i

-n

A , YOPqYP^YYPOY^YW [/i^SîjA^^WAnPAOT/STo®"'".»

E8

84

DISCUSSION

Effects Of Mutations on Self-cleavage Rate

Fedor and Uhlenbeck (1992) outlined a kinetic pathway for

an intermolecular reaction involving a ribozyme and a

substrate RNA (Fig. 6). According to this model, cleavage is

limited by either formation of an active structure, i.e., a

hammerhead or by the rate at which products are released from

the ribozyme. kj describes the rate at which the two RNAs

interact and fold into a hammerhead, kg is the actual clevage

rate and kscharacterizes the rate of product release. In

general, the kinetic pathway proposed for the bimolecular

reaction can also describe what occurs in the intramolecular

cleavage reaction, except that the latter is zero order and

the bimolecular reaction is first order. Therefore, any

mutation that affects the cleavage rate of the sBYDV (+) RNA

hammerhead can be described by the reaction rates in the Fedor

and Uhlenbeck model. Any alternative structures within the

hammerhead should be discussed relative to how they affect the

formation of the hammerhead. Since actual phosphodiester bond

cleavage (kg) is believed to be instantaneous and virtually

irreversible, most if not all alternative structures that form

within the hammerhead will affect either ki or kg but not kg.

85

The basepairing between LI and L2a which disrupts

hammerhead formation in the sBYDV (+) RNA self-cleavage domain

is predicted to be the most stable helix (AG= -10.1 kcal/mol)

in the satellite RNA (Miller & Silver, 1991). The unpaired

nucleotides (C-24 and A-73) situated at the top of stem II of

the hammerhead may be crucial for the formation of the

alternative basepairing (Fig. 1). Deletion of both bases

results in a significant increase in the cleavage rate,

suggesting that C-24 and A-73 indeed play a role in making the

alternative, non-cleaving structure sterically possible.

E + S E - S E - P 1 - P 2 E + P 1 + P 2

E-P1+P2 ^3

Figure 6. Proposed reaction pathway for bimolecular cleavage (adapted from Fedor & Uhlenbeck, 1992).

Upon comparison, the mutant transcript that directly

inhibits basepairing between LI and L2a, M3/4/20, cleaves much

faster than M3/4. This is consistent with the idea that M3/4

acts indirectly to disrupt Ll/L2a helix formation and inhibits

but does not completely prevent helix formation. Finally,

86

M3/4/20 cleaved as fast as M20 (Miller & Silver, 1991); while,

the double mutant M3/4 cleaves significantly slower. We

concluded that deleting C-24 and A-73 in a transcript with

M20, has little additional positive effect on the cleavage

rate. Therefore, these data indicate the major alternative

structure in the SSI transcript that inhibits cleavage is the

putative basepairing between LI and L2a. In general, there

seems to be two ways in which the rate of SSI cleavage can be

increased: directly by changing nts so that the two regions

(LI and L2a) are no longer complementary, or by deleting C-24

and A-73. In either case, the kj of the cleavage reaction is

increased since alternative structure(s) other than the

hammerhead are less likely to form.

Nuclease Sensitivity

The phosphodiester bond cleavage of small molecular

weight RNAs is: (i) highly dependent on the formation of the

hammerhead structure (Forster & Symons, 1987b; Sheldon &

Symons, 1989) and (ii) instantaneous and essentially

irreversible (Fedor & Uhlenbeck, 1992). Furthermore, Haldane

(1930) proposed that the transition state intermediate of any

enzyme-catalyzed reaction must be unstable to successfully

lower the activation energy. Therefore, when using structure-

sensitive nucleases to look at a cleaving RNA, care must be

taken in the interpretation of the data. The slow-cleaving

87

transcripts SSI, M3, and M4 will exist, generally, as inactive

molecules and thus sensitivity probing will most likely

reflect the presence of these inactive forms. However, with

the fast-cleaving transcripts, the probing may reveal

structure of the minority of molecules that form inactive

structures, but would not detect the majority which will have

self-cleaved. For example, the very fast-cleaving transcript

(M3/4/20) and the significantly less active RNA (M3/4/20a)

have nearly the same nuclease probing map (Fig. 5). This

result indicates that nuclease probing can not always

discriminate between active and inactive molecules. Secondly,

in the case of transcripts that have the M20 mutation (M20,

M3/4/20 and M3/4/20a), the CUGANGA region becomes

significantly less accessible to single strand analysis. This

change in enzyme susceptibility was the most significant in

the entire RNA molecule. Because formation of the hammerhead

depends on this region to be single-stranded (Forster &

Symons, 1987a), and nuclease probing indicated some of the

fast cleaving transcripts to be double-stranded in this

region, we conclude that this is the structure of the fraction

of transcripts that do not cleave even with extended times of

incubation. Even though the LI and L2a basepairing is

disrupted (Fig 4 & 5), other alternative structures are also

possible. In fact, GCG software using the RNA secondary

structure analysis applications, MFOLD and PLOTFOLD, indicates

88

additional basepairing is possible in both M3/4/20 and

M3/4/20a between nts 20-29 and 48-57 that is not present in

any of the other mutant transcripts. Finally, in nearly all

the transcripts, helix I has a high degree of single-stranded

character (Fig. 4 & 5) and thus the cleavage site has an

"open" structure. For ASBVd self-cleavage, a double

hammerhead model was proposed that involved the binding of a

second ASBVd molecule to the first in a manner that extends

stem III thus in effect stabilizing the very short and

unstable helix III. It seems unreasonable to believe stem I

can be so unstable and still cleave efficiently. Therefore,

our data are consistent with the proposal that structures

observed with nuclease sensitivity probing are ones that occur

in RNAs that self-cleave more slowly than the nucleases cut.

These structures may reflect those parts of the RNA that

inhibit the formation of the active hammerhead structure.

These data might help explain the observation that purified

transcripts of sLTSV require a boiling/snapcooling step before

efficient cleavage is realized (Forster & Symons, 1987).

Other Hammerheads

Generally speaking, the cleavage rate observed for sBYDV

(+) RNA is slower than for other self-cleaving RNAs. Even the

(-) strand hammerhead of sBYDV RNA cleaves at a much faster

rate than its counterpart in the (+) sense (Miller et al..

89

1991). It was believed earlier that the alternative bases

found in the (+) strand hammerhead were responsible for the

slow cleavage rate. However, mutagenic analysis of the

trinucleotide 5' to the cleavage site (Ruffner, et al., 1990)

and the discovery of the self-cleaving RNA of CarSV (Hernandez

et al., 1992) seem to indicate that the decrease in cleavage

efficiency of sBYDV (+) RNA is not due to the alternative

bases. More likely the slow cleavage rate of sBYDV is the

result of all the non-conserved nts interacting to form stable

alternative conformations with themselves and with the

conserved nts that make up the hammerhead. This would be

analogous to the global effects seen in proteins where one

amino acid change not in the active site per se still

interferes with catalytic activity. On the other hand, bases

that are a long distance from the cleavage site may in effect

inhibit formation of alternative structures {Ll-L2a helix).

In this case, the cleavage rate would increase. For example,

a permuted dimeric clone of sBYDV RNA that is composed of a

greater number of wildtype nts on either side of the cleavage

site cleaves much more efficiently than the less-than full-

length monomers (Miller & Silver, 1991; Silver et al., in

preparation). In summary, the rate of hammerhead-mediated

self-cleavage is likely affected by not only the conserved

nucleotides but also by the non-conserved bases. It is the

90

global interaction of all the nucleolids within a self-

cleaving RNA that governs the actual rate of cleavage.

91

REFERENCES

Baer, M. F., Arnez, J. G., Guerrier-Takada, C., Vioque, A., & Altmann, S. (1990) . Preparation and characterization of RNase P from E. coli. Methods in Enzvmoloav. 181. 569-582.

Bruening, G. (1989). Compilation of self-cleaving sequences from plant virus satellite RNAs and other sources. Methods in Enzvmoloav. 1980. 546-558.

Bruening, G., Passmore, B. K., Toi, H. v., Buzayan, J. M., & Feldstein, P. A. (1991). Replication of a plant virus satellite RNA: Evidence favors transcription of circular templates of both polarities. Molecular Plant-Microbe Interactions. 4, 219-225.

Conway, L., & Wickens, M. (1989). Modification interference analysis of reactions using RNA substrates. Methods in enzvmoloav. 180. 369-379.

Epstein, L. M., & Gall, J. G. (1987). Self-cleaving transcripts of satellite DNA from the newt. Cell. 48. 535-543.

Fedor, M. J., & Uhlenbeck, 0. C. (1992). Kinetics of intermolecular cleavage by hammerhead ribozymes. Biochemistry. 31. 12042-12054.

Forster, A. C., & Symons, R. H. (1987a). Self-cleavage of plus and minus RNAs of a virusoid and a structural model for the active sites. Cell. 49. 211-220.

Forster, A. C., & Symons, R. H. (1987b). Self-cleavage of plus and minus RNAs of a virusoid and a structural model for the active sites. Cell. 49, 211-220.

Forster, A. C., & Symons, R. H. (1987c). Self-cleavage of virusoid RNA is performed by the proposed 55-nucleotide active site. Cell. 50. 9-16.

Grodberg, J., & Dunn, J. J. (1988). omp T encodes Escherichia coli outer membrane protease that cleaves T7 RNA polymerase during purification. J. Bacterid. 170. 1245-1253.

92

Haldane, J. B. S. (1930). Enzymes. London: Longmans.

Herlitze, S., & Koenen, M. (1990). A general and rapid mutagenesis method using polymerase chain reaction. Gene. 91, 143-147.

Hernandez, C., Daros, J. A., Elena, S. F., Moya, A., & Flores, R. (1992). The strands of both polarities of a small circular RNA from carnation self-cleave in vitro through alternative double-and single-hammerhead structures. Nucleic Acids Research. 20.6323-6329.

Hernandez, C., & Flores, R. (1992). Plus and minus RNAs of peach latent mosaic viroid self-cleave in vitro via hammerhead structures. Proceedings of the National Academv of Sciences. USA. 89. 3711-3715.

Hutchins, C. J., Rathjen, P. D., Forster, A. C., & Symons, R. H. (1986). Self-cleavage of plus and minus RNA transcripts of avocado sunblotch viroid. Nucleic Acids Research. 14. 3627-3641.

Lockard, R. E., & Kumar, A. (1981). Mapping tRNA structure in solution using double-strand-specific ribonuclease Vi from cobra venom. Nucleic Acids Research. 9, 5125-5140.

Miller, W. A., Hercus, T., Waterhouse, P. M., & Gerlach, W. L. (1991). A satellite RNA of barley yellow dwarf virus contains novel hammerhead structure in the self-cleavage domain. Virology. 183. 711-720.

Miller, W. A., & Silver, S. L. (1991). Alternative tertiary structure attenuates self-cleavage of the ribozyme in the satellite RNA of barley yellow dwarf virus. Nucleic Acids Research. 19, 513-520.

Milligan, J. F., & Uhlenbeck, O. C. (1989). Synthesis of small RNAs using T7 RNA polymerase. Methods in Enzvmology. 180. 51-62.

Prody, G. A., Bakos, J. T., Buzayan, J. M., Schneider, I. R., & Bruening, G. (1986). Autolytic processing of dimeric plant virus satellite RNA. Science. 231. 1577-1580.

Ruffner, D. E., Dahm, S. C., & Uhlenbeck, O. C. (1989). Studies on the hammerhead RNA self-cleaving domain. Gene. 82/ 31-41.

Ruffner, D. E., Stormo, G. D., & Uhlenbeck, O. C. (1990). Sequence requirements of the hammerhead RNA self-cleavage reaction. Biochemistry. 29, 10695-10702.

93

Sambrook, J., Fritsch, E. F., & Maniatis, T. (1989). Molecular cloning: A laboratory manual (2nd ed.)« Cold Spring Harbor: Cold Spring Harbor Laboratory Press.

Sheldon, C. C., & Symons, R. H. (1989). Mutagenesis analysis of a self-cleaving RNA. Nucleic Acids Research. 17, 5679-5685.

Symons, R. H. (1991a). The intriguing viroids and virusoids: What is their information content and how did they evolve? Molecular Plant-Microbe Interactions. 4, 111-121.

Symons, R. H. (1991b). Ribozymes. Critical Reviews in Plant Sciences. 10. 189-234.

Vary, C. P. H., & Vournakis, J. N. (1984). RNA structure analysis using T2 ribonuclease:detection of pH and metal ion induced conformational changes in yeast tRNA ". Nucleic Acids Research. 12, 6763-6778.

Zawadski, V., & Gross, H. J. (1991). Rapid and simple purification of T7 RNA polymerase. Nucleic Acids Research. 19, 1948.

94

REPLICATION OF TRANSCRIPTS FROM A CLONE OF BARLEY YELLOW DWARF VIRUS SATELLITE RNA IN OAT PROTOPLASTS

95

Replication of transcripts from a cDNA clone of barley yellow dwarf virus satellite RNA in oat protoplasts

Silver, S.L., M.S.

Miller, VI.A., Ph.D.

From the Department of Plant Pathology, Iowa State University, Ames, lA 50011

96

ABSTRACT

A small RNA associated with an isolate of barley yellow

dwarf virus (BYDV, RPV serotype) has been described which has

the physical properties of a satellite RNA (Miller et al.,

1991). Here, we demonstrate that this RNA has the biological

properties of a satellite RNA; it depends on helper virus

(BYDV genomic) RNA for replication and the helper RNA does not

depend on the satellite. To separate helper from satellite

RNA, a permuted dimeric clone was constructed from which

infectious satellite RNA could be transcribed in vitro. The

dimeric transcript self-cleaved to produce monomeric satellite

RNA. When this RNA was co-electroporated with BYDV genomic

RNA into oat protoplasts, replication of both RNAs was

detected by Northern hybridization. Satellite RNA was

incapable of independent replication. The presence of

discrete oligomeric forms of (+) and (-) sense satellite RNA

in infected protoplasts suggests that both strands replicate

by a rolling circle mechanism.

97

INTRODUCTION

Satellite RNAs of plant viruses are single-stranded

molecules that are completely dependent on a helper virus for

replication, encapsidation and spread (for review see

Roossinck et al., 1992). The helper virus is able to

replicate and spread in the absence of the satellite RNA.

Satellite RNAs have little sequence similarity with either the

helper virus RNA or host RNA. Virus disease symptoms can be

altered by the presence of the satellite RNA. In the majority

of cases, satellite RNAs attenuate symptoms with a concomitant

decrease in helper virus titer (Gerlach et al., 1986;

Roossinck et al., 1992; Waterworth et al., 1979).

One class that we call small satellite RNAs can form

circles and multimers that undergo a self-cleavage reaction

during replication. These include satellite RNAs of the

nepovirus, sobemovirus (virusoids) and luteovirus groups

(Francki, 1985; Keese & Symons, 1987; Miller et al., 1991;

Prody et al., 1986). The termini at the cleavage site include

a 5'-hydroxyl and a 2'-3'-cyclic phosphodiester (Buzayan

et al., 1986; Miller et al., 1991). It has been proposed that

the small satellite RNAs replicate by a rolling circle

mechanism in which large multimers are generated and then

98

cleaved into monomer-sized molecules (Branch & Robertson,

1984; Hutchins et al., 1985). This self-cleavage occurs with

a conserved hammerhead-shaped domain or less frequently a

hairpin structure (Forster & Symons, 1987a; Hampel et al.,

1990). The hammerhead is composed of three helical domains

(I, II, and III) and a central core of eleven conserved,

predominantly single-stranded nucleotides (Forster & Symons,

1987a) that are critical for self-cleavage (Ruffner et al.,

1990; Sheldon & Symons, 1989).

We described previously a satellite-like RNA associated

with barley yellow dwarf virus (sBYDV RNA) which has the above

physical properties of a small satellite RNA (Miller et al.,

1991). However, we had not demonstrated that this RNA is a

true satellite RNA by showing that it requires BYDV for

propagation and that BYDV does not require the satellite. To

pursue this question we first constructed a cDNA clone from

which full-length sBYDV RNA could be transcribed. This

allowed certain separation of helper and satellite RNA. The

in vitro-transcribed sBYDV RNA was then co-electroporated

along with BYDV virion RNA into oat protoplasts. The isolates

of BYDV we used for virion RNA isolation have been shown

previously not to have an associated satellite RNA. This is

similar to the approach of Gerlach et al.,(1986) who co-

inoculated tobacco plants with tobacco ringspot virus (ToBRV)

and the sToBRV RNA. Because BYDV is not mechanically

99

transmissible to whole plants (Oswald, 1951) we used a

protoplast system instead.

To construct an infectious sBYDV RNA transcript with

correct termini, we started with a permuted dimeric clone

(pBWS30) described previously (Miller et al., 1991). Both

copies of the dimer in this clone contain a deletion of the

3/-terminal base (nt 322) of monomeric sBYDV RNA (+) strand.

This deletion rendered (+) sense transcripts of pBWS30

extremely slow at self-cleavage. This is not surprising since

this resulted in deletion of the non-basepaired residue at the

5' side of the self-cleavage site required by the hammerhead

(Miller et al., 1991). Base 322 was restored to the pBWS30

sequence by site-directed mutagenesis at both cleavage sites.

The first mutagenesis reaction was according to Kunkel (1987)

using the oligomer 5'- TACGCGCTCTGT (ACGT)ATCCACGAAATAG-3'

which was degenerate at the site of base insertion. The

oligomer hybridizes on the dimeric insert in plasmid pBWS30

across each cleavage site (Figure lA). The resulting clones

were screened by double-stranded DNA sequencing (Promega).

For unknown reasons, only the 3' cleavage site was mutagenized

by this method. The 5' cleavage site was mutagenized

separately with the same primer by the PGR method of Herlitze

and Koenen (1990). The Hindlll-Bglll fragment of pBWS30 was

cloned into Bglll/Hindlll-cut pSLllSO (Pharmacia) to create

pHB-FL. The first PGR involved 25 cycles of amplification

100

(Amplitaq, Perkin-Elmer-Cetus) using the M13 reverse primer

and the above mutagenic oligomer. The purified PGR product

and the M13 forward primer were used for the second PGR using

the same target DNA (pHB-FL). Products from the second PGR

were digested with Bglll/Hindlll, gel-purified and ligated

into Bglll/Hindlll-cut pBWS30A that had been mutated

previously at the 3' cleavage site. Insertion of the

deoxyadenylate at both cleavage sites was confirmed by

sequencing. Other bases inserted at the cleavage site were

confirmed by sequencing but were not tested for cleavage.

Self-cleavage of Dimeric sBYDV RNA

The resulting permuted, dimeric wild type (pFL-WT) clone

was linearized with EcoRI and transcribed using SP6 RNA

polymerase (Promega) and [a-®^P] GTP (NEN/DuPont). An aliquot

of the transcription reaction was electrophoresed on a 6%

polyacrylamide gel and radioactive bands detected by

autoradiography.

Dependence of sBYDV RNA Replication

on BYDV Genomic RNA

A mixture of satellite-free isolates consisting of PAV-IL

and RPV-NY was propagated in oats (Avena sativa cv. Clintland

64) from which virus and viral RNA were extracted as described

by Waterhouse et al. (1986). Non-radiolabeled, permuted

101

dimeric sBYDV RNA was synthesized by in vitro transcription of

EcoJîJ-linearized pFL-WT using SP6 RNA polymerase (Ambion

Megascript kit, Austin, TX). The monomer obtained by self-

cleavage (as in Fig. IB), was gel-purified (Sambrook et al.,

1989). One hundred nanograms of this monomer and/or 100 ng of

viral RNA (17-fold molar excess of sBYDV RNA) were used as

inoculum. Protoplasts were prepared and electroporated as

described by Dinesh-Kumar et al. (1992). Total RNA was

isolated from protoplasts at various times after

A.

1 1 ^ 1 1 SP6 —

u Self-cleaved transcript:

nts:

B.

FL-WT M

269

4'

1 1 . .-.A#

322 122

Figure l. Map of permuted dimeric clone and transcripts of sBYDV RNA. Panel A shows the map of sBYDV RNA in the transcription vector, pBWS3 0A. Shaded regions indicate sequences involved in (+) strand cleavage. Arrows indicate cleavage sites. Expected cleavage product sizes for (+) strand are indicated. Abbreviations: R, EcoRI; S, Sau3AI; B, Bglll;, H, Hindlll. Panel B shows an autoradiograph of transcripts of in vitro transcribed (+) strand sBYDV RNA cleavage products after denaturing polyacrylamide gel electrophoresis.

102

electroporation, and analyzed by Northern hybridization (Fig.

2). In RNA from protoplasts inoculated with BYDV genomic RNA,

a (-) sense viral RNA probe complementary to the 5' end of the

BYDV-RPV genome, detected an approximately 5.5 kb band that

co-migrated with purified virion RNA (Fig. 2A). This was not

simply detection of inoculum RNA, because no viral RNA was

detected 5 min after inoculation (Fig. 2A, lane 1). Because

it spanned only the 5'-terminal 250 bases, this probe was not

expected to detect 3'-terminal subgenomic RNAs. A similar

pattern was detected when the blot was stripped and re-probed

with (-) sense BYDV-PAV genomic RNA (data not shown). Thus,

RNAs of both serotypes replicated in oat protoplasts. The

mixture of serotypes was used because such a mixture is known

to support sBYDV RNA replication in plants (Miller et al.,

1991) and the serotypes act synergistically (Baltenberger et

al., 1987) resulting in exacerbation of symptoms. Probes

specific for both the (+) and (-) strands of sBYDV RNA

hybridized to low molecular weight RNAs (Fig. 2B and C) that

accumulated by 30 hrs. post-inoculation. Neither probe

hybridized to RNA from protoplasts inoculated with sBYDV RNA

alone, indicating that it could not replicate in the absence

of BYDV genomic RNA. A slight decrease in BYDV-RPV genomic

RNA was observed consistently when sBYDV was co-electroporated

(Fig. 2A, compare lanes 2 and 3 with 5 and 6). This is

somewhat surprising because BYDV isolates that contain sBYDV

Figure 2. Northern hybridization of replication products in oat protoplasts. Five micrograms of total RNA isolated from protoplasts was electrophoretically separated on each lane of a 1% agarose gel and blotted to Genescreen (duPont/NEN) nylon membrane for hybridization with the probes indicated at right. After autoradiography, radioactive probe was removed from the blot by boiling for 15 min in O.lxSSC, 0.1% SDS, to allow for hybridization with a different probe. Protoplasts were inoculated with BYDV genomic RNA only (lanes 1-3), both BYDV genomic RNA and sBYDV RNA transcript (lanes 4-6), and sBYDV RNA transcript only (lanes 7-9). Protoplasts were harvested at 5 min (lanes 1, 4, 7), 30 hr (lanes 2, 5, 8) or 72 hr (lanes 3, 6, 9) after electroporation. Lane 10: 0.1 pg BYDV genomic RNA. Lane 11: 0.1 nq (+) sense monomeric sBYDV RNA transcript. Lane 12: 0.1 nq (-) sense sBYDV RNA transcript (including partial cleavage products) obtained by T7 RNA polymerase transcription from Hindlll-linearized pFL-WT. Mobilities of BYDV genomic RNA (G) and monomeric, dimeric and trimeric forms of sBYDV RNA (1, 2, 3) are indicated at left. A. Autoradiograph after probing with an a-[^^P]-labeled (-) sense transcript obtained by transcription of Apal-linearized pML5 with SP6 polymerase. pML5 contains an EcoRV fragment (bases 809-1191, R. Beckett, unpublished data) of the BYDV-RPV genome inserted in the EcRV site of pGEMSZ (Promega). B. After removal of RPV genomic RNA-specific probe, the blot was reprobed with a-[ P]-labeled (-) sense sBYDV RNA transcribed as described above. C. After removal of (-) sense sBYDV RNA probe, the blot was reprobed with a-[ P]-labeled (+) sense sBYDV RNA obtained by transcription as in Fig. 1.

104

Inoculum RNA: BYDV BYDV& sBYDV only sBYDV only

1 2 3 4 5 6 7 8 9 10 11 12 . Probe:

(-) BYDV-RPV RNA I

I

(-) sBYDV transcript

(+)sBYDV transcript

105

RNA in infected plants give high yields of virus (Miller

et al., 1991). Additional controls must be performed to

verify that the decrease in BYDV genomic RNA accumulation in

protoplasts is caused specifically by sBYDV RNA.

Replication of Both Strands of sBYDV RNA by a

Rolling Circle Mechanism

An oligomeric series of monomer through pentamer is

visible for (+) strand sBYDV RNA, and monomer through tetramer

for (-) strands. The higher molecular weight smear of (+)

sense satellite RNA may represent higher order multimers that

cannot be resolved on this gel system which was used to allow

detection of both genomic and satellite RNAs. In both

strands, the amount of multimer decreased with increasing

size. There was no cross-hybridization between satellite and

genomic RNA. (-) sense transcript hybridized weakly with

itself (Fig. 2B, lane 12), but (+) sense transcript did not

self-hybridize (Fig. 2C). Thus, the similarity of the (-)

sense pattern (Fig. 2C) to the (+) sense pattern (Fig. 2C) is

not due to cross-hybridization. The (-) strand pattern

differs from previous studies of satellite and viroid

replicative intermediates in infected plants (Branch et al.,

1982; Hutchins et al., 1985) by the relative ease of detection

and the distinct multimeric series of bands. The difficulty

in detection in previous cases was probably due to the excess

106

of (+) sense satellite RNA in infected tissue and dissociation

of bound, unlabeled RNA from the nylon membrane (Hutchins

et al., 1985). At least two factors may have contributed to

the ease of minus strand detection here. We bound the

extracted RNA to the nylon membrane by the more efficient

method of UV cross-linking rather than baking. Secondly, the

RNA was extracted from protoplasts which give synchronous

infection and vastly higher yields of RNA per weight of tissue

than do whole plants. Finally, the ratio of (+) to (-)

strands of sBYDV RNA may not be as great as with other

satellite RNAs.

The multimeric series of bands suggests that both strands

replicate by a rolling circle mechanism (Branch & Robertson,

1984; Hutchins et al., 1985; Kiefer et al., 1982). By this

symmetrical model of replication, the monomeric (+) sense RNA

circularizes to act as a template for production of multimeric

complementary strands which undergo self-cleavage to form

monomers which then circularize and the cycle is repeated to

produce (+) sense monomers. Although other models are

possible, the evidence with similar satellites such as sTobRV

(Bruening et al., 1991) strongly support this model. Thus

sBYDV RNA resembles sTobRV RNA, sLTSV RNA (Forster & Symons,

1987a), avocado sunblotch viroid (Hutchins et al., 1986) and

carnation stunt associated RNA (Hernandez & Flores, 1992) in

that both strands self-cleave during replication. This

107

contrasts with satellites of VTMoV, SCMoV and SNMV in which

only the (+) strand circularizes and self-cleaves. The (-)

strand forms a linear, multimeric (-)-stranded template for

(+) strand synthesis (Chu, 1983; Davies et al., 1990; Hutchins

et al., 1985) .

This construction of an infectious sBYDV RNA transcript

will allow us to determine its serotype-specificity and effect

on disease symptoms. sBYDV RNA was isolated from a mixture of

Australian PAY and RPV isolates of BYDV and from pure RPV

derived from this mixture (Miller et al., 1991). To determine

which BYDV serotypes are capable of supporting BYDV will

require rigorous separation of viral genomic RNAs, preferably

by construction of full-length clones. It is noteworthy that

the RNA-dependent RNA polymerase of the RPV serotype, but not

the PAV serotype, is related to those of the sobemoviruses

which are known to support similar satellite RNAs (Habili &

Symons, 1989; Vincent, 1991). Thus, helpers capable of

supporting sBYDV RNA replication may be limited to RPV-like

serotypes of BYDV. To study the effect of sBYDV RNA on

disease symptoms will require inoculation of plants with

aphids that acquired satellite-containing virus from

protoplasts (Young, 1991) or by agroinfection (Leiser et al.,

1992). Other satellite-like RNAs are associated with

luteoviruses. The ST9-associated RNA of BWYV may be a large

gene-encoding satellite (Chin et al, 1993), and a satellite

108

RNA has been shown to be associated with ground nut rosette

virus, a non-luteovirus that depends on ground nut rosette

assister luteovirus for transmission and disease (Murant,

1990). However, sBYDV RNA is the first luteovirus-associated

RNA shown to fulfill completely the definition of a satellite.

To understand how a satellite RNA affects symptom development

and how the helper virus and satellite RNA co-exist in vivo

demands defining more clearly the three-way relationship

between the satellite RNA, helper virus and host plant.

109

REFERENCES

Baltenberger, D. E., Ohm, H. W., & Foster, J. E. (1987). Reactions of oat, barley and wheat to infection with barley yellow dwarf virus isolates. Crop Sciences. 27, 195-198.

Branch, A. D., Robertson, H. D. (1984). A replication cycle for viroids and other small infectious RNAs. Science. 223. 450—455.

Branch, A. D., Robertson, H. D., Greer, C., Gegenheimer, P., Peebles, C., Abelson, J. (1982). Cell-free circularization of viroid progeny RNA by an RNA ligase from wheat germ. Science. 217. 1147-1149.

Bruening, G. (1989). Compilation of self-cleaving sequences from plant virus satellite RNAs and other sources. Methods in Enzvmoloav. 180. 546-558.

Bruening, G., Passmore, B. K., Toi, H. v., Buzayan, J. M., & Feldstein, P. A. (1991). Replication of a plant virus satellite RNA: Evidence favors transcription of circular templates of both polarities. Molecular Plant-Microbe Interactions. 4, 219-225.

Buzayan, J. M., Gerlach, W. L., & Bruening, G. (1986). Satellite tobacco ringspot virus RNA: A subset of the RNA sequence is sufficient for autolytic processing. Proceedings of the National Academy of Sciences. USA. 83. 8859-8862.

Chin, L., Foster, J. L., Falk, B. W. (1993). The Beet Western Yellows Virus ST9- Associated RNA shares structural and Nucleotide sequence homology with Carmo-like viruses. Virology. 192. 473-482.

Chu, P. W. G., Francki, R. I. B., Randies, J. W. (1983). Detection, isolation and characterization of high molecular weight double-stranded RNAs in plants infected with velvet tobacco mottle virus. Virology. 126. 480-492.

110

Davles, C., Haseloff, J., & Symons, R. H. (1990). Structure, self-cleavage, and replication of two viroid-like satellite RNAs(virusoids) of subterranean clover mottle virus. Viroloav. 177. 216-224.

Dinesh-Kumar, S. P., Brault, V., & Miller, W. A. (1992). Precise mapping and in vitro translation of a trifunctional subgenomic RNA of barley yellow dwarf virus. Viroloav. 187. 711-722.

Forster, A. C., & Symons, R. H. (1987a). Self-cleavage of plus and minus RNAs of a virusoid and a structural model for the active sites. Cell. 49. 211-220.

Forster, A. C., & Symons, R. H. (1987b). Self-cleavage of virusoid RNA is performed by the proposed 55-nucleotide active site. Cell. 50. 9-16.

Francki, R. I. B. (1985). Plant Virus Satellites. Annual Review of Microbioloav. 39. 151-174.

Gerlach, W. L., Buzayan, J. M., Schneider, I. R., & Bruening, G. (1986). Satellite tobacco ringspot virus RNA: Biological activity of DNA clones and their in vitro transcripts. Viroloav. 151. 172-185.

Habili, N., & Symons, R. H. (1989). Evolutionary relationship between luteoviruses and other RNA plant viruses based on sequence motifs in their putative RNA polymerases and nucleic acid helicases. Nucleic Acids Research. 17, 9543-9555.

Hampel, A., Tritz, R., Hicks, M., Cruz, P. (1990). Hairpin catalytic RNA model: Evidence for helices and sequence requirement for substrate RNA. Nucleic Acids Research. 18, 299-304.

Herlitze, S., Koenen, M. (1990). A general and rapid mutagenesis method using polymerase chain reaction. Gene. 91/ 143-147.

Hernandez, C., & Flores, R. (1992). Plus and minus RNAs of peach latent mosaic viroid self-cleave in vitro via hammerhead structures. Proceedings of the National Academy of Sciences. USA. 89. 3711-3715.

Ill

Hutchins, C. J., Keese, P., Visvader, J. E., Rathjen, P. D., Mclnnes, J. L., & Symons, R. H. (1985). Comparison of multimeric plus and minus forms of viroids and virusoids. Plant Molecular Biology. 4, 293-304.

Hutchins, C. J., Rathjen, P. D., Forster, A. C., & Symons, R. H. (1986). Self-cleavage of plus and minus RNA transcripts of avocado sunblotch viroid. Nucleic Acids Research. 14. 3627-3641.

Keese, P., Symons, R. H. (1987). The structure of viroids and virusoids. Boca Raton: CRC Press.

Kiefer, M. C., Daubert, S. D., Schneider, I. R., Bruening, G. (1982). Multimeric forms of satellite tobacco ringspot virus RNA. Virology. 137. 371-381.

Kunkel, T. A., Roberts, J. D., Zakour, R. A. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods In Enzvmology. 154. 367-382.

Leiser, R. M., Ziegler-Graff, V., Reutenauer, A., Herrbach, E., Lemaire, O., Guilley, H., Richards, K., Jonard, G. (1992). Agroinfection as an alternative to insects for infecting plants with beet western yellows luteovirus. Proceedings of the National Academy of Sciences. 89. 9136-9140.

Miller, W. A., Hercus, T., Waterhouse, P. M., & Gerlach, W. L. (1991). A satellite RNA of barley yellow dwarf virus contains a novel hammerhead structure in the self-cleavage domain. Virology. 183. 711-720.

Murant, A. F. (1990). Dependence of groundnut rosette virus on its satellite RNA as well as on groundnut rosette assister luteovirus for transmission by Aphis craccivora. Journal of General Virology. 71, 2163-2166.

Oswald, J. W., Houston, B. R. (1951). A new virus disease of cereals, transmissible by aphids. Plant Disease Reporter. 35, 471-475.

Prody, G. A., Bakos, J. M., Buzayan, J. M., & Schneider, I. R., Bruening, G. (1986). Autolytic processing of dimeric plant virus satellite RNA. Science. 231. 1577-1580.

Roossinck, M. J., Sleat, D., & Palukitis, P. (1992). Satellite RNAs of plant viruses; Structures and biological effects. Microbiological Reviews. 56. 265-279.

112

Ruffner, D. E., Stormo, G. D., & Uhlenbeck, O. C. (1990). Sequence requirements of the hammerhead RNA self-cleavage reaction. Biochemistry. 29. 10695-10702.

Sambrook, J., Fritsch, E. F., Maniatis, T. (1989). Molecular cloning: A laboratory manual (2nd ed.). Cold Spring Harbor: Cold Spring Laboratory Press.

Sheldon, C. C., & Symons, R. H. (1989). Mutagenesis analysis of a self-cleaving RNA. Nucleic Acids Research. 17. 5679-5685.

Vincent, J. R., Lister, R. M., Larkins, B. A. (1991). Nucleotide sequence analysis and genomic organization of the NY-RPV isolate of barley yellow dwarf virus. Journal of General Virology. 72. 2347-2355.

Waterhouse, P. M., Gerlach, W. L., Miller, W. A. (1986). Serotype-specific and general luteovirus probes from cloned cDNA sequences of barley yellow dwarf virus. Journal of Virology. §!_, 1273-1281.

Waterworth, H. E., Kaper, J. M., & Tousignant, M. E. (1979). CARNA5, the small cucumber mosaic virus-dependent replicating RNA, regulates disease expression. Science. 204. 845-847.

Young, M. J., Kelly, L., Larkin, P. J., Waterhouse, P. M., Gerlach, W. L. (1991). Infectious in vitro transcripts from a cloned cDNA of barley yellow dwarf virus. Virology. 180. 372-379.

113

BIMOLECULAR CLEAVAGE REACTION AND THE DESIGN OF TARGET-SPECIFIC RIBOZYMES

114

Biitiolecular cleavage reaction and the design of target specific ribozymes

Silver, S.L., M.S.

Miller, VI.A., Ph.D.

Department of Plant Pathology, Iowa State University, Ames 50011

115

INTRODUCTION

The first successful demonstration of a bimolecular

reaction involving an autocatalytic RNA was the ribozyme L-19

IVS derived from the pre-rRNA of T. thermophilia (Zaug et al.,

1986). As an endoribonuclease the L-19 IVS was directed

against a specific site within the a-globin mRNA (Zaug et al.,

1986). With a length of nearly 400 nts, the L-19 IVS RNA may

undergo changes in conformation resulting in formation of

inactive ribozyme structures in vivo. Additionally, the

kinetics of L-19 IVS RNA is characterized by Briggs-Haldane

kinetics, in which high affinity binding to the substrate and

the subsequent slow release of product is observed. The end

result is the propensity of the ribozyme to bind both

incorrect and correct substrate molecules equally well;

thereby cleaving a higher percentage of incorrect RNA

molecules (Herschlag, 1991). For these reasons, the potential

usefulness of the L-19 IVS ribozyme in vivo may be limited.

Uhlenbeck (1987) has suggested using the hammerhead

catalytic domain as a ribozyme since it is composed of only 50

nucleotides (Forster & Symons, 1987) which reduces the risk of

inactive ribozyme formation in vivo. In addition, the

116

hammerhead ribozyme is expected to cleave with Michaelis-

Menten kinetics; unlike the L-19 TVS ribozyme.

Uhlenbeck (1987), using the hammerhead of ASBV, dissected

the enzyme and substrate components into two separate

molecules (Fig lA). The substrate RNA contained a three-base

loop that connected the conserved nucleotides GAAA and U of

the hammerhead. The ribozyme component contained the

remaining conserved hammerhead nucleotides. After the

substrate and ribozyme RNAs were transcribed and annealed in

the presence of Mg^^, significant cleavage of the substrate RNA

into two fragments was observed (Uhlenbeck, 1987). The RNA

enzyme demonstrated turnover capability without undergoing

modification and thus was truly catalytic. This observation

was a significant development in the use of gene-targeted

ribozymes; since, now an RNA could potentially inactivate, not

only one copy of an RNA as in the case of an antisense

molecule, but several. Many examples of hammerheads now exist

that demonstrate bimolecular cleavage capability (Gerlach

et al., 1987; Jeffries & Symons, 1989; Koizumi et al., 1988).

In 1988 a more general acting hammerhead-derived ribozyme

was proposed which required the substrate RNA to contain only

the conserved U located one base upstream of the cleavage site

(Haseloff & Gerlach, 1988) (Fig IB). Since the catalytic

domain contained the majority of conserved nucleotides, almost

any substrate RNA could theoretically be targeted for

117

A. C C G A-U C-G /

Substrate^yi^-f^ ̂ pppQCQÇÇ® yÇÇAQÇoH hoCGCGG^ çAGCUCQGppp

Ribozyme

B.

5' Substrate f

xxxxxxyyyyyy xxxxxx

Glgcjyyyyy^xxxxxx DTMXXXXXX

II

III

lA A-U G-C

G U

II

Ribozyme

Figure 1. (A) Division of the ASBV hammerhead into substrate and catalytic domains. Conserved bases of hammerhead are in bold and italics. Arrow indicates cleavage site (Uhlenbeck, 1987) . (B) Gene-targeted ribozyme as proposed by Haseloff and Gerlach (1988). (I) indicates the one conserved nucleotide in the substrate RNA. (II) identifies the target arms which give specificity to the ribozyme. (Ill) is the catalytic domain of the ribozyme. Arrow indicates cleavage site (Haseloff & Gerlach, 1988).

118

cleavage. This ribozyme was constructed using 10 conserved

nucleotides of sToBRV (+) RNA connected by a 4 basepair helix

and a tetraloop. It was designed with "arms" that would base-

pair to the bacterial chloramphenical acetyl-transferase (CAT)

mRNA which included the U of the target. The CAT transcript

and ribozyme were incubated and significant cleavage of the

RNA was observed (Haseloff & Gerlach, 1988). Since the first

demonstration of a hammerhead-type ribozyme cleaving an

unrelated substrate RNA, other target-specific ribozymes have

been constructed (for review see Symons, 1991).

When designing gene-targeted ribozymes it is imperative

to consider the reaction pathway proposed for the

intermolecular cleavage reaction (Fedor & Uhlenbeck, 1992;

Fig. 2). The formation and dissociation of the enzyme-

substrate complex (E-S) is defined by the rate constants

and k.i respectively. The actual cleavage reaction is defined

by kgand dissociation of products from the ribozyme is defined

by kg and k^. Three main parameters must be

E-P2+P1

E + 8 E^ ̂ E-P1-P2 E+P1+P2

E-P1+P2

Figure 2. Proposed reaction pathway for bimolecular cleavage (Fedor & Uhlenbeck, 1992)

119

considered during ribozyme design. The first involves

selecting a ribozyme that has minimal sequence requirements.

As mentioned previously, the hammerhead catalytic domain is

excellent in this regard. The ribozyme described by Haseloff

and Gerlach (1988) has only 22 nts that are involved directly

in catalysis. Further deletions within the ribozyme, i.e.,

the short stem-loop connecting the two regions of conserved

bases in the ribozyme only decreases the cleavage rate (McCall

et al., 1992). Therefore, the 22 nt long sequence is likely

the shortest catalytic domain still capable of cleavage.

Secondly, alternative conformations within the target sequence

can pose significant difficulties for E-S formation. For

instance, some hammerhead ribozymes with a slow rate of

product formation have a low binding affinity for the

substrate RNA (Fedor & Uhlenbeck, 1992; Xing & Whitton, 1993).

It is believed this observation is the result of an

alternative secondary structure at the cleavage site.

Identification of target sites with a significant likelihood

of forming secondary structures can be accomplished using RNA

structure analysis software. A more time-consuming method by

which to find RNA secondary structures involves structure-

sensitive nucleases and chemical modification analysis.

The last consideration when designing a ribozyme is the

length and composition of the target arms. Changes in either

parameter result in dramatic effects on the rates of substrate

120

dissociation (k.j) and product release (kg and k^) (Fedor &

Uhlenbeck, 1992). By increasing the length of the target

arms, a corresponding increase in the stability of the E-S

complex occurs. A more stable E-S leads to a higher number of

incorrect RNAs binding to the ribozyme (lowered discrimination

index), because a few mismatches between ribozyme and target

will be tolerated and subsequently the cleavage of more

incorrect RNA molecules (Herschlag, 1991). Since the rate of

dissociation of small RNA duplexes is dependent on the length

and composition of the RNA (Tinoco, 1982), the rate of product

dissociation of the hammerhead ribozyme also depends directly

on the length and sequence of the target arms. This is a

major dilemma since both E-S complex formation and product

dissociation are dependent on the same parameters. This

dilemma is evident from mutagenic analysis of the target arms.

Base changes that increase kg and k^ also leads to an increase

in k.i. Haldane (1930) argued that instability of the E-S

complex is in fact the result of a lowering of the activation

energy between the E-S and E-P during enzyme catalysis.

Instability of the E-S complex is beneficial when attempting

to lower the activation energy. However, the E-S complex must

be sufficiently stable to allow cleavage. When designing a

ribozyme, therefore, the target arms must be long enough to

form a stable E-S complex but not so long as to lower the

121

discrimination index of the ribozyme or inhibit the release of

products from the ribozyme.

Presently, the optimal length and composition of the

target arms that results in the most efficient cleavage of a

substrate RNA in vivo is not known. However, many ribozymes

that cleave their substrate RNA efficiently have been

constructed. One of the best characterized ribozymes cleaves

c-fos mRNA (Scanlon et al., 1991). The ribozyme was shown to

significantly decrease the level of several proteins whose

translation is regulated by the c-fos mRNA product, whereas an

inactive form of the ribozyme had no influence on c-fos

regulated proteins. The accumulation of c-fos mRNA cleavage

products in vivo, however, was not determined. Therefore, as

is typical for most in vivo ribozyme studies, it is unclear

whether the ribozyme acts as a catalytic entity or simply as a

better antisense molecule than the inactive, mutated ribozyme.

To ascertain the efficacy of target-specific ribozymes, it is

imperative that the experimental approach allows one to

distinguish between cleavage of the target and mere antisense

inhibition.

In the present work, we dissect the sBYDV RNA hammerhead

into separate ribozyme and substrate transcripts and

demonstrate that a wildtype and a mutant catalytic domain have

the ability to associate with the substrate RNA in a manner

consistent with hammerhead formation. We also show that a

122

ribozyme targeted against the 5' end of BYDV-PAV is able to

specifically cleave a portion of the viral genomic RNA in

vitro.

123

MATERIAL AND METHODS

construction of Ribozymes

B19 and B5/19 ribozymes

To test whether the sBYDV RNA hammerhead can function in

an intermolecular fashion, the catalytic and substrate domains

of the (+) hammerhead were separated by placing bases 310 to

10 on one transcript (substrate) and bases 10 through 89 on a

second transcript (ribozyme). The first bimolecular enzyme

(B19) was constructed by cutting pSSM19 (Miller & Silver,

1991) and pGEM3Z (Promega, Madison, WI) with Sad and Drall.

The 2357 basepair (bp) vector fragment from the pSSM19

digestion was ligated to the 898 bp fragment from the pGEM3Z

digestion. The second bimolecular enzyme, 35/19 was

constructed from the clone pSSM5 (Miller & Silver, 1991).

SSM5 contains a 34 base deletion of nucleotides 30 to 63. The

M19 mutation containing the Sad site was introduced by site-

directed mutagenesis of pSSMS with the primer 5'

AGACAGTACGAGCTCTGTTATC 3' using the method of Kunkel et al.,

(1987). The resulting mutant pSSM5/19 (Fig. 3B) was divided

into catalytic and substrate domain as described above.

124

A. Substrate .310 MO

AUUUC aiOQA r BiBiBi^ùàÀÀàcËÀMÙ •••uj.MJiiii.w.ijaa tr

Ribozyme

"uqqu

B. Substrate

**^^UUUC (HJCKÏA^ACAQ'P®" 3' UauCAUGCU

TOU-A

3'

CGûGCt M lAAGCGG

Ribozyme

Figure 3. Bimolecular hammerhead formation of sBYDV (+) strand RNA. Boxed bases are conserved among all hammerheads.Numbering of nucleotides is based on the full-length satellite RNA. Cleavage sites indicated by an arrow. (A) B 19 and substrate RNA cleavage structure. (B) B 5/19 and substrate RNA cleavage structure.

125

Gene-targeted ribozymes

Sites within the BYDV genomic RNA containing the sequence

AUA were targeted for cleavage using the catalytic domain of

the sBYDV RNA (+) strand hammerhead. The ribozymes were

constructed by annealing complementary oligomers encoding the

ribozyme sequence to obtain a double stranded fragment with

sticky ends. The fragment was cloned into the transcription

vector pGEM3Z. Oligomers were synthesized using /3-

cyanoethylphosphoramidite chemistry (Nucleic Acids Facility,

Iowa State University). The subgenomic (SUBI) and upstream

(UPl) ribozymes (see below for specific target sites) were

cloned using the oligomers in Figure 4. Prior to cloning, the

oligomers were phosphorylated with T4 kinase. The oligomers

were annealed using a standard annealing buffer (40 mM Tris-

HCl, pH 7.4, and 4 mM MgClg) and approximately 1 /xg of each

oligomer (Ausubel et al., 1989). The annealing reaction was

heated to 95° C for 1 min followed by slow cooling to 22° C.

The annealed oligomers were ligated into BamHI-PstI digested

pGEM3Z. Successful transformation of E. coli (strain DH5aF')

with these ligation mixes required serial dilutions of the

ligation reaction; since high levels of DNA have been

implicated in decreased transformation efficiency.

126

Subgenomic Ribozyme Oligomers BarnH Prt

5' QArcCATACTAACCTQ(TA)CQACQTATCAATAQATACAaAAATAAACCCTATCCrGC/* 3' 3' 0TAT<SATTQQAC(AT)QCTQCATAQTTATCTATQTCTTTATTTQGQ^TA3 5'

Upstream Ribozyme Oligomers BwnH Pit)

5' QArCCTTGCTTTAQACTQ(TA)CQACQTATCAATAQATACAQAAATQTnTACTCTQCA 3' 3' GAACQAAATCTQAC(A'T7QCTQCATAGtrTATCTATQTCTTTACAAAATCWa 5'

Ribozyme 175 oligomer 3' ATATCACTCABCATAAT 5'

5' TAAAQCQQTTTCQTCCTCACQQACTCATCAQAAAQACTTCCTATAQTQAQTCQTATTA 3'

Figure 4. Oligonucleotides used in cloning the gene-targeted ribozymes or in the oligo-directed transcription of Rz 175. Bases involved in restriction enzyme sites are in italics. Bases in bold are the ribozyme target arms. Nucleotides in bold and underlined make up the T7 RNA polymerase promoter. Sequences involved in the catalytic domain of the ribozyme are boxed.

In Vitro Transcription and Cleavage Assays

B19 and B5/19 ribozymes

Transcripts of the bimolecular enzymes were synthesized

by digesting pB19 and pB5/19 with Hind III, extracting with

phenol/chloroform and ethanol precipitating for 3 0 min at

-80° C. The linearized DNA was resuspended in 0.1%

diethylpyrocarbonate (DEPC)-treated water and quantified by

determining the O.D.260nm* A typical ICQ nl transcription

127

reaction contained transcription buffer (40 mM Tris-HCl, pH

8.0, 6 mM MgClg, 5 mM DTT, 1 mM spermidine), 0.5-1.0 mM NTP,

100 units of RNasin, 10 jug of linearized template and 150

units of T7 RNA polymerase. The reaction was incubated at 37°

C for 1-3 hours. For a-[®^P]-labeled transcripts, 50 nCi of a-

[®^P]GTP (NEN/duPont) was added to the reaction. Substrate RNA

was transcribed from Sacl-linearized pSSM19 (Miller & Silver,

1991). Each RNA was run on a 6% polyacrylamide gel containing

7 M urea and full-length substrate and ribozyme molecules were

purified by excising the radioactive bands and eluting the RNA

from the gel by constant shaking in elution buffer (0.5 M

ammonium acetate, 1 mM EDTA, pH 8.0, and 0.1% SDS; Sambrook et

al., 1989). Radioactivity was determined by liquid

scintillation counting. Cleavage assays were performed as

described previously (see Material and Methods, Section I).

Gene-targeted ribozymes

Ribozymes UPl and SUBI were transcribed from Pst I-

linearized duplex DNA using T7 RNA polymerase. Full-length

ribozyme transcripts were gel-purified as above. Ribozyme 175

(Rz 175) was transcribed directly from an oligomer containing

the complement of the T7 RNA polymerase promoter (Fig. 4)

according to the method of Milligan and Uhlenbeck (1989). The

17-mer containing the T7 RNA polymerase promoter was combined

in an equal molar ratio with the synthetic template containing

the ribozyme and the complement of the T7 RNA polymerase

128

promoter (Fig. 4). Annealing of the two oligomers was

performed by heating to 95° C in Tris, pH 7.5, and 10 mM MgClg

followed by quick cooling to room temperature. The resulting

partially double-stranded oligomer was directly used for

transcription of Rzl75.

UPl substrate RNA was transcribed from EcoRI-linearized

pPA142 (Miller et al., 1988) and SUBI substrate was

transcribed from EcoRl-digested pSP-17 (Dinesh-Kumar et al.,

1992) . Substrate RNA for Rzl75 was transcribed from EcoRV-

digested pPAV-6 (Dinesh-Kumar et al., 1992). All substrates

were internally labeled using a-[®^P]-GTP and gel-purified from

a 6% polyacrylamide gel as described previously.

129

RESULTS AND DISCUSSION

Bimolecular Cleavage

The efficiency of the sBYDV (+) RNA hammerhead in a

bimolecular cleavage reaction was determined by dividing the

catalytic and substrate domains of pSS19 and pSSM5 into

separate transcripts (Fig. 3A & B). The cleavage assay

contained either B5/19 or B19 and a 5-fold molar excess of

substrate RNA. After incubating the ribozyme and substrate

for 1 hour at 3 0° C in 10 mM MgClg, the cleavage products were

separated on a 10% polyacrylamide gel containing 7 M urea

followed by quantification of fragments by phosphoryimage

analysis (Molecular Dynamics). B19 converted 4% of the

substrate into the expected 18 base and 8 base products

(Fig. 5). Incubation of B5/19 and S19 resulted in cleavage of

nearly 38% of the substrate RNA into products. Incubation of

the substrate and B5/19 transcripts at either 37° C or 45° C

resulted in approximately 65% of the substrate RNA being

converted into products (Fig. 6) .

The B5/19 cleavage rate is similar to other bimolecular

reactions that use the hammerhead catalytic domain of the

satellite RNA of tobacco ringspot virus (sToBRV RNA) (Haseloff

& Gerlach, 1988) and avocado sunblotch viroid (ASBVd)

(Uhlenbeck, 1987). The only sequence difference between B19

130

30°C 37t 45°C

z i A z i £ z o

A + o

Ë + o

(n A (0 (0 Ë CO (0 i!

#

3' PRODUCT

Figure 5. Bimolecular cleavage by ribozyme B19. Autoradiograph of transcripts subjected to denaturing polyacrylamide gel electrophoresis after incubation in cleavage conditions for 1 hour at 30| C. Mobilities of full-length substrate (S) and 5' and 3' products are indicated. Abbreviations: Rz, ribozyme; S, substrate.

131

m #

^ 3' PRODUCT

5' PRODUCT

Figure 6. Bimolecular cleavage by ribozyme B5/19. Autoradiograph of transcripts subjected to denaturing polyacrylamide gel electrophoresis after incubation in cleavage conditions for 1 hour at temperatures indicated. Mobilities of full-length (S) and 5' and 3' products are indicated. Abbreviations: Rz, ribozyme; S, substrate.

132

and B5/19 is the 34 base deletion in B5/19 (Fig. 3).

Secondary structure comparison of each ribozyme/substrate pair

using the software MFOLD and PLOTFOLD in the GCG package

(Zuker, 1989) revealed no significant alternative conformation

that could account for the poor cleavage efficiency of B19. A

significant difference, however, was observed in the

calculated -AG values of the two ribozyme/substrate complexes.

B19 forms a more stable hammerhead than does B5/19. According

to Fedor and Uhlenbeck (1992), increasing the stability of a

hammerhead above an optimal point could potentially cause an

actual decline in the rate of product release. The -AG of the

B19-S19 complex is -26.9 whereas the -AG of the B 5/19-S19

complex is significantly more positive with a value of -20.4.

Further deletions and base changes in the catalytic domain

along with nuclease probing experiments will be required to

fully characterize the chemistry of enzyme association and

product release.

Gene Targeted Ribozymes

Ribozymes designed to down-regulate a particular gene

have met with some success in vivo (for review see Gotten &

Birnstiel, 1989; Scanlon et al., 1991/ Symons, 1991; Xing &

Whitton, 1993). Thus we attempted to define ribozyme target

sites within the genome of BYDV-PAV. The first ribozyme

tested, UPl, was directed at a sequence in BYDV-PAV spanning

133

the nucleotides 1018 to 1039 of the 39K open reading frame

(ORF) (Fig. 7). UPl resulted in no detectable cleavage after

1 hour at 37° C (data not shown) . The second ribozyme tested

against the BYDV genome was SUBI. This ribozyme anneals at a

site extending over nucleotides 2769 to 2789. 2769 is the

exact start of subgenomic RNA 1 formed during BYDV infection

(Fig. 7) (Dinesh-Kumar et al., 1992). Similar to the UPl

ribozyme, SUBI resulted in no significant cleavage of BYDV

genomic RNA.

A survey of the UPl target sequence using the program,

RNASE did not reveal any obvious secondary structures within

the target site. Upon further analysis using GCG-MFOLD

(Zuker, 1989), the 3' end of the target sequence demonstrated

the potential to form duplex DNA that may interfere with

association of the ribozyme to the cleavage site sufficiently

to inhibit cleavage of the target sequence. A search of the

SUBI target sequence using nuclease probing analysis revealed

a significant conformation within the subgenomic promoter

sequence (Dinesh-Kumar et al., 1992) (Fig. 8). The target

sequence is bounded by the two arrows (Fig. 8) and forms a

stem-loop structure that clearly would inhibit the annealing

of ribozyme and substrate.

After the failure of two ribozyme constructs to cleave

genomic BYDV RNA in vitro, the third ribozyme we tested used

the catalytically-important nts from the sToBRV hammerhead.

134

5 '

Readthrough Frameshift

60K(POL) 1 mm

CP 22K (t7K

f Leaky Scanning

• 6.7K

3 '

Subitrat*

®A g®Aa®

y^A RJbozynw qIC

A A UA

ButwtrMi i s'aAUfOGajuuAmauuMUAi s-

M Rixsyini Q-C

A A UA

•

RbozytiM A a Q U

Figure 7. Sequences targeted for ribozyme-mediated cleavage. (A) Genome organization of BYDV-PAV. (B) For each ribozyme, the catalytic domain and the target site are given. Arrows indicate the cleavage site.

135

G G®°

A A U-G C-G A-U C-G C-G

A-U

u% ^ « G A90 CP ORF start

U-A^O y y C^

'°UU.A a'=AAU4°AGUU-AU

\ U-G G-C

;....G^"'-'AC»UUAGCUc'ty CAAAUCAAAAUGGC A... 3' ' 130

17K ORF Start

Figure 8. Proposed secondary structure of the subgenomic promoter sequence of BYDV-PAV. Arrows indicate start and end points of Rz-175 target site (Dinesh-Kumar et al., 1992).

136

With the sToBRV-derived ribozyme, the 5' side of the cleavage

site must now have a GUC trinucleotide instead of the AUA

trinucleotide. The target site in BYDV genome was chosen

after extensively searching the entire BYDV genome for a

cleavage site that had little opportunity for secondary

structure formation. A 5' end sequence was selected because

cleavage here should inhibit an early step in virus

replication. The cleavage assay contained 3 0 nM ribozyme and

100 nM substrate RNA. Approximately 25% of the substrate RNA

was converted into product after 180 min incubation in

standard cleavage conditions at 37° C (Fig. 9).

Future attempts to designing target-specific ribozymes

against BYDV genomic RNA will involve the careful selection of

numerous sites within the genomic RNA that do not form

predicted stable secondary structures. Nuclease probing

experiments along with determining the cleavage efficiency of

ribozymes at many sites within the BYDV RNA will give insight

into avoiding ribozyme inactivity due to alternative

conformations. In addition, the smallest, most efficient

ribozyme will need to be designed. This will entail

determining what role(s) the conserved and non-conserved bases

serve in the cleavage reaction and how changes within these

bases change the dynamics of hammerhead formation and product

dissociation.

137

SUBSTRATE

5' PRODUCT

3' PRODUCT

Figure 9. Rz-175 cleavage assay. Autoradiograph of transcripts after incubation for indicated times. Mobilities of full-length substrate (5' 258 bases of BYDV-PAV) and 5' and 3' products are given.

138

REFERENCES

Gotten, M., & Birnstiel, M. L. (1989). Ribozyme mediated destruction of RNA in vivo. The EMBO Journal. 8, 3861-3866.

Dinesh-Kumar, S. P., Brault, V., & Miller, W. A. (1992). Precise mapping and in vitro translation of a trifunctional subgenomic RNA of barley yellow dwarf virus. Virology. 187. 711-722.

Fedor, M. J., & Uhlenbeck, O. C. (1992). Kinetics of intermolecular cleavage by hammerhead ribozymes. Biochemistrv. 31. 12042-12054.

Forster, A. C., & Symons, R. H. (1987). Self-cleavage of virusoid RNA is performed by the proposed 55-nucleotide active site. Cell. 50. 9-16.

Gerlach, W. L., Llewellyn, D., & Haseloff, J. (1987). Construction of a plant disease resistance gene from the satellite RNA of tobacco ringspot virus. Nature. 328. 802-805.

Haldane, J. B. S. (1930) . Enzymes. London: Longmans.

Haseloff, J., & Gerlach, W. L. (1988). Simple RNA enzymes with new and highly specific endoribonuclease activities. Nature. 334. 585-591.

Herschlag, D. (1991). Implications of ribozyme kinetics for targeting the cleavage of specific RNA molecules in vivo: more isn't always better. Proceedings of the National Academy of Sciences. USA. 88. 6921-6925.

Jeffries, A. J., & Symons, R. H. (1989). A catalytic 13-mer ribozyme. Nucleic Acids Research. 17. 1371-1377.

Koizumi, M., Iwai, S., & Ohtsuka, E. (1988). Construction of a series of several self-cleaving RNA duplexes using synthetic 21-mers. FEB. 228. 228-230.

139

Kunkel, T. A., Roberts, J. D., & Zakour, R. A. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods In Enzvmoloav. 154. 367-382.

McCall, M. J., Hendry, P., & Jennings, P. A. (1992). Minimal sequence requirements for ribozyme activity. Proceedings of the National Academy of Sciences. 89. 5710-5714.

Miller, W. A., & Silver, S. L. (1991). Alternative tertiary structure attenuates self-cleavage of the ribozyme in the satellite RNA of barley yellow dwarf virus. Nucleic Acids Research. 19, 513-520.

Miller, W. A., Waterhouse, P. M., & Gerlach, W. L. (1988). Sequence and organization of barley yellow dwarf virus genomic RNA. Nucleic Acids Research. 16, 6097-6111.

Milligan, J. F., & Uhlenbeck, O. C. (1989). Synthesis of small RNAs using T7 RNA polymerase. Methods in Enzvmoloav. 180. 51-62.

Sambrook, J., Fritsch, E. F., & Maniatis, T. (1989). Molecular cloning; A laboratory manual (2nd ed.). Cold Spring Harbor: Cold Spring Laboratory Press.

Scanlon, K. J., Jiao, L., Funato, T., Wang, W., Tone, T., Rossi, J. J., & Kashani-Sabet, M. (1991). Ribozyme-mediated cleavage of c-fos mRNA reduces gene expression of DNA synthesis enzymes and metallothionein. Proceedings of the National Academy of Sciences. USA. 88, 10591-10595.

Symons, R. H. (1991). Ribozymes. Critical Reviews in Plant Sciences. 10. 189-234.

Uhlenbeck, O. C. (1987). A small catalytic oligoribonucleotide. Nature. 328. 596-600.

Xing, Z., & Whitton, L. (1993). An anti-lymphocytic choriomeningitis virus ribozyme expressed in tissue culture cells diminishes viral RNA levels and leads to a reduction in infectious virus yield. Journal of Virology. 67. 1840-1847.

Zaug, A. J., Been, M. D., & Cech, T. R. (1986). Tetrahymena ribozyme acts like an RNA restriction enzyme. Nature. 324. 429-433.

Zuker, M. (1989). On finding all suboptimal foldings of an RNA molecule. Science. 244. 48-52.

140

GENERAL SUMMARY

Barley yellow dwarf virus (BYDV) is the most widespread

and destructive plant virus disease of small grain cereals

(Plumb, 1983). Significant grain yield losses due to BYDV

have been observed in both deliberate and natural infections

(Yamani & Hill, 1991). Several methods have been employed to

control BYDV infestations. For example, (i) monitoring of

aphid populations to determine the best time for planting or

for application of insecticides, (ii) use of an aphid parasite

to decrease the aphid population, and (iii) breeding for

resistance cultivars using the Yd2 gene from Ethiopian barley,

have all been used in the past with varying degrees of

success. Less classical approaches to disease management have

also been implemented to control virus infestations.

Mechanisms such as coat protein-mediated resistance and the

use of satellite RNAs have been used with other plant viruses.

Since no one control strategy can be or has been proven

completely effective in eliminating yield losses due to BYDV,

it is necessary to further characterize BYDV and the recently

discovered satellite of BYDV with respect to pathogenesis.

This study was limited to the analysis of the self-cleavage

site within sBYDV (+) RNA, synthesis, initial characterization

141

of a full-length infectious sBYDV clone, and the design and

testing of target-specific ribozymes against BYDV genomic RNA.

In PAPER I and II, we attempted to further characterize

the hammerhead structure that is believed to be required for

self-cleavage of sBYDV (+) RNA. In addition to having the 11

conserved nts found in all hammerheads, the (+) strand

cleavage site of sBYDV has several novel features. First, the

trinucleotide at the 5' side of the cleavage site is AUA,

rather than the usual GUC. Second, two unpaired bases C-24

and A-73 are located at the top of stem II. Only one other

self-cleaving RNA has bases analogous to C-24 and A-73.

Finally, an additional helix not accounted for in the

hammerhead motif may form within the cleavage domain of sBYDV

(+) RNA. From site-directed mutagenesis and structure

sensitive probing of a less-than-full-length sBYDV RNA

transcript, we demonstrated that the alternative structure

does form and results in a very inefficient cleavage reaction.

These data are consistent with the proposal (Fedor &

Uhlenbeck, 1992) that all bases in and near the cleavage site

affect the rate of cleavage. Deletion of both of the

unpaired, nonconserved nts C-24 and A-73 had a positive

influence on the cleavage rate. This further underscores the

importance of many bases in the hammerhead in cleavage.

PAPER III involved the cloning of a full-length,

infectious sBYDV. Initial characterization of the construct

142

proved the small RNA found associated with BYDV-RPV is indeed

a true satellite RNA. Furthermore, preliminary results

suggest that the presence of the sBYDV with BYDV inhibits the

replication of the helper virus. More rigorous testing of

this observation should indicate whether this inhibition is

valid or due to experimental variation.

PAPER IV involved the use of the hammerhead motif of

sBYDV (+) RNA for the design of a target-specific ribozyme

against BYDV genomic RNA. Although we observed cleavage of

BYDV RNA in vitro, cleavage of BYDV RNA in vivo will be more

difficult to obtain. Such inhibitory effects as inability of

the ribozyme to find and anneal to the target RNA, slow rates

of product dissociation and less than optimal

concentrations within the cell will most probably decrease

cleavage efficacy and thus several additional ribozyme

constructs will need to be tested.

To effectively control yield losses imposed by BYDV

infestations, a better understanding of how BYDV and sBYDV

affect pathogenesis is mandatory. With full-length infectious

clones of the sBYDV and helper virus, questions concerning the

relationships between satellite RNAs, different helper virus

serotypes, host plant species, and environment can now be

addressed.

143

LITERATURE CITED

Altmann, S. (1987). Ribonuclease P: An enzyme with a catalytic RNA subunit. Advances in Enzvmoloav. 62. 1-36.

Baer, M. F., Arnez, J. G., Guerrier-Takada, C., Vioque, A., & Altmann, S. (1990). Preparation and characterization of RNase P from E. coli. Methods in Enzvmoloav. 181. 569-582.

Been, M. D., & Cech, T. R. (1986). Sequence specificity of Tetrahymena pre-rRNA self-splicing, trans-splicing and RNA enzyme activity. Cell. 47. 207-216.

Been, M. D., Prrotta, A. T., & Rosenstein, S. P. (1992). Secondary structure of the self-cleaving RNA of Hepatitis delta virus; Applications to catalytic RNA design. Biochemistry. 31. 11843-11852.

Branch, A. D., & Robertson, H. D. (1984). A replication cycle for viroids and other small infectious RNAs. Science. 223. 450-455.

Brault, v., & Miller, W. A. (1992). Translational frameshifting mediated by a viral sequence in plant cells. Proceedings of the National Academy of Sciences. 89. 2262 -2266 .

Bruening, G. (1989). Compilation of self-cleaving sequences from plant virus satellite RNAs and other sources. Methods in Enzvmoloav. 180. 546-558.

Burgin, A. B., & Pace, N. R. (1990). Mapping of the active site of ribonuclease P RNA using a subunit containing a photoaffinity agent. EMBO J.. £, 4111-4115.

Cech, T. R., Zaug, A. J., Grabowski, P. J. (1981). In vitro splicing of the ribosomal RNA precursor of Tetrahymena: Involvement of a guanosine nucleotide in the excision of the intervening sequence. Cell. 27. 487-490.

Cech, T. R. (1990). Self-splicing of group I introns. Annual Review of Biochemistry. 59. 543-568.

144

Gotten, M., Schaffner, G., & Birnstiel, M. L. (1989). Ribozyme, antisense RNA, and antisense DNA inhibition of U7 small nuclear ribonucleoprotein-mediated histone pre-mRNA processing in vitro. Molecular and Cellular Bioloav. 9, 4479-4487.

Dahm, S. C., & Uhlenbeck, O. C. (1991). Role of divalent metal ions in the hammerhead RNA cleavage reaction. Biochemistrv. 30. 9464-9469.

Davies, C., Haseloff, J., & Symons, R. H. (1990). Structure, self-cleavage, and replication of two viroid-like satellite RNAs (virusoids) of subterranean clover mottle virus. Viroloav. 177. 216-224.

Davies, R. W., Waring, R. B., Ray, J. A., Brown, T. A., & Scazzocchio, C. (1982). Making ends meet: A model for RNA splicing in fungal mitochondria. Nature. 300. 719-724.

Dinesh-Kumar, S. P., Brault, V., & Miller, W. A. (1992). Precise mapping and in vitro translation of a trifunctional subgenomic RNA of barley yellow dwarf virus. Viroloav. 187. 711-722.

Ehrenmann, K., Schroeder, R., Chandry, P. S., Hall, D. H., & Belfort, M. (1989). Sequence specificity of the P6 pairing for splicing of the group I td intron of phage T4. Nucleic Acids Research. 17, 9147-9163.

Epstein, L. M., & Gall, J. G. (1987). Self-cleaving transcripts of satellite DNA from the newt. Cell. 48. 535-543.

Fedor, M. J., & Uhlenbeck, 0. C. (1992). Kinetics of intermolecular cleavage by hammerhead ribozymes. Biochemistrv. 31. 12042-12054.

Forster, A. C., & Altmann, S. (1990). External guide sequence for an RNA enzyme. Science. 249. 783-786.

Forster, A. C., & Symons, R. H. (1987). Self-cleavage of plus and minus RNAs of a virusoid and a structural model for the active sites. Cell. 49, 211-220.

Francki, R. I. B. (1985). Plant virus satellites. Annual Review of Microbioloav. 39, 151-174.

Garriga, G., & Lambowitz, A. M. (1986). Protein dependent splicing of a group I intron in ribonucleoprotein particles and soluble fractions. Cell. 46. 669-680.

145

Guerrier-Takada, C., Gardiner, K., Marsh, T., Pace, N., & Altman, S. (1983). The RNA moiety of ribonuclease P is the catalytic subunit of the enzyme. Cell. 35, 849-857.

Hampel, A., Tritz, R., Hicks, M., & Cruz, P. (1990). Hairpin catalytic RNA model: Evidence for helices and sequence requirement for substrate RNA. Nucleic Acids Research. 18, 299-304.

Haseloff, J., & Gerlach, W. L. (1988). Simple RNA enzymes with new and highly specific endoribonuclease activities. Nature. 334. 585-591.

Haseloff, J., & Gerlach, W. L. (1989). Sequences required for self-catalysed cleavage of the satellite RNA of tobacco ringspot virus. Gene. 82. 43-52.

Hernandez, C., Daros, J. A., Elena, S. F., Moya, A., & Flores, R. (1992). The strands of both polarities of a small circular RNA from carnation self-cleave in vitro through alternative double- and single-hammerhead structures. Nucleic Acids Research. 20. 6323-6329.

Hernandez, C., & Flores, R. (1992). Plus and minus RNAs of peach latent mosaic viroid self-cleave in vitro via hammerhead structures. Proceedings of the National Academy of Sciences. USA. 89. 3711-3715.

Hutchins, C. J., Keese, P., Visvader, J. E., Rathjen, P. D., Mclnnes, J. L., & Symons, R. H. (1985). Comparison of multimeric plus and minus forms of viroids and virusoids. Plant Molecular Biology. 4, 293-304.

Hutchins, C. J., Rathjen, P. D., Forster, A. C., & Symonds, R. H. (1986). Self-cleavage of plus and minus RNA transcripts of avocado sunblotch viroid. Nucleic Acids Research. 14, 3627-3641.

Jacquier, A. (1990). Self-splicing group II and nuclear pre-mRNA introns: How similar are they? Trends in Biochemical Sciences. 15, 351-354.

Keese, P., & symons, R. H. (1987). The structure of viroids and virusoids. Boca Raton; CRC Press.

Kruger, K., Grabowski, P. J., Zaug, A. J., Sands, J., Gottschling, D. E., Cech, T. R. (1982). Self-splicing RNA: Autoexcision and autocyclization of the ribosomal RNA intervening sequence of Tetrahymena. Cell. 31. 147-157.

146

Kuo, M., Sharmeen, L., Dinter-Gottlieb, G., & Taylor, J. (1988). Characterization of self-cleaving RNA sequences on the genome and antigenome of human hepatitis delta virus. Journal of Viroloav. 62. 4439-4444.

Lazowaska, J., Jacq, C., & Slonimski, P. P. (1980). Sequence of introns and flanking exons in wildtype and box3 mutants of cytochrome b reveals an interlaced splicing protein coded by an intron. Cell. 22. 333-348.

Mei, H. Y., Kaaret, T. W., & Bruice, T. C. (1989). A computational approach to the mechanism of self-cleavage of hammerhead RNA. Proceedings of the National Academy of Sciences. USA. 86. 9727-9731.

Michel, F., Jacquier, A., & Dujon, B. (1982). Comparison of fungal mitochondrial introns reveals extensive homologies in RNA secondary structure. Biochimie. 64. 867-881.

Michel, F., Umesono, K., & Ozeki, H. (1989). Comparison and functional anatomy of group II catalytic introns—A review. Gene, 5-30.

Miller, W. A., Hercus, T., Waterhouse, P. M., & Gerlach, W. L. (1991). A satellite RNA of barley yellow dwarf virus contains a novel hammerhead structure in the self-cleavage domain. Viroloav. 183. 711-720.

Miller, W. A., & Silver, S. L. (1991). Alternative tertiary structure attenuates self-cleavage of the ribozyme in the satellite RNA of barley yellow dwarf virus. Nucleic Acids Research. 19, 513-520.

Miller, W. A., Waterhouse, P. M., & Gerlach, W. L. (1988). Sequence and organization of barley yellow dwarf virus genomic RNA. Nucleic Acids Research. 16, 6097-6111.

Oswald, J. W., & Houston, B. R. (1951). A new virus disease of cereals, transmissible by aphids. Plant Disease Reporter. 35. 471-475.

Pace, N. R., & Smith, D. (1990). Ribonuclease P; Function and variation. Journal of Biological Chemistrv. 265. 3587-3590.

Perrotta, A. T., & Been, M. D. (1991). A pseudoknot-like structure required for efficient self-cleavage of hepatitis delta virus RNA. Nature. 350. 434-436.

147

Plumb, R. T. (1983). Barley yellow dwarf virus—A global problem. London: Blackwell Sciences.

Prody, G. A., Bakos, J. T., Buzayan, J. M., Schneider, I. R., & Bruening, G. (1986). Autolytic processing of dimeric plant virus satellite RNA. Science. 231. 1577-1580.

Rochow, W. F. (1970). Barley yellow dwarf virus: Phenotypic mixing and vector specificity. Science. 167. 875-878.

Roossinck, M. J., Sleat, D., & Palukitis, P. (1992). Satellite RNAs of plant viruses; Structures and biological effects. Microbiological Reviews. 56. 265-279.

Ruby, S. W., & Abelson, J. (1991). Pre-mRNA splicing in yeast. Trends in Genetics. 2» 79-85.

Ruffner, D. E., Dahm, S. C., & Uhlenbeck, O. C. (1989). Studies on the hammerhead RNA self-cleaving domain. Gene. 82, 31-41.

Ruffner, D. E., Stormo, G. D., & Uhlenbeck, O. C. (1990). Sequence requirements of the hammerhead RNA self-cleavage reaction. Biochemistry. 29. 10695-10702.

Sarver, N., M.Cantin, E., Chang, P. S., Zaia, J. A., Ladne, P.A., Stephens, D. A., & Rossi, J. J. (1990). Ribozymes as potential anti-HIV-1 therapeutic agents. Science. 247. 1222-1225.

Saville, B. J., & Collins, R. A. (1990). A site-specific self-cleavage reaction performed by a novel RNA in Neurospora mitochondria. Cell. 61. 685.

Saxena, S. K., & Ackerman, E. J. (1990). Ribozymes correctly cleave a model substrate and endogenous RNA in vivo. The Journal of Biological Chemistry. 28, 17106-17109.

Scanlon, K. J., Jiao, L., Funato, T., Wang, W., Tone, T., Rossi, J. J., & Kashani-Sabet, M. (1991). Ribozyme-mediated cleavage of c-fos mRNA reduces gene expression of DNA synthesis enzymes and metallothionein. Proceedings of the National Academy of Sciences. USA. 88, 10591-10595.

Schneider, I. R. (1969). Satellite-like particle of tobacco ringspot virus that resembles tobacco ringspot virus. Science. 166. 1627-1629.

Schneider, I. R. (1977). Defective plant viruses. Montclair: Allanheld, Osmun.

148

Sharmeen, L., Kuo, M. Y. P., Dinter-Gottlieb, G., & Taylor, J. (1988). Antigenomic RNA of human hepatitis delta virus can undergo self-cleavage. Journal of Virology. 62. 2674.

Sheldon, C. C., & Symons, R. H. (1989). Mutagenesis analysis of a self-cleaving RNA. Nucleic Acids Research. 17. 5679-5685.

Shiraishi, H., & Shimura, Y. (1988). Functional domains of the RNA component of ribonuclease P revealed by chemical probing of mutant RNAs. EMBO J.. 7, 3817-3821.

Slim, G., & Gait, M. J. (1991). Configurationally defined phosphorothioate-containing oligoribonucleotides in the study of the mechanism of cleavage of hammerhead ribozymes. Nucleic Acids Research. 19, 1183-1188.

Symons, R. H. (1989). Self-cleavage of RNA in the replication of small pathogens of plants and animals. Trends in Biochemical Sciences. 14 November. 445-450.

Symons, R. H. (1991a). The intriguing viroids and virusoids: What is their information content and how did they evolve? Molecular Plant-Microbe Interactions. 4, 111-121.

Symons, R. H. (1991b). Ribozymes. Critical Reviews in Plant Sciences. 10, 189-234.

Tani, T., Takahashi, Y., & Ohshima, Y. (1992). Activity of chimeric RNAs of U6 snRNA and (-) sTRSV in the cleavage of a substrate RNA. Nucleic Acids Research. 20, 2991-2996.

Thill, G., Blumenfeld, M., Lescure, F., & Vasseur, M. (1991). Self-cleavage of a 71 nucleotide-long ribozyme derived from hepatitis delta virus genomic RNA. Nucleic Acids Research. 19, 6519-6525.

Uchimaru, T., Uebayasi, M., Tanabe, K., & Taira, K. (1993). Theoretical analyses on the role of Mg2+ ions in ribozyme reactions. The FASEB Journal. 7, 137-142.

Uhlenbeck, O. C. (1987). A small catalytic oligoribonucleotide. Nature. 328. 596-600.

Vincent, J. R., Lister, R. M., & Larkins, B. A. (1991). Nucleotide sequence analysis and genomic organization of the NY-RPV isolate of barley yellow dwarf virus. Journal of General Virology. 72. 2347-2355.

149

Waring, R. B., Towner, P., Minter, S. J., & Davies, R. W. (1986). Splice-site selection by a self-splicing RNA of Tetrahymena. Nature. 321. 133-139.

Wu, H. N., Lin, Y. J., Lin, F. P., Makino, S., Chang, M. F., & Lai, M. C. C. (1989) . Human hepatitis delta RNA subfragments contain an autocleavage activity. Proceedings of the National Academy of Sciences. 86. 1831-1835.

Wu, H. N., Wang, Y. J., Hung, C. F., Lee, H. J., & Lai, M. M. C. (1992). Sequence and structure of the catalytic RNA of hepatitis delta virus genomic RNA. Journal of Molecular Biology. 223. 233-245.

Yamani, M. E., & Hill, J. H. (1991). Crop loss assessment and germplasm screening for resistance to barley yellow dwarf virus in west-central Morocco. Phvtopath. Medit. 30, 93-102.

Zaug, A. J., Been, M. D., & Cech, T. R. (1986). Tetrahymena ribozyme acts like an RNA restriction enzyme. Nature. 324. 429-433.

Zieve, G. W., & Sauterer, R. A. (1990). Cell biology of the snRNA particles. Critical Reviews of Biochemistry and Molecular Biology. 25. 1-46.