Proc. Natl. Acad. Sci. USAVol. 86, pp. 7341-7345, October 1989Biochemistry

Immunoglobulin enhancer and promoter motifs 5' of the B29B-cell-specific gene

(lymphocyte gene/transcription signals/tissue-specific gene control)

GARY G. HERMANSON*t, MICHAEL BRISKIN*, DAVID SIGMAN*t, AND RANDOLPH WALL*§¶*Molecular Biology Institute, University of California, Los Angeles, and Departments of tBiological Chemistry and of §Microbiology and Immunology,University of California, Los Angeles, School of Medicine, Los Angeles, CA 90024

Communicated by M. Frederick Hawthorne, June 26, 1989 (received for review April 3, 1989)

ABSTRACT B29 is a B-cell-specific member of the immu-noglobulin gene superfamily that is expressed throughoutB-cell development beginning with the earliest precursor B cellsundergoing immunoglobulin heavy-chain gene segment re-arrangements. We have analyzed the region upstream of theB29 gene to identify DNA sequences involved in transcriptionalregulation of this gene. The B29 gene lacks a TATA box andtranscription is initiated at multiple sites. The B29 gene se-quence 5' ofthese transcription start sites contains six promoterand enhancer motifs known to control immunoglobulin genetranscription. The most notable is a perfect octamer (5'-ATTTGCAT-3'), which binds the Oct-2 B-cell-specific tran-scription factor and thereby can account for the tissue-specificexpression of this gene.

The cis-acting enhancer and promoter sequence motifs thatcontrol immunoglobulin gene transcription have been exten-sively characterized. Closely related sequences called E mo-tifs were first identified by in vivo footprinting in the heavy-chain enhancer (1, 2). Three examples of E motifs also arelocated in the K light-chain enhancer (3). Distinct trans-actingfactors have been shown to bind in vitro to the El motif in theheavy-chain enhancer and to the highly similar E3 motifs in theheavy- and light-chain enhancers (3-7). The E motifs showtissue-specific reactivity in vivo (1, 2). However, as assayed invitro, the factors binding to the E motifs are present in all cells.Individual E motifs have been shown to contribute additivelyto the overall total activity of immunoglobulin heavy- andlight-chain enhancers (reviewed in ref. 6).Two other transcriptional control motifs have been iden-

tified that determine the tissue-specific expression and stage-specific activation of immunoglobulin heavy- and light-chaingenes. The octamer motif, 5'-ATTTGCAT-3', or its inversecomplement, 5'-ATGCAAAT-3', is found in all immunoglob-ulin light- and heavy-chain promoters and in the heavy-chainenhancer (8, 9). This motif is the principal determinant thatconfers B-cell-specific activity in immunoglobulin light- andheavy-chain promoters and in the heavy-chain enhancer (6,10-14). This motif in close proximity with a TATA boxconstitutes a minimal active promoter capable of conferringB-cell-specific transcription (15). The ubiquitous octamerbinding factor, Oct-1, as well as the B-cell-specific octamerbinding factor, Oct-2, have now been cloned (refs. 16-20;reviewed in ref. 21). These octamer factors also interact withthe heptamer motif(5'-CTAATGA-3') located adjacent to theoctamer and shown to contribute to the activity of immuno-globulin heavy-chain promoters (22-25).The KB DNA sequence motif located in the light-chain

enhancer controls the stage-specific activation and transcrip-tion of K light-chain genes (3, 6, 26-28). The NF-KB trans-acting factor, which binds the KB motif, is expressed in all

cells in an inactive form complexed to a labile cytoplasmicinhibitor called IKB (29, 30). Different inducers of K tran-scription (31-33) activate NF-KB to a DNA binding state bycausing the release of IKB (26-30). It recently has beenreported that the KB motif in close linkage with a TATA boxfunctions as a B-cell-specific promoter (34). The tissue-specific activities ofthe octamer and KB DNA motifs requiresthe binding of B-cell-specific trans-acting factors.We have undertaken the isolation and characterization of

B-cell-specific genes to determine their function in B-celldevelopment and to define the regulatory DNA sequencesthat control their tissue- and stage-specific transcription. Werecently reported the isolation ofa B-cell-specific gene calledB29, which is expressed at all stages in B-cell development(35). The B29 gene encodes a cell-surface glycoprotein witha single immunoglobulin-like domain resembling the pro-posed progenitor of the immunoglobulin gene superfamily(36, 37). We have analyzed the sites for transcription initia-tion in the B29 gene to localize promoter and other regulatorysequences that control the transcription of this gene. We findthat B29 mRNAs contain heterogeneous 5' ends, indicatingthat transcription of this gene is initiated at multiple siteslocated 18-66 nucleotides upstream of the B29 coding se-quence. Consistent with this finding, the region upstream ofthese transcription start sites does not contain any DNAsequence resembling a TATA box. Strikingly, the 5' flankingregion of the B29 gene contains multiple DNA sequenceelements corresponding to known transcriptional regulatorymotifs and trans-acting factor binding sites present in thepromoters and enhancers of immunoglobulin light- andheavy-chain genes. 11

METHODSPrimer-Extension Mapping. A synthetic 20-nucleotide

DNA primer (GCAGGAACAACAGCCAGTGG) comple-mentary to nucleotides 372-391 of the B29 sequence shownin Fig. 2C was purchased. The primer was purified by elutionfrom a 20o polyacrylamide gel and shown to correctlyhybridize to the B29 sequence by DNA sequence analysis(data not shown). For the primer-extension reactions, theprimer was treated with kinase to a specific activity of 3 x 101cpm/,ug (2 x 106 cpm/pmol). Either 30 jig of cytoplasmicRNA or 3 ug of cytoplasmic poly(A)-containing RNA wascoprecipitated with 2.8 x 106 cpm of end-labeled primer. Thereactions were carried out exactly as described by Westawayet al. (38) except that the hybridization temperature was 60°C(identical results were obtained at 65°C) and 15 units of avian

Abbreviations: VH, heavy-chain variable region gene segment; pd,pentadecanucleotide.TPresent address: Salk Institute, La Jolla, CA 92037.ITo whom reprint requests should be addressed."The sequence reported in this paper has been deposited in theGenBank data base (accession no. M26184).

7341

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 17

, 202

0

7342 Biochemistry: Hermanson et al.

myeloblastosis virus reverse transcriptase (Pharmacia) wasadded for 1 hr at 420C. After 1 hr, the reverse transcriptasewas inactivated by adding EDTA to 50 mM and heating thereaction at 1000C for 10 min. One microliter of RNase A (1mg/ml) was added and incubated at 370C for 15 min followedby phenol/CHCl3 extracton and ethanol precipitation. Thepellet was resuspended in 3 1.d of80% formamide sequencingdye, boiled, and loaded onto a sequencing gel next to an mpl8sequencing ladder. After electrophoresis, the gel was fixed in10% methanol/10% acetic acid, dried down, and exposed tox-ray film at -70'C with an intensifying screen for 5 days.S1 Nuclease Mapping. The 470-base-pair Pst I fragment

encompassing exon 1 was cloned into pTZ18 (Pharmacia). Auniformly labeled antisense RNA transcript was made withT7 RNA polymerase and [a-32P]ATP. The full-length tran-script was isolated by elution from a 4% polyacrylamide gel.The procedure of Quarless and Heinrich (39) was followedexactly except that the RNA was denatured at 700C for 10 minand hybridized overnight at 450C.

RESULTSMultiple 5' Ends in B29 mRNA. We first determined the

B29 genomic gene sequence upstream of the B29 codingregion (Fig. 1B). This information was used in S1 nucleaseand in primer-extension mapping studies to locate the 5'termini ofB29 mRNA (38, 39). The experimental strategy andresults of the primer-extension mapping are presented in Fig.1. Multiple discrete primer-extended bands are evident withmRNA from B cells (Fig. 1A, lane 1) and pre-B cells (lanes3 and 6), but not with mRNA isolated from either Friend cells(lane 2) or T cells (lanes 4 and 5). This finding reaffirms theB-cell specificity of B29 gene expression (35). The 15-20nested bands obtained with mRNA from B-lineage cells(lanes 1, 3, and 6) are located between 18 and 66 nucleotidesupstream of the ATG initiation codon for B29 translation(Fig. 1B). A pattern of multiple bands consistently reproduc-ing those obtained by primer extension was also generated byS1 nuclease mapping (39) using a uniformly labeled comple-mentary RNA transcript spanning this region of the B29 gene(results not shown). These findings indicate considerableheterogeneity in the sites of transcription initiation in the B29gene. Such 5' heterogeneity is observed in eukaryotic mRNAtranscribed from genes lacking the canonical TATA box. TheB29 gene does not contain any sequence resembling a TATAor CAAT box over the region 350 nucleotides 5' of themapped start sites for transcription (Fig. 1B).The Octamer 5' of the B29 Gene Binds the B-Cell-Specific

Oct-2 Factor. The B29 genomic DNA sequence immediatelyupstream ofthe clustered transcription start sites contains thesequence 5'-ATTTGCAT-3', which is identical to the con-served immunoglobulin gene octamer motif and in the sameorientation as the octamer in K light-chain gene promotersand in the heavy-chain enhancer (8, 9). The octamer inimmunoglobulin genes binds both the ubiquitous nuclearfactor Oct-1 (encoded by the oct-i gene) and the B-cell-specific octamer factor Oct-2 (encoded by the oct-2 gene)(refs. 16-20; reviewed in ref. 21). We carried out nuclearfactor binding studies assayed in gel shifts (3) to determinewhether the octamer motif in the B29 gene would bind eitherof the octamer binding factors (Fig. 2). The specificity ofoctamer factor binding to a B29 gene segment bearing theoctamer was established by competition with a syntheticduplex DNA oligonucleotide containing the octamer se-quence. Extracts from lipopolysaccharide (LPS)-treated anduntreated 70Z/3 pre-B cells (lanes 2-5) were compared to anextract from HeLa cells (lanes 6 and 7) to identify B-cell-specific octamer complexes. The predominant retardedband present in both cell types was effectively blocked bycompetition with the octamer competitor DNA, indicating

A iA G C T Hi

_ of

120-3 _

-4*

100-__

- _

_ 3_ w

80- .. I6

.P~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

t

2 3 4

T

6

5 6

BCAGCTGACCTAAGAGATGACCCACAGTGGGACAGAGGGAGTTAGAAACACTGGCTGTCCC

E4TAGAAGATTCAGGAGCAACCCCTTCCCAGGGGGTCTCTCAAGAACCCAAAGCTGTGCTAC

Dd E3CCAGGCAGGACCACCCTTCGAGTCCTAGCAGA =ATGATGAAGtTGCCCT CCATAGG

octamer he ta-UTCCCTGGAGGGATGGTGCCTCC GGGTCTAA7TT!TATGGCAGGAAGGGGCCTAATmerUGGGAAGAGGCGGAGAGGAGACAXGCTGCAGCCCkGGCTGACXTACXGTTACXT8TTTCGCCCCCXAACCTCCTTG8GCTCAGAGACAGAGCAGTGACCGCCACACTGGTGCTGTCTTCCATGCCCTGCCACTGGCTGTTGTTCCTGC

Ir- primer

FIG. 1. Primer-extension mapping of multiple 5' ends in the B29mRNA. (A) A synthetic 20-nucleotide-long primer complementary tonucleotides 372-391 of the B29 sequence shown in Fig. 2C washybridized to 30 ,jg of total cytoplasmic RNA (lanes 1, 2, 5, and 6)or 3 ,ug of cytoplasmic poly(A)-containing RNA (lanes 3 and 4). Thehybridized primers were extended with reverse transcriptase, pro-cessed as described in Methods, and electrophoresed next to asequencing ladder of mpl8. The numbers on the left of the sequenc-ing ladder refer to the length (in nucleotides) of the mpl8 sequencingproducts. (B) Sequence of the B29 promoter and mapped mRNA capsites. The sequence of the B29 gene is displayed, indicating thelocations of the mRNA 5' ends (0) as mapped by primer extension(38). The location of the oligonucleotide primer used in primer-extension mapping on mRNA is underlined. Immunoglobulin en-hancer and promoter elements are overlined. The putative B29translation initiation codon is boxed.

that it is the ubiquitous octamer binding factor Oct-1 (3, 6,10-14). A faster-migrating band, only present in 70Z/3pre-B-cell extracts, was also effectively blocked by compe-tition with the octamer competitor DNA (compare lanes 2and 4 with 3 and 5). This complex is presumed to be theB-cell-specific octamer factor Oct-2 (3, 6, 10-14). Furtherproof that the band designated Oct-2 is the B-cell-specificoctamer binding factor comes from the finding that theintensity of this band is significantly increased after LPSinduction of 70Z/3 pre-B cells (lanes 2 and 4) as previouslyreported (15). These results establish that the B29 octamerlacking a TATA box binds both the ubiquitous and theB-cell-specific octamer factors. The factor binding resultsindicate that the B29 octamer can function as a B-cell-specificpromoter without a TATA box.Other Immunoglobulin Enhancer and Promoter Motifs 5' of

the B29 Gene. While the octamer motif is sufficient forB-cell-specific promoter activity (15), multiple sequence el-

Proc. Natl. Acad Sci. USA 86 (1989)

Dow

nloa

ded

by g

uest

on

Nov

embe

r 17

, 202

0

Proc. Natl. Acad. Sci. USA 86 (1989) 7343

I-M

a) CO CO c'i C',C N N z Rizcell extract: 0N 0D 0C l- N- N- N-

competitor: -

Oct 1 -4

Oct 2 -4

_ r.+. -.I A+

v F~~~~~~~~~~~1 ...

1 2 3 4 5

FIG. 2. The octamer in the B29 gene binds theoctamer factor Oct-2. Electrophoretic mobility shift aperformed with nuclear extracts from uninduced (lan(lipopolysaccharide induced (lanes 4 and 5) 70Z/3 pfrom HeLa cells (lanes 6 and 7) reacted with a 114-nPst I/Pvu II fragment end-labeled with polynucleotiFig. 3). Duplex octamer competitor oligonucleotTAATI7TGCATGTC-3' was added at 100 ng per biisamples in lanes 3, 5, and 7 to establish the specificitysite binding.

ements contribute to the overall activity of imrpromoters. In addition to the octamer motif, tiregion of the B29 gene contains several otherments known to function in immunoglobulin getion (Fig. 3). The heptamer motif 5'-CTCATCserved in many immunoglobulin heavy-chainchain promoters where it contributes to maxinactivity (22, 23). The heptamer sequence 5'-CTj

A200 bp

located 14 nucleotides 3' of the B29 octamer (Fig. 1B). Thisheptamer differs in only one nucleotide from the active

CZ (x5 heptamer motif5'-CTAATGA-3' present in the V1VH heavy-a, <v chain promoter (V, variable region; H, heavy chain) (22). TheI I B29 heptamer sequence matches the highly conserved hep-

+ tamer consensus nucleotides at positions 1, 4, and 6, but notat position 7 (23). The heptamer is found 2-22 nucleotides 5'of the octamer in most heavy-chain promoters (22, 23).However, the heptamer configuration in the B29 gene isexactly like that in the Vh81X heavy-chain promoter (40).The octamer and heptamer motifs do not share any appar-

ent sequence similarity. Nonetheless, recent binding studieswith Oct-i and Oct-2 factors expressed from their respectivecloned genes indicate that both of these factors bind coop-eratively to the octamer and heptamer elements in immuno-globulin promoters (24, 25). This cooperativity of Oct-1 andOct-2 binding provides an explanation for the functionalcomplementation of these two elements in determining pro-moter activity (22). These considerations argue that theheptamer and octamer motifs in the B29 gene exhibit similarcooperativity in contributing to B29 promoter activity.

6 7 The 5' region flanking the B29 gene contains two othercontrol motifs present in many immunoglobulin promoterB-cell-specific regions. Upstream of the B29 octamer is an 8-nucleotide-long

es 2 and 3) and pyrimidine tract (5'-CCTCCCCT-3') like those seen in manyre-B cells and heavy-chain promoters and shown to contribute to the func-iucleotide-long tional activity of the V1VH promoter (22). While the spacingide kinase (see and size of these pyrimidine tracts is quite variable (22), theide 5'-CTAG- placement and length of this element in the B29 gene arending assay to similar to those in VH promoters. The pyrimidine tract in theofthe octamer B29 gene is preceded by the sequence 5'-ACCAGCTGAT-

GAAGC-3', which has an 11/15 nucleotide match to theconsensus pentadecanucleotide (pd) motif (5'-TGCAGCT-

nunoglobulin GTNCNAN-3') found in many K light-chain promoters and inie 5' flanking the heavy-chain enhancer (9). The promoter of the B-r control ele- cell-specific J-chain gene also contains a pd-like element (41).-ne transcrip- The functional significance of these pd motifs or their binding'A-3' is con- to nuclear factors has not been established.and K light- The 5' flanking region of the B29 gene also containsnal promoter sequences highly homologous to different immunoglobulinAATGG-3' is enhancer E motifs (refs. 1-3; see also ref. 6). The first E-like

100

E4 pd E3 py octa. hepta. mRNA 5'ends Precursor Exon

T -

ATG AG/GT

BB29E3KE3

5' 3'C T C C C A T AG G G T C C CG T C C C A T G T G G T T A C

jiE3 AGG T C A TG TGG C A AGVHV1E3 T T T T C A T G T G A T G A G

CB29E4

jiE4T T C C C A G G G G G T C T CT A C C C A G G T G G T G T T

FIG. 3. Scheme showing the location of immunoglobulin transcription control motif in the 5' flanking region of the B29 gene. (A) Sequencemotifs in the 5' region of the B29 gene homologous to immunoglobulin promoter and enhancer motifs are shown to scale. Not all mapped mRNA5' ends are noted on this diagram. (B) Sequence comparison of the B29 E3 motif with known E3 nuclear factor binding sites in the K enhancer(KE3), in the heavy-chain enhancer (,UE3), and in the V1 heavy-chain promoter (VHViE3). (C) Sequence comparison of the B29 E4 motif withthe functional E4 motif of the heavy-chain enhancer (jE4). bp, Base pairs; py, pyrimidine tract; octa., octamer; hepta., heptamer.

Biochemistry: Hermanson et al.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 17

, 202

0

7344 Biochemistry: Hermanson et al.

motif is located 35 nucleotides 5' of the B29 octamer element(between the pyrimidine tract and the pd motif; Fig. 3). Thissequence is a 6/8 nucleotide match to both the KE3 and to thegE3 enhancer motifs (Fig. 3). Both of these immunoglobulinE3 motifs bind the same nuclear factor and contribute toimmunoglobulin light- and heavy-chain enhancer activity (3,4, 6, 7). Recently, it has been found that the V1 heavy-chainpromoter contains an E3-like sequence with a 6/8 nucleotidematch to gE3 and a 7/8 match to KE3, which binds partiallypurified E3 factor (7). Since the B29 E3 sequence is as closelyrelated as any of the other E3 motifs that bind the E3 factor,we predict that the B29 E3 motif should also bind E3 factor.The B29 sequence contains an E4 motif located 130 nucle-

otides 5' of the B29 octamer (refs. 1 and 2; see Fig. 1B). Thesequence ofthis B29 E4 motifis 7/8 nucleotides identical to theE4 motif in the heavy-chain enhancer (see Fig. 3). The B29sequence contains a second E4-like motif, beginning 95 nu-cleotides 5' of the octamer, which is 5/8 nucleotides identicalto the E4 motif in the heavy-chain enhancer (30-33). Nuclearfactor binding in vitro to the E4 motif has not been reportedeven though functional studies indicate that the E4 motif andthe closely linked octamer in the heavy-chain enhancer con-stitute -25% of the total activity of the complete heavy-chainenhancer (32, 33). We have observed a single retarded band ingel shift assays with a DNA fragment in which the B29 E4motif from 130 nucleotides 5' of the octamer was the onlyknown factor binding site (unpublished results).

DISCUSSIONThe B29 gene is the first B-cell-specific gene other thanimmunoglobulins and the J-chain gene (41) to have its tran-scription control regions analyzed. The region immediately 5'of the B29 gene shows a tight clustering of six knowntranscriptional control motifs from immunoglobulin light- andheavy-chain promoters and enhancers. A heptamer and anoctamer, a pyrimidine tract, a pd element, and E3 and E4motifs are located within the 160-nucleotide-long stretchbetween 22 and 80 nucleotides upstream of the multipleinitiation sites for B29 transcription. This tightly clusteredarrangement contrasts sharply with the spatial separation anddifferent functional activities of these control motifs in immu-noglobulin light- and heavy-chain promoters and enhancers(reviewed in ref. 6). It probably is not meaningful to distin-guish the different immunoglobulin control motifs in the B29gene as either enhancer or promoter elements. It is nowevident that operational differences between promoters andenhancers break down when the respective control motifs areplaced in different contexts. Like the octamer (8, 9), otherimmunoglobulin control motifs also exhibit duality in func-tion and can operate as either promoter or enhancer ele-ments. The KB enhancer motif functions as a B-cell-specificpromoter element when experimentally inserted close to aTATA box (34). The V1VH promoter contains a functional E3enhancer motif that binds the E3 factor (7). Thus, thefunctional activities of immunoglobulin control motifs ineither enhancers or promoters appear to be dependent on theconfiguration (i.e., the nature and arrangement) of adjacentcontrol signals rather than on intrinsic properties of the motif.Of all the immunoglobulin control elements in the 5'

flanking region ofthe B29 gene, the octamer motif is the mostimportant as it is sufficient to account for the B-cell speci-ficity of this gene. The octamer in light- and heavy-chainpromoters is located "70 nucleotides upstream of the initi-ation sites for transcription (8, 9). The B29 octamer is locatedbetween 42 and 100 nucleotides 5' of the mapped transcrip-tion initiation sites. This is within the experimentally deter-mined effective distance for the B-cell-specific promoteractivity of this element (15). The B29 octamer is a perfectmatch to the 8-nucleotide octamer motif (8, 9). This 8-

nucleotide octamer sequence binds the Oct-2 B cell factorand promotes tissue-specific transcription (15). Heavy-chaingene promoters contain A in the so-called "10th position"(i.e., 5'-ATGCAAATNA-3') following the octamer motif (8,9). Most light-chain genes contain T in the correspondingposition of the inverted octamer motif. This "10th base"reportedly increases the overall activity of this motif. Theoctamer motif in the B29 gene contains C as the inverted 10thbase (i.e., CAATTTGCAT-3'). The B29 octamer is an exactmatch to the octamer and 10th base in the rearrangedfunctional 70Z/3 K light-chain gene (8).The combined transcriptional activities of the octamer and

the other immunoglobulin motifs in the B29 gene might beexpected to approach that ofimmunoglobulin genes. Both theheptamer and pyrimidine-rich elements contribute signifi-cantly (i.e., "'50%) to the total activity of the V1VH promoter(22). The enhancer motif, E4, and adjacent octamer (in thesame orientation as in the B29 gene) in the immunoglobulinheavy-chain enhancer exhibit ==25% of the total activity ofthe complete heavy-chain enhancer (6). A truncated heavy-chain enhancer containing E3, E4, and the octamer has40-50%o of the transcriptional activity of the complete heavy-chain enhancer (6). We find that the relative transcription ofthe B29 gene was 20-30% that of the ,u heavy-chain gene inisolated nuclei from 70Z/3 pre-B cells (unpublished results).A number of other B-cell-specific genes recently have been

cloned. These isolated genes provide the opportunity to studythe mechanisms in tissue-specific as well as developmentalstage-specific gene expression. The A5, VpreBl, and VpreB2genes are exclusively expressed in pre-B cells (42-45). Themb-1 (46) and B1 (i.e., CD20) (47, 48) genes are expressed inall stages of B-cell development up to terminally differenti-ated plasma cells. The lyb-2 gene is only expressed at theB-cell stage in lymphocyte development (49). The J-chaingene is only expressed in terminally differentiated immuno-globulin-secreting plasma cells (41). Finally, reflecting itscrucial role in determining B-cell-specific gene expression,the oct-2 gene encoding the Oct-2 factor, like the B29 gene,is expressed throughout B-cell development (16, 18-20).With the exception of B29 and the J-chain gene (41), tran-scriptional control regions have not been defined for any ofthese B-cell-specific genes. Definition of the regulatory se-quences and trans-acting factors controlling the expression ofthese and other B-cell-specific genes should reveal the mech-anisms controlling the tissue and developmental stage-specific expression of B-cell genes.

This work was supported by National Institutes of Health Re-search Grants CA 12800 (R.W.), GM40185 (R.W. and D.S.), andGM39559 (D.S.) and by Public Health Service National ResearchAwards CA09056 (G.G.H.) and AI07126 (M.B.) G.G.H. was alsosupported by a grant from the California Institute for Cancer Re-search (CICR).

1. Ephrussi, A., Church, G., Tonegawa, S. & Gilbert, W. (1985)Science 227, 134-140.

2. Church, G., Ephrussi, A., Gilbert, W. & Tonegawa, S. (1985)Nature (London) 313, 798-801.

3. Sen, R. & Baltimore, D. (1986) Cell 46, 705-716.4. Weinberger, J., Baltimore, D. & Sharp, P. (1986) Nature

(London) 322, 846-848.5. Peterson, C., Orth, K. & Calame, K. (1986) Mol. Cell. Biol. 6,

4168-4178.6. Lenardo, M., Pierce, J. & Baltimore, D. (1987) Science 236,

1573-1577.7. Peterson, C. & Calame, K. (1989) Mol. Cell. Biol. 9, 776-786.8. Parslow, T., Blair, D., Murphy, W. & Granner, D. (1984) Proc.

Natl. Acad. Sci. USA 81, 2650-2654.9. Falkner, F. . & Zachau, H. G. (1984) Nature (London) 310,

71-74.10. Landolfi, N., Capra, J. & Tucker, P. (1986) Nature (London)

323, 548-551.

Proc. Natl. Acad. Sci. USA 86 (1989)

Dow

nloa

ded

by g

uest

on

Nov

embe

r 17

, 202

0

Proc. Natl. Acad. Sci. USA 86 (1989) 7345

11. Staudt, L., Singh, H., Sen, R., Wirth, T., Sharp, P. & Balti-more, D. (1986) Nature (London) 323, 640-643.

12. Augereau, P. & Chambon, P. (1986) EMBO J. 5, 1791-1797.13. Gerster, T., Matthias, P., Thali, M., Jiricny, J. & Schaffner, W.

(1987) EMBO J. 6, 1323-1330.14. LeBowitz, J., Kobayachi, T., Staudt, L., Baltimore, D. &

Sharp, P. (1988) Genes Dev. 2, 1227-1237.15. Wirth, T., Staudt, L. & Baltimore, D. (1987) Nature (London)

329, 174-178.16. Staudt, L., Clerc, R., Singh, H., LeBowitz, J., Sharp, P. &

Baltimore, D. (1988) Science 241, 577-580.17. Ko, H.-S., Fast, P., McBride, W. & Staudt, L. (1988) Cell 55,

135-144.18. Muller, M., Ruppert, S., Schaffner, W. & Matthias, P. (1988)

Nature (London) 336, 544-551.19. Scheidereit, C., Cromlish, J., Gerster, T., Kawakami, K.,

Balmaceda, C.-G., Currie, A. & Roeder, R. (1988) Nature(London) 336, 551-557.

20. Clerc, R., Corcoran, L., LeBowitz, J., Baltimore, D. & Sharp,P. (1988) Genes Dev. 2, 1570-1581.

21. Herr, W., Sturm, R., Clerc, R., Corcoran, L., Baltimore, D.,Sharp, P., Ingraham, H., Rosenfeld, M., Finney, M., Ruvkun,G. & Horvitz, R. (1988) Genes Dev. 2, 1513-1516.

22. Eaton, S. & Calame, K. (1987) Proc. Natl. Acad. Sci. USA 84,7634-7638.

23. Landolfi, N., Yin, X.-M., Capra, J. & Tucker, P. (1988) NucleicAcids Res. 16, 5503-5514.

24. Poellinger, L. & Roeder, R. (1989) Mol. Cell. Biol. 9, 747-756.25. Poellinger, L., Yoza, B. & Roeder, R. (1989) Nature (London)

337, 573-576.26. Sen, R. & Baltimore, D. (1986) Cell 47, 921-928.27. Pierce, J., Lenardo, M. & Baltimore, D. (1988) Proc. Natl.

Acad. Sci. USA 85, 1482-1486.28. Nelsen, B., Hellman, L. & Sen, R. (1988) Mol. Cell. Biol. 8,

3526-3531.29. Baeuerle, P. & Baltimore, D. (1988) Cell 53, 211-217.30. Baeuerle, P. & Baltimore, D. (1988) Science 242, 540-546.

31. Wall, R., Briskin, M., Carter, C., Govan, C., Taylor, A. &Kincade, P. (1986) Proc. Natl. Acad. Sci. USA 83, 295-298.

32. Nelson, K., Kelley, D. & Perry, R. (1985) Proc. Natl. Acad.Sci. USA 82, 5305-5309.

33. Sen, R. & Baltimore, D. (1986) Cell 47, 921-928.34. Wirth, T. & Baltimore, D. (1988) EMBO J. 7, 3109-3113.35. Hermanson, G., Eisenberg, D., Kincade, P. & Wall, R. (1988)

Proc. Natl. Acad. Sci. USA 85, 6890-6894.36. Hood, L., Kronenberg, M. & Hunkapiller, T. (1985) Cell 40,

225-229.37. Williams, A. & Barclay, A. N. (1987) Annu. Rev. Immunol. 6,

381-405.38. Westaway, D., Goodman, P. A., Mirenda, C. A., McKinley,

M. P., Carlson, G. A. & Prusiner, S. B. (1987) Cell 51, 651-662.

39. Quarless, S. A. & Heinrich, G. C. (1986) BioTechniques 4,434-437.

40. Yancopoulos, G., Desiderio, S., Paskind, M., Kearney, J.,Baltimore, D. & Alt, F. (1984) Nature (London) 311, 727-733.

41. Matsuuchi, L., Cann, G. & Koshland, M. E. (1986) Proc. Natl.Acad. Sci. USA 83, 456-460.

42. Sakaguchi, N., Berger, C. N. & Melchers, F. (1986) EMBO J.5, 2139-2147.

43. Kudo, A., Sakaguchi, N. & Melchers, F. (1987) EMBO J. 6,103-107.

44. Jongstra, J., Jongstra-Bilen, J., Tidmarsh, G. & Davis, M.(1988) Mol. Immunol. 25, 687-693.

45. Kudo, A. & Melchers, F. (1987) EMBO J. 6, 2267-2272.46. Sakaguchi, N., Kashiwamura, S.-I., Kimoto, M., Thalmann, P.

& Melchers, F. (1988) EMBO J. 7, 3457-3464.47. Tedder, T., Streuli, M., Schlossman, S. & Saito, H. (1988)

Proc. Natl. Acad. Sci. USA 85, 208-212.48. Tedder, T., Klejman, G., Disteche, C., Adler, D., Schlossman,

S. & Saito, H. (1988) J. Immunol. 41, 4388-4394.49. Nakayama, E., von Hoegen, I. & Parnes, J. (1989) Proc. Natl.

Acad. Sci. USA 86, 1352-1356.

Biochemistry: Hermanson et al.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 17

, 202

0