Proc. Natl. Acad. Sci. USAVol. 82, pp. 5875-5879, September 1985Genetics

Two-micrometer circle site-specific recombination: The minimalsubstrate and the possible role of flanking sequences

(inversion/resolution/oligomerization/dyad symmetry)

MAKKUNI JAYARAMResearch Institute of Scripps Clinic, Department of Molecular Biology, 10666 North Torrey Pines Road, La Jolla, CA 92037

Communicated by Franklin W. Stahl, May 16, 1985

ABSTRACT The 2-Mum circle ]ONA of yeast encodes asite-specific recombination system (FLP recombination). Therecombination region had been mapped earlier to a 65-base-pair (bp) segment within the 599-bp-long inverted repeats of themolecule. I have shown that the "minimal" FLP substrateresides in a 13-bp dyad symmetry plus an 8-bp core locatedwithin the 65-bp recombination region. Further, as determinedby different in vivo assays, sequences extraneous to the minimalFLP site and the 65-bp recombination region can affect theefficiency of the recombination reaction.

Site-specific recombination systems are of interest for tworeasons. They may bring about developmentally relevantgenomic rearrangements in both prokaryotes and eukaryotes(1-4); they provide a biochemical means to study the molec-ular mechanisms of recombination. The two best-studiedrecombination reactions are those mediated by the Int proteinof phage X and the resolvase encoded by the kin transposonsTn3 and y8 (5, 6). Recently, considerable information hasbeen obtained regarding the lox-cre recombination system ofphage P1 (7).The 2-pum circle, a commonly occurring plasmid in Sac-

charomyces cerevisiae, also encodes a site-specific recom-bination system. This plasmid codes for a protein, FLP,which catalyzes recombination within the inverted repeats ofthe molecule to cause intramolecular inversion (8, 9). Inaddition, FLP can mediate intermolecular recombinationbetween plasmids containing the 2-,um circle repeat to pro-duce homo- or heterodimers as well as higher oligomers (10,11). FLP also promotes efficient intramolecular resolutionbetween directly oriented 2-,pm circle repeats (10, 12).

Initiation of FLP recombination is confined to a region of<65 base pairs (bp) within the 599-bp 2-pum circle repeat (9).This recombination region includes and is surrounded byseveral DNA symmetries (10, 13). I have used chemicallysynthesized FLP substrates to determine (i) what sequencesconstitute the "minimal" FLP site, (ii) what DNA symme-tries are germane to the reaction, and (iii) whether 2-pum circlesequences flanking the minimal site can influence its reac-tivity.

MATERIALS AND METHODSChemical Synthesis of Oligonucleotides. The oligonucleo-

tides (both strands) were synthesized in a 380A AppliedBiosystems nucleic acid synthesizer by using the phospha-ramidite method (14). The complementary strands, afterphosphorylation with polynucleotide kinase, were annealedin 6 mM Tris HCl, pH 7.5/6 mM MgCl2/120 mM NaCl byheating to 55°C followed by slow cooling to room tempera-ture. The annealing mixture was further cooled to 8-10°C and

digested with an excess of BamHI plus HindIII at thistemperature for at least 8 hr. The digestion mixture wasextracted with phenol and precipitated with ethanol in thepresence of purified yeast tRNA as carrier.

Plasmids of the pJ and pJL Series. The synthetic oligonu-cleotides J1-J3, cut with BamHI and HindIII, were ligated toa pACYC184 derivative (lacking the single Xba I site), whichwas also cut with BamHI and HindIII. The general structureof these plasmids (pJ) is shown in Fig. 1B. Before using theseplasmids in recombination assays, the accuracy of the se-quence of the cloned oligonucleotide was confirmed (15).Plasmids PJ4-PJ6 were constructed by ligating the appropriategel-purified EcoRI plus Xba I fragments derived from pJ1-pJ3(also see Fig. 1). The pJ7 plasmid was made by cloning the900-bp HindIII fragment from the A form of 2-gm circle thatincludes one copy of the repeated segment into the HindIIIsite of the pACYC184 derivative described above (13).The pJ plasmids were cut with Sal I and ligated to a 2200-bp

Sal I-Xho I fragment from YEP13 that includes the yeastLEU2 gene (16). The structure of the resulting plasmid pJLis shown in Fig. 1B.pJK Plasmids. The 900-bp HindIII fragment from the A

form of 2-,um circle was cloned into pUC19 in the desiredorientation (13, 17). This pUC19 derivative was linearized bypartial HindIl digestion, and the ends of the molecule weremade flush by Klenow polymerase in the presence of all fourdeoxynucleoside triphosphates. Ligation to a 1500-bpHindIII fragment carrying the kanamycin-resistance (KanR)gene derived from Tn5, also blunt-ended, produced a plasmidfrom which the 2-,um circle repeat and the KanR gene couldbe coexcised as a HindIII-BamHI fragment (7). This plasmidwas first cut with HindIII, blunt-ended by the Klenowfilling-in reaction, and then cut with BamHI. The fragment(A) containing the 2-,um circle repeat and the KanR gene wasgel-purified. Similarly, pACYC184 was cut with Sal I, blunt-ended, and then cut with BamHI. The larger of the twofragments (B), which includes the chloramphenicol-resis-tance (CamR) gene, was gel-purified. Ligation of A to Bresults in a plasmid from which it is possible to extract anEcoRI-Sal I piece that includes the 2-,um circle repeat and theKanR gene. This DNA fragment when joined to theEcoRI-Sal I fragment from the pJ plasmids containing thesynthetic oligonucleotides (or a copy of the intact 2-,pm circlerepeat) creates the pJK series of plasmids (see Fig. 3A).pMJ Plasmid. In the pMJ plasmid the FLP gene is ex-

pressed from the A PR promoter. Plasmid pCQV2 was cut withBamHI and the single-stranded DNA ends were removed bytreatment with S1 nuclease (18). After a second digestionwith Pvu II, the larger of the two fragments (A) was purified.Similarly, pCV21 was cut with Sph I and treated with Sinuclease to remove the single-stranded extensions (9). It wasthen cut with Hpa I, and the fragment containing the FLP

Abbreviations: bp, base pair(s); KanR, kanamycin resistance; KanS,kanamycin sensitivity; AmpR, ampicillin resistance; CamR, chlor-amphenicol resistance.

5875

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Dec

embe

r 16

, 202

0

Proc. NatL Acad. Sci USA 82 (1985)

gene (B) was purified. A and B were ligated to produce aplasmid, pMI, in which the expression of FLP is driven bytranscriptional and translational signals derived from the Xcro gene. The plasmid also carries the temperature-sensitiveX repressor c1857. The FLP recombination site present inpMI was eliminated by digestion with Xba I, followed by S1nuclease treatment and religation. The plasmid thus ob-tained, pMJ, is no longer a substrate for FLP-mediatedrecombination.

General Methods. Yeast transformations were performedas described by Ito et al. (19). The recipient strains wereDCO4 [cir'] and DCO4 [cir0], Mata leu2-04 adel strains,which contain and lack 2-gm circles, respectively. Bacterialtransformations were done according to Mandel and Higa(20). The recipient strains used were HB101 (recA13, aral4,proA2, supE44, r-, mB) and C600 (thil, leuB6, lac Y1, tonA21,supE44). DNA from yeast was isolated by the procedure ofCryer et al. (21). Plasmid DNA from Escherichia coli wasprepared by the method of Ohtsubo et al. (22).

RESULTS

A list of the synthetic oligonucleotides used in this studyalong with their DNA sequences is shown in Fig. 1A.Oligonucleotides J1-J3 (the names refer to the double-strand-ed forms) were chemically synthesized. J4-J6 were derivedfrom J1-J3 by the appropriate combination of sequencesleftward or rightward of the Xba I site (see Materials andMethods).

In Fig. 1B and in Fig. 3A, I have indicated the basicstructures of the substrate plasmids (pJ, pJL, and pJK) usedin the recombination assays. Plasmid pMJ, which is the

A

source of the FLP protein in assays carried out in E. coli, isalso shown in Fig. 1B.Experiment 1. Part A: Can a synthetic substrate partake in

intermolecular recombination with itself? Members of the pJseries ofplasmids were used to transform a recA E. coli strainto CamR. The plasmid population isolated from this hostconsists almost entirely of the monomeric form (Fig. 2). TherecA host harboring each of the pJ plasmids was thentransformed to ampicillin resistance (AmpR) by a compatiblepBR322-derived plasmid (pMJ) in which the FLP gene isexpressed from the A PR promoter. The AmpR, CamRtransformants were grown at 370C or 420C for 15-20 gener-ations, and plasmids isolated from them were fractionated onagarose gels (Fig. 2). Plasmid pJ7, with a complete 2-,um circlerepeat, shows efficient FLP-mediated oligomerization (Fig.2A). Approximately 65-75% of the plasmid exists in thedimeric or higher oligomeric forms in the presence of FLP.Plasmid PJ3, containing the previously defined 65-bp recom-bination region, shows modest oligpmerization-significant-ly less than pJ7. Starting with a PJ3 monomer, no more than20% of the plasmid is seen to form multimers when providedwith FLP. In results shown in Fig. 2B, the parent PJ3 is adimer. It is clear that the resolution of the dimer into itsmonomer via FLP recombination is more efficient than itsmultimerization. The implications of this result becomeparticularly relevant in the context ofexperiment 2. PlasmidspJ1 and PJ2 appear to be almost refractory to oligomerizationby FLP (Fig. 2 C and D). Plasmids PJ4, pJ5, and PJ6 also showlittle, if any, FLP-mediated oligomerization (<10% dimersplus oligomers; data not shown).

A B1 2 3 1 2 3

C D1 0

BamHXba

AAGCTTCCTATACTTTCTAGAGAATAGGATCC

AAGCTTCCTATACTTTCTAGAGAATAGGAACTTCGGATCC_ACTCTTCTT. GAATGGATCGAC

AAGCTTCAAAAGCGCTCTGAAG TTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCAAGGATCC

AAGCTTCAAAAGCGCTCTGAAG TTCCTATACTTTCTAGAGAATAGGATCC

AAGCTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCAAGGATCC

AAGCTTCAAAAGCGCTCTGAAG TTCCTATACTTTCTAGAGAATAGGAACTTCGGATCC

B

pJ

EcoRCAMR

Hind III

Sal BamH

pJL

Ji -FDOC

S-PDCC

FcCJ3J4

J5

pMJ

EcoRPst c1857

M APR

FLc EcoR

Pvu IllHpa

FIG. 1. Synthetic FLP substrates and plasmids used in recom-bination assays. (A) The oligonucleotides used in the FLP recombi-nation assays are shown. J1-J3 were chemically synthesized. Anearly perfect 13-bp dyad symmetry with an 8-bp core region (seealso Fig. 4) present in J3 is indicated ( ). The 13-bp symmetryelement is present twice on the right-hand side with a 1-bp gapbetween the two copies. J-J6 were obtained biochemically fromJ1-J3 by combining appropriate sequences to the left and to the rightof the Xba I site. (B) The basic structures of the pJ, pJL, pJK, andpMJ plasmids are shown. The synthetic oligonucleotides are repre-sented as filled rectangular boxes and the 2-gm circle repeat is shownas the open rectangular box. The arrows in pMJ show the directionof transcription of the cI857 and the FLP genes.

- Foc

Poc

FCC

-Pcc

FIG. 2. Intermolecular FLP recombination. The recA E. colistrain HB101 was transformed with each of the pJ plasmids or witheach of the pJ plasmids plus the pMJ plasmid in which FLP isexpressed from the PR promoter. Plasmid DNA isolated from thetransformants was fractionated by agarose gel electrophoresis andvisualized by ethidium bromide staining. A, B, C, and D correspondto pJ7 (which contains an intact 2-gm circle repeat), pJ3, PJ2, and pJ1,respectively. Neither pJ7 (A, lane 1) nor the FLP plasmid pMJ (A,lane 2) shows any oligomerization in HB101. However, when theycoexist in HB101, pJ7 undergoes efficient intermolecular recombi-nation to dimers and higher oligomers (A, lane 3). The parent pJ3plasmid is a dimer (B, lane 1), which is resolved into its monomer inthe presence of the FLP plasmid (B, lane 3). pJ3 also undergoesoligomerization, but with significantly lower efficiency than pJ7 (B,lane 3). Upon digestion with Sal I, which cuts once within the pJplasmids but does not cut pMJ, the recombinant bands disappearand, as expected, a band corresponding to linear-length pJ3 plasmidappears (B, lane 2). PJ2 and pJj do not show any recombination inHB101 (lane 1 of C and D, respectively) and little, if any, recombi-nation even in the presence of pMJ (lane 2 of C and D, respectively).Plasmid DNA in D was cut with Pst I, which linearizes pMJ but doesnot cut pJj. The letters P and F correspond to the test plasmid (pJ)and the FLP plasmid (pMJ), respectively. The arrows indicaterecombinant bands resulting from FLP reaction. CC, closed circle;0, open circle; L, linear plasmid; DCC, dimer closed circle; DOC,dimer open circle.

Hind III

5876 Genetics: Jayaram

Dow

nloa

ded

by g

uest

on

Dec

embe

r 16

, 202

0

Proc. NatL Acad Sci. USA 82 (1985) 5877

Part B: Can a synthetic substrate undergo intermolecularrecombination with a 2-,um circle repeat? Plasmids of the pJLseries, which contain the yeast LEU2 gene (Fig. 1B), weretested for their ability to transform isogenic leu2- yeaststrains that do or do not contain 2-,4m circles [(cir') or (cir0)]to leucine prototrophy. Since the plasmids are devoid of ayeast replication origin, they can give rise to (cir0) transform-ants only by "low-frequency" integration at the chromo-somal leu2 locus via homologous recombination. In the (cir')strain, however, those plasmids that contain a functional FLPsite can be efficiently integrated into the endogenous 2-,4mcircles by FLP recombination and thereby acquire a yeastreplication origin. Such plasmids can, therefore, transformthe (cir') yeast strain at "high" frequencies. The results ofthe experiment summarized in Table 1 conform to those ofexperiment 1-that is, the efficiency of the FLP substratesfollows the order: native 2-gm circle repeat > J3 > J2 or J1.That the transformants do arise by the expected route iscertified by the following tests. (i) When four randomlypicked transformants derived from each plasmid were grownnonselectively, they showed loss of the LEU2 marker,thereby declaring the extrachromosomal existence of themarker (data not shown). (ii) Restriction enzyme analysis oftotal DNA isolated from these transformants also confirmsthe FLP-mediated association between the pJ plasmids and2-,4m circles (data not shown).The validity of the results from the yeast transformation

assay is strengthened by the following observation. In arecombination assay similar to that described under experi-ment 1, part A, intermolecular recombination of the pJplasmids was measured by using the pMI plasmid (seeMaterials and Methods) as the source of FLP. Since pMIcontains a functional FLP site, it can potentially form aheterodimer or a heterooligomer with a pJ plasmid. Suchproducts are easily identified by appropriate restrictionenzyme digestion. The pJ7 plasmid undergoes this reactionreadily, whereas pJ3 does so with considerably reducedefficiency (data not shown). The other plasmids (pJ1, PJ2, PJ4,pJ5, and pJ6) form virtually no heterodimers with pMI.

Experiment 2. Are the synthetic substrates active inintramolecular resolution? The pJK plasmids contain anintact 2-,um circle repeat and a synthetic oligonucleotide (ora second copy of the 2-,um circle repeat) arranged in directorientation. They bracket, on one side, the pACYC184replication origin and the CamR gene, and, on the other, theKanR gene derived from Tn5 (Fig. 3A). Recombinationbetween the direct repeats should result in the formation oftwo circular molecules, one of which retains the CamR geneand the replication origin and the other of which contains theKanR gene but is bereft of a replication origin.The pJK plasmids were introduced into a recA bacterial

strain that harbors the FLP plasmid (pMJ) by selecting forCamR. The fraction of the AmpR, CamR transformants thatwas also KanR was estimated (Table 2). Plasmid pJ1K showsvirtually no loss of KanR, whereas pJ2K gives rise to asignificant fraction of kanamycin-sensitive (Kans) transfor-

Table 1. Transformation of [cirl] and [cir'] yeast by pJL plasmidsLeu+ transformants, no. per 5

jig of plasmid DNAPlasmid DCO4 [ciril DCO4 [cir-ipJIL '0 0pJ2L 0 5pJ3L 0 42pJ7L 0 320

The lithium acetate transformation protocol described by Ito et al.(16) was used. To minimize the variabilities, all transformations wereperformed simultaneously on the same batch of recipient cells.

A

EcoR

pJK OR ;~\ Hind Ill

BamHHind III Sal

KAN'

B

LL.

UA-

1.00.8L0.6-

0.4

0.2

.coRCAM nR KAN'

Hind IllHind III Sal

pJIK

PJ3K

1 2 3N

4 5 6

CpJ2K pJ3K pJ7K

PA,Fh -J

FIG. 3. Intramolecular FLP recombination. (A) The structure ofthe pJK plasmids is shown. The 2-,um circle repeat is represented bythe open box (oj), and the synthetic oligonucleotide (or the secondcopy of the 2-,m circle repeat) is represented by the filled box (-).The arrows indicate the relative orientations of the FLP recombi-nation regions. Intramolecular recombination within pJK producestwo circular molecules, A and B. Only A contains a functionalreplication origin. (B) E. coli strain HB101 harboring pMJ wastransformed to CamR by using the pJK plasmids. A set of transform-ants initially scored as AmpR, CamR, KanR was propagated inmedium free of kanamycin and the rate of loss of KanR wasdetermined. F0 and FN refer to the fraction of the AmpR, CamR cellsin the population that is also KanR at time zero and following Ngenerations of growth, respectively. The value of F0 was 5-8% forpJ3K and pJ7K and 40-50% for PJ2K. The abscissa (N) correspondsto the number of generations. The values on the graph are the meansof three data points. (C) Plasmid DNA isolated from CamR, KanRtransformants of HB101 produced by the pJK plasmids or fromCamR, AmpR, Kans transformants resulting from the transformationof HB101 harboring pMJ was digested with EcoRI, fractionated onagarose gels, and stained with ethidium bromide. The decrease in thesize of the pJK plasmids following loss of KanR (compare bands Pand PA in lanes marked KanR and Kans, respectively) is consistentwith the FLP recombination outlined in A. The bands labeled F1 andF2 arise from the pMJ plasmid.

mants (-30-40%). Of those transformants obtained frompJ7K (with two complete copies of the 2-,m circle repeat)-75% were Kans. The corresponding value for pJ3K wasroughly 90%. It would therefore appear that the resolutionreaction is more efficient between J3 and a 2-,um circle repeat

Genetics: Jayaram

Dow

nloa

ded

by g

uest

on

Dec

embe

r 16

, 202

0

Proc. NatL Acad Sci USA 82 (1985)

Table 2. FLP-mediated intramolecular resolution

Transformants, no.

AmpR, CamR, KanR+

Plasmid AmpR, CamR, Kans AmpR, CamR, Kans %

pJ1K 625 0 0PJ2K 842 312 37pJ3K 864 778 90pJ7K 923 689 75

The recA E. coli strain harboring the FLP plasmid pMJ wastransformed to CamR by using the pJK plasmids. The transformantswere selected on ampicillin- and chloramphenicol-containing platesand replicated onto kanamycin plates. The transformation wascarried out at 37TC.

than between two 2-,um circle repeats. This rather misleadingresult can be rationalized as follows. Provided the circle B(Fig. 3A) has a finite half-life, it has a certain probability ofundergoing the reverse reaction (an intermolecular FLPrecombination) and reuniting with circle A. As would beexpected from the results of experiment 1, this reactionoccurs more efficiently between two native 2-gm circlerepeats than between two J3 segments.

I have also followed the rate of loss of KanR during thegrowth of a transformant that was initially CamR, AmpR,KanR (Fig. 3B). The results demonstrate that J1 is not a FLPsubstrate and that J2 is a FLP substrate, although a much lessefficient substrate than J3 or an intact 2-,am circle repeat.Finally, plasmid DNA isolated from the KanR transformantsshows a decrease in size expected from a deletion caused bythe FLP reaction (Fig. 3C). Further restriction enzymeanalyses confirm that the cause of Kans is, in fact, thepredicted FLP-mediated recombination.

DISCUSSIONThe segment of 2-/im circle repeat in which the FLP recom-bination region resides is replete with DNA symmetries (10,13). Some of the more prominent ones are depicted in Fig. 4.Of particular interest with respect to FLP recombination is anearly perfect 13-bp inverted repeat bordering an 8-bp

1 l a lVb2 2'l 3 3'

GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCso I

Xbal

5' 3'2:CTTCAGAGCGCTTTTG2':CTTCAGAGCGCTTTTG3:CTTCAAAGCGTTTCCG3':TTTCGAAGCGC TCG

FIG. 4. The FLP recombination region. On a portion of the 2-jumcircle repeat [from approximately position 3380 to 4020 (13)], theFLP recombination region mapped by Broach et al. (9) and theminimal recombination site defined by this paper are indicated as thesolid and hatched rectangular boxes, respectively. The nucleotidesequence of the dyad symmetry 1-la, which constitutes the minimalFLP site, is shown. 1 is identical in sequence to la and follows it witha 1-bp gap. There is a singular imperfection at position 12 of the 1-1'dyad symmetry. The nucleotide sequences of the other symmetryelements flanking the minimal recombination site are also shown.

spacer. Mutations that eliminate recombination in vivo and invitro have been mapped to the spacer region or to the invertedrepeat (9, 23, 24). The preponderance of symmetries issuggestive of DNA-protein interactions that could be perti-nent to FLP recombination. The results reported here dem-onstrate that the sequences essential for the reaction areresident in the 1-1l dyad symmetry and its 8-bp core region.They also imply that DNA sequences extraneous to theminimal FLP site can modulate its reactivity.

Synapsis of the participating FLP sites during recombina-tion may involve random three-dimensional diffusion ornonrandom mechanisms such as DNA tracking by FLP ortoroidal winding of DNA around FLP (25, 26). However, areasonable expectation (which is borne out by experiment)would be that intramolecular recombination is a more effi-cient reaction than intermolecular recombination. Hence,definition of the minimal FLP site shall be based solely on theresults from the intramolecular resolution assay (experiment2, Results). One then compares the performance of theminimal substrate in intermolecular recombination to thoseencompassing larger segments of the 2-Jim circle repeat andattempts to infer the possible role of flanking sequences in thereaction.

According to the intramolecular recombination test, theshortest oligonucleotide, J1, fails to qualify as a substrate.The symmetry element 1 of J1 (Fig. 4) lacks the first base pairand contains an insertion between positions 4 and 5, whereasla contains a deletion of the terminal 5 bp (see Fig. 1). In J2,the left symmetry element is the same as that in J1 (Fig. 1);however, J2 contains an intact la. J2 is identified as arelatively weak substrate for recombination, whereas J3,which includes the symmetry elements 1, 1l and lb is anefficient substrate. These results lead to the conclusion thatthe dyad symmetry 1-la with its 8-bp core meets thestructural requirements for a FLP substrate. In fact, theminimal substrate must be smaller, since the first base pair ofthe symmetry element is dispensable and since the insertionof a base pair between positions 4 and 5 fails to abolish thereaction.The definition of the minimal substrate by the in vivo assay

is consistent with the results obtained by using an in vitroFLP recombination system. "Footprinting" experimentsshow that partially purified FLP can protect, from DNasedigestion, a 50-bp segment of the 2-Am circle repeat thatspans the dyad symmetry 1-la, its 8-bp spacer, and thesecond copy of the symmetry element, 1b (ref. 23; see alsoFig. 4). Further, the entire 1 sequence and at least theterminal 3 bp of the 1-la dyad symmetry are dispensable inthe in vitro reaction (Michael M. Cox, Department of Bio-chemistry, University of Wisconsin; personal communica-tion).The intermolecular recombination assay (see experiment

1, part A, Results) declares J1, J2, J4, J5, and J6 as virtuallynonsubstrates and J3 as a substrate with a modest degree ofreactivity. An intact 2-gim circle (J7) is a good substrate in thisassay, considerably superior to J3. Nearly 70% of the pJ7plasmid isolated from the FLP-containing host exists in thedimeric for higher oligomeric state. The corresponding valuefor pJ3 is only about 20%. Assuming that the initial concen-tration of the plasmid monomer is not significantly differentfor the pJ plasmids and that the plasmid population analyzedhas reached equilibrium, the average rate constant for theoligomerization reaction must be higher for pJ7 than for pJ3.Another point of interest is that the only structural differencebetween J3 (a substrate) and J6 (a nonsubstrate) is thepresence in J3 of the second copy of the symmetry element

b1'. This would imply that the lb sequence does enhance thereactivity of the minimal FLP substrate. The oligonucleotideJ5, which also contains the 1l and 1b sequences but is mutatedin 1 (a deletion of the first base pair and an insertion between

5878 Genetics: Jayaram

Dow

nloa

ded

by g

uest

on

Dec

embe

r 16

, 202

0

Proc. NatL. Acad. Sci. USA 82 (1985) 5879

positions 4 and 5), is not a FLP substrate. Thus, thestimulatory effect of 1b appears to be anulled by the mutationsin 1.The enhancement in the reactivity of the minimal FLP site

by 2-gm circle sequences must almost certainly involveDNA-protein interactions. An increase in the homology ofthe reacting chromatids alone cannot be the explanation,since, in experiment 1, part A (see Results), the reactionoccurs between completely homologous molecules. TheDNA symmetries in the 2-gm circle repeat that lie outside ofthe minimal site might interact with the FLP protein and actas enhancers of recombination. The situation could beanalogous to that of the X repressor or the Cro protein, whichcan bind to a set of six operators with affinities varying overa wide range (27, 28). The observation that FLP does notprotect these sequences in footprinting experiments must betempered by the fact that the level of purity of the protein wasprobably not sufficient to identify weak binding (23). In fact,the observed protection includes 7 bp each of the symmetryelements 2' and 3'.The best FLP substrate, J7, includes, in addition to the 599

bp of the 2-pum circle repeat, 300 bp of 2-,um circle uniqueDNA. The possibility that sequences responsible for en-hancement of recombination may reside in the unique DNAcannot be ruled out. It is also noteworthy that J7 contains thecoding region for the carboxyl-terminal portion of the FLPprotein. Pertinent in this context is the finding that theinversion ofthe G loop in phage Mu and that of the H segmentin Salmonella are enhanced by cis-acting sequences locatedwithin the structural genes for the Gin and Hin proteins,which, respectively, catalyze these reactions (29, 30).The FLP recombination system is, in general, analogous to

several prokaryotic site-specific recombination systems. Thesimilarity of the FLP site to the reaction center in the lox-crerecombination system of phage P1 is particularly remarkable(12). The lox site also consists of a 13-bp dyad symmetry withan 8-bp core region (31). Further, both FLP and Cre catalyzesite-specific cleavage within the core region producing a free5' OH and a 3' protein-bound terminus (23, 32). This chemicalsimilarity also extends to the cleavage by the Int proteinwithin the X attachment site (33).The definition of the minimal FLP site provides the

opportunity to investigate the details of protein-DNA inter-actions in recombination and the role of flanking sequencesin modulating the efficiency of the reaction.

I thank Dr. Hansen Hsuing and Ms. Emily Chen for help insynthesizing oligonucleotides. I am grateful to Dr. Lih-Jiuan Youngfor her help in some of the experiments. The work was supported bythe National Science Foundation.

1. Nash, H. A. (1977) Curr. Top. Microbiol. Immunol. 78,171-199.

2. Simon, M., Zieg, T., Silverman, M., Mandel, G. & Doolittle,R. (1980) Science 209, 1370-1374.

3. Plasterk, R. H. A. & Van de Putte, P. (1984) Biochim.Biophys. Acta 782, 111-119.

4. Tonegawa, S., Sakano, H., Maki, R., Traunecker, A.,Heinrich, G., Roeder, W. & Kurosawa, Y. (1980) Cold SpringHarbor Symp. Quant. Biol. 45, 839-858.

5. Reed, R. R. (1981) Cell 25, 713-719.6. Weisberg, R. & Landy, A. (1983) in Lambda II, eds. Hendrix,

R. W., Roberts, J. W., Stahl, F. W. & Weisberg, R. A. (ColdSpring Harbor Laboratory, Cold Spring Harbor, NY), pp.211-250.

7. Abremski, K., Hoess, R. & Sternberg, N. (1983) Cell 32,1301-1311.

8. Broach, J. R. & Hicks, J. B. (1980) Cell 21, 501-508.9. Broach, J. R., Gurascio, V. R. & Jayaram, M. (1982) Cell 29,

227-234.10. Jayaram, M., Li, Y. Y., McLeod, M. M. & Broach, J. R.

(1983) in Mechanisms of DNA Replication and Recombina-tion, ed. Cozzarelli, N. R. (Liss, New York), pp. 685-694.

11. Cox, M. (1983) Proc. Natl. Acad. Sci. USA 80, 4223-4227.12. Dan Vetter, B. J., Andrews, R. & Sadowski, P. D. (1983)

Proc. Natl. Acad. Sci. USA 80, 7284-7288.13. Hartley, J. L. & Donelson, J. E. (1980) Nature (London) 286,

860-864.14. Beaucage, S. L. & Caruthers, M. H. (1981) Tetrahedron Lett.

22, 1859-1862.15. Maxam, A. M. & Gilbert, W. (1977) Proc. Natl. Acad. Sci.

USA 74, 560-564.16. Broach, J. R., Strathern, J. N. & Hicks, J. B. (1979) Gene 8,

121-133.17. Norrander, J., Kempe, T. & Messing, J. (1984) Gene 26,

101-106.18. Queen, C. (1983) J. Mol. Appl. Genet. 2, 1-10.19. Ito, H., Fukuda, Y., Murata, K. & Kimura, A. (1983) J.

Bacteriol. 153, 163-168.20. Mandel, M. & Higa, A. (1970) J. Mol. Biol. 53, 154-168.21. Cryer, D. F., Eccleshall, R. & Marmur, J. (1975) in Methods in

Cell Biology, ed. Prescott, D. M. (Academic, New York), Vol.12, pp. 39-54.

22. Ohtsubo, E., Rosenbloom, M., Schrempf, H., Goebel, W. &Rosen, J. (1978) J. Mol. Gen. Genet. 159, 131-141.

23. Andrews, B. J., Proteau, G. A., Beatty, L. G. & Sadowski,P. D. (1985) Cell 40, 795-803.

24. McLeod, M. M., Volkert, F. & Broach, J. (1984) Cold SpringHarbor Symp. Quant. Biol. 49, 779-787.

25. Benjamin, H. W., Matzuk, M. M., Karsnow, M. A. &Cozzarelli, N. R. (1985) Cell 40, 147-158.

26. Hoess, R., Abremski, K. & Sternberg, N. (1984) Cold SpringHarbor Symp. Quant. Biol. 49, 761-767.

27. Johnson, A. D., Meyer, B. J. & Ptashne, M. (1978) Proc. Natl.Acad. Sci. USA 75, 1783-1787.

28. Johnson, A. D., Meyer, B. J. & Ptashne, M. (1979) Proc. Natl.Acad. Sci. USA 76, 5061-5065.

29. Kahmann, R. & Mertens, F. R. (1984) Cold Spring HarborSymp. Quant. Biol. 49, 285-294.

30. Johnson, R. C. & Simon, M. I. (1985) Cell 41, 781-791.31. Hoess, R. & Abremski, K. (1984) Proc. Natl. Acad. Sci. USA

81, 1026-1029.32. Hoess, R. H. & Abremski, K. (1985) J. Mol. Biol. 181,

351-362.33. Craig, N. L. & Nash, H. A. (1983) Cell 35, 795-803.

Genetics: Jayaram

Dow

nloa

ded

by g

uest

on

Dec

embe

r 16

, 202

0