International Journal of

Molecular Sciences

Article

Identification and Analysis of Mitogen-ActivatedProtein Kinase (MAPK) Cascades in Fragaria vesca

Heying Zhou dagger Suyue Ren dagger Yuanfang Han Qing Zhang Ling Qin and Yu Xing

Beijing Key Laboratory for Agricultural Application and New Technique College of Plant Science and TechnologyBeijing Collaborative Innovation Center for Eco-Environmental Improvement with Forestry and Fruit TreesBeijing University of Agriculture Beijing 102206 China zhydyx2012126com (HZ) fenhui315126com (SR)hanyuanfang186163com (YH) zhangqingbuaeducn (QZ) qinlingbuaeducn (LQ) Correspondence xingyubuaeducn Tel +86-10-8079-7229dagger These authors contributed equally to this work

Received 24 July 2017 Accepted 10 August 2017 Published 13 August 2017

Abstract Mitogen-activated protein kinase (MAPK) cascades are highly conserved signaling modulesin eukaryotes including yeasts plants and animals MAPK cascades are responsible for proteinphosphorylation during signal transduction events and typically consist of three protein kinasesMAPK MAPK kinase and MAPK kinase kinase In this current study we identified a total of12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and one FvMAPKKKK genes in the recently publishedFragaria vesca genome sequence This work reported the classification annotation and phylogeneticevaluation of these genes and an assessment of conserved motifs and the expression profilingof members of the gene family were also analyzed here The expression profiles of the MAPKand MAPKK genes in different organs and fruit developmental stages were further investigatedusing quantitative real-time reverse transcription PCR (qRT-PCR) Finally the MAPK and MAPKKexpression patterns in response to hormone and abiotic stresses (salt drought and high and lowtemperature) were investigated in fruit and leaves of F vesca The results provide a platform for furthercharacterization of the physiological and biochemical functions of MAPK cascades in strawberry

Keywords Fragaria vesca MAP kinase cascades phylogenetic relationships abiotic stressesgene expression

1 Introduction

Plants are influenced by different biotic or abiotic stresses thus in response have developeda few signaling networks to protect them at the molecular or cellular levels [1] A series ofinter-lined regulatory signaling networks is composed of some stress-activated molecular pathways [2]The protein-kinase-based cascades associated with responses to extracellular stimuli are themitogen-activated protein kinase (MAPK) cascades which are conserved components of signaltransduction pathways in eukaryotes ranging from yeast to plants and animals [3ndash6]

MAPK cascades involve protein phosphorylation events that contribute to signaling [3] andacknowledged eukaryotic MAPKs can be separated into three main subfamilies according to theirstructural characteristics which is often related to their functions in various signal transductionpathways The MAPK cascades classically are composed three protein kinases MAPK (MAPKMPK)MAPK kinase (MAPKKMKK) and MAPK kinase kinase (MAPKKKMAP3K) but sometimescontain a MAP3K kinase that phosphorylates the corresponding downstream substrates [78] MAPKcan catalyze the phosphorylation of a substrate protein by chemically adding phosphate groupsfrom adenosine triphosphate (ATP) [9] MAP3Ks are substantially serine or threonine kinases thatphosphorylate MAP2Ks at a conserved ST-X3minus5-ST motif [10ndash12] MAPKs have TDY and TEYphosphorylation motifs in their activation loops which can be phosphorylated by MAPKKs [19]

Int J Mol Sci 2017 18 1766 doi103390ijms18081766 wwwmdpicomjournalijms

Int J Mol Sci 2017 18 1766 2 of 18

Plant MAPKs can be separated into four groups (A B C and D) in which members of Groups A Band C possess the TEY motif at its phosphorylation site and members of Group D possesses the TDYmotif [1]

In plants MAPKs have been shown to phosphorylate different substrates such as cytoskeletonbinging proteins transcription factors and other kinases [313] Many genes that encode MAPKcascades have been characterized from Arabidopsis thaliana tobacco (Nicotiana tabacum) barley(Hordeum vulgare) maize (Zea mays) and rice (Oryza sativa) [10121415] In A thaliana a completeMAPK cascade (MEKK1-MKK45-MAPK36) triggered by bacterial flagellin-derived peptide flg22was characterized which up-regulated the expression of the transcription factors of WRKY2229 andthen increased resistance to both fungal and bacterial pathogens [16] CTR1 (the RAF-like MAP3K)plays an important role in leaf senescence and camalexin biosynthesis [1718] Many reports showedthat MAPK cascades involved in different stress responses such as drought salt cold or ABA treatmentin different crops [19ndash29] MKKs containing 11 catalytic subdomains are identified by a kinase domainand a KR-KR-KR-X1-6-L-X-LVS MAPK-docking domain and are functioned by phosphorylatedtheir conserved serine and threonine residues (ST-X3-5-ST motif) [5] MKKs can be classifiedinto four groups according to the description in A thaliana and rice and several MKKs have beencharacterized in a variety of plant species [30] Those MKKs are involved in several abiotic stressesIn A thaliana MKK1 mediated ABA induced CAT1 expression during drought stress the FSD23expressions were activated by MEKK1 via MKK5-MPK6-coupled signaling in salt stress and MKK5involved into high light induced CSD expressions [20ndash23] SIPK and WIPK activated by NtMEK2influenced cell death [31] and SIMKK played a key role in both salt- and elicitor-induced signals inalfalfa (Medicago sativa) [3233]

As the largest class of MAPK cascades the MAP3Ks can be divided into three subfamilies (MEKKRaf and ZIK) A conserved G(TS)Px(WYF)MAPEV kinase domain can be found in the members ofthe MEKK subfamily and in the ZIK subfamily most of the proteins have the GTPEFMAPE(LV)Ydomain while Raf subfamily members have the GTxx(WY)MAPE domain [8] The members of theRAF subfamily have a kinase domain in C-terminal and a long regulatory domain in their N-terminalcompared with the members in the ZIK subfamily which have the kinase domain in the N-terminal [34]In A thaliana MEKK1 has been shown to regulate defense responses against bacteria and fungi [35]and a Raf-like MAP3K AtEDR1 is involved in SA-inducible defense responses [36] The ZIK subfamilywhich contains 10 and 9 members in A thaliana and rice respectively regulates flowering time andcircadian rhythms [37]

The identification and characterization of different members of the MAPK cascades have beenreported by functional genomic studies in various plant species including A thaliana maize ricealfalfa tobacco and grapevine (Vitis vinifera) They comprise complex gene families which have beenbest studied in model plants such as A thaliana and rice [13538ndash41] There are at least 80 MAPKKKs10 MAPKKs and 20 MAPKs in the A thaliana genome whereas the rice genome contains at least75 MAPKKKs 8 MAPKKs and 17 MAPKs Few MAPK cascades have been identified in fruit cropsalthough 14 MAPKs 5 MAPKKs 62 MAPKKKs and 7 MAPKKKKs were identified in the grapevinegenome and less is known in their regulatory mechanism and function This is especially true formany fruit crops of horticultural value

It is unknown in their functions of most MAPK in plants but MAPK cascades have been identifiedin horticultural crops such as grapevine and cucumber (Cucumis sativus) [3442] In the currentstudy we identified a total of 12 FvMAPKs 7 FvMAPKKs 73 FvMAPKKKs and 1 FvMAPKKKK fromthe recently published strawberry (F vesca ldquoHawaii 4rdquo) genome [43] We report the classificationannotation and a phylogenetic evaluation of these genes and an assessment of conserved motifs and theresults of expression profiling of members of the gene family were also analyzed here The expressionpatterns of MAPK cascades genes in different organs and different fruit developmental stages werefurther analyzed using quantitative real-time reverse transcription PCR (qRT-PCR) and the gene

Int J Mol Sci 2017 18 1766 3 of 18

expression patterns in response to hormone and abiotic stress in leaves and fruit were also assessedThe results may provide information for further functional studies of this kind of kinases in strawberry

2 Results

21 Genome-Wide Identification of MAPK Cascade Genes in F vesca

A total of 12 MAPK 7 MAPKK 73 MAPKKK and 1 MAP4K open reading frames (ORFs) encodingputative MAPK cascade proteins were identified in the F vesca genomic [43] The number of FvMAPKgenes (12) was less than in A thaliana (20) and rice (17) Among them the lengths of the deducedproteins ranged from 365 amino acids (FvMPK9) to 691 residues (FvMPK3) and the pI values rangedfrom 505 (FvMPK9) to 926 (FvMPK2) The number of genes in the MAPKK subfamily (7) was evenlower than in A thaliana which has 10 members In this subfamily the full lengths of the proteinsequences ranged from 244 to 518 amino acids however the pI values were similar to the FvMAPKproteins and ranged from 534 (FvMAPKK5) to 928 (FvMAPKK2) Among the 73 MAPKKKs the pIvalues ranged from 450 to 1009 (Table 1)

To investigate the genetic divergence within the MAPK cascade genes as well as the geneduplication patterns the physical locations of the genes on the strawberry chromosomes wereinvestigated (Figure 1) Ninety-three genes were mapped on all seven chromosomes with distributionsfrom ranging from 11 to 17 Chromosomes 3 and 5 contained 17 MAPK cascade genes andchromosomes 6 1 7 2 and 4 contained 16 13 12 11 and 7 genes respectively

Int J Mol Sci 2017 18 1766 3 of 18

leaves and fruit were also assessed The results may provide information for further functional studies of this kind of kinases in strawberry

2 Results

21 Genome-Wide Identification of MAPK Cascade Genes in F vesca

A total of 12 MAPK 7 MAPKK 73 MAPKKK and 1 MAP4K open reading frames (ORFs) encoding putative MAPK cascade proteins were identified in the F vesca genomic [43] The number of FvMAPK genes (12) was less than in A thaliana (20) and rice (17) Among them the lengths of the deduced proteins ranged from 365 amino acids (FvMPK9) to 691 residues (FvMPK3) and the pI values ranged from 505 (FvMPK9) to 926 (FvMPK2) The number of genes in the MAPKK subfamily (7) was even lower than in A thaliana which has 10 members In this subfamily the full lengths of the protein sequences ranged from 244 to 518 amino acids however the pI values were similar to the FvMAPK proteins and ranged from 534 (FvMAPKK5) to 928 (FvMAPKK2) Among the 73 MAPKKKs the pI values ranged from 450 to 1009 (Table 1)

To investigate the genetic divergence within the MAPK cascade genes as well as the gene duplication patterns the physical locations of the genes on the strawberry chromosomes were investigated (Figure 1) Ninety-three genes were mapped on all seven chromosomes with distributions from ranging from 11 to 17 Chromosomes 3 and 5 contained 17 MAPK cascade genes and chromosomes 6 1 7 2 and 4 contained 16 13 12 11 and 7 genes respectively

Figure 1 Chromosomal locations of strawberry MAPK MAPKK MAPKKK and MAP4K genes Chr1ndashChr7 represent the seven chromosomes Black lines on bars indicate the locations of each gene

A phylogenetic tree was generated to provide insights into the evolutionary divergence of the MAPK cascade from a common ancestor and to infer evolutionary relationships among various genes or species All predicted MAPK cascade protein sequences and the corresponding A thaliana sequences were aligned and a rooted phylogenetic tree was constructed by aligning full length amino acid sequences (Figures 2 and 3) The FvMAPK sequences were further divided into four subfamilies based on the conserved threonine and tyrosine residues in the TEY and TDY motifs in their phosphorylation activation loop (Figure 3A) Only one MAP4K was identified and this was predicted to contain the conserved TFVGTPxWMAPEV motif

Figure 1 Chromosomal locations of strawberry MAPK MAPKK MAPKKK and MAP4K genesChr1ndashChr7 represent the seven chromosomes Black lines on bars indicate the locations of each gene

A phylogenetic tree was generated to provide insights into the evolutionary divergence of theMAPK cascade from a common ancestor and to infer evolutionary relationships among variousgenes or species All predicted MAPK cascade protein sequences and the corresponding A thalianasequences were aligned and a rooted phylogenetic tree was constructed by aligning full lengthamino acid sequences (Figures 2 and 3) The FvMAPK sequences were further divided into foursubfamilies based on the conserved threonine and tyrosine residues in the TEY and TDY motifs in theirphosphorylation activation loop (Figure 3A) Only one MAP4K was identified and this was predictedto contain the conserved TFVGTPxWMAPEV motif

Int J Mol Sci 2017 18 1766 4 of 18

Table 1 MAPK cascade proteins identified in the Fragaria vesca genome

Gene Name Gene ID Chr Location ORF (aa) mW (kDa) pI Instability Index Ai GRAVY Number of Exons

MAPKs

MAPK1 101290762 5 17846991788845 377 4324 64 4614 9053 minus037 6MAPK2 101294541 3 1115642011160717 609 6937 926 3232 8392 minus044 10MAPK3 101295052 5 1018896010193438 691 7845 786 4465 7596 minus064 11MAPK4 101295411 4 1306719113073043 561 6382 873 3624 774 minus048 10MAPK5 101297368 1 10814221084925 391 4471 565 3958 8982 minus028 5MAPK6 101300335 4 1860320218607991 580 6633 707 3818 8053 minus055 12MAPK7 101306152 6 2681961126825467 618 7068 923 3711 8112 minus047 10MAPK8 101306313 3 1969054919693371 371 4271 562 3946 9332 minus026 6MAPK9 101308652 3 1987036019873988 365 4185 505 4204 9534 minus028 6

MAPK10 101313449 7 45747234578939 373 4267 608 439 8938 minus033 6MAPK11 101313547 1 90411329043978 370 4264 832 3343 9432 minus024 3MAPK12 101314433 2 3225454532257169 372 4264 609 3846 9513 minus025 3

MAPKKs

MAPKK1 101296494 5 2101810121019144 347 3873 564 5827 8654 minus019 1MAPKK2 101298915 6 2645795826460120 365 4037 928 6036 7668 minus044 1MAPKK3 101299988 1 51163875119659 355 3986 614 511 9575 minus018 8MAPKK4 101300536 5 98585409860210 325 3628 801 5845 8252 minus026 1MAPKK5 101302771 6 3736887637372756 518 5753 534 4536 8963 minus015 9MAPKK6 101309937 5 14507081451997 244 2672 644 5661 8029 minus031 1MAPKK7 101310227 5 14593291461416 350 3886 601 6741 7606 minus035 1

MAPKKKs

MAPKKK1 101291312 2 3293299732939667 714 7816 958 5643 6679 minus055 10MAPKKK2 101291614 3 1395828613959565 311 3468 559 3915 799 minus031 1MAPKKK3 101291671 1 41013794109515 973 10854 703 4549 8131 minus042 15MAPKKK4 101291740 6 3697109836974966 384 4280 676 3676 7562 minus049 6MAPKKK5 101292378 2 1835793418361624 278 3177 966 4347 9612 minus004 8MAPKKK6 101292778 3 84050278408729 539 6114 957 5083 7636 minus057 4MAPKKK7 101292844 1 41733204175043 265 2970 577 4662 8347 minus040 1MAPKKK8 101293476 4 71053857111294 390 4369 648 3242 7923 minus044 7MAPKKK9 101294141 2 25889782594536 1126 12514 580 5166 7417 minus058 9MAPKKK10 101294311 7 20956252102937 1221 13558 547 4797 7209 minus061 9

Int J Mol Sci 2017 18 1766 5 of 18

Table 1 Cont

Gene Name Gene ID Chr Location ORF (aa) mW (kDa) pI Instability Index Ai GRAVY Number of Exons

MAPKKK11 101294663 5 1679080016799279 511 5561 861 5295 7977 minus045 8MAPKKK12 101294665 5 2465376424659548 591 6524 568 548 7093 minus059 9MAPKKK13 101294687 6 2508665225087498 214 2404 634 4953 829 minus047 2MAPKKK14 101295466 7 21677542172789 690 7610 623 3712 8451 minus024 15MAPKKK15 101295905 3 2600613226009750 415 4698 791 4022 867 minus043 12MAPKKK16 101296046 7 21797582185318 678 7520 552 3959 8745 minus022 15MAPKKK17 101296626 2 1777874417784528 570 6392 588 5583 8463 minus049 16MAPKKK18 101297008 1 1123608811240295 625 6899 927 6735 6882 minus054 11MAPKKK19 101297162 6 52430045248949 670 7451 597 5702 7143 minus053 17MAPKKK20 101298508 4 1768414917687733 434 4907 779 3692 8406 minus048 11MAPKKK21 101298797 5 29581272962070 404 4458 751 3714 8037 minus039 6MAPKKK22 101298822 6 3578569035790732 457 5178 610 4473 8407 minus046 13MAPKKK23 101299949 4 85530048558770 1092 12156 555 4315 7231 minus059 9MAPKKK24 101299957 5 29990073002862 347 3954 804 5215 8265 minus033 3MAPKKK25 101300060 5 10369411041266 697 7806 649 4446 7791 minus058 14MAPKKK26 101300175 1 11338111138366 475 5379 910 4471 8682 minus045 13MAPKKK27 101300188 7 404217406592 344 3794 576 3634 8846 minus007 1MAPKKK28 101300232 3 626166628364 407 4497 489 4756 7592 minus030 1MAPKKK29 101300748 6 105416107101 426 4779 888 454 8061 minus045 1MAPKKK30 101302206 1 33586133363681 995 10961 887 4356 7784 minus047 8MAPKKK31 101302247 3 2694096426947028 717 7993 570 4353 7798 minus033 10MAPKKK32 101302307 1 1002916610031248 415 4528 503 4691 8436 minus014 1MAPKKK33 101302624 3 42329644238052 458 5196 759 4966 9072 minus041 12MAPKKK34 101302797 7 1963344819634707 325 3669 872 3902 8098 minus036 1MAPKKK35 101303378 7 1963952719640520 322 3661 880 4045 8717 minus042 1MAPKKK36 101303395 2 2299293522998826 555 6175 630 4728 8674 minus036 16MAPKKK37 101303762 2 1471979514732427 554 6213 537 4228 8727 minus039 16MAPKKK38 101303943 7 620946625977 343 3774 605 3837 8703 minus010 3MAPKKK39 101304212 6 2590987725910863 328 3685 861 4291 8945 minus025 1MAPKKK40 101304439 2 1601834416021537 400 4429 753 301 7507 minus042 6MAPKKK41 101305170 6 2175947621761269 309 3491 467 3889 944 minus013 4MAPKKK42 101305413 7 57595115762791 444 4943 692 5558 8279 minus026 10MAPKKK43 101305446 3 2523315725239380 777 8622 683 5065 6851 minus066 13MAPKKK44 101305461 4 1240460712409591 677 7437 724 4743 7493 minus044 17

Int J Mol Sci 2017 18 1766 6 of 18

Table 1 Cont

Gene Name Gene ID Chr Location ORF (aa) mW (kDa) pI Instability Index Ai GRAVY Number of Exons

MAPKKK45 101305547 3 1501602315017869 447 4964 450 5048 8002 minus019 1MAPKKK46 101305739 3 57621425770103 1323 14589 511 4654 7592 minus056 9MAPKKK47 101305774 6 1313261813140647 845 9361 577 4472 8134 minus037 16MAPKKK48 101305797 1 22432522248966 1403 15280 525 4701 7302 minus052 10MAPKKK49 101307123 5 1749532317497199 405 4508 536 5535 7607 minus016 2MAPKKK50 101307418 6 3760187437604741 346 3884 721 4297 8491 minus024 6MAPKKK51 101307975 3 1314136213142841 488 5377 485 4932 7904 minus015 1MAPKKK52 101308436 2 2047217320477216 927 10152 536 4352 8395 minus032 13MAPKKK53 101308592 6 1588339615899615 765 8591 577 5123 8058 minus041 18MAPKKK54 101308868 5 15734201580407 902 9841 944 6015 6401 minus060 12MAPKKK55 101309867 1 80844508090390 572 6491 569 4985 835 minus043 16MAPKKK56 101309911 3 949163951911 374 4266 896 4665 811 minus042 3MAPKKK57 101310026 5 1017421710182364 1034 11294 553 4891 8121 minus044 13MAPKKK58 101310764 7 2236511822371514 903 9723 971 6572 6298 minus059 12MAPKKK59 101312454 5 2679636926801049 390 4424 557 436 8349 minus040 6MAPKKK60 101312659 6 2097441620976740 433 4951 510 3722 8379 minus048 5MAPKKK61 101312816 3 2525580525265535 794 8906 609 5014 7649 minus045 17MAPKKK62 101312898 2 98594129866665 1192 13083 515 482 8005 minus044 9MAPKKK63 101313105 3 2526993825276589 710 8027 732 4181 7839 minus048 13MAPKKK64 101313212 5 57646445768035 350 3978 643 4669 8309 minus030 7MAPKKK65 101313251 1 1606427416069495 618 6706 922 5262 6738 minus053 11MAPKKK66 101313299 3 2691406626919397 239 2717 923 3057 9669 minus021 11MAPKKK67 101315161 6 67071786711235 358 4009 903 3993 8802 minus030 6MAPKKK68 101315443 6 93407100195 918 10048 591 4443 7724 minus045 13MAPKKK69 105349270 7 57641745768902 438 4717 1009 5937 7792 minus048 10MAPKKK70 105349796 2 1835555618356787 219 2473 873 4283 8945 minus021 4MAPKKK71 105351460 1 1082311810824804 351 3906 497 4776 7359 minus036 1MAPKKK72 105351574 5 1316239613164156 298 3363 684 5069 8208 minus043 1MAPKKK73 105353223 7 51440135149034 682 7782 815 446 8776 minus040 13

MAPKKKKs

MAP4K1 101308962 4 1722231317230075 821 9020 521 4782 7106 minus054 18

Int J Mol Sci 2017 18 1766 7 of 18

The division of the FvMAPK sequences into four distinct groups was consistent with previousreports [1437] FvMAPK1 FvMAPK9 and FvMAPK10 clustered within Group I MAPKs are involvedin both abiotic stress responses and cell division in A thaliana [2324] FvMAPK5 and FvMAPK8belonged to Group II together with AtMPK3 and AtMPK6 and Group III includes FvMAPK11and FvMAPK12 and members from this group in other plant species are known to be regulated byboth biotic and abiotic stresses [25] The largest group was Group IV which included five members(FvMAPK2 FvMAPK3 FvMAPK4 FvMAPK6 and FvMAPK7) with the TDY motif in their T-loopand the absence of the C-terminal CD domain which is consistently present in members of the otherMAPK groups

Int J Mol Sci 2017 18 1766 7 of 18

The division of the FvMAPK sequences into four distinct groups was consistent with previous reports [1437] FvMAPK1 FvMAPK9 and FvMAPK10 clustered within Group I MAPKs are involved in both abiotic stress responses and cell division in A thaliana [2324] FvMAPK5 and FvMAPK8 belonged to Group II together with AtMPK3 and AtMPK6 and Group III includes FvMAPK11 and FvMAPK12 and members from this group in other plant species are known to be regulated by both biotic and abiotic stresses [25] The largest group was Group IV which included five members (FvMAPK2 FvMAPK3 FvMAPK4 FvMAPK6 and FvMAPK7) with the TDY motif in their T-loop and the absence of the C-terminal CD domain which is consistently present in members of the other MAPK groups

Figure 2 Phylogenetic relationships between strawberry MAPK cascade proteins The abbreviations of MAPK cascade proteins are as follows MAPK Mitogen-activated Protein Kinase red lines MAPKK MAPK Kinase green lines MAPKKK MAPKK Kinase blue lines MAP4K MAPKKK Kinase purple lines

Figure 2 Phylogenetic relationships between strawberry MAPK cascade proteins The abbreviationsof MAPK cascade proteins are as follows MAPK Mitogen-activated Protein Kinase red linesMAPKK MAPK Kinase green lines MAPKKK MAPKK Kinase blue lines MAP4K MAPKKKKinase purple lines

Int J Mol Sci 2017 18 1766 8 of 18Int J Mol Sci 2017 18 1766 8 of 18

Figure 3 Phylogenetic relationships between MAPK cascade proteins from Arabidopsis thaliana and strawberry (A) phylogenetic relationship between A thaliana and FvMAPK proteins red lines show TEY group (B) phylogenetic relationship between A thaliana and FvMAPKK proteins green lines show TDY group and (C) phylogenetic relationship between A thaliana and FvMAPKKK proteins MAPKKK forms the largest group of MAPK cascade proteins with 73 members classified into two subfamilies MEKK (green lines) and Raf (red lines) which contain 30 and 43 genes in the Fragaria vesca and A thaliana genomes (D) Phylogenetic relationship between A thaliana and strawberry MAPKKKK proteins

Seven members of the MAPKK subfamily similar to the AtMAPKKs could also be divided into four groups FvMAPKK1 FvMAPKK3 and FvMAPKK5 were most similar to AtMPKK10 AtMPKK6 and AtMPKK3 respectively while FvMPKK2 is homologous to AtMPKK4AtMPKK5 FvMPKK4 -6 and -7 and AtMPKK7 -8 and -9 clustered into the same group (Figure 3B)

MAPKKKs are activated by either phosphorylation by other MAPKKK kinases or by G proteins and G protein-coupled receptors With 73 members the MAPKKK subfamily represented the largest subfamily of a similar size to that in rice (75 members) larger than that in grape (62 members) but smaller than that in A thaliana (80 members) Generally the members of this subfamily can be classified into three groups the MEKK subfamily the ZIK subfamily and the Raf subfamily however only two groups were identified in the strawberry genome In total there were 30 FvMAPKKKs in the MEKK subfamily and 43 in the Raf subfamily with no ZIK members identified (Figure 3C)

Although several MAP4Ks have been reported in plant genomes based on phylogenetic analyses of their kinase domain little is known about the roles of MAPKKKKs in plants Only one member was identified in F vesca (Figure 3D)

22 Expression Profiles of FvMAPKs and FvMAPKKs in Different Organs and Fruit Developmental Stages

Expression profiles provide some useful clues to gene functions To investigate the putative involvement of FvMAPK and FvMAPKK genes in strawberry growth and development the expression patterns of all of these genes were analyzed under normal growth conditions in four different organs (leaves roots stems and fruits) at various developmental stages Of the 19 predicted genes all were expressed in at least one of the four organs (Figure 4) FvMPK7 and FvMPK10 showed high expression in leaves and FvMPK10 and FvMPK11 were highly expressed in fruits FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in all organs while FvMAPKK6 and FvMAPKK7 were only expressed in leaves and FvMAPKK1 and FvMAPKK3 did not express any of the different organs under normal growth conditions

Figure 3 Phylogenetic relationships between MAPK cascade proteins from Arabidopsis thalianaand strawberry (A) phylogenetic relationship between A thaliana and FvMAPK proteins red linesshow TEY group (B) phylogenetic relationship between A thaliana and FvMAPKK proteins greenlines show TDY group and (C) phylogenetic relationship between A thaliana and FvMAPKKKproteins MAPKKK forms the largest group of MAPK cascade proteins with 73 members classifiedinto two subfamilies MEKK (green lines) and Raf (red lines) which contain 30 and 43 genes in theFragaria vesca and A thaliana genomes (D) Phylogenetic relationship between A thaliana and strawberryMAPKKKK proteins

Seven members of the MAPKK subfamily similar to the AtMAPKKs could also be divided intofour groups FvMAPKK1 FvMAPKK3 and FvMAPKK5 were most similar to AtMPKK10 AtMPKK6and AtMPKK3 respectively while FvMPKK2 is homologous to AtMPKK4AtMPKK5 FvMPKK4 -6and -7 and AtMPKK7 -8 and -9 clustered into the same group (Figure 3B)

MAPKKKs are activated by either phosphorylation by other MAPKKK kinases or by G proteinsand G protein-coupled receptors With 73 members the MAPKKK subfamily represented the largestsubfamily of a similar size to that in rice (75 members) larger than that in grape (62 members) butsmaller than that in A thaliana (80 members) Generally the members of this subfamily can beclassified into three groups the MEKK subfamily the ZIK subfamily and the Raf subfamily howeveronly two groups were identified in the strawberry genome In total there were 30 FvMAPKKKs in theMEKK subfamily and 43 in the Raf subfamily with no ZIK members identified (Figure 3C)

Although several MAP4Ks have been reported in plant genomes based on phylogenetic analysesof their kinase domain little is known about the roles of MAPKKKKs in plants Only one member wasidentified in F vesca (Figure 3D)

22 Expression Profiles of FvMAPKs and FvMAPKKs in Different Organs and Fruit Developmental Stages

Expression profiles provide some useful clues to gene functions To investigate the putativeinvolvement of FvMAPK and FvMAPKK genes in strawberry growth and development the expressionpatterns of all of these genes were analyzed under normal growth conditions in four different organs(leaves roots stems and fruits) at various developmental stages Of the 19 predicted genes all wereexpressed in at least one of the four organs (Figure 4) FvMPK7 and FvMPK10 showed high expressionin leaves and FvMPK10 and FvMPK11 were highly expressed in fruits FvMAPKK2 FvMAPKK4 andFvMAPKK5 were expressed in all organs while FvMAPKK6 and FvMAPKK7 were only expressed inleaves and FvMAPKK1 and FvMAPKK3 did not express any of the different organs under normalgrowth conditions

Int J Mol Sci 2017 18 1766 9 of 18Int J Mol Sci 2017 18 1766 9 of 18

Figure 4 Expression patterns of FvMPKs and FvMPKKs in different organs X-axis is the relative expression while Y-axis is MAPK and MAPKK genes white box root blue box stem green box leave red box fruit

We also determined the expression of FvMAPK cascade genes in different fruit developmental stages The transcript levels of FvMAPK2 and FvMAPK12 were lower than any other of the genes in all the different fruit developmental stages For the remaining 10 genes the expression patterns could be roughly divided into three categories FvMAPK3 FvMAPK4 and FvMAPK11 showed the same expression patterns which increased through development FvMAPK1 FvMAPK9 and FvMAPK10 expression however declined during fruit development Finally there were six genes (FvMAPK5 FvMAPK6 FvMAPK7 and FvMAPK8) that showed a high expression in the early stages then a decrease and later an increase in the later stages of fruit development In the FvMAPKKs subfamily only FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in fruits at a detectable level and they had the same expression patterns which gradually rose through fruit development (Figure 5) Since F vesca is a new model for investigating non-climacteric fruit development and ripening we focused on determining the expression profiles of the FvMAPKKK subfamily to different fruit developmental stages The expression profiles of the FvMAPKKK genes revealed a much higher expression in early stages than in later ripening or senescing stages indicating that they are most likely related to signal transduction during development in metabolically active tissues (Figure 6) Some FvMAPKKK transcripts showed higher levels in earlier than later stages of fruit development while others showed the opposite pattern This information can be important for further investigation of the signal transduction pathways involved in the regulation of fruit development and ripening in which different MAPKKK subfamily members may be involved

Figure 4 Expression patterns of FvMPKs and FvMPKKs in different organs X-axis is the relativeexpression while Y-axis is MAPK and MAPKK genes white box root blue box stem green box leavered box fruit

We also determined the expression of FvMAPK cascade genes in different fruit developmentalstages The transcript levels of FvMAPK2 and FvMAPK12 were lower than any other of the genes inall the different fruit developmental stages For the remaining 10 genes the expression patternscould be roughly divided into three categories FvMAPK3 FvMAPK4 and FvMAPK11 showedthe same expression patterns which increased through development FvMAPK1 FvMAPK9 andFvMAPK10 expression however declined during fruit development Finally there were six genes(FvMAPK5 FvMAPK6 FvMAPK7 and FvMAPK8) that showed a high expression in the early stagesthen a decrease and later an increase in the later stages of fruit development In the FvMAPKKssubfamily only FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in fruits at a detectablelevel and they had the same expression patterns which gradually rose through fruit development(Figure 5) Since F vesca is a new model for investigating non-climacteric fruit development andripening we focused on determining the expression profiles of the FvMAPKKK subfamily to differentfruit developmental stages The expression profiles of the FvMAPKKK genes revealed a much higherexpression in early stages than in later ripening or senescing stages indicating that they are most likelyrelated to signal transduction during development in metabolically active tissues (Figure 6) SomeFvMAPKKK transcripts showed higher levels in earlier than later stages of fruit development whileothers showed the opposite pattern This information can be important for further investigation of thesignal transduction pathways involved in the regulation of fruit development and ripening in whichdifferent MAPKKK subfamily members may be involved

Int J Mol Sci 2017 18 1766 10 of 18Int J Mol Sci 2017 18 1766 10 of 18

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis is the relative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental stages The gene expression levels were showed by the color box from blue to red indicating from low to high for each gene 18ndash42 DAF five developmental stages of days after flowering

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis is therelative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental stages ofdays after flowering

Int J Mol Sci 2017 18 1766 10 of 18

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis

is the relative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental

stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental

stages The gene expression levels were showed by the color box from blue to red indicating from

low to high for each gene 18ndash42 DAF five developmental stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental stagesThe gene expression levels were showed by the color box from blue to red indicating from low to highfor each gene 18ndash42 DAF five developmental stages of days after flowering

Int J Mol Sci 2017 18 1766 11 of 18

23 Gene Expression Profiles of FvMAPKs and FvMAPKKs in Response to Hormones and Abiotic Stresses inF vesca Leaves

We investigated whether salt drought low temperature and exogenous application of thehormones indole acetic acid (IAA) and abscisic acid (ABA) would induce expression of the FvMAPKand FvMAPKK genes in seedling leaves using qRT-PCR analysis After cold treatment most of thetested genes showed a large expression increase 48 h after treatment Among them was MAPK2whose expression increased in early stages before decreasing In general drought stress resulted inthe induction of the greatest number of genes and a significantly improved in the process 12 daysIn response to salt stress the expression of five FvMAPK genes (FvMAPK5 -9 -10 -11 and -12) and threeFvMAPKK genes (FvMAPKK1 -3 and -5) increased Interestingly the transcript levels of FvMAPKK3were specifically activated by salt stress and not by the other treatments The expression of FvMAPK3and -12 and FvMAPKK4 -5 and -6 was activated by ABA while the IAA treatment only resulted in achange in FvMAPKK4 expression which was up-regulated two days after treatment (Figure 7)

Int J Mol Sci 2017 18 1766 11 of 18

23 Gene Expression Profiles of FvMAPKs and FvMAPKKs in Response to Hormones and Abiotic

Stresses in F vesca Leaves

We investigated whether salt drought low temperature and exogenous application of the

hormones indole acetic acid (IAA) and abscisic acid (ABA) would induce expression of the

FvMAPK and FvMAPKK genes in seedling leaves using qRT-PCR analysis After cold treatment

most of the tested genes showed a large expression increase 48 h after treatment Among them was

MAPK2 whose expression increased in early stages before decreasing In general drought stress

resulted in the induction of the greatest number of genes and a significantly improved in the

process 12 days In response to salt stress the expression of five FvMAPK genes (FvMAPK5 -9 -10

-11 and -12) and three FvMAPKK genes (FvMAPKK1 -3 and -5) increased Interestingly the

transcript levels of FvMAPKK3 were specifically activated by salt stress and not by the other

treatments The expression of FvMAPK3 and -12 and FvMAPKK4 -5 and -6 was activated by ABA

while the IAA treatment only resulted in a change in FvMAPKK4 expression which was

up-regulated two days after treatment (Figure 7)

Figure 7 Expression patterns of FvMPK and FvMPKK genes after different stress and hormone

treatments of leaves in Fragaria vesca Leaves were harvested every two days (0 2 4 6 8 10 and 12

days) after treatment Abscisic acid (ABA) (100 μM) indole-3-acetic acid (IAA) (100 μM) NaCl (100

mM) and drought treatments Leaves from the low temperature treatment were collected at 0 4 8

12 24 48 and 72 h after cold stress application

24 Expression Patterns of FvMAPK and FvMAPKK Genes in Response to Sucrose Hormones and

Abiotic Stresses in F vesca Fruits

The expression patterns of the FvMAPK and FvMAPKK genes at an early stage (18 DAF days

after flowering) and a late stage (36 DAF) of fruit development in response to exogenous IAA ABA

and sucrose treatment and drought high temperature or low temperature stresses were also

examined by qRT-PCR analyses Almost all showed a higher expression level in the early than in

the later stage It was interesting that the transcript levels of almost all the genes were up-regulated

in response to IAA drought and low temperature treatment at the early stage of fruit development

(18 DAF) During low temperature stress the expression of 17 of the 19 genes increased

significantly at 18 DAF while the transcript levels of FvMAPK3 FvMAPKK1 FvMAPKK3

FvMAPKK6 and FvMAPKK7 were significantly up-regulated by high temperature treatment even

Figure 7 Expression patterns of FvMPK and FvMPKK genes after different stress and hormonetreatments of leaves in Fragaria vesca Leaves were harvested every two days (0 2 4 6 8 10 and12 days) after treatment Abscisic acid (ABA) (100 microM) indole-3-acetic acid (IAA) (100 microM) NaCl(100 mM) and drought treatments Leaves from the low temperature treatment were collected at 0 4 812 24 48 and 72 h after cold stress application

24 Expression Patterns of FvMAPK and FvMAPKK Genes in Response to Sucrose Hormones and AbioticStresses in F vesca Fruits

The expression patterns of the FvMAPK and FvMAPKK genes at an early stage (18 DAF daysafter flowering) and a late stage (36 DAF) of fruit development in response to exogenous IAA ABAand sucrose treatment and drought high temperature or low temperature stresses were also examinedby qRT-PCR analyses Almost all showed a higher expression level in the early than in the later stageIt was interesting that the transcript levels of almost all the genes were up-regulated in responseto IAA drought and low temperature treatment at the early stage of fruit development (18 DAF)During low temperature stress the expression of 17 of the 19 genes increased significantly at 18 DAFwhile the transcript levels of FvMAPK3 FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 weresignificantly up-regulated by high temperature treatment even though the expression of FvMAPKK1

Int J Mol Sci 2017 18 1766 12 of 18

FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions(Figure 8)

Int J Mol Sci 2017 18 1766 12 of 18

though the expression of FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions (Figure 8)

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stress pre-treatments Red and blue boxes indicate high and low expression levels respectively for each gene Six treatments Abscisic acid (ABA) 100 μM indole-3-acetic acid (IAA) 100 μM Suc sucrose 50 μM Dry drought treatment High high temperature (40 degC) Low low temperature (4 degC) Con controlled trials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yet been comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and 1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genome while at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genome even though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome (~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and 5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similar in size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that of A thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based on phylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogenetically characterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Only one MAP4K member was identified in the F vesca genome but the ORF showed strong similarity to ScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles in ovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based on the conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinase subdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to each other FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference in length is usually due to variation in the length of the domain or a variable number of introns and may indicate the absence or presence of motifs which can affect the functional specificity There are 10 and 7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins ranged in size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members of the FvMAPKKK subfamily were distributed to all the

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stresspre-treatments Red and blue boxes indicate high and low expression levels respectively for each geneSix treatments Abscisic acid (ABA) 100 microM indole-3-acetic acid (IAA) 100 microM Suc sucrose 50 microMDry drought treatment High high temperature (40 C) Low low temperature (4 C) Con controlledtrials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yetbeen comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genomewhile at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genomeeven though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome(~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similarin size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that ofA thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based onphylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogeneticallycharacterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Onlyone MAP4K member was identified in the F vesca genome but the ORF showed strong similarity toScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles inovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based onthe conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinasesubdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to eachother FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference inlength is usually due to variation in the length of the domain or a variable number of introns and mayindicate the absence or presence of motifs which can affect the functional specificity There are 10 and7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins rangedin size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members

Int J Mol Sci 2017 18 1766 13 of 18

of the FvMAPKKK subfamily were distributed to all the chromosomes and shared 12ndash34 identitywith each other with a sequence length ranging from 214 to 1403 amino acids A kinase domainin the C-terminal and a long regulatory domain in the N- terminal region were identified in mostFvMAPKKKs suggesting that the specific long regulatory domain exited in the N-terminal of theRAF subfamily may involve in specify the kinase activity and regulating protein interaction [45] It isinteresting that no FvMAPKKK was found that belonged to the ZIK subfamily which in other specieshas members with a conserved GTPEFMAPE (LV) Y signature The absence of the characteristic ZIKsubfamily feature in F vesca might suggest the presence of a slightly modified RAF domain instead ofthe typical ZIK domain as reported in Vitis [42]

As the last two steps of the MAPK cascade MAPK and MAPKK link upstream kinases anddownstream substrates As dual-specificity kinases MAPKKs can be activated and phosphorylatedby MAPKKKs via phosphorylation of ThrSer residues while MAPKKs also phosphorylate thedownstream MAPKs and activated MAPKs can phosphorylate different substrates including othertranscription factors kinases and cytoskeleton binding proteins [3] The MAPK cascade protein(MAP4K-MAPKKK-MAPKK-MAPK) family is large and the functions of the various members canbe complex Though there are many members identified in the MAPKKK and MAP4K subfamilieslittle is known about the MAPKs and MAPKKs In this study we mainly focused our gene expressionpattern analysis on the MAPK and MAPKK genes We evaluated the expression patterns of all ofthe predicted members of the FvMAPK and FvMAPKK subfamily in different strawberry organs anddevelopmental stages The expression of most of the FvMAPK and FvMAPKK genes was detected in thestrawberry organs investigated possibly reflecting their involvement in a common metabolic andordevelopmental process Among them FvMAPK7 FvMAPK10 and FvMAPKK2 showed significantlyhigher expression in leaves than in other organs and FvMAPKK6 and FvMAPKK7 were specificallyexpressed in leaves whereas the FvMAPK6 transcripts were not be detected in leaves indicatingdifferent functions for divergent family members

Stress-specific increased MAPK genes and kinase activity has been identified when plantsare suffering from a variety of abiotic stresses including drought cold high salinity ozone UVirradiation and oxidative stress [46ndash49] Plant hormones were detected playing a role in trigger stressresponses and developmental pathways with other signaling molecules [4650ndash52] The componentsof MEKK1 MKK2 MPK4 andor MPK6 respond to drought salt or cold stressed were characterizedin A thaliana [2247] We studied the interaction between hormone and gene expression patterns instrawberry fruit FvMAPK5 and FvMAPK8 belong to group II which contains well-characterizedMAPK genes including AtMAPK3 and AtMAPK6 It has been reported that AtMAPK3 can be activatedin response to abiotic stresses and pathogens and AtMAPK6 also plays a role in abiotic and bioticstresses [10395354] Similarly we speculate that FvMAPK5 and FvMAPK8 are important for abioticor biotic stress responses due to their transcriptional activation by cold and drought FvMAPK1FvMAPK9 and FvMAPK10 are clustered in Group I while also includes AtMAPK4 AtMAPK5AtMAPK11 AtMAPK12 and AtMAPK13 AtMPK4 and its upstream MAPKK AtMKK2 are involvedin both biotic and abiotic stresses The expression patterns of FvMAPK1 FvMAPK9 and FvMAPK10were similar in fruits but not in leaves suggesting different functions depending on the organ [55]

In A thaliana AtMPKK3 is up-regulated in response to ABA [46] and FvMPKK5 which showedthe highest homology to AtMPKK3 showed strong activation by ABA in leaves suggesting asimilar function Interestingly AtMKK1AtMKK2 which are activated by salt drought and coldstresses [2223] and their ortholog FvMAPKK3 showed specific activation by salt stress in leaves andsignificant expression changes due to cold and heat stress

Int J Mol Sci 2017 18 1766 14 of 18

4 Materials and Methods

41 Identification of Potential MAPK Cascade Gene Family Members in Strawberry

To identify a complete list of strawberry MAPK cascade genes we used two public databases theNational Centre for Biotechnology Information (NCBI httpwwwncbinlmnihgov) and F vescaBioView Gene Model Database (httpsstrawberryplantandfoodconz)

42 Phylogenetic Analysis of A Thaliana and the Strawberry MAPK Cascade Genes

Phylogenetic analysis was performed using the MEGA 51 software (USA) and theneighbor-joining method Bootstrap values were calculated for 1000 iterations [5657] The A thalianaMAPK cascades gene family database was obtained from TAIR (The A thaliana Information Resourcehttpwwwarabidopsisorg) and used for comparative analysis

43 Plant Material and Fruit Pre-Treatments

F vesca (ldquoHawaii 4rdquo) plants were grown on a growth chamber at 22 plusmn 1 C in a 1311 h darklightphotoperiod Fruit samples were harvested every 6 days starting of the 18 days after flowering (18 2430 36 and 42 DAF) At each developmental stage ten representative fruits were sampled and tissueswere immediately frozen in liquid nitrogen and stored at minus80 C until further use In order to obtaindifferent pre-treatment experimental fruits two stages (18 and 36 DAF) were selected for sucrose andhormone treatments The fruits were cut in half longitudinally and half was used as a control whilethe other half was used for processing The different treatments used in this work were indole-3-aceticacid (IAA) abscisic acid (ABA) and sucrose at a concentration of 100 100 and 50 microM respectively Thehigh and low temperature was 40 C and 4 C All other experiments were performed at 25 C

44 The Processing of Strawberry Leaves under Different Stress and Hormone Treatments

To investigate the induced expression patterns of the FvMAPK and FvMAPKK genes in seedlingleaves in response to various treatments 30 days old soil grown seedlings were used For salt stresstreatment seedlings were irrigated in 100 mM NaCl collected 2 4 6 8 10 and 12 days after salttreatment of leaves without salt stress as control For the drought stress treatment all plants werestopped to water after full irrigation watering then clipping the leaves in 2 4 6 8 10 and 12 daysand no drought stress as the control respectively For the cold treatment seedlings were maintainedat 0 C and leaf material collected at 4 8 12 24 48 and 72 h Leaves cultivated in a growth chamberat 22 plusmn 1 C were used as controls For the hormone treatments plants were sprayed with solutionscontaining 100 microM ABA or 100 microM IAA then leaves were collected after 2 4 6 8 10 and 12 daysPlants that had not been sprayed served as the controls Samples were immediately frozen in liquidnitrogen and stored at minus80 C

45 RNA Extraction and Real-Time PCR Analysis

Total RNA was isolated from strawberry fruits harvested at 18 24 30 36 and 42 DAF usingthe Plant RNA Kit (Omega USA) according to the manufacturerrsquos instructions and total RNA wasreverse transcribed into cDNA using the Invitrogen reverse transcription kit (SuperScriptIII ReverseTranscriptase USA) Real-time PCR was performed to confirm gene expression patterns using a LightCyclerreg 96 SW11 Real Time PCR System (Roche Germany) with SYBR-Green (Takara Dalian China)The primer sequences used are designed based on gene sequences and the Beacon designer softwareand are shown in Table 2 in this study Each reaction consists of 5 microL SYBR 35 microL ddH2O 1 microL dilutedtemplate (1 microL of the generated first-strand cDNA diluted by 9 microL ddH2O) and 025 microL of each of twogene specific primers Thermal cycling conditions were 95 C for 10 min then 40 cycles at 95 C for20 s 54 C for 20 s 72 C for 20 s

Int J Mol Sci 2017 18 1766 3 of 18

expression patterns in response to hormone and abiotic stress in leaves and fruit were also assessedThe results may provide information for further functional studies of this kind of kinases in strawberry

2 Results

21 Genome-Wide Identification of MAPK Cascade Genes in F vesca

A total of 12 MAPK 7 MAPKK 73 MAPKKK and 1 MAP4K open reading frames (ORFs) encodingputative MAPK cascade proteins were identified in the F vesca genomic [43] The number of FvMAPKgenes (12) was less than in A thaliana (20) and rice (17) Among them the lengths of the deducedproteins ranged from 365 amino acids (FvMPK9) to 691 residues (FvMPK3) and the pI values rangedfrom 505 (FvMPK9) to 926 (FvMPK2) The number of genes in the MAPKK subfamily (7) was evenlower than in A thaliana which has 10 members In this subfamily the full lengths of the proteinsequences ranged from 244 to 518 amino acids however the pI values were similar to the FvMAPKproteins and ranged from 534 (FvMAPKK5) to 928 (FvMAPKK2) Among the 73 MAPKKKs the pIvalues ranged from 450 to 1009 (Table 1)

To investigate the genetic divergence within the MAPK cascade genes as well as the geneduplication patterns the physical locations of the genes on the strawberry chromosomes wereinvestigated (Figure 1) Ninety-three genes were mapped on all seven chromosomes with distributionsfrom ranging from 11 to 17 Chromosomes 3 and 5 contained 17 MAPK cascade genes andchromosomes 6 1 7 2 and 4 contained 16 13 12 11 and 7 genes respectively

Int J Mol Sci 2017 18 1766 3 of 18

leaves and fruit were also assessed The results may provide information for further functional studies of this kind of kinases in strawberry

2 Results

21 Genome-Wide Identification of MAPK Cascade Genes in F vesca

A total of 12 MAPK 7 MAPKK 73 MAPKKK and 1 MAP4K open reading frames (ORFs) encoding putative MAPK cascade proteins were identified in the F vesca genomic [43] The number of FvMAPK genes (12) was less than in A thaliana (20) and rice (17) Among them the lengths of the deduced proteins ranged from 365 amino acids (FvMPK9) to 691 residues (FvMPK3) and the pI values ranged from 505 (FvMPK9) to 926 (FvMPK2) The number of genes in the MAPKK subfamily (7) was even lower than in A thaliana which has 10 members In this subfamily the full lengths of the protein sequences ranged from 244 to 518 amino acids however the pI values were similar to the FvMAPK proteins and ranged from 534 (FvMAPKK5) to 928 (FvMAPKK2) Among the 73 MAPKKKs the pI values ranged from 450 to 1009 (Table 1)

To investigate the genetic divergence within the MAPK cascade genes as well as the gene duplication patterns the physical locations of the genes on the strawberry chromosomes were investigated (Figure 1) Ninety-three genes were mapped on all seven chromosomes with distributions from ranging from 11 to 17 Chromosomes 3 and 5 contained 17 MAPK cascade genes and chromosomes 6 1 7 2 and 4 contained 16 13 12 11 and 7 genes respectively

Figure 1 Chromosomal locations of strawberry MAPK MAPKK MAPKKK and MAP4K genes Chr1ndashChr7 represent the seven chromosomes Black lines on bars indicate the locations of each gene

A phylogenetic tree was generated to provide insights into the evolutionary divergence of the MAPK cascade from a common ancestor and to infer evolutionary relationships among various genes or species All predicted MAPK cascade protein sequences and the corresponding A thaliana sequences were aligned and a rooted phylogenetic tree was constructed by aligning full length amino acid sequences (Figures 2 and 3) The FvMAPK sequences were further divided into four subfamilies based on the conserved threonine and tyrosine residues in the TEY and TDY motifs in their phosphorylation activation loop (Figure 3A) Only one MAP4K was identified and this was predicted to contain the conserved TFVGTPxWMAPEV motif

Figure 1 Chromosomal locations of strawberry MAPK MAPKK MAPKKK and MAP4K genesChr1ndashChr7 represent the seven chromosomes Black lines on bars indicate the locations of each gene

A phylogenetic tree was generated to provide insights into the evolutionary divergence of theMAPK cascade from a common ancestor and to infer evolutionary relationships among variousgenes or species All predicted MAPK cascade protein sequences and the corresponding A thalianasequences were aligned and a rooted phylogenetic tree was constructed by aligning full lengthamino acid sequences (Figures 2 and 3) The FvMAPK sequences were further divided into foursubfamilies based on the conserved threonine and tyrosine residues in the TEY and TDY motifs in theirphosphorylation activation loop (Figure 3A) Only one MAP4K was identified and this was predictedto contain the conserved TFVGTPxWMAPEV motif

Int J Mol Sci 2017 18 1766 4 of 18

Table 1 MAPK cascade proteins identified in the Fragaria vesca genome

Gene Name Gene ID Chr Location ORF (aa) mW (kDa) pI Instability Index Ai GRAVY Number of Exons

MAPKs

MAPK1 101290762 5 17846991788845 377 4324 64 4614 9053 minus037 6MAPK2 101294541 3 1115642011160717 609 6937 926 3232 8392 minus044 10MAPK3 101295052 5 1018896010193438 691 7845 786 4465 7596 minus064 11MAPK4 101295411 4 1306719113073043 561 6382 873 3624 774 minus048 10MAPK5 101297368 1 10814221084925 391 4471 565 3958 8982 minus028 5MAPK6 101300335 4 1860320218607991 580 6633 707 3818 8053 minus055 12MAPK7 101306152 6 2681961126825467 618 7068 923 3711 8112 minus047 10MAPK8 101306313 3 1969054919693371 371 4271 562 3946 9332 minus026 6MAPK9 101308652 3 1987036019873988 365 4185 505 4204 9534 minus028 6

MAPK10 101313449 7 45747234578939 373 4267 608 439 8938 minus033 6MAPK11 101313547 1 90411329043978 370 4264 832 3343 9432 minus024 3MAPK12 101314433 2 3225454532257169 372 4264 609 3846 9513 minus025 3

MAPKKs

MAPKK1 101296494 5 2101810121019144 347 3873 564 5827 8654 minus019 1MAPKK2 101298915 6 2645795826460120 365 4037 928 6036 7668 minus044 1MAPKK3 101299988 1 51163875119659 355 3986 614 511 9575 minus018 8MAPKK4 101300536 5 98585409860210 325 3628 801 5845 8252 minus026 1MAPKK5 101302771 6 3736887637372756 518 5753 534 4536 8963 minus015 9MAPKK6 101309937 5 14507081451997 244 2672 644 5661 8029 minus031 1MAPKK7 101310227 5 14593291461416 350 3886 601 6741 7606 minus035 1

MAPKKKs

MAPKKK1 101291312 2 3293299732939667 714 7816 958 5643 6679 minus055 10MAPKKK2 101291614 3 1395828613959565 311 3468 559 3915 799 minus031 1MAPKKK3 101291671 1 41013794109515 973 10854 703 4549 8131 minus042 15MAPKKK4 101291740 6 3697109836974966 384 4280 676 3676 7562 minus049 6MAPKKK5 101292378 2 1835793418361624 278 3177 966 4347 9612 minus004 8MAPKKK6 101292778 3 84050278408729 539 6114 957 5083 7636 minus057 4MAPKKK7 101292844 1 41733204175043 265 2970 577 4662 8347 minus040 1MAPKKK8 101293476 4 71053857111294 390 4369 648 3242 7923 minus044 7MAPKKK9 101294141 2 25889782594536 1126 12514 580 5166 7417 minus058 9MAPKKK10 101294311 7 20956252102937 1221 13558 547 4797 7209 minus061 9

Int J Mol Sci 2017 18 1766 5 of 18

Table 1 Cont

Gene Name Gene ID Chr Location ORF (aa) mW (kDa) pI Instability Index Ai GRAVY Number of Exons

MAPKKK11 101294663 5 1679080016799279 511 5561 861 5295 7977 minus045 8MAPKKK12 101294665 5 2465376424659548 591 6524 568 548 7093 minus059 9MAPKKK13 101294687 6 2508665225087498 214 2404 634 4953 829 minus047 2MAPKKK14 101295466 7 21677542172789 690 7610 623 3712 8451 minus024 15MAPKKK15 101295905 3 2600613226009750 415 4698 791 4022 867 minus043 12MAPKKK16 101296046 7 21797582185318 678 7520 552 3959 8745 minus022 15MAPKKK17 101296626 2 1777874417784528 570 6392 588 5583 8463 minus049 16MAPKKK18 101297008 1 1123608811240295 625 6899 927 6735 6882 minus054 11MAPKKK19 101297162 6 52430045248949 670 7451 597 5702 7143 minus053 17MAPKKK20 101298508 4 1768414917687733 434 4907 779 3692 8406 minus048 11MAPKKK21 101298797 5 29581272962070 404 4458 751 3714 8037 minus039 6MAPKKK22 101298822 6 3578569035790732 457 5178 610 4473 8407 minus046 13MAPKKK23 101299949 4 85530048558770 1092 12156 555 4315 7231 minus059 9MAPKKK24 101299957 5 29990073002862 347 3954 804 5215 8265 minus033 3MAPKKK25 101300060 5 10369411041266 697 7806 649 4446 7791 minus058 14MAPKKK26 101300175 1 11338111138366 475 5379 910 4471 8682 minus045 13MAPKKK27 101300188 7 404217406592 344 3794 576 3634 8846 minus007 1MAPKKK28 101300232 3 626166628364 407 4497 489 4756 7592 minus030 1MAPKKK29 101300748 6 105416107101 426 4779 888 454 8061 minus045 1MAPKKK30 101302206 1 33586133363681 995 10961 887 4356 7784 minus047 8MAPKKK31 101302247 3 2694096426947028 717 7993 570 4353 7798 minus033 10MAPKKK32 101302307 1 1002916610031248 415 4528 503 4691 8436 minus014 1MAPKKK33 101302624 3 42329644238052 458 5196 759 4966 9072 minus041 12MAPKKK34 101302797 7 1963344819634707 325 3669 872 3902 8098 minus036 1MAPKKK35 101303378 7 1963952719640520 322 3661 880 4045 8717 minus042 1MAPKKK36 101303395 2 2299293522998826 555 6175 630 4728 8674 minus036 16MAPKKK37 101303762 2 1471979514732427 554 6213 537 4228 8727 minus039 16MAPKKK38 101303943 7 620946625977 343 3774 605 3837 8703 minus010 3MAPKKK39 101304212 6 2590987725910863 328 3685 861 4291 8945 minus025 1MAPKKK40 101304439 2 1601834416021537 400 4429 753 301 7507 minus042 6MAPKKK41 101305170 6 2175947621761269 309 3491 467 3889 944 minus013 4MAPKKK42 101305413 7 57595115762791 444 4943 692 5558 8279 minus026 10MAPKKK43 101305446 3 2523315725239380 777 8622 683 5065 6851 minus066 13MAPKKK44 101305461 4 1240460712409591 677 7437 724 4743 7493 minus044 17

Int J Mol Sci 2017 18 1766 6 of 18

Table 1 Cont

Gene Name Gene ID Chr Location ORF (aa) mW (kDa) pI Instability Index Ai GRAVY Number of Exons

MAPKKK45 101305547 3 1501602315017869 447 4964 450 5048 8002 minus019 1MAPKKK46 101305739 3 57621425770103 1323 14589 511 4654 7592 minus056 9MAPKKK47 101305774 6 1313261813140647 845 9361 577 4472 8134 minus037 16MAPKKK48 101305797 1 22432522248966 1403 15280 525 4701 7302 minus052 10MAPKKK49 101307123 5 1749532317497199 405 4508 536 5535 7607 minus016 2MAPKKK50 101307418 6 3760187437604741 346 3884 721 4297 8491 minus024 6MAPKKK51 101307975 3 1314136213142841 488 5377 485 4932 7904 minus015 1MAPKKK52 101308436 2 2047217320477216 927 10152 536 4352 8395 minus032 13MAPKKK53 101308592 6 1588339615899615 765 8591 577 5123 8058 minus041 18MAPKKK54 101308868 5 15734201580407 902 9841 944 6015 6401 minus060 12MAPKKK55 101309867 1 80844508090390 572 6491 569 4985 835 minus043 16MAPKKK56 101309911 3 949163951911 374 4266 896 4665 811 minus042 3MAPKKK57 101310026 5 1017421710182364 1034 11294 553 4891 8121 minus044 13MAPKKK58 101310764 7 2236511822371514 903 9723 971 6572 6298 minus059 12MAPKKK59 101312454 5 2679636926801049 390 4424 557 436 8349 minus040 6MAPKKK60 101312659 6 2097441620976740 433 4951 510 3722 8379 minus048 5MAPKKK61 101312816 3 2525580525265535 794 8906 609 5014 7649 minus045 17MAPKKK62 101312898 2 98594129866665 1192 13083 515 482 8005 minus044 9MAPKKK63 101313105 3 2526993825276589 710 8027 732 4181 7839 minus048 13MAPKKK64 101313212 5 57646445768035 350 3978 643 4669 8309 minus030 7MAPKKK65 101313251 1 1606427416069495 618 6706 922 5262 6738 minus053 11MAPKKK66 101313299 3 2691406626919397 239 2717 923 3057 9669 minus021 11MAPKKK67 101315161 6 67071786711235 358 4009 903 3993 8802 minus030 6MAPKKK68 101315443 6 93407100195 918 10048 591 4443 7724 minus045 13MAPKKK69 105349270 7 57641745768902 438 4717 1009 5937 7792 minus048 10MAPKKK70 105349796 2 1835555618356787 219 2473 873 4283 8945 minus021 4MAPKKK71 105351460 1 1082311810824804 351 3906 497 4776 7359 minus036 1MAPKKK72 105351574 5 1316239613164156 298 3363 684 5069 8208 minus043 1MAPKKK73 105353223 7 51440135149034 682 7782 815 446 8776 minus040 13

MAPKKKKs

MAP4K1 101308962 4 1722231317230075 821 9020 521 4782 7106 minus054 18

Int J Mol Sci 2017 18 1766 7 of 18

The division of the FvMAPK sequences into four distinct groups was consistent with previousreports [1437] FvMAPK1 FvMAPK9 and FvMAPK10 clustered within Group I MAPKs are involvedin both abiotic stress responses and cell division in A thaliana [2324] FvMAPK5 and FvMAPK8belonged to Group II together with AtMPK3 and AtMPK6 and Group III includes FvMAPK11and FvMAPK12 and members from this group in other plant species are known to be regulated byboth biotic and abiotic stresses [25] The largest group was Group IV which included five members(FvMAPK2 FvMAPK3 FvMAPK4 FvMAPK6 and FvMAPK7) with the TDY motif in their T-loopand the absence of the C-terminal CD domain which is consistently present in members of the otherMAPK groups

Int J Mol Sci 2017 18 1766 7 of 18

The division of the FvMAPK sequences into four distinct groups was consistent with previous reports [1437] FvMAPK1 FvMAPK9 and FvMAPK10 clustered within Group I MAPKs are involved in both abiotic stress responses and cell division in A thaliana [2324] FvMAPK5 and FvMAPK8 belonged to Group II together with AtMPK3 and AtMPK6 and Group III includes FvMAPK11 and FvMAPK12 and members from this group in other plant species are known to be regulated by both biotic and abiotic stresses [25] The largest group was Group IV which included five members (FvMAPK2 FvMAPK3 FvMAPK4 FvMAPK6 and FvMAPK7) with the TDY motif in their T-loop and the absence of the C-terminal CD domain which is consistently present in members of the other MAPK groups

Figure 2 Phylogenetic relationships between strawberry MAPK cascade proteins The abbreviations of MAPK cascade proteins are as follows MAPK Mitogen-activated Protein Kinase red lines MAPKK MAPK Kinase green lines MAPKKK MAPKK Kinase blue lines MAP4K MAPKKK Kinase purple lines

Figure 2 Phylogenetic relationships between strawberry MAPK cascade proteins The abbreviationsof MAPK cascade proteins are as follows MAPK Mitogen-activated Protein Kinase red linesMAPKK MAPK Kinase green lines MAPKKK MAPKK Kinase blue lines MAP4K MAPKKKKinase purple lines

Int J Mol Sci 2017 18 1766 8 of 18Int J Mol Sci 2017 18 1766 8 of 18

Figure 3 Phylogenetic relationships between MAPK cascade proteins from Arabidopsis thaliana and strawberry (A) phylogenetic relationship between A thaliana and FvMAPK proteins red lines show TEY group (B) phylogenetic relationship between A thaliana and FvMAPKK proteins green lines show TDY group and (C) phylogenetic relationship between A thaliana and FvMAPKKK proteins MAPKKK forms the largest group of MAPK cascade proteins with 73 members classified into two subfamilies MEKK (green lines) and Raf (red lines) which contain 30 and 43 genes in the Fragaria vesca and A thaliana genomes (D) Phylogenetic relationship between A thaliana and strawberry MAPKKKK proteins

Seven members of the MAPKK subfamily similar to the AtMAPKKs could also be divided into four groups FvMAPKK1 FvMAPKK3 and FvMAPKK5 were most similar to AtMPKK10 AtMPKK6 and AtMPKK3 respectively while FvMPKK2 is homologous to AtMPKK4AtMPKK5 FvMPKK4 -6 and -7 and AtMPKK7 -8 and -9 clustered into the same group (Figure 3B)

MAPKKKs are activated by either phosphorylation by other MAPKKK kinases or by G proteins and G protein-coupled receptors With 73 members the MAPKKK subfamily represented the largest subfamily of a similar size to that in rice (75 members) larger than that in grape (62 members) but smaller than that in A thaliana (80 members) Generally the members of this subfamily can be classified into three groups the MEKK subfamily the ZIK subfamily and the Raf subfamily however only two groups were identified in the strawberry genome In total there were 30 FvMAPKKKs in the MEKK subfamily and 43 in the Raf subfamily with no ZIK members identified (Figure 3C)

Although several MAP4Ks have been reported in plant genomes based on phylogenetic analyses of their kinase domain little is known about the roles of MAPKKKKs in plants Only one member was identified in F vesca (Figure 3D)

22 Expression Profiles of FvMAPKs and FvMAPKKs in Different Organs and Fruit Developmental Stages

Expression profiles provide some useful clues to gene functions To investigate the putative involvement of FvMAPK and FvMAPKK genes in strawberry growth and development the expression patterns of all of these genes were analyzed under normal growth conditions in four different organs (leaves roots stems and fruits) at various developmental stages Of the 19 predicted genes all were expressed in at least one of the four organs (Figure 4) FvMPK7 and FvMPK10 showed high expression in leaves and FvMPK10 and FvMPK11 were highly expressed in fruits FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in all organs while FvMAPKK6 and FvMAPKK7 were only expressed in leaves and FvMAPKK1 and FvMAPKK3 did not express any of the different organs under normal growth conditions

Figure 3 Phylogenetic relationships between MAPK cascade proteins from Arabidopsis thalianaand strawberry (A) phylogenetic relationship between A thaliana and FvMAPK proteins red linesshow TEY group (B) phylogenetic relationship between A thaliana and FvMAPKK proteins greenlines show TDY group and (C) phylogenetic relationship between A thaliana and FvMAPKKKproteins MAPKKK forms the largest group of MAPK cascade proteins with 73 members classifiedinto two subfamilies MEKK (green lines) and Raf (red lines) which contain 30 and 43 genes in theFragaria vesca and A thaliana genomes (D) Phylogenetic relationship between A thaliana and strawberryMAPKKKK proteins

Seven members of the MAPKK subfamily similar to the AtMAPKKs could also be divided intofour groups FvMAPKK1 FvMAPKK3 and FvMAPKK5 were most similar to AtMPKK10 AtMPKK6and AtMPKK3 respectively while FvMPKK2 is homologous to AtMPKK4AtMPKK5 FvMPKK4 -6and -7 and AtMPKK7 -8 and -9 clustered into the same group (Figure 3B)

MAPKKKs are activated by either phosphorylation by other MAPKKK kinases or by G proteinsand G protein-coupled receptors With 73 members the MAPKKK subfamily represented the largestsubfamily of a similar size to that in rice (75 members) larger than that in grape (62 members) butsmaller than that in A thaliana (80 members) Generally the members of this subfamily can beclassified into three groups the MEKK subfamily the ZIK subfamily and the Raf subfamily howeveronly two groups were identified in the strawberry genome In total there were 30 FvMAPKKKs in theMEKK subfamily and 43 in the Raf subfamily with no ZIK members identified (Figure 3C)

Although several MAP4Ks have been reported in plant genomes based on phylogenetic analysesof their kinase domain little is known about the roles of MAPKKKKs in plants Only one member wasidentified in F vesca (Figure 3D)

22 Expression Profiles of FvMAPKs and FvMAPKKs in Different Organs and Fruit Developmental Stages

Expression profiles provide some useful clues to gene functions To investigate the putativeinvolvement of FvMAPK and FvMAPKK genes in strawberry growth and development the expressionpatterns of all of these genes were analyzed under normal growth conditions in four different organs(leaves roots stems and fruits) at various developmental stages Of the 19 predicted genes all wereexpressed in at least one of the four organs (Figure 4) FvMPK7 and FvMPK10 showed high expressionin leaves and FvMPK10 and FvMPK11 were highly expressed in fruits FvMAPKK2 FvMAPKK4 andFvMAPKK5 were expressed in all organs while FvMAPKK6 and FvMAPKK7 were only expressed inleaves and FvMAPKK1 and FvMAPKK3 did not express any of the different organs under normalgrowth conditions

Int J Mol Sci 2017 18 1766 9 of 18Int J Mol Sci 2017 18 1766 9 of 18

Figure 4 Expression patterns of FvMPKs and FvMPKKs in different organs X-axis is the relative expression while Y-axis is MAPK and MAPKK genes white box root blue box stem green box leave red box fruit

We also determined the expression of FvMAPK cascade genes in different fruit developmental stages The transcript levels of FvMAPK2 and FvMAPK12 were lower than any other of the genes in all the different fruit developmental stages For the remaining 10 genes the expression patterns could be roughly divided into three categories FvMAPK3 FvMAPK4 and FvMAPK11 showed the same expression patterns which increased through development FvMAPK1 FvMAPK9 and FvMAPK10 expression however declined during fruit development Finally there were six genes (FvMAPK5 FvMAPK6 FvMAPK7 and FvMAPK8) that showed a high expression in the early stages then a decrease and later an increase in the later stages of fruit development In the FvMAPKKs subfamily only FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in fruits at a detectable level and they had the same expression patterns which gradually rose through fruit development (Figure 5) Since F vesca is a new model for investigating non-climacteric fruit development and ripening we focused on determining the expression profiles of the FvMAPKKK subfamily to different fruit developmental stages The expression profiles of the FvMAPKKK genes revealed a much higher expression in early stages than in later ripening or senescing stages indicating that they are most likely related to signal transduction during development in metabolically active tissues (Figure 6) Some FvMAPKKK transcripts showed higher levels in earlier than later stages of fruit development while others showed the opposite pattern This information can be important for further investigation of the signal transduction pathways involved in the regulation of fruit development and ripening in which different MAPKKK subfamily members may be involved

Figure 4 Expression patterns of FvMPKs and FvMPKKs in different organs X-axis is the relativeexpression while Y-axis is MAPK and MAPKK genes white box root blue box stem green box leavered box fruit

We also determined the expression of FvMAPK cascade genes in different fruit developmentalstages The transcript levels of FvMAPK2 and FvMAPK12 were lower than any other of the genes inall the different fruit developmental stages For the remaining 10 genes the expression patternscould be roughly divided into three categories FvMAPK3 FvMAPK4 and FvMAPK11 showedthe same expression patterns which increased through development FvMAPK1 FvMAPK9 andFvMAPK10 expression however declined during fruit development Finally there were six genes(FvMAPK5 FvMAPK6 FvMAPK7 and FvMAPK8) that showed a high expression in the early stagesthen a decrease and later an increase in the later stages of fruit development In the FvMAPKKssubfamily only FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in fruits at a detectablelevel and they had the same expression patterns which gradually rose through fruit development(Figure 5) Since F vesca is a new model for investigating non-climacteric fruit development andripening we focused on determining the expression profiles of the FvMAPKKK subfamily to differentfruit developmental stages The expression profiles of the FvMAPKKK genes revealed a much higherexpression in early stages than in later ripening or senescing stages indicating that they are most likelyrelated to signal transduction during development in metabolically active tissues (Figure 6) SomeFvMAPKKK transcripts showed higher levels in earlier than later stages of fruit development whileothers showed the opposite pattern This information can be important for further investigation of thesignal transduction pathways involved in the regulation of fruit development and ripening in whichdifferent MAPKKK subfamily members may be involved

Int J Mol Sci 2017 18 1766 10 of 18Int J Mol Sci 2017 18 1766 10 of 18

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis is the relative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental stages The gene expression levels were showed by the color box from blue to red indicating from low to high for each gene 18ndash42 DAF five developmental stages of days after flowering

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis is therelative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental stages ofdays after flowering

Int J Mol Sci 2017 18 1766 10 of 18

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis

is the relative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental

stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental

stages The gene expression levels were showed by the color box from blue to red indicating from

low to high for each gene 18ndash42 DAF five developmental stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental stagesThe gene expression levels were showed by the color box from blue to red indicating from low to highfor each gene 18ndash42 DAF five developmental stages of days after flowering

Int J Mol Sci 2017 18 1766 11 of 18

23 Gene Expression Profiles of FvMAPKs and FvMAPKKs in Response to Hormones and Abiotic Stresses inF vesca Leaves

We investigated whether salt drought low temperature and exogenous application of thehormones indole acetic acid (IAA) and abscisic acid (ABA) would induce expression of the FvMAPKand FvMAPKK genes in seedling leaves using qRT-PCR analysis After cold treatment most of thetested genes showed a large expression increase 48 h after treatment Among them was MAPK2whose expression increased in early stages before decreasing In general drought stress resulted inthe induction of the greatest number of genes and a significantly improved in the process 12 daysIn response to salt stress the expression of five FvMAPK genes (FvMAPK5 -9 -10 -11 and -12) and threeFvMAPKK genes (FvMAPKK1 -3 and -5) increased Interestingly the transcript levels of FvMAPKK3were specifically activated by salt stress and not by the other treatments The expression of FvMAPK3and -12 and FvMAPKK4 -5 and -6 was activated by ABA while the IAA treatment only resulted in achange in FvMAPKK4 expression which was up-regulated two days after treatment (Figure 7)

Int J Mol Sci 2017 18 1766 11 of 18

23 Gene Expression Profiles of FvMAPKs and FvMAPKKs in Response to Hormones and Abiotic

Stresses in F vesca Leaves

We investigated whether salt drought low temperature and exogenous application of the

hormones indole acetic acid (IAA) and abscisic acid (ABA) would induce expression of the

FvMAPK and FvMAPKK genes in seedling leaves using qRT-PCR analysis After cold treatment

most of the tested genes showed a large expression increase 48 h after treatment Among them was

MAPK2 whose expression increased in early stages before decreasing In general drought stress

resulted in the induction of the greatest number of genes and a significantly improved in the

process 12 days In response to salt stress the expression of five FvMAPK genes (FvMAPK5 -9 -10

-11 and -12) and three FvMAPKK genes (FvMAPKK1 -3 and -5) increased Interestingly the

transcript levels of FvMAPKK3 were specifically activated by salt stress and not by the other

treatments The expression of FvMAPK3 and -12 and FvMAPKK4 -5 and -6 was activated by ABA

while the IAA treatment only resulted in a change in FvMAPKK4 expression which was

up-regulated two days after treatment (Figure 7)

Figure 7 Expression patterns of FvMPK and FvMPKK genes after different stress and hormone

treatments of leaves in Fragaria vesca Leaves were harvested every two days (0 2 4 6 8 10 and 12

days) after treatment Abscisic acid (ABA) (100 μM) indole-3-acetic acid (IAA) (100 μM) NaCl (100

mM) and drought treatments Leaves from the low temperature treatment were collected at 0 4 8

12 24 48 and 72 h after cold stress application

24 Expression Patterns of FvMAPK and FvMAPKK Genes in Response to Sucrose Hormones and

Abiotic Stresses in F vesca Fruits

The expression patterns of the FvMAPK and FvMAPKK genes at an early stage (18 DAF days

after flowering) and a late stage (36 DAF) of fruit development in response to exogenous IAA ABA

and sucrose treatment and drought high temperature or low temperature stresses were also

examined by qRT-PCR analyses Almost all showed a higher expression level in the early than in

the later stage It was interesting that the transcript levels of almost all the genes were up-regulated

in response to IAA drought and low temperature treatment at the early stage of fruit development

(18 DAF) During low temperature stress the expression of 17 of the 19 genes increased

significantly at 18 DAF while the transcript levels of FvMAPK3 FvMAPKK1 FvMAPKK3

FvMAPKK6 and FvMAPKK7 were significantly up-regulated by high temperature treatment even

Figure 7 Expression patterns of FvMPK and FvMPKK genes after different stress and hormonetreatments of leaves in Fragaria vesca Leaves were harvested every two days (0 2 4 6 8 10 and12 days) after treatment Abscisic acid (ABA) (100 microM) indole-3-acetic acid (IAA) (100 microM) NaCl(100 mM) and drought treatments Leaves from the low temperature treatment were collected at 0 4 812 24 48 and 72 h after cold stress application

24 Expression Patterns of FvMAPK and FvMAPKK Genes in Response to Sucrose Hormones and AbioticStresses in F vesca Fruits

The expression patterns of the FvMAPK and FvMAPKK genes at an early stage (18 DAF daysafter flowering) and a late stage (36 DAF) of fruit development in response to exogenous IAA ABAand sucrose treatment and drought high temperature or low temperature stresses were also examinedby qRT-PCR analyses Almost all showed a higher expression level in the early than in the later stageIt was interesting that the transcript levels of almost all the genes were up-regulated in responseto IAA drought and low temperature treatment at the early stage of fruit development (18 DAF)During low temperature stress the expression of 17 of the 19 genes increased significantly at 18 DAFwhile the transcript levels of FvMAPK3 FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 weresignificantly up-regulated by high temperature treatment even though the expression of FvMAPKK1

Int J Mol Sci 2017 18 1766 12 of 18

FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions(Figure 8)

Int J Mol Sci 2017 18 1766 12 of 18

though the expression of FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions (Figure 8)

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stress pre-treatments Red and blue boxes indicate high and low expression levels respectively for each gene Six treatments Abscisic acid (ABA) 100 μM indole-3-acetic acid (IAA) 100 μM Suc sucrose 50 μM Dry drought treatment High high temperature (40 degC) Low low temperature (4 degC) Con controlled trials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yet been comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and 1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genome while at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genome even though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome (~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and 5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similar in size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that of A thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based on phylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogenetically characterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Only one MAP4K member was identified in the F vesca genome but the ORF showed strong similarity to ScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles in ovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based on the conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinase subdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to each other FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference in length is usually due to variation in the length of the domain or a variable number of introns and may indicate the absence or presence of motifs which can affect the functional specificity There are 10 and 7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins ranged in size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members of the FvMAPKKK subfamily were distributed to all the

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stresspre-treatments Red and blue boxes indicate high and low expression levels respectively for each geneSix treatments Abscisic acid (ABA) 100 microM indole-3-acetic acid (IAA) 100 microM Suc sucrose 50 microMDry drought treatment High high temperature (40 C) Low low temperature (4 C) Con controlledtrials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yetbeen comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genomewhile at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genomeeven though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome(~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similarin size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that ofA thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based onphylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogeneticallycharacterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Onlyone MAP4K member was identified in the F vesca genome but the ORF showed strong similarity toScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles inovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based onthe conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinasesubdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to eachother FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference inlength is usually due to variation in the length of the domain or a variable number of introns and mayindicate the absence or presence of motifs which can affect the functional specificity There are 10 and7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins rangedin size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members

Int J Mol Sci 2017 18 1766 13 of 18

of the FvMAPKKK subfamily were distributed to all the chromosomes and shared 12ndash34 identitywith each other with a sequence length ranging from 214 to 1403 amino acids A kinase domainin the C-terminal and a long regulatory domain in the N- terminal region were identified in mostFvMAPKKKs suggesting that the specific long regulatory domain exited in the N-terminal of theRAF subfamily may involve in specify the kinase activity and regulating protein interaction [45] It isinteresting that no FvMAPKKK was found that belonged to the ZIK subfamily which in other specieshas members with a conserved GTPEFMAPE (LV) Y signature The absence of the characteristic ZIKsubfamily feature in F vesca might suggest the presence of a slightly modified RAF domain instead ofthe typical ZIK domain as reported in Vitis [42]

As the last two steps of the MAPK cascade MAPK and MAPKK link upstream kinases anddownstream substrates As dual-specificity kinases MAPKKs can be activated and phosphorylatedby MAPKKKs via phosphorylation of ThrSer residues while MAPKKs also phosphorylate thedownstream MAPKs and activated MAPKs can phosphorylate different substrates including othertranscription factors kinases and cytoskeleton binding proteins [3] The MAPK cascade protein(MAP4K-MAPKKK-MAPKK-MAPK) family is large and the functions of the various members canbe complex Though there are many members identified in the MAPKKK and MAP4K subfamilieslittle is known about the MAPKs and MAPKKs In this study we mainly focused our gene expressionpattern analysis on the MAPK and MAPKK genes We evaluated the expression patterns of all ofthe predicted members of the FvMAPK and FvMAPKK subfamily in different strawberry organs anddevelopmental stages The expression of most of the FvMAPK and FvMAPKK genes was detected in thestrawberry organs investigated possibly reflecting their involvement in a common metabolic andordevelopmental process Among them FvMAPK7 FvMAPK10 and FvMAPKK2 showed significantlyhigher expression in leaves than in other organs and FvMAPKK6 and FvMAPKK7 were specificallyexpressed in leaves whereas the FvMAPK6 transcripts were not be detected in leaves indicatingdifferent functions for divergent family members

Stress-specific increased MAPK genes and kinase activity has been identified when plantsare suffering from a variety of abiotic stresses including drought cold high salinity ozone UVirradiation and oxidative stress [46ndash49] Plant hormones were detected playing a role in trigger stressresponses and developmental pathways with other signaling molecules [4650ndash52] The componentsof MEKK1 MKK2 MPK4 andor MPK6 respond to drought salt or cold stressed were characterizedin A thaliana [2247] We studied the interaction between hormone and gene expression patterns instrawberry fruit FvMAPK5 and FvMAPK8 belong to group II which contains well-characterizedMAPK genes including AtMAPK3 and AtMAPK6 It has been reported that AtMAPK3 can be activatedin response to abiotic stresses and pathogens and AtMAPK6 also plays a role in abiotic and bioticstresses [10395354] Similarly we speculate that FvMAPK5 and FvMAPK8 are important for abioticor biotic stress responses due to their transcriptional activation by cold and drought FvMAPK1FvMAPK9 and FvMAPK10 are clustered in Group I while also includes AtMAPK4 AtMAPK5AtMAPK11 AtMAPK12 and AtMAPK13 AtMPK4 and its upstream MAPKK AtMKK2 are involvedin both biotic and abiotic stresses The expression patterns of FvMAPK1 FvMAPK9 and FvMAPK10were similar in fruits but not in leaves suggesting different functions depending on the organ [55]

In A thaliana AtMPKK3 is up-regulated in response to ABA [46] and FvMPKK5 which showedthe highest homology to AtMPKK3 showed strong activation by ABA in leaves suggesting asimilar function Interestingly AtMKK1AtMKK2 which are activated by salt drought and coldstresses [2223] and their ortholog FvMAPKK3 showed specific activation by salt stress in leaves andsignificant expression changes due to cold and heat stress

Int J Mol Sci 2017 18 1766 14 of 18

4 Materials and Methods

41 Identification of Potential MAPK Cascade Gene Family Members in Strawberry

To identify a complete list of strawberry MAPK cascade genes we used two public databases theNational Centre for Biotechnology Information (NCBI httpwwwncbinlmnihgov) and F vescaBioView Gene Model Database (httpsstrawberryplantandfoodconz)

42 Phylogenetic Analysis of A Thaliana and the Strawberry MAPK Cascade Genes

Phylogenetic analysis was performed using the MEGA 51 software (USA) and theneighbor-joining method Bootstrap values were calculated for 1000 iterations [5657] The A thalianaMAPK cascades gene family database was obtained from TAIR (The A thaliana Information Resourcehttpwwwarabidopsisorg) and used for comparative analysis

43 Plant Material and Fruit Pre-Treatments

F vesca (ldquoHawaii 4rdquo) plants were grown on a growth chamber at 22 plusmn 1 C in a 1311 h darklightphotoperiod Fruit samples were harvested every 6 days starting of the 18 days after flowering (18 2430 36 and 42 DAF) At each developmental stage ten representative fruits were sampled and tissueswere immediately frozen in liquid nitrogen and stored at minus80 C until further use In order to obtaindifferent pre-treatment experimental fruits two stages (18 and 36 DAF) were selected for sucrose andhormone treatments The fruits were cut in half longitudinally and half was used as a control whilethe other half was used for processing The different treatments used in this work were indole-3-aceticacid (IAA) abscisic acid (ABA) and sucrose at a concentration of 100 100 and 50 microM respectively Thehigh and low temperature was 40 C and 4 C All other experiments were performed at 25 C

44 The Processing of Strawberry Leaves under Different Stress and Hormone Treatments

To investigate the induced expression patterns of the FvMAPK and FvMAPKK genes in seedlingleaves in response to various treatments 30 days old soil grown seedlings were used For salt stresstreatment seedlings were irrigated in 100 mM NaCl collected 2 4 6 8 10 and 12 days after salttreatment of leaves without salt stress as control For the drought stress treatment all plants werestopped to water after full irrigation watering then clipping the leaves in 2 4 6 8 10 and 12 daysand no drought stress as the control respectively For the cold treatment seedlings were maintainedat 0 C and leaf material collected at 4 8 12 24 48 and 72 h Leaves cultivated in a growth chamberat 22 plusmn 1 C were used as controls For the hormone treatments plants were sprayed with solutionscontaining 100 microM ABA or 100 microM IAA then leaves were collected after 2 4 6 8 10 and 12 daysPlants that had not been sprayed served as the controls Samples were immediately frozen in liquidnitrogen and stored at minus80 C

45 RNA Extraction and Real-Time PCR Analysis

Total RNA was isolated from strawberry fruits harvested at 18 24 30 36 and 42 DAF usingthe Plant RNA Kit (Omega USA) according to the manufacturerrsquos instructions and total RNA wasreverse transcribed into cDNA using the Invitrogen reverse transcription kit (SuperScriptIII ReverseTranscriptase USA) Real-time PCR was performed to confirm gene expression patterns using a LightCyclerreg 96 SW11 Real Time PCR System (Roche Germany) with SYBR-Green (Takara Dalian China)The primer sequences used are designed based on gene sequences and the Beacon designer softwareand are shown in Table 2 in this study Each reaction consists of 5 microL SYBR 35 microL ddH2O 1 microL dilutedtemplate (1 microL of the generated first-strand cDNA diluted by 9 microL ddH2O) and 025 microL of each of twogene specific primers Thermal cycling conditions were 95 C for 10 min then 40 cycles at 95 C for20 s 54 C for 20 s 72 C for 20 s

Int J Mol Sci 2017 18 1766 4 of 18

Table 1 MAPK cascade proteins identified in the Fragaria vesca genome

Gene Name Gene ID Chr Location ORF (aa) mW (kDa) pI Instability Index Ai GRAVY Number of Exons

MAPKs

MAPK1 101290762 5 17846991788845 377 4324 64 4614 9053 minus037 6MAPK2 101294541 3 1115642011160717 609 6937 926 3232 8392 minus044 10MAPK3 101295052 5 1018896010193438 691 7845 786 4465 7596 minus064 11MAPK4 101295411 4 1306719113073043 561 6382 873 3624 774 minus048 10MAPK5 101297368 1 10814221084925 391 4471 565 3958 8982 minus028 5MAPK6 101300335 4 1860320218607991 580 6633 707 3818 8053 minus055 12MAPK7 101306152 6 2681961126825467 618 7068 923 3711 8112 minus047 10MAPK8 101306313 3 1969054919693371 371 4271 562 3946 9332 minus026 6MAPK9 101308652 3 1987036019873988 365 4185 505 4204 9534 minus028 6

MAPK10 101313449 7 45747234578939 373 4267 608 439 8938 minus033 6MAPK11 101313547 1 90411329043978 370 4264 832 3343 9432 minus024 3MAPK12 101314433 2 3225454532257169 372 4264 609 3846 9513 minus025 3

MAPKKs

MAPKK1 101296494 5 2101810121019144 347 3873 564 5827 8654 minus019 1MAPKK2 101298915 6 2645795826460120 365 4037 928 6036 7668 minus044 1MAPKK3 101299988 1 51163875119659 355 3986 614 511 9575 minus018 8MAPKK4 101300536 5 98585409860210 325 3628 801 5845 8252 minus026 1MAPKK5 101302771 6 3736887637372756 518 5753 534 4536 8963 minus015 9MAPKK6 101309937 5 14507081451997 244 2672 644 5661 8029 minus031 1MAPKK7 101310227 5 14593291461416 350 3886 601 6741 7606 minus035 1

MAPKKKs

MAPKKK1 101291312 2 3293299732939667 714 7816 958 5643 6679 minus055 10MAPKKK2 101291614 3 1395828613959565 311 3468 559 3915 799 minus031 1MAPKKK3 101291671 1 41013794109515 973 10854 703 4549 8131 minus042 15MAPKKK4 101291740 6 3697109836974966 384 4280 676 3676 7562 minus049 6MAPKKK5 101292378 2 1835793418361624 278 3177 966 4347 9612 minus004 8MAPKKK6 101292778 3 84050278408729 539 6114 957 5083 7636 minus057 4MAPKKK7 101292844 1 41733204175043 265 2970 577 4662 8347 minus040 1MAPKKK8 101293476 4 71053857111294 390 4369 648 3242 7923 minus044 7MAPKKK9 101294141 2 25889782594536 1126 12514 580 5166 7417 minus058 9MAPKKK10 101294311 7 20956252102937 1221 13558 547 4797 7209 minus061 9

Int J Mol Sci 2017 18 1766 5 of 18

Table 1 Cont

Gene Name Gene ID Chr Location ORF (aa) mW (kDa) pI Instability Index Ai GRAVY Number of Exons

MAPKKK11 101294663 5 1679080016799279 511 5561 861 5295 7977 minus045 8MAPKKK12 101294665 5 2465376424659548 591 6524 568 548 7093 minus059 9MAPKKK13 101294687 6 2508665225087498 214 2404 634 4953 829 minus047 2MAPKKK14 101295466 7 21677542172789 690 7610 623 3712 8451 minus024 15MAPKKK15 101295905 3 2600613226009750 415 4698 791 4022 867 minus043 12MAPKKK16 101296046 7 21797582185318 678 7520 552 3959 8745 minus022 15MAPKKK17 101296626 2 1777874417784528 570 6392 588 5583 8463 minus049 16MAPKKK18 101297008 1 1123608811240295 625 6899 927 6735 6882 minus054 11MAPKKK19 101297162 6 52430045248949 670 7451 597 5702 7143 minus053 17MAPKKK20 101298508 4 1768414917687733 434 4907 779 3692 8406 minus048 11MAPKKK21 101298797 5 29581272962070 404 4458 751 3714 8037 minus039 6MAPKKK22 101298822 6 3578569035790732 457 5178 610 4473 8407 minus046 13MAPKKK23 101299949 4 85530048558770 1092 12156 555 4315 7231 minus059 9MAPKKK24 101299957 5 29990073002862 347 3954 804 5215 8265 minus033 3MAPKKK25 101300060 5 10369411041266 697 7806 649 4446 7791 minus058 14MAPKKK26 101300175 1 11338111138366 475 5379 910 4471 8682 minus045 13MAPKKK27 101300188 7 404217406592 344 3794 576 3634 8846 minus007 1MAPKKK28 101300232 3 626166628364 407 4497 489 4756 7592 minus030 1MAPKKK29 101300748 6 105416107101 426 4779 888 454 8061 minus045 1MAPKKK30 101302206 1 33586133363681 995 10961 887 4356 7784 minus047 8MAPKKK31 101302247 3 2694096426947028 717 7993 570 4353 7798 minus033 10MAPKKK32 101302307 1 1002916610031248 415 4528 503 4691 8436 minus014 1MAPKKK33 101302624 3 42329644238052 458 5196 759 4966 9072 minus041 12MAPKKK34 101302797 7 1963344819634707 325 3669 872 3902 8098 minus036 1MAPKKK35 101303378 7 1963952719640520 322 3661 880 4045 8717 minus042 1MAPKKK36 101303395 2 2299293522998826 555 6175 630 4728 8674 minus036 16MAPKKK37 101303762 2 1471979514732427 554 6213 537 4228 8727 minus039 16MAPKKK38 101303943 7 620946625977 343 3774 605 3837 8703 minus010 3MAPKKK39 101304212 6 2590987725910863 328 3685 861 4291 8945 minus025 1MAPKKK40 101304439 2 1601834416021537 400 4429 753 301 7507 minus042 6MAPKKK41 101305170 6 2175947621761269 309 3491 467 3889 944 minus013 4MAPKKK42 101305413 7 57595115762791 444 4943 692 5558 8279 minus026 10MAPKKK43 101305446 3 2523315725239380 777 8622 683 5065 6851 minus066 13MAPKKK44 101305461 4 1240460712409591 677 7437 724 4743 7493 minus044 17

Int J Mol Sci 2017 18 1766 6 of 18

Table 1 Cont

Gene Name Gene ID Chr Location ORF (aa) mW (kDa) pI Instability Index Ai GRAVY Number of Exons

MAPKKK45 101305547 3 1501602315017869 447 4964 450 5048 8002 minus019 1MAPKKK46 101305739 3 57621425770103 1323 14589 511 4654 7592 minus056 9MAPKKK47 101305774 6 1313261813140647 845 9361 577 4472 8134 minus037 16MAPKKK48 101305797 1 22432522248966 1403 15280 525 4701 7302 minus052 10MAPKKK49 101307123 5 1749532317497199 405 4508 536 5535 7607 minus016 2MAPKKK50 101307418 6 3760187437604741 346 3884 721 4297 8491 minus024 6MAPKKK51 101307975 3 1314136213142841 488 5377 485 4932 7904 minus015 1MAPKKK52 101308436 2 2047217320477216 927 10152 536 4352 8395 minus032 13MAPKKK53 101308592 6 1588339615899615 765 8591 577 5123 8058 minus041 18MAPKKK54 101308868 5 15734201580407 902 9841 944 6015 6401 minus060 12MAPKKK55 101309867 1 80844508090390 572 6491 569 4985 835 minus043 16MAPKKK56 101309911 3 949163951911 374 4266 896 4665 811 minus042 3MAPKKK57 101310026 5 1017421710182364 1034 11294 553 4891 8121 minus044 13MAPKKK58 101310764 7 2236511822371514 903 9723 971 6572 6298 minus059 12MAPKKK59 101312454 5 2679636926801049 390 4424 557 436 8349 minus040 6MAPKKK60 101312659 6 2097441620976740 433 4951 510 3722 8379 minus048 5MAPKKK61 101312816 3 2525580525265535 794 8906 609 5014 7649 minus045 17MAPKKK62 101312898 2 98594129866665 1192 13083 515 482 8005 minus044 9MAPKKK63 101313105 3 2526993825276589 710 8027 732 4181 7839 minus048 13MAPKKK64 101313212 5 57646445768035 350 3978 643 4669 8309 minus030 7MAPKKK65 101313251 1 1606427416069495 618 6706 922 5262 6738 minus053 11MAPKKK66 101313299 3 2691406626919397 239 2717 923 3057 9669 minus021 11MAPKKK67 101315161 6 67071786711235 358 4009 903 3993 8802 minus030 6MAPKKK68 101315443 6 93407100195 918 10048 591 4443 7724 minus045 13MAPKKK69 105349270 7 57641745768902 438 4717 1009 5937 7792 minus048 10MAPKKK70 105349796 2 1835555618356787 219 2473 873 4283 8945 minus021 4MAPKKK71 105351460 1 1082311810824804 351 3906 497 4776 7359 minus036 1MAPKKK72 105351574 5 1316239613164156 298 3363 684 5069 8208 minus043 1MAPKKK73 105353223 7 51440135149034 682 7782 815 446 8776 minus040 13

MAPKKKKs

MAP4K1 101308962 4 1722231317230075 821 9020 521 4782 7106 minus054 18

Int J Mol Sci 2017 18 1766 7 of 18

The division of the FvMAPK sequences into four distinct groups was consistent with previousreports [1437] FvMAPK1 FvMAPK9 and FvMAPK10 clustered within Group I MAPKs are involvedin both abiotic stress responses and cell division in A thaliana [2324] FvMAPK5 and FvMAPK8belonged to Group II together with AtMPK3 and AtMPK6 and Group III includes FvMAPK11and FvMAPK12 and members from this group in other plant species are known to be regulated byboth biotic and abiotic stresses [25] The largest group was Group IV which included five members(FvMAPK2 FvMAPK3 FvMAPK4 FvMAPK6 and FvMAPK7) with the TDY motif in their T-loopand the absence of the C-terminal CD domain which is consistently present in members of the otherMAPK groups

Int J Mol Sci 2017 18 1766 7 of 18

The division of the FvMAPK sequences into four distinct groups was consistent with previous reports [1437] FvMAPK1 FvMAPK9 and FvMAPK10 clustered within Group I MAPKs are involved in both abiotic stress responses and cell division in A thaliana [2324] FvMAPK5 and FvMAPK8 belonged to Group II together with AtMPK3 and AtMPK6 and Group III includes FvMAPK11 and FvMAPK12 and members from this group in other plant species are known to be regulated by both biotic and abiotic stresses [25] The largest group was Group IV which included five members (FvMAPK2 FvMAPK3 FvMAPK4 FvMAPK6 and FvMAPK7) with the TDY motif in their T-loop and the absence of the C-terminal CD domain which is consistently present in members of the other MAPK groups

Figure 2 Phylogenetic relationships between strawberry MAPK cascade proteins The abbreviations of MAPK cascade proteins are as follows MAPK Mitogen-activated Protein Kinase red lines MAPKK MAPK Kinase green lines MAPKKK MAPKK Kinase blue lines MAP4K MAPKKK Kinase purple lines

Figure 2 Phylogenetic relationships between strawberry MAPK cascade proteins The abbreviationsof MAPK cascade proteins are as follows MAPK Mitogen-activated Protein Kinase red linesMAPKK MAPK Kinase green lines MAPKKK MAPKK Kinase blue lines MAP4K MAPKKKKinase purple lines

Int J Mol Sci 2017 18 1766 8 of 18Int J Mol Sci 2017 18 1766 8 of 18

Figure 3 Phylogenetic relationships between MAPK cascade proteins from Arabidopsis thaliana and strawberry (A) phylogenetic relationship between A thaliana and FvMAPK proteins red lines show TEY group (B) phylogenetic relationship between A thaliana and FvMAPKK proteins green lines show TDY group and (C) phylogenetic relationship between A thaliana and FvMAPKKK proteins MAPKKK forms the largest group of MAPK cascade proteins with 73 members classified into two subfamilies MEKK (green lines) and Raf (red lines) which contain 30 and 43 genes in the Fragaria vesca and A thaliana genomes (D) Phylogenetic relationship between A thaliana and strawberry MAPKKKK proteins

Seven members of the MAPKK subfamily similar to the AtMAPKKs could also be divided into four groups FvMAPKK1 FvMAPKK3 and FvMAPKK5 were most similar to AtMPKK10 AtMPKK6 and AtMPKK3 respectively while FvMPKK2 is homologous to AtMPKK4AtMPKK5 FvMPKK4 -6 and -7 and AtMPKK7 -8 and -9 clustered into the same group (Figure 3B)

MAPKKKs are activated by either phosphorylation by other MAPKKK kinases or by G proteins and G protein-coupled receptors With 73 members the MAPKKK subfamily represented the largest subfamily of a similar size to that in rice (75 members) larger than that in grape (62 members) but smaller than that in A thaliana (80 members) Generally the members of this subfamily can be classified into three groups the MEKK subfamily the ZIK subfamily and the Raf subfamily however only two groups were identified in the strawberry genome In total there were 30 FvMAPKKKs in the MEKK subfamily and 43 in the Raf subfamily with no ZIK members identified (Figure 3C)

Although several MAP4Ks have been reported in plant genomes based on phylogenetic analyses of their kinase domain little is known about the roles of MAPKKKKs in plants Only one member was identified in F vesca (Figure 3D)

22 Expression Profiles of FvMAPKs and FvMAPKKs in Different Organs and Fruit Developmental Stages

Expression profiles provide some useful clues to gene functions To investigate the putative involvement of FvMAPK and FvMAPKK genes in strawberry growth and development the expression patterns of all of these genes were analyzed under normal growth conditions in four different organs (leaves roots stems and fruits) at various developmental stages Of the 19 predicted genes all were expressed in at least one of the four organs (Figure 4) FvMPK7 and FvMPK10 showed high expression in leaves and FvMPK10 and FvMPK11 were highly expressed in fruits FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in all organs while FvMAPKK6 and FvMAPKK7 were only expressed in leaves and FvMAPKK1 and FvMAPKK3 did not express any of the different organs under normal growth conditions

Figure 3 Phylogenetic relationships between MAPK cascade proteins from Arabidopsis thalianaand strawberry (A) phylogenetic relationship between A thaliana and FvMAPK proteins red linesshow TEY group (B) phylogenetic relationship between A thaliana and FvMAPKK proteins greenlines show TDY group and (C) phylogenetic relationship between A thaliana and FvMAPKKKproteins MAPKKK forms the largest group of MAPK cascade proteins with 73 members classifiedinto two subfamilies MEKK (green lines) and Raf (red lines) which contain 30 and 43 genes in theFragaria vesca and A thaliana genomes (D) Phylogenetic relationship between A thaliana and strawberryMAPKKKK proteins

Seven members of the MAPKK subfamily similar to the AtMAPKKs could also be divided intofour groups FvMAPKK1 FvMAPKK3 and FvMAPKK5 were most similar to AtMPKK10 AtMPKK6and AtMPKK3 respectively while FvMPKK2 is homologous to AtMPKK4AtMPKK5 FvMPKK4 -6and -7 and AtMPKK7 -8 and -9 clustered into the same group (Figure 3B)

MAPKKKs are activated by either phosphorylation by other MAPKKK kinases or by G proteinsand G protein-coupled receptors With 73 members the MAPKKK subfamily represented the largestsubfamily of a similar size to that in rice (75 members) larger than that in grape (62 members) butsmaller than that in A thaliana (80 members) Generally the members of this subfamily can beclassified into three groups the MEKK subfamily the ZIK subfamily and the Raf subfamily howeveronly two groups were identified in the strawberry genome In total there were 30 FvMAPKKKs in theMEKK subfamily and 43 in the Raf subfamily with no ZIK members identified (Figure 3C)

Although several MAP4Ks have been reported in plant genomes based on phylogenetic analysesof their kinase domain little is known about the roles of MAPKKKKs in plants Only one member wasidentified in F vesca (Figure 3D)

22 Expression Profiles of FvMAPKs and FvMAPKKs in Different Organs and Fruit Developmental Stages

Expression profiles provide some useful clues to gene functions To investigate the putativeinvolvement of FvMAPK and FvMAPKK genes in strawberry growth and development the expressionpatterns of all of these genes were analyzed under normal growth conditions in four different organs(leaves roots stems and fruits) at various developmental stages Of the 19 predicted genes all wereexpressed in at least one of the four organs (Figure 4) FvMPK7 and FvMPK10 showed high expressionin leaves and FvMPK10 and FvMPK11 were highly expressed in fruits FvMAPKK2 FvMAPKK4 andFvMAPKK5 were expressed in all organs while FvMAPKK6 and FvMAPKK7 were only expressed inleaves and FvMAPKK1 and FvMAPKK3 did not express any of the different organs under normalgrowth conditions

Int J Mol Sci 2017 18 1766 9 of 18Int J Mol Sci 2017 18 1766 9 of 18

Figure 4 Expression patterns of FvMPKs and FvMPKKs in different organs X-axis is the relative expression while Y-axis is MAPK and MAPKK genes white box root blue box stem green box leave red box fruit

We also determined the expression of FvMAPK cascade genes in different fruit developmental stages The transcript levels of FvMAPK2 and FvMAPK12 were lower than any other of the genes in all the different fruit developmental stages For the remaining 10 genes the expression patterns could be roughly divided into three categories FvMAPK3 FvMAPK4 and FvMAPK11 showed the same expression patterns which increased through development FvMAPK1 FvMAPK9 and FvMAPK10 expression however declined during fruit development Finally there were six genes (FvMAPK5 FvMAPK6 FvMAPK7 and FvMAPK8) that showed a high expression in the early stages then a decrease and later an increase in the later stages of fruit development In the FvMAPKKs subfamily only FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in fruits at a detectable level and they had the same expression patterns which gradually rose through fruit development (Figure 5) Since F vesca is a new model for investigating non-climacteric fruit development and ripening we focused on determining the expression profiles of the FvMAPKKK subfamily to different fruit developmental stages The expression profiles of the FvMAPKKK genes revealed a much higher expression in early stages than in later ripening or senescing stages indicating that they are most likely related to signal transduction during development in metabolically active tissues (Figure 6) Some FvMAPKKK transcripts showed higher levels in earlier than later stages of fruit development while others showed the opposite pattern This information can be important for further investigation of the signal transduction pathways involved in the regulation of fruit development and ripening in which different MAPKKK subfamily members may be involved

Figure 4 Expression patterns of FvMPKs and FvMPKKs in different organs X-axis is the relativeexpression while Y-axis is MAPK and MAPKK genes white box root blue box stem green box leavered box fruit

We also determined the expression of FvMAPK cascade genes in different fruit developmentalstages The transcript levels of FvMAPK2 and FvMAPK12 were lower than any other of the genes inall the different fruit developmental stages For the remaining 10 genes the expression patternscould be roughly divided into three categories FvMAPK3 FvMAPK4 and FvMAPK11 showedthe same expression patterns which increased through development FvMAPK1 FvMAPK9 andFvMAPK10 expression however declined during fruit development Finally there were six genes(FvMAPK5 FvMAPK6 FvMAPK7 and FvMAPK8) that showed a high expression in the early stagesthen a decrease and later an increase in the later stages of fruit development In the FvMAPKKssubfamily only FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in fruits at a detectablelevel and they had the same expression patterns which gradually rose through fruit development(Figure 5) Since F vesca is a new model for investigating non-climacteric fruit development andripening we focused on determining the expression profiles of the FvMAPKKK subfamily to differentfruit developmental stages The expression profiles of the FvMAPKKK genes revealed a much higherexpression in early stages than in later ripening or senescing stages indicating that they are most likelyrelated to signal transduction during development in metabolically active tissues (Figure 6) SomeFvMAPKKK transcripts showed higher levels in earlier than later stages of fruit development whileothers showed the opposite pattern This information can be important for further investigation of thesignal transduction pathways involved in the regulation of fruit development and ripening in whichdifferent MAPKKK subfamily members may be involved

Int J Mol Sci 2017 18 1766 10 of 18Int J Mol Sci 2017 18 1766 10 of 18

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis is the relative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental stages The gene expression levels were showed by the color box from blue to red indicating from low to high for each gene 18ndash42 DAF five developmental stages of days after flowering

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis is therelative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental stages ofdays after flowering

Int J Mol Sci 2017 18 1766 10 of 18

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis

is the relative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental

stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental

stages The gene expression levels were showed by the color box from blue to red indicating from

low to high for each gene 18ndash42 DAF five developmental stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental stagesThe gene expression levels were showed by the color box from blue to red indicating from low to highfor each gene 18ndash42 DAF five developmental stages of days after flowering

Int J Mol Sci 2017 18 1766 11 of 18

23 Gene Expression Profiles of FvMAPKs and FvMAPKKs in Response to Hormones and Abiotic Stresses inF vesca Leaves

We investigated whether salt drought low temperature and exogenous application of thehormones indole acetic acid (IAA) and abscisic acid (ABA) would induce expression of the FvMAPKand FvMAPKK genes in seedling leaves using qRT-PCR analysis After cold treatment most of thetested genes showed a large expression increase 48 h after treatment Among them was MAPK2whose expression increased in early stages before decreasing In general drought stress resulted inthe induction of the greatest number of genes and a significantly improved in the process 12 daysIn response to salt stress the expression of five FvMAPK genes (FvMAPK5 -9 -10 -11 and -12) and threeFvMAPKK genes (FvMAPKK1 -3 and -5) increased Interestingly the transcript levels of FvMAPKK3were specifically activated by salt stress and not by the other treatments The expression of FvMAPK3and -12 and FvMAPKK4 -5 and -6 was activated by ABA while the IAA treatment only resulted in achange in FvMAPKK4 expression which was up-regulated two days after treatment (Figure 7)

Int J Mol Sci 2017 18 1766 11 of 18

23 Gene Expression Profiles of FvMAPKs and FvMAPKKs in Response to Hormones and Abiotic

Stresses in F vesca Leaves

We investigated whether salt drought low temperature and exogenous application of the

hormones indole acetic acid (IAA) and abscisic acid (ABA) would induce expression of the

FvMAPK and FvMAPKK genes in seedling leaves using qRT-PCR analysis After cold treatment

most of the tested genes showed a large expression increase 48 h after treatment Among them was

MAPK2 whose expression increased in early stages before decreasing In general drought stress

resulted in the induction of the greatest number of genes and a significantly improved in the

process 12 days In response to salt stress the expression of five FvMAPK genes (FvMAPK5 -9 -10

-11 and -12) and three FvMAPKK genes (FvMAPKK1 -3 and -5) increased Interestingly the

transcript levels of FvMAPKK3 were specifically activated by salt stress and not by the other

treatments The expression of FvMAPK3 and -12 and FvMAPKK4 -5 and -6 was activated by ABA

while the IAA treatment only resulted in a change in FvMAPKK4 expression which was

up-regulated two days after treatment (Figure 7)

Figure 7 Expression patterns of FvMPK and FvMPKK genes after different stress and hormone

treatments of leaves in Fragaria vesca Leaves were harvested every two days (0 2 4 6 8 10 and 12

days) after treatment Abscisic acid (ABA) (100 μM) indole-3-acetic acid (IAA) (100 μM) NaCl (100

mM) and drought treatments Leaves from the low temperature treatment were collected at 0 4 8

12 24 48 and 72 h after cold stress application

24 Expression Patterns of FvMAPK and FvMAPKK Genes in Response to Sucrose Hormones and

Abiotic Stresses in F vesca Fruits

The expression patterns of the FvMAPK and FvMAPKK genes at an early stage (18 DAF days

after flowering) and a late stage (36 DAF) of fruit development in response to exogenous IAA ABA

and sucrose treatment and drought high temperature or low temperature stresses were also

examined by qRT-PCR analyses Almost all showed a higher expression level in the early than in

the later stage It was interesting that the transcript levels of almost all the genes were up-regulated

in response to IAA drought and low temperature treatment at the early stage of fruit development

(18 DAF) During low temperature stress the expression of 17 of the 19 genes increased

significantly at 18 DAF while the transcript levels of FvMAPK3 FvMAPKK1 FvMAPKK3

FvMAPKK6 and FvMAPKK7 were significantly up-regulated by high temperature treatment even

Figure 7 Expression patterns of FvMPK and FvMPKK genes after different stress and hormonetreatments of leaves in Fragaria vesca Leaves were harvested every two days (0 2 4 6 8 10 and12 days) after treatment Abscisic acid (ABA) (100 microM) indole-3-acetic acid (IAA) (100 microM) NaCl(100 mM) and drought treatments Leaves from the low temperature treatment were collected at 0 4 812 24 48 and 72 h after cold stress application

24 Expression Patterns of FvMAPK and FvMAPKK Genes in Response to Sucrose Hormones and AbioticStresses in F vesca Fruits

The expression patterns of the FvMAPK and FvMAPKK genes at an early stage (18 DAF daysafter flowering) and a late stage (36 DAF) of fruit development in response to exogenous IAA ABAand sucrose treatment and drought high temperature or low temperature stresses were also examinedby qRT-PCR analyses Almost all showed a higher expression level in the early than in the later stageIt was interesting that the transcript levels of almost all the genes were up-regulated in responseto IAA drought and low temperature treatment at the early stage of fruit development (18 DAF)During low temperature stress the expression of 17 of the 19 genes increased significantly at 18 DAFwhile the transcript levels of FvMAPK3 FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 weresignificantly up-regulated by high temperature treatment even though the expression of FvMAPKK1

Int J Mol Sci 2017 18 1766 12 of 18

FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions(Figure 8)

Int J Mol Sci 2017 18 1766 12 of 18

though the expression of FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions (Figure 8)

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stress pre-treatments Red and blue boxes indicate high and low expression levels respectively for each gene Six treatments Abscisic acid (ABA) 100 μM indole-3-acetic acid (IAA) 100 μM Suc sucrose 50 μM Dry drought treatment High high temperature (40 degC) Low low temperature (4 degC) Con controlled trials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yet been comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and 1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genome while at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genome even though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome (~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and 5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similar in size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that of A thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based on phylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogenetically characterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Only one MAP4K member was identified in the F vesca genome but the ORF showed strong similarity to ScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles in ovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based on the conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinase subdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to each other FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference in length is usually due to variation in the length of the domain or a variable number of introns and may indicate the absence or presence of motifs which can affect the functional specificity There are 10 and 7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins ranged in size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members of the FvMAPKKK subfamily were distributed to all the

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stresspre-treatments Red and blue boxes indicate high and low expression levels respectively for each geneSix treatments Abscisic acid (ABA) 100 microM indole-3-acetic acid (IAA) 100 microM Suc sucrose 50 microMDry drought treatment High high temperature (40 C) Low low temperature (4 C) Con controlledtrials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yetbeen comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genomewhile at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genomeeven though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome(~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similarin size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that ofA thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based onphylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogeneticallycharacterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Onlyone MAP4K member was identified in the F vesca genome but the ORF showed strong similarity toScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles inovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based onthe conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinasesubdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to eachother FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference inlength is usually due to variation in the length of the domain or a variable number of introns and mayindicate the absence or presence of motifs which can affect the functional specificity There are 10 and7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins rangedin size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members

Int J Mol Sci 2017 18 1766 13 of 18

of the FvMAPKKK subfamily were distributed to all the chromosomes and shared 12ndash34 identitywith each other with a sequence length ranging from 214 to 1403 amino acids A kinase domainin the C-terminal and a long regulatory domain in the N- terminal region were identified in mostFvMAPKKKs suggesting that the specific long regulatory domain exited in the N-terminal of theRAF subfamily may involve in specify the kinase activity and regulating protein interaction [45] It isinteresting that no FvMAPKKK was found that belonged to the ZIK subfamily which in other specieshas members with a conserved GTPEFMAPE (LV) Y signature The absence of the characteristic ZIKsubfamily feature in F vesca might suggest the presence of a slightly modified RAF domain instead ofthe typical ZIK domain as reported in Vitis [42]

As the last two steps of the MAPK cascade MAPK and MAPKK link upstream kinases anddownstream substrates As dual-specificity kinases MAPKKs can be activated and phosphorylatedby MAPKKKs via phosphorylation of ThrSer residues while MAPKKs also phosphorylate thedownstream MAPKs and activated MAPKs can phosphorylate different substrates including othertranscription factors kinases and cytoskeleton binding proteins [3] The MAPK cascade protein(MAP4K-MAPKKK-MAPKK-MAPK) family is large and the functions of the various members canbe complex Though there are many members identified in the MAPKKK and MAP4K subfamilieslittle is known about the MAPKs and MAPKKs In this study we mainly focused our gene expressionpattern analysis on the MAPK and MAPKK genes We evaluated the expression patterns of all ofthe predicted members of the FvMAPK and FvMAPKK subfamily in different strawberry organs anddevelopmental stages The expression of most of the FvMAPK and FvMAPKK genes was detected in thestrawberry organs investigated possibly reflecting their involvement in a common metabolic andordevelopmental process Among them FvMAPK7 FvMAPK10 and FvMAPKK2 showed significantlyhigher expression in leaves than in other organs and FvMAPKK6 and FvMAPKK7 were specificallyexpressed in leaves whereas the FvMAPK6 transcripts were not be detected in leaves indicatingdifferent functions for divergent family members

Stress-specific increased MAPK genes and kinase activity has been identified when plantsare suffering from a variety of abiotic stresses including drought cold high salinity ozone UVirradiation and oxidative stress [46ndash49] Plant hormones were detected playing a role in trigger stressresponses and developmental pathways with other signaling molecules [4650ndash52] The componentsof MEKK1 MKK2 MPK4 andor MPK6 respond to drought salt or cold stressed were characterizedin A thaliana [2247] We studied the interaction between hormone and gene expression patterns instrawberry fruit FvMAPK5 and FvMAPK8 belong to group II which contains well-characterizedMAPK genes including AtMAPK3 and AtMAPK6 It has been reported that AtMAPK3 can be activatedin response to abiotic stresses and pathogens and AtMAPK6 also plays a role in abiotic and bioticstresses [10395354] Similarly we speculate that FvMAPK5 and FvMAPK8 are important for abioticor biotic stress responses due to their transcriptional activation by cold and drought FvMAPK1FvMAPK9 and FvMAPK10 are clustered in Group I while also includes AtMAPK4 AtMAPK5AtMAPK11 AtMAPK12 and AtMAPK13 AtMPK4 and its upstream MAPKK AtMKK2 are involvedin both biotic and abiotic stresses The expression patterns of FvMAPK1 FvMAPK9 and FvMAPK10were similar in fruits but not in leaves suggesting different functions depending on the organ [55]

In A thaliana AtMPKK3 is up-regulated in response to ABA [46] and FvMPKK5 which showedthe highest homology to AtMPKK3 showed strong activation by ABA in leaves suggesting asimilar function Interestingly AtMKK1AtMKK2 which are activated by salt drought and coldstresses [2223] and their ortholog FvMAPKK3 showed specific activation by salt stress in leaves andsignificant expression changes due to cold and heat stress

Int J Mol Sci 2017 18 1766 14 of 18

4 Materials and Methods

41 Identification of Potential MAPK Cascade Gene Family Members in Strawberry

To identify a complete list of strawberry MAPK cascade genes we used two public databases theNational Centre for Biotechnology Information (NCBI httpwwwncbinlmnihgov) and F vescaBioView Gene Model Database (httpsstrawberryplantandfoodconz)

42 Phylogenetic Analysis of A Thaliana and the Strawberry MAPK Cascade Genes

Phylogenetic analysis was performed using the MEGA 51 software (USA) and theneighbor-joining method Bootstrap values were calculated for 1000 iterations [5657] The A thalianaMAPK cascades gene family database was obtained from TAIR (The A thaliana Information Resourcehttpwwwarabidopsisorg) and used for comparative analysis

43 Plant Material and Fruit Pre-Treatments

F vesca (ldquoHawaii 4rdquo) plants were grown on a growth chamber at 22 plusmn 1 C in a 1311 h darklightphotoperiod Fruit samples were harvested every 6 days starting of the 18 days after flowering (18 2430 36 and 42 DAF) At each developmental stage ten representative fruits were sampled and tissueswere immediately frozen in liquid nitrogen and stored at minus80 C until further use In order to obtaindifferent pre-treatment experimental fruits two stages (18 and 36 DAF) were selected for sucrose andhormone treatments The fruits were cut in half longitudinally and half was used as a control whilethe other half was used for processing The different treatments used in this work were indole-3-aceticacid (IAA) abscisic acid (ABA) and sucrose at a concentration of 100 100 and 50 microM respectively Thehigh and low temperature was 40 C and 4 C All other experiments were performed at 25 C

44 The Processing of Strawberry Leaves under Different Stress and Hormone Treatments

To investigate the induced expression patterns of the FvMAPK and FvMAPKK genes in seedlingleaves in response to various treatments 30 days old soil grown seedlings were used For salt stresstreatment seedlings were irrigated in 100 mM NaCl collected 2 4 6 8 10 and 12 days after salttreatment of leaves without salt stress as control For the drought stress treatment all plants werestopped to water after full irrigation watering then clipping the leaves in 2 4 6 8 10 and 12 daysand no drought stress as the control respectively For the cold treatment seedlings were maintainedat 0 C and leaf material collected at 4 8 12 24 48 and 72 h Leaves cultivated in a growth chamberat 22 plusmn 1 C were used as controls For the hormone treatments plants were sprayed with solutionscontaining 100 microM ABA or 100 microM IAA then leaves were collected after 2 4 6 8 10 and 12 daysPlants that had not been sprayed served as the controls Samples were immediately frozen in liquidnitrogen and stored at minus80 C

45 RNA Extraction and Real-Time PCR Analysis

Total RNA was isolated from strawberry fruits harvested at 18 24 30 36 and 42 DAF usingthe Plant RNA Kit (Omega USA) according to the manufacturerrsquos instructions and total RNA wasreverse transcribed into cDNA using the Invitrogen reverse transcription kit (SuperScriptIII ReverseTranscriptase USA) Real-time PCR was performed to confirm gene expression patterns using a LightCyclerreg 96 SW11 Real Time PCR System (Roche Germany) with SYBR-Green (Takara Dalian China)The primer sequences used are designed based on gene sequences and the Beacon designer softwareand are shown in Table 2 in this study Each reaction consists of 5 microL SYBR 35 microL ddH2O 1 microL dilutedtemplate (1 microL of the generated first-strand cDNA diluted by 9 microL ddH2O) and 025 microL of each of twogene specific primers Thermal cycling conditions were 95 C for 10 min then 40 cycles at 95 C for20 s 54 C for 20 s 72 C for 20 s

Int J Mol Sci 2017 18 1766 5 of 18

Table 1 Cont

Gene Name Gene ID Chr Location ORF (aa) mW (kDa) pI Instability Index Ai GRAVY Number of Exons

MAPKKK11 101294663 5 1679080016799279 511 5561 861 5295 7977 minus045 8MAPKKK12 101294665 5 2465376424659548 591 6524 568 548 7093 minus059 9MAPKKK13 101294687 6 2508665225087498 214 2404 634 4953 829 minus047 2MAPKKK14 101295466 7 21677542172789 690 7610 623 3712 8451 minus024 15MAPKKK15 101295905 3 2600613226009750 415 4698 791 4022 867 minus043 12MAPKKK16 101296046 7 21797582185318 678 7520 552 3959 8745 minus022 15MAPKKK17 101296626 2 1777874417784528 570 6392 588 5583 8463 minus049 16MAPKKK18 101297008 1 1123608811240295 625 6899 927 6735 6882 minus054 11MAPKKK19 101297162 6 52430045248949 670 7451 597 5702 7143 minus053 17MAPKKK20 101298508 4 1768414917687733 434 4907 779 3692 8406 minus048 11MAPKKK21 101298797 5 29581272962070 404 4458 751 3714 8037 minus039 6MAPKKK22 101298822 6 3578569035790732 457 5178 610 4473 8407 minus046 13MAPKKK23 101299949 4 85530048558770 1092 12156 555 4315 7231 minus059 9MAPKKK24 101299957 5 29990073002862 347 3954 804 5215 8265 minus033 3MAPKKK25 101300060 5 10369411041266 697 7806 649 4446 7791 minus058 14MAPKKK26 101300175 1 11338111138366 475 5379 910 4471 8682 minus045 13MAPKKK27 101300188 7 404217406592 344 3794 576 3634 8846 minus007 1MAPKKK28 101300232 3 626166628364 407 4497 489 4756 7592 minus030 1MAPKKK29 101300748 6 105416107101 426 4779 888 454 8061 minus045 1MAPKKK30 101302206 1 33586133363681 995 10961 887 4356 7784 minus047 8MAPKKK31 101302247 3 2694096426947028 717 7993 570 4353 7798 minus033 10MAPKKK32 101302307 1 1002916610031248 415 4528 503 4691 8436 minus014 1MAPKKK33 101302624 3 42329644238052 458 5196 759 4966 9072 minus041 12MAPKKK34 101302797 7 1963344819634707 325 3669 872 3902 8098 minus036 1MAPKKK35 101303378 7 1963952719640520 322 3661 880 4045 8717 minus042 1MAPKKK36 101303395 2 2299293522998826 555 6175 630 4728 8674 minus036 16MAPKKK37 101303762 2 1471979514732427 554 6213 537 4228 8727 minus039 16MAPKKK38 101303943 7 620946625977 343 3774 605 3837 8703 minus010 3MAPKKK39 101304212 6 2590987725910863 328 3685 861 4291 8945 minus025 1MAPKKK40 101304439 2 1601834416021537 400 4429 753 301 7507 minus042 6MAPKKK41 101305170 6 2175947621761269 309 3491 467 3889 944 minus013 4MAPKKK42 101305413 7 57595115762791 444 4943 692 5558 8279 minus026 10MAPKKK43 101305446 3 2523315725239380 777 8622 683 5065 6851 minus066 13MAPKKK44 101305461 4 1240460712409591 677 7437 724 4743 7493 minus044 17

Int J Mol Sci 2017 18 1766 6 of 18

Table 1 Cont

Gene Name Gene ID Chr Location ORF (aa) mW (kDa) pI Instability Index Ai GRAVY Number of Exons

MAPKKK45 101305547 3 1501602315017869 447 4964 450 5048 8002 minus019 1MAPKKK46 101305739 3 57621425770103 1323 14589 511 4654 7592 minus056 9MAPKKK47 101305774 6 1313261813140647 845 9361 577 4472 8134 minus037 16MAPKKK48 101305797 1 22432522248966 1403 15280 525 4701 7302 minus052 10MAPKKK49 101307123 5 1749532317497199 405 4508 536 5535 7607 minus016 2MAPKKK50 101307418 6 3760187437604741 346 3884 721 4297 8491 minus024 6MAPKKK51 101307975 3 1314136213142841 488 5377 485 4932 7904 minus015 1MAPKKK52 101308436 2 2047217320477216 927 10152 536 4352 8395 minus032 13MAPKKK53 101308592 6 1588339615899615 765 8591 577 5123 8058 minus041 18MAPKKK54 101308868 5 15734201580407 902 9841 944 6015 6401 minus060 12MAPKKK55 101309867 1 80844508090390 572 6491 569 4985 835 minus043 16MAPKKK56 101309911 3 949163951911 374 4266 896 4665 811 minus042 3MAPKKK57 101310026 5 1017421710182364 1034 11294 553 4891 8121 minus044 13MAPKKK58 101310764 7 2236511822371514 903 9723 971 6572 6298 minus059 12MAPKKK59 101312454 5 2679636926801049 390 4424 557 436 8349 minus040 6MAPKKK60 101312659 6 2097441620976740 433 4951 510 3722 8379 minus048 5MAPKKK61 101312816 3 2525580525265535 794 8906 609 5014 7649 minus045 17MAPKKK62 101312898 2 98594129866665 1192 13083 515 482 8005 minus044 9MAPKKK63 101313105 3 2526993825276589 710 8027 732 4181 7839 minus048 13MAPKKK64 101313212 5 57646445768035 350 3978 643 4669 8309 minus030 7MAPKKK65 101313251 1 1606427416069495 618 6706 922 5262 6738 minus053 11MAPKKK66 101313299 3 2691406626919397 239 2717 923 3057 9669 minus021 11MAPKKK67 101315161 6 67071786711235 358 4009 903 3993 8802 minus030 6MAPKKK68 101315443 6 93407100195 918 10048 591 4443 7724 minus045 13MAPKKK69 105349270 7 57641745768902 438 4717 1009 5937 7792 minus048 10MAPKKK70 105349796 2 1835555618356787 219 2473 873 4283 8945 minus021 4MAPKKK71 105351460 1 1082311810824804 351 3906 497 4776 7359 minus036 1MAPKKK72 105351574 5 1316239613164156 298 3363 684 5069 8208 minus043 1MAPKKK73 105353223 7 51440135149034 682 7782 815 446 8776 minus040 13

MAPKKKKs

MAP4K1 101308962 4 1722231317230075 821 9020 521 4782 7106 minus054 18

Int J Mol Sci 2017 18 1766 7 of 18

The division of the FvMAPK sequences into four distinct groups was consistent with previousreports [1437] FvMAPK1 FvMAPK9 and FvMAPK10 clustered within Group I MAPKs are involvedin both abiotic stress responses and cell division in A thaliana [2324] FvMAPK5 and FvMAPK8belonged to Group II together with AtMPK3 and AtMPK6 and Group III includes FvMAPK11and FvMAPK12 and members from this group in other plant species are known to be regulated byboth biotic and abiotic stresses [25] The largest group was Group IV which included five members(FvMAPK2 FvMAPK3 FvMAPK4 FvMAPK6 and FvMAPK7) with the TDY motif in their T-loopand the absence of the C-terminal CD domain which is consistently present in members of the otherMAPK groups

Int J Mol Sci 2017 18 1766 7 of 18

The division of the FvMAPK sequences into four distinct groups was consistent with previous reports [1437] FvMAPK1 FvMAPK9 and FvMAPK10 clustered within Group I MAPKs are involved in both abiotic stress responses and cell division in A thaliana [2324] FvMAPK5 and FvMAPK8 belonged to Group II together with AtMPK3 and AtMPK6 and Group III includes FvMAPK11 and FvMAPK12 and members from this group in other plant species are known to be regulated by both biotic and abiotic stresses [25] The largest group was Group IV which included five members (FvMAPK2 FvMAPK3 FvMAPK4 FvMAPK6 and FvMAPK7) with the TDY motif in their T-loop and the absence of the C-terminal CD domain which is consistently present in members of the other MAPK groups

Figure 2 Phylogenetic relationships between strawberry MAPK cascade proteins The abbreviations of MAPK cascade proteins are as follows MAPK Mitogen-activated Protein Kinase red lines MAPKK MAPK Kinase green lines MAPKKK MAPKK Kinase blue lines MAP4K MAPKKK Kinase purple lines

Figure 2 Phylogenetic relationships between strawberry MAPK cascade proteins The abbreviationsof MAPK cascade proteins are as follows MAPK Mitogen-activated Protein Kinase red linesMAPKK MAPK Kinase green lines MAPKKK MAPKK Kinase blue lines MAP4K MAPKKKKinase purple lines

Int J Mol Sci 2017 18 1766 8 of 18Int J Mol Sci 2017 18 1766 8 of 18

Figure 3 Phylogenetic relationships between MAPK cascade proteins from Arabidopsis thaliana and strawberry (A) phylogenetic relationship between A thaliana and FvMAPK proteins red lines show TEY group (B) phylogenetic relationship between A thaliana and FvMAPKK proteins green lines show TDY group and (C) phylogenetic relationship between A thaliana and FvMAPKKK proteins MAPKKK forms the largest group of MAPK cascade proteins with 73 members classified into two subfamilies MEKK (green lines) and Raf (red lines) which contain 30 and 43 genes in the Fragaria vesca and A thaliana genomes (D) Phylogenetic relationship between A thaliana and strawberry MAPKKKK proteins

Seven members of the MAPKK subfamily similar to the AtMAPKKs could also be divided into four groups FvMAPKK1 FvMAPKK3 and FvMAPKK5 were most similar to AtMPKK10 AtMPKK6 and AtMPKK3 respectively while FvMPKK2 is homologous to AtMPKK4AtMPKK5 FvMPKK4 -6 and -7 and AtMPKK7 -8 and -9 clustered into the same group (Figure 3B)

MAPKKKs are activated by either phosphorylation by other MAPKKK kinases or by G proteins and G protein-coupled receptors With 73 members the MAPKKK subfamily represented the largest subfamily of a similar size to that in rice (75 members) larger than that in grape (62 members) but smaller than that in A thaliana (80 members) Generally the members of this subfamily can be classified into three groups the MEKK subfamily the ZIK subfamily and the Raf subfamily however only two groups were identified in the strawberry genome In total there were 30 FvMAPKKKs in the MEKK subfamily and 43 in the Raf subfamily with no ZIK members identified (Figure 3C)

Although several MAP4Ks have been reported in plant genomes based on phylogenetic analyses of their kinase domain little is known about the roles of MAPKKKKs in plants Only one member was identified in F vesca (Figure 3D)

22 Expression Profiles of FvMAPKs and FvMAPKKs in Different Organs and Fruit Developmental Stages

Expression profiles provide some useful clues to gene functions To investigate the putative involvement of FvMAPK and FvMAPKK genes in strawberry growth and development the expression patterns of all of these genes were analyzed under normal growth conditions in four different organs (leaves roots stems and fruits) at various developmental stages Of the 19 predicted genes all were expressed in at least one of the four organs (Figure 4) FvMPK7 and FvMPK10 showed high expression in leaves and FvMPK10 and FvMPK11 were highly expressed in fruits FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in all organs while FvMAPKK6 and FvMAPKK7 were only expressed in leaves and FvMAPKK1 and FvMAPKK3 did not express any of the different organs under normal growth conditions

Figure 3 Phylogenetic relationships between MAPK cascade proteins from Arabidopsis thalianaand strawberry (A) phylogenetic relationship between A thaliana and FvMAPK proteins red linesshow TEY group (B) phylogenetic relationship between A thaliana and FvMAPKK proteins greenlines show TDY group and (C) phylogenetic relationship between A thaliana and FvMAPKKKproteins MAPKKK forms the largest group of MAPK cascade proteins with 73 members classifiedinto two subfamilies MEKK (green lines) and Raf (red lines) which contain 30 and 43 genes in theFragaria vesca and A thaliana genomes (D) Phylogenetic relationship between A thaliana and strawberryMAPKKKK proteins

Seven members of the MAPKK subfamily similar to the AtMAPKKs could also be divided intofour groups FvMAPKK1 FvMAPKK3 and FvMAPKK5 were most similar to AtMPKK10 AtMPKK6and AtMPKK3 respectively while FvMPKK2 is homologous to AtMPKK4AtMPKK5 FvMPKK4 -6and -7 and AtMPKK7 -8 and -9 clustered into the same group (Figure 3B)

MAPKKKs are activated by either phosphorylation by other MAPKKK kinases or by G proteinsand G protein-coupled receptors With 73 members the MAPKKK subfamily represented the largestsubfamily of a similar size to that in rice (75 members) larger than that in grape (62 members) butsmaller than that in A thaliana (80 members) Generally the members of this subfamily can beclassified into three groups the MEKK subfamily the ZIK subfamily and the Raf subfamily howeveronly two groups were identified in the strawberry genome In total there were 30 FvMAPKKKs in theMEKK subfamily and 43 in the Raf subfamily with no ZIK members identified (Figure 3C)

Although several MAP4Ks have been reported in plant genomes based on phylogenetic analysesof their kinase domain little is known about the roles of MAPKKKKs in plants Only one member wasidentified in F vesca (Figure 3D)

22 Expression Profiles of FvMAPKs and FvMAPKKs in Different Organs and Fruit Developmental Stages

Expression profiles provide some useful clues to gene functions To investigate the putativeinvolvement of FvMAPK and FvMAPKK genes in strawberry growth and development the expressionpatterns of all of these genes were analyzed under normal growth conditions in four different organs(leaves roots stems and fruits) at various developmental stages Of the 19 predicted genes all wereexpressed in at least one of the four organs (Figure 4) FvMPK7 and FvMPK10 showed high expressionin leaves and FvMPK10 and FvMPK11 were highly expressed in fruits FvMAPKK2 FvMAPKK4 andFvMAPKK5 were expressed in all organs while FvMAPKK6 and FvMAPKK7 were only expressed inleaves and FvMAPKK1 and FvMAPKK3 did not express any of the different organs under normalgrowth conditions

Int J Mol Sci 2017 18 1766 9 of 18Int J Mol Sci 2017 18 1766 9 of 18

Figure 4 Expression patterns of FvMPKs and FvMPKKs in different organs X-axis is the relative expression while Y-axis is MAPK and MAPKK genes white box root blue box stem green box leave red box fruit

We also determined the expression of FvMAPK cascade genes in different fruit developmental stages The transcript levels of FvMAPK2 and FvMAPK12 were lower than any other of the genes in all the different fruit developmental stages For the remaining 10 genes the expression patterns could be roughly divided into three categories FvMAPK3 FvMAPK4 and FvMAPK11 showed the same expression patterns which increased through development FvMAPK1 FvMAPK9 and FvMAPK10 expression however declined during fruit development Finally there were six genes (FvMAPK5 FvMAPK6 FvMAPK7 and FvMAPK8) that showed a high expression in the early stages then a decrease and later an increase in the later stages of fruit development In the FvMAPKKs subfamily only FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in fruits at a detectable level and they had the same expression patterns which gradually rose through fruit development (Figure 5) Since F vesca is a new model for investigating non-climacteric fruit development and ripening we focused on determining the expression profiles of the FvMAPKKK subfamily to different fruit developmental stages The expression profiles of the FvMAPKKK genes revealed a much higher expression in early stages than in later ripening or senescing stages indicating that they are most likely related to signal transduction during development in metabolically active tissues (Figure 6) Some FvMAPKKK transcripts showed higher levels in earlier than later stages of fruit development while others showed the opposite pattern This information can be important for further investigation of the signal transduction pathways involved in the regulation of fruit development and ripening in which different MAPKKK subfamily members may be involved

Figure 4 Expression patterns of FvMPKs and FvMPKKs in different organs X-axis is the relativeexpression while Y-axis is MAPK and MAPKK genes white box root blue box stem green box leavered box fruit

We also determined the expression of FvMAPK cascade genes in different fruit developmentalstages The transcript levels of FvMAPK2 and FvMAPK12 were lower than any other of the genes inall the different fruit developmental stages For the remaining 10 genes the expression patternscould be roughly divided into three categories FvMAPK3 FvMAPK4 and FvMAPK11 showedthe same expression patterns which increased through development FvMAPK1 FvMAPK9 andFvMAPK10 expression however declined during fruit development Finally there were six genes(FvMAPK5 FvMAPK6 FvMAPK7 and FvMAPK8) that showed a high expression in the early stagesthen a decrease and later an increase in the later stages of fruit development In the FvMAPKKssubfamily only FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in fruits at a detectablelevel and they had the same expression patterns which gradually rose through fruit development(Figure 5) Since F vesca is a new model for investigating non-climacteric fruit development andripening we focused on determining the expression profiles of the FvMAPKKK subfamily to differentfruit developmental stages The expression profiles of the FvMAPKKK genes revealed a much higherexpression in early stages than in later ripening or senescing stages indicating that they are most likelyrelated to signal transduction during development in metabolically active tissues (Figure 6) SomeFvMAPKKK transcripts showed higher levels in earlier than later stages of fruit development whileothers showed the opposite pattern This information can be important for further investigation of thesignal transduction pathways involved in the regulation of fruit development and ripening in whichdifferent MAPKKK subfamily members may be involved

Int J Mol Sci 2017 18 1766 10 of 18Int J Mol Sci 2017 18 1766 10 of 18

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis is the relative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental stages The gene expression levels were showed by the color box from blue to red indicating from low to high for each gene 18ndash42 DAF five developmental stages of days after flowering

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis is therelative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental stages ofdays after flowering

Int J Mol Sci 2017 18 1766 10 of 18

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis

is the relative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental

stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental

stages The gene expression levels were showed by the color box from blue to red indicating from

low to high for each gene 18ndash42 DAF five developmental stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental stagesThe gene expression levels were showed by the color box from blue to red indicating from low to highfor each gene 18ndash42 DAF five developmental stages of days after flowering

Int J Mol Sci 2017 18 1766 11 of 18

23 Gene Expression Profiles of FvMAPKs and FvMAPKKs in Response to Hormones and Abiotic Stresses inF vesca Leaves

We investigated whether salt drought low temperature and exogenous application of thehormones indole acetic acid (IAA) and abscisic acid (ABA) would induce expression of the FvMAPKand FvMAPKK genes in seedling leaves using qRT-PCR analysis After cold treatment most of thetested genes showed a large expression increase 48 h after treatment Among them was MAPK2whose expression increased in early stages before decreasing In general drought stress resulted inthe induction of the greatest number of genes and a significantly improved in the process 12 daysIn response to salt stress the expression of five FvMAPK genes (FvMAPK5 -9 -10 -11 and -12) and threeFvMAPKK genes (FvMAPKK1 -3 and -5) increased Interestingly the transcript levels of FvMAPKK3were specifically activated by salt stress and not by the other treatments The expression of FvMAPK3and -12 and FvMAPKK4 -5 and -6 was activated by ABA while the IAA treatment only resulted in achange in FvMAPKK4 expression which was up-regulated two days after treatment (Figure 7)

Int J Mol Sci 2017 18 1766 11 of 18

23 Gene Expression Profiles of FvMAPKs and FvMAPKKs in Response to Hormones and Abiotic

Stresses in F vesca Leaves

We investigated whether salt drought low temperature and exogenous application of the

hormones indole acetic acid (IAA) and abscisic acid (ABA) would induce expression of the

FvMAPK and FvMAPKK genes in seedling leaves using qRT-PCR analysis After cold treatment

most of the tested genes showed a large expression increase 48 h after treatment Among them was

MAPK2 whose expression increased in early stages before decreasing In general drought stress

resulted in the induction of the greatest number of genes and a significantly improved in the

process 12 days In response to salt stress the expression of five FvMAPK genes (FvMAPK5 -9 -10

-11 and -12) and three FvMAPKK genes (FvMAPKK1 -3 and -5) increased Interestingly the

transcript levels of FvMAPKK3 were specifically activated by salt stress and not by the other

treatments The expression of FvMAPK3 and -12 and FvMAPKK4 -5 and -6 was activated by ABA

while the IAA treatment only resulted in a change in FvMAPKK4 expression which was

up-regulated two days after treatment (Figure 7)

Figure 7 Expression patterns of FvMPK and FvMPKK genes after different stress and hormone

treatments of leaves in Fragaria vesca Leaves were harvested every two days (0 2 4 6 8 10 and 12

days) after treatment Abscisic acid (ABA) (100 μM) indole-3-acetic acid (IAA) (100 μM) NaCl (100

mM) and drought treatments Leaves from the low temperature treatment were collected at 0 4 8

12 24 48 and 72 h after cold stress application

24 Expression Patterns of FvMAPK and FvMAPKK Genes in Response to Sucrose Hormones and

Abiotic Stresses in F vesca Fruits

The expression patterns of the FvMAPK and FvMAPKK genes at an early stage (18 DAF days

after flowering) and a late stage (36 DAF) of fruit development in response to exogenous IAA ABA

and sucrose treatment and drought high temperature or low temperature stresses were also

examined by qRT-PCR analyses Almost all showed a higher expression level in the early than in

the later stage It was interesting that the transcript levels of almost all the genes were up-regulated

in response to IAA drought and low temperature treatment at the early stage of fruit development

(18 DAF) During low temperature stress the expression of 17 of the 19 genes increased

significantly at 18 DAF while the transcript levels of FvMAPK3 FvMAPKK1 FvMAPKK3

FvMAPKK6 and FvMAPKK7 were significantly up-regulated by high temperature treatment even

Figure 7 Expression patterns of FvMPK and FvMPKK genes after different stress and hormonetreatments of leaves in Fragaria vesca Leaves were harvested every two days (0 2 4 6 8 10 and12 days) after treatment Abscisic acid (ABA) (100 microM) indole-3-acetic acid (IAA) (100 microM) NaCl(100 mM) and drought treatments Leaves from the low temperature treatment were collected at 0 4 812 24 48 and 72 h after cold stress application

24 Expression Patterns of FvMAPK and FvMAPKK Genes in Response to Sucrose Hormones and AbioticStresses in F vesca Fruits

The expression patterns of the FvMAPK and FvMAPKK genes at an early stage (18 DAF daysafter flowering) and a late stage (36 DAF) of fruit development in response to exogenous IAA ABAand sucrose treatment and drought high temperature or low temperature stresses were also examinedby qRT-PCR analyses Almost all showed a higher expression level in the early than in the later stageIt was interesting that the transcript levels of almost all the genes were up-regulated in responseto IAA drought and low temperature treatment at the early stage of fruit development (18 DAF)During low temperature stress the expression of 17 of the 19 genes increased significantly at 18 DAFwhile the transcript levels of FvMAPK3 FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 weresignificantly up-regulated by high temperature treatment even though the expression of FvMAPKK1

Int J Mol Sci 2017 18 1766 12 of 18

FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions(Figure 8)

Int J Mol Sci 2017 18 1766 12 of 18

though the expression of FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions (Figure 8)

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stress pre-treatments Red and blue boxes indicate high and low expression levels respectively for each gene Six treatments Abscisic acid (ABA) 100 μM indole-3-acetic acid (IAA) 100 μM Suc sucrose 50 μM Dry drought treatment High high temperature (40 degC) Low low temperature (4 degC) Con controlled trials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yet been comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and 1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genome while at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genome even though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome (~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and 5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similar in size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that of A thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based on phylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogenetically characterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Only one MAP4K member was identified in the F vesca genome but the ORF showed strong similarity to ScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles in ovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based on the conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinase subdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to each other FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference in length is usually due to variation in the length of the domain or a variable number of introns and may indicate the absence or presence of motifs which can affect the functional specificity There are 10 and 7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins ranged in size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members of the FvMAPKKK subfamily were distributed to all the

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stresspre-treatments Red and blue boxes indicate high and low expression levels respectively for each geneSix treatments Abscisic acid (ABA) 100 microM indole-3-acetic acid (IAA) 100 microM Suc sucrose 50 microMDry drought treatment High high temperature (40 C) Low low temperature (4 C) Con controlledtrials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yetbeen comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genomewhile at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genomeeven though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome(~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similarin size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that ofA thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based onphylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogeneticallycharacterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Onlyone MAP4K member was identified in the F vesca genome but the ORF showed strong similarity toScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles inovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based onthe conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinasesubdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to eachother FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference inlength is usually due to variation in the length of the domain or a variable number of introns and mayindicate the absence or presence of motifs which can affect the functional specificity There are 10 and7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins rangedin size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members

Int J Mol Sci 2017 18 1766 13 of 18

of the FvMAPKKK subfamily were distributed to all the chromosomes and shared 12ndash34 identitywith each other with a sequence length ranging from 214 to 1403 amino acids A kinase domainin the C-terminal and a long regulatory domain in the N- terminal region were identified in mostFvMAPKKKs suggesting that the specific long regulatory domain exited in the N-terminal of theRAF subfamily may involve in specify the kinase activity and regulating protein interaction [45] It isinteresting that no FvMAPKKK was found that belonged to the ZIK subfamily which in other specieshas members with a conserved GTPEFMAPE (LV) Y signature The absence of the characteristic ZIKsubfamily feature in F vesca might suggest the presence of a slightly modified RAF domain instead ofthe typical ZIK domain as reported in Vitis [42]

As the last two steps of the MAPK cascade MAPK and MAPKK link upstream kinases anddownstream substrates As dual-specificity kinases MAPKKs can be activated and phosphorylatedby MAPKKKs via phosphorylation of ThrSer residues while MAPKKs also phosphorylate thedownstream MAPKs and activated MAPKs can phosphorylate different substrates including othertranscription factors kinases and cytoskeleton binding proteins [3] The MAPK cascade protein(MAP4K-MAPKKK-MAPKK-MAPK) family is large and the functions of the various members canbe complex Though there are many members identified in the MAPKKK and MAP4K subfamilieslittle is known about the MAPKs and MAPKKs In this study we mainly focused our gene expressionpattern analysis on the MAPK and MAPKK genes We evaluated the expression patterns of all ofthe predicted members of the FvMAPK and FvMAPKK subfamily in different strawberry organs anddevelopmental stages The expression of most of the FvMAPK and FvMAPKK genes was detected in thestrawberry organs investigated possibly reflecting their involvement in a common metabolic andordevelopmental process Among them FvMAPK7 FvMAPK10 and FvMAPKK2 showed significantlyhigher expression in leaves than in other organs and FvMAPKK6 and FvMAPKK7 were specificallyexpressed in leaves whereas the FvMAPK6 transcripts were not be detected in leaves indicatingdifferent functions for divergent family members

Stress-specific increased MAPK genes and kinase activity has been identified when plantsare suffering from a variety of abiotic stresses including drought cold high salinity ozone UVirradiation and oxidative stress [46ndash49] Plant hormones were detected playing a role in trigger stressresponses and developmental pathways with other signaling molecules [4650ndash52] The componentsof MEKK1 MKK2 MPK4 andor MPK6 respond to drought salt or cold stressed were characterizedin A thaliana [2247] We studied the interaction between hormone and gene expression patterns instrawberry fruit FvMAPK5 and FvMAPK8 belong to group II which contains well-characterizedMAPK genes including AtMAPK3 and AtMAPK6 It has been reported that AtMAPK3 can be activatedin response to abiotic stresses and pathogens and AtMAPK6 also plays a role in abiotic and bioticstresses [10395354] Similarly we speculate that FvMAPK5 and FvMAPK8 are important for abioticor biotic stress responses due to their transcriptional activation by cold and drought FvMAPK1FvMAPK9 and FvMAPK10 are clustered in Group I while also includes AtMAPK4 AtMAPK5AtMAPK11 AtMAPK12 and AtMAPK13 AtMPK4 and its upstream MAPKK AtMKK2 are involvedin both biotic and abiotic stresses The expression patterns of FvMAPK1 FvMAPK9 and FvMAPK10were similar in fruits but not in leaves suggesting different functions depending on the organ [55]

In A thaliana AtMPKK3 is up-regulated in response to ABA [46] and FvMPKK5 which showedthe highest homology to AtMPKK3 showed strong activation by ABA in leaves suggesting asimilar function Interestingly AtMKK1AtMKK2 which are activated by salt drought and coldstresses [2223] and their ortholog FvMAPKK3 showed specific activation by salt stress in leaves andsignificant expression changes due to cold and heat stress

Int J Mol Sci 2017 18 1766 14 of 18

4 Materials and Methods

41 Identification of Potential MAPK Cascade Gene Family Members in Strawberry

To identify a complete list of strawberry MAPK cascade genes we used two public databases theNational Centre for Biotechnology Information (NCBI httpwwwncbinlmnihgov) and F vescaBioView Gene Model Database (httpsstrawberryplantandfoodconz)

42 Phylogenetic Analysis of A Thaliana and the Strawberry MAPK Cascade Genes

Phylogenetic analysis was performed using the MEGA 51 software (USA) and theneighbor-joining method Bootstrap values were calculated for 1000 iterations [5657] The A thalianaMAPK cascades gene family database was obtained from TAIR (The A thaliana Information Resourcehttpwwwarabidopsisorg) and used for comparative analysis

43 Plant Material and Fruit Pre-Treatments

F vesca (ldquoHawaii 4rdquo) plants were grown on a growth chamber at 22 plusmn 1 C in a 1311 h darklightphotoperiod Fruit samples were harvested every 6 days starting of the 18 days after flowering (18 2430 36 and 42 DAF) At each developmental stage ten representative fruits were sampled and tissueswere immediately frozen in liquid nitrogen and stored at minus80 C until further use In order to obtaindifferent pre-treatment experimental fruits two stages (18 and 36 DAF) were selected for sucrose andhormone treatments The fruits were cut in half longitudinally and half was used as a control whilethe other half was used for processing The different treatments used in this work were indole-3-aceticacid (IAA) abscisic acid (ABA) and sucrose at a concentration of 100 100 and 50 microM respectively Thehigh and low temperature was 40 C and 4 C All other experiments were performed at 25 C

44 The Processing of Strawberry Leaves under Different Stress and Hormone Treatments

To investigate the induced expression patterns of the FvMAPK and FvMAPKK genes in seedlingleaves in response to various treatments 30 days old soil grown seedlings were used For salt stresstreatment seedlings were irrigated in 100 mM NaCl collected 2 4 6 8 10 and 12 days after salttreatment of leaves without salt stress as control For the drought stress treatment all plants werestopped to water after full irrigation watering then clipping the leaves in 2 4 6 8 10 and 12 daysand no drought stress as the control respectively For the cold treatment seedlings were maintainedat 0 C and leaf material collected at 4 8 12 24 48 and 72 h Leaves cultivated in a growth chamberat 22 plusmn 1 C were used as controls For the hormone treatments plants were sprayed with solutionscontaining 100 microM ABA or 100 microM IAA then leaves were collected after 2 4 6 8 10 and 12 daysPlants that had not been sprayed served as the controls Samples were immediately frozen in liquidnitrogen and stored at minus80 C

45 RNA Extraction and Real-Time PCR Analysis

Total RNA was isolated from strawberry fruits harvested at 18 24 30 36 and 42 DAF usingthe Plant RNA Kit (Omega USA) according to the manufacturerrsquos instructions and total RNA wasreverse transcribed into cDNA using the Invitrogen reverse transcription kit (SuperScriptIII ReverseTranscriptase USA) Real-time PCR was performed to confirm gene expression patterns using a LightCyclerreg 96 SW11 Real Time PCR System (Roche Germany) with SYBR-Green (Takara Dalian China)The primer sequences used are designed based on gene sequences and the Beacon designer softwareand are shown in Table 2 in this study Each reaction consists of 5 microL SYBR 35 microL ddH2O 1 microL dilutedtemplate (1 microL of the generated first-strand cDNA diluted by 9 microL ddH2O) and 025 microL of each of twogene specific primers Thermal cycling conditions were 95 C for 10 min then 40 cycles at 95 C for20 s 54 C for 20 s 72 C for 20 s

Int J Mol Sci 2017 18 1766 6 of 18

Table 1 Cont

Gene Name Gene ID Chr Location ORF (aa) mW (kDa) pI Instability Index Ai GRAVY Number of Exons

MAPKKK45 101305547 3 1501602315017869 447 4964 450 5048 8002 minus019 1MAPKKK46 101305739 3 57621425770103 1323 14589 511 4654 7592 minus056 9MAPKKK47 101305774 6 1313261813140647 845 9361 577 4472 8134 minus037 16MAPKKK48 101305797 1 22432522248966 1403 15280 525 4701 7302 minus052 10MAPKKK49 101307123 5 1749532317497199 405 4508 536 5535 7607 minus016 2MAPKKK50 101307418 6 3760187437604741 346 3884 721 4297 8491 minus024 6MAPKKK51 101307975 3 1314136213142841 488 5377 485 4932 7904 minus015 1MAPKKK52 101308436 2 2047217320477216 927 10152 536 4352 8395 minus032 13MAPKKK53 101308592 6 1588339615899615 765 8591 577 5123 8058 minus041 18MAPKKK54 101308868 5 15734201580407 902 9841 944 6015 6401 minus060 12MAPKKK55 101309867 1 80844508090390 572 6491 569 4985 835 minus043 16MAPKKK56 101309911 3 949163951911 374 4266 896 4665 811 minus042 3MAPKKK57 101310026 5 1017421710182364 1034 11294 553 4891 8121 minus044 13MAPKKK58 101310764 7 2236511822371514 903 9723 971 6572 6298 minus059 12MAPKKK59 101312454 5 2679636926801049 390 4424 557 436 8349 minus040 6MAPKKK60 101312659 6 2097441620976740 433 4951 510 3722 8379 minus048 5MAPKKK61 101312816 3 2525580525265535 794 8906 609 5014 7649 minus045 17MAPKKK62 101312898 2 98594129866665 1192 13083 515 482 8005 minus044 9MAPKKK63 101313105 3 2526993825276589 710 8027 732 4181 7839 minus048 13MAPKKK64 101313212 5 57646445768035 350 3978 643 4669 8309 minus030 7MAPKKK65 101313251 1 1606427416069495 618 6706 922 5262 6738 minus053 11MAPKKK66 101313299 3 2691406626919397 239 2717 923 3057 9669 minus021 11MAPKKK67 101315161 6 67071786711235 358 4009 903 3993 8802 minus030 6MAPKKK68 101315443 6 93407100195 918 10048 591 4443 7724 minus045 13MAPKKK69 105349270 7 57641745768902 438 4717 1009 5937 7792 minus048 10MAPKKK70 105349796 2 1835555618356787 219 2473 873 4283 8945 minus021 4MAPKKK71 105351460 1 1082311810824804 351 3906 497 4776 7359 minus036 1MAPKKK72 105351574 5 1316239613164156 298 3363 684 5069 8208 minus043 1MAPKKK73 105353223 7 51440135149034 682 7782 815 446 8776 minus040 13

MAPKKKKs

MAP4K1 101308962 4 1722231317230075 821 9020 521 4782 7106 minus054 18

Int J Mol Sci 2017 18 1766 7 of 18

The division of the FvMAPK sequences into four distinct groups was consistent with previousreports [1437] FvMAPK1 FvMAPK9 and FvMAPK10 clustered within Group I MAPKs are involvedin both abiotic stress responses and cell division in A thaliana [2324] FvMAPK5 and FvMAPK8belonged to Group II together with AtMPK3 and AtMPK6 and Group III includes FvMAPK11and FvMAPK12 and members from this group in other plant species are known to be regulated byboth biotic and abiotic stresses [25] The largest group was Group IV which included five members(FvMAPK2 FvMAPK3 FvMAPK4 FvMAPK6 and FvMAPK7) with the TDY motif in their T-loopand the absence of the C-terminal CD domain which is consistently present in members of the otherMAPK groups

Int J Mol Sci 2017 18 1766 7 of 18

The division of the FvMAPK sequences into four distinct groups was consistent with previous reports [1437] FvMAPK1 FvMAPK9 and FvMAPK10 clustered within Group I MAPKs are involved in both abiotic stress responses and cell division in A thaliana [2324] FvMAPK5 and FvMAPK8 belonged to Group II together with AtMPK3 and AtMPK6 and Group III includes FvMAPK11 and FvMAPK12 and members from this group in other plant species are known to be regulated by both biotic and abiotic stresses [25] The largest group was Group IV which included five members (FvMAPK2 FvMAPK3 FvMAPK4 FvMAPK6 and FvMAPK7) with the TDY motif in their T-loop and the absence of the C-terminal CD domain which is consistently present in members of the other MAPK groups

Figure 2 Phylogenetic relationships between strawberry MAPK cascade proteins The abbreviations of MAPK cascade proteins are as follows MAPK Mitogen-activated Protein Kinase red lines MAPKK MAPK Kinase green lines MAPKKK MAPKK Kinase blue lines MAP4K MAPKKK Kinase purple lines

Figure 2 Phylogenetic relationships between strawberry MAPK cascade proteins The abbreviationsof MAPK cascade proteins are as follows MAPK Mitogen-activated Protein Kinase red linesMAPKK MAPK Kinase green lines MAPKKK MAPKK Kinase blue lines MAP4K MAPKKKKinase purple lines

Int J Mol Sci 2017 18 1766 8 of 18Int J Mol Sci 2017 18 1766 8 of 18

Figure 3 Phylogenetic relationships between MAPK cascade proteins from Arabidopsis thaliana and strawberry (A) phylogenetic relationship between A thaliana and FvMAPK proteins red lines show TEY group (B) phylogenetic relationship between A thaliana and FvMAPKK proteins green lines show TDY group and (C) phylogenetic relationship between A thaliana and FvMAPKKK proteins MAPKKK forms the largest group of MAPK cascade proteins with 73 members classified into two subfamilies MEKK (green lines) and Raf (red lines) which contain 30 and 43 genes in the Fragaria vesca and A thaliana genomes (D) Phylogenetic relationship between A thaliana and strawberry MAPKKKK proteins

Seven members of the MAPKK subfamily similar to the AtMAPKKs could also be divided into four groups FvMAPKK1 FvMAPKK3 and FvMAPKK5 were most similar to AtMPKK10 AtMPKK6 and AtMPKK3 respectively while FvMPKK2 is homologous to AtMPKK4AtMPKK5 FvMPKK4 -6 and -7 and AtMPKK7 -8 and -9 clustered into the same group (Figure 3B)

MAPKKKs are activated by either phosphorylation by other MAPKKK kinases or by G proteins and G protein-coupled receptors With 73 members the MAPKKK subfamily represented the largest subfamily of a similar size to that in rice (75 members) larger than that in grape (62 members) but smaller than that in A thaliana (80 members) Generally the members of this subfamily can be classified into three groups the MEKK subfamily the ZIK subfamily and the Raf subfamily however only two groups were identified in the strawberry genome In total there were 30 FvMAPKKKs in the MEKK subfamily and 43 in the Raf subfamily with no ZIK members identified (Figure 3C)

Although several MAP4Ks have been reported in plant genomes based on phylogenetic analyses of their kinase domain little is known about the roles of MAPKKKKs in plants Only one member was identified in F vesca (Figure 3D)

22 Expression Profiles of FvMAPKs and FvMAPKKs in Different Organs and Fruit Developmental Stages

Expression profiles provide some useful clues to gene functions To investigate the putative involvement of FvMAPK and FvMAPKK genes in strawberry growth and development the expression patterns of all of these genes were analyzed under normal growth conditions in four different organs (leaves roots stems and fruits) at various developmental stages Of the 19 predicted genes all were expressed in at least one of the four organs (Figure 4) FvMPK7 and FvMPK10 showed high expression in leaves and FvMPK10 and FvMPK11 were highly expressed in fruits FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in all organs while FvMAPKK6 and FvMAPKK7 were only expressed in leaves and FvMAPKK1 and FvMAPKK3 did not express any of the different organs under normal growth conditions

Figure 3 Phylogenetic relationships between MAPK cascade proteins from Arabidopsis thalianaand strawberry (A) phylogenetic relationship between A thaliana and FvMAPK proteins red linesshow TEY group (B) phylogenetic relationship between A thaliana and FvMAPKK proteins greenlines show TDY group and (C) phylogenetic relationship between A thaliana and FvMAPKKKproteins MAPKKK forms the largest group of MAPK cascade proteins with 73 members classifiedinto two subfamilies MEKK (green lines) and Raf (red lines) which contain 30 and 43 genes in theFragaria vesca and A thaliana genomes (D) Phylogenetic relationship between A thaliana and strawberryMAPKKKK proteins

Seven members of the MAPKK subfamily similar to the AtMAPKKs could also be divided intofour groups FvMAPKK1 FvMAPKK3 and FvMAPKK5 were most similar to AtMPKK10 AtMPKK6and AtMPKK3 respectively while FvMPKK2 is homologous to AtMPKK4AtMPKK5 FvMPKK4 -6and -7 and AtMPKK7 -8 and -9 clustered into the same group (Figure 3B)

MAPKKKs are activated by either phosphorylation by other MAPKKK kinases or by G proteinsand G protein-coupled receptors With 73 members the MAPKKK subfamily represented the largestsubfamily of a similar size to that in rice (75 members) larger than that in grape (62 members) butsmaller than that in A thaliana (80 members) Generally the members of this subfamily can beclassified into three groups the MEKK subfamily the ZIK subfamily and the Raf subfamily howeveronly two groups were identified in the strawberry genome In total there were 30 FvMAPKKKs in theMEKK subfamily and 43 in the Raf subfamily with no ZIK members identified (Figure 3C)

Although several MAP4Ks have been reported in plant genomes based on phylogenetic analysesof their kinase domain little is known about the roles of MAPKKKKs in plants Only one member wasidentified in F vesca (Figure 3D)

22 Expression Profiles of FvMAPKs and FvMAPKKs in Different Organs and Fruit Developmental Stages

Expression profiles provide some useful clues to gene functions To investigate the putativeinvolvement of FvMAPK and FvMAPKK genes in strawberry growth and development the expressionpatterns of all of these genes were analyzed under normal growth conditions in four different organs(leaves roots stems and fruits) at various developmental stages Of the 19 predicted genes all wereexpressed in at least one of the four organs (Figure 4) FvMPK7 and FvMPK10 showed high expressionin leaves and FvMPK10 and FvMPK11 were highly expressed in fruits FvMAPKK2 FvMAPKK4 andFvMAPKK5 were expressed in all organs while FvMAPKK6 and FvMAPKK7 were only expressed inleaves and FvMAPKK1 and FvMAPKK3 did not express any of the different organs under normalgrowth conditions

Int J Mol Sci 2017 18 1766 9 of 18Int J Mol Sci 2017 18 1766 9 of 18

Figure 4 Expression patterns of FvMPKs and FvMPKKs in different organs X-axis is the relative expression while Y-axis is MAPK and MAPKK genes white box root blue box stem green box leave red box fruit

We also determined the expression of FvMAPK cascade genes in different fruit developmental stages The transcript levels of FvMAPK2 and FvMAPK12 were lower than any other of the genes in all the different fruit developmental stages For the remaining 10 genes the expression patterns could be roughly divided into three categories FvMAPK3 FvMAPK4 and FvMAPK11 showed the same expression patterns which increased through development FvMAPK1 FvMAPK9 and FvMAPK10 expression however declined during fruit development Finally there were six genes (FvMAPK5 FvMAPK6 FvMAPK7 and FvMAPK8) that showed a high expression in the early stages then a decrease and later an increase in the later stages of fruit development In the FvMAPKKs subfamily only FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in fruits at a detectable level and they had the same expression patterns which gradually rose through fruit development (Figure 5) Since F vesca is a new model for investigating non-climacteric fruit development and ripening we focused on determining the expression profiles of the FvMAPKKK subfamily to different fruit developmental stages The expression profiles of the FvMAPKKK genes revealed a much higher expression in early stages than in later ripening or senescing stages indicating that they are most likely related to signal transduction during development in metabolically active tissues (Figure 6) Some FvMAPKKK transcripts showed higher levels in earlier than later stages of fruit development while others showed the opposite pattern This information can be important for further investigation of the signal transduction pathways involved in the regulation of fruit development and ripening in which different MAPKKK subfamily members may be involved

Figure 4 Expression patterns of FvMPKs and FvMPKKs in different organs X-axis is the relativeexpression while Y-axis is MAPK and MAPKK genes white box root blue box stem green box leavered box fruit

We also determined the expression of FvMAPK cascade genes in different fruit developmentalstages The transcript levels of FvMAPK2 and FvMAPK12 were lower than any other of the genes inall the different fruit developmental stages For the remaining 10 genes the expression patternscould be roughly divided into three categories FvMAPK3 FvMAPK4 and FvMAPK11 showedthe same expression patterns which increased through development FvMAPK1 FvMAPK9 andFvMAPK10 expression however declined during fruit development Finally there were six genes(FvMAPK5 FvMAPK6 FvMAPK7 and FvMAPK8) that showed a high expression in the early stagesthen a decrease and later an increase in the later stages of fruit development In the FvMAPKKssubfamily only FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in fruits at a detectablelevel and they had the same expression patterns which gradually rose through fruit development(Figure 5) Since F vesca is a new model for investigating non-climacteric fruit development andripening we focused on determining the expression profiles of the FvMAPKKK subfamily to differentfruit developmental stages The expression profiles of the FvMAPKKK genes revealed a much higherexpression in early stages than in later ripening or senescing stages indicating that they are most likelyrelated to signal transduction during development in metabolically active tissues (Figure 6) SomeFvMAPKKK transcripts showed higher levels in earlier than later stages of fruit development whileothers showed the opposite pattern This information can be important for further investigation of thesignal transduction pathways involved in the regulation of fruit development and ripening in whichdifferent MAPKKK subfamily members may be involved

Int J Mol Sci 2017 18 1766 10 of 18Int J Mol Sci 2017 18 1766 10 of 18

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis is the relative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental stages The gene expression levels were showed by the color box from blue to red indicating from low to high for each gene 18ndash42 DAF five developmental stages of days after flowering

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis is therelative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental stages ofdays after flowering

Int J Mol Sci 2017 18 1766 10 of 18

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis

is the relative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental

stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental

stages The gene expression levels were showed by the color box from blue to red indicating from

low to high for each gene 18ndash42 DAF five developmental stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental stagesThe gene expression levels were showed by the color box from blue to red indicating from low to highfor each gene 18ndash42 DAF five developmental stages of days after flowering

Int J Mol Sci 2017 18 1766 11 of 18

23 Gene Expression Profiles of FvMAPKs and FvMAPKKs in Response to Hormones and Abiotic Stresses inF vesca Leaves

We investigated whether salt drought low temperature and exogenous application of thehormones indole acetic acid (IAA) and abscisic acid (ABA) would induce expression of the FvMAPKand FvMAPKK genes in seedling leaves using qRT-PCR analysis After cold treatment most of thetested genes showed a large expression increase 48 h after treatment Among them was MAPK2whose expression increased in early stages before decreasing In general drought stress resulted inthe induction of the greatest number of genes and a significantly improved in the process 12 daysIn response to salt stress the expression of five FvMAPK genes (FvMAPK5 -9 -10 -11 and -12) and threeFvMAPKK genes (FvMAPKK1 -3 and -5) increased Interestingly the transcript levels of FvMAPKK3were specifically activated by salt stress and not by the other treatments The expression of FvMAPK3and -12 and FvMAPKK4 -5 and -6 was activated by ABA while the IAA treatment only resulted in achange in FvMAPKK4 expression which was up-regulated two days after treatment (Figure 7)

Int J Mol Sci 2017 18 1766 11 of 18

23 Gene Expression Profiles of FvMAPKs and FvMAPKKs in Response to Hormones and Abiotic

Stresses in F vesca Leaves

We investigated whether salt drought low temperature and exogenous application of the

hormones indole acetic acid (IAA) and abscisic acid (ABA) would induce expression of the

FvMAPK and FvMAPKK genes in seedling leaves using qRT-PCR analysis After cold treatment

most of the tested genes showed a large expression increase 48 h after treatment Among them was

MAPK2 whose expression increased in early stages before decreasing In general drought stress

resulted in the induction of the greatest number of genes and a significantly improved in the

process 12 days In response to salt stress the expression of five FvMAPK genes (FvMAPK5 -9 -10

-11 and -12) and three FvMAPKK genes (FvMAPKK1 -3 and -5) increased Interestingly the

transcript levels of FvMAPKK3 were specifically activated by salt stress and not by the other

treatments The expression of FvMAPK3 and -12 and FvMAPKK4 -5 and -6 was activated by ABA

while the IAA treatment only resulted in a change in FvMAPKK4 expression which was

up-regulated two days after treatment (Figure 7)

Figure 7 Expression patterns of FvMPK and FvMPKK genes after different stress and hormone

treatments of leaves in Fragaria vesca Leaves were harvested every two days (0 2 4 6 8 10 and 12

days) after treatment Abscisic acid (ABA) (100 μM) indole-3-acetic acid (IAA) (100 μM) NaCl (100

mM) and drought treatments Leaves from the low temperature treatment were collected at 0 4 8

12 24 48 and 72 h after cold stress application

24 Expression Patterns of FvMAPK and FvMAPKK Genes in Response to Sucrose Hormones and

Abiotic Stresses in F vesca Fruits

The expression patterns of the FvMAPK and FvMAPKK genes at an early stage (18 DAF days

after flowering) and a late stage (36 DAF) of fruit development in response to exogenous IAA ABA

and sucrose treatment and drought high temperature or low temperature stresses were also

examined by qRT-PCR analyses Almost all showed a higher expression level in the early than in

the later stage It was interesting that the transcript levels of almost all the genes were up-regulated

in response to IAA drought and low temperature treatment at the early stage of fruit development

(18 DAF) During low temperature stress the expression of 17 of the 19 genes increased

significantly at 18 DAF while the transcript levels of FvMAPK3 FvMAPKK1 FvMAPKK3

FvMAPKK6 and FvMAPKK7 were significantly up-regulated by high temperature treatment even

Figure 7 Expression patterns of FvMPK and FvMPKK genes after different stress and hormonetreatments of leaves in Fragaria vesca Leaves were harvested every two days (0 2 4 6 8 10 and12 days) after treatment Abscisic acid (ABA) (100 microM) indole-3-acetic acid (IAA) (100 microM) NaCl(100 mM) and drought treatments Leaves from the low temperature treatment were collected at 0 4 812 24 48 and 72 h after cold stress application

24 Expression Patterns of FvMAPK and FvMAPKK Genes in Response to Sucrose Hormones and AbioticStresses in F vesca Fruits

The expression patterns of the FvMAPK and FvMAPKK genes at an early stage (18 DAF daysafter flowering) and a late stage (36 DAF) of fruit development in response to exogenous IAA ABAand sucrose treatment and drought high temperature or low temperature stresses were also examinedby qRT-PCR analyses Almost all showed a higher expression level in the early than in the later stageIt was interesting that the transcript levels of almost all the genes were up-regulated in responseto IAA drought and low temperature treatment at the early stage of fruit development (18 DAF)During low temperature stress the expression of 17 of the 19 genes increased significantly at 18 DAFwhile the transcript levels of FvMAPK3 FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 weresignificantly up-regulated by high temperature treatment even though the expression of FvMAPKK1

Int J Mol Sci 2017 18 1766 12 of 18

FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions(Figure 8)

Int J Mol Sci 2017 18 1766 12 of 18

though the expression of FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions (Figure 8)

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stress pre-treatments Red and blue boxes indicate high and low expression levels respectively for each gene Six treatments Abscisic acid (ABA) 100 μM indole-3-acetic acid (IAA) 100 μM Suc sucrose 50 μM Dry drought treatment High high temperature (40 degC) Low low temperature (4 degC) Con controlled trials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yet been comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and 1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genome while at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genome even though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome (~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and 5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similar in size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that of A thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based on phylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogenetically characterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Only one MAP4K member was identified in the F vesca genome but the ORF showed strong similarity to ScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles in ovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based on the conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinase subdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to each other FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference in length is usually due to variation in the length of the domain or a variable number of introns and may indicate the absence or presence of motifs which can affect the functional specificity There are 10 and 7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins ranged in size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members of the FvMAPKKK subfamily were distributed to all the

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stresspre-treatments Red and blue boxes indicate high and low expression levels respectively for each geneSix treatments Abscisic acid (ABA) 100 microM indole-3-acetic acid (IAA) 100 microM Suc sucrose 50 microMDry drought treatment High high temperature (40 C) Low low temperature (4 C) Con controlledtrials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yetbeen comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genomewhile at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genomeeven though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome(~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similarin size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that ofA thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based onphylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogeneticallycharacterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Onlyone MAP4K member was identified in the F vesca genome but the ORF showed strong similarity toScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles inovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based onthe conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinasesubdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to eachother FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference inlength is usually due to variation in the length of the domain or a variable number of introns and mayindicate the absence or presence of motifs which can affect the functional specificity There are 10 and7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins rangedin size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members

Int J Mol Sci 2017 18 1766 13 of 18

of the FvMAPKKK subfamily were distributed to all the chromosomes and shared 12ndash34 identitywith each other with a sequence length ranging from 214 to 1403 amino acids A kinase domainin the C-terminal and a long regulatory domain in the N- terminal region were identified in mostFvMAPKKKs suggesting that the specific long regulatory domain exited in the N-terminal of theRAF subfamily may involve in specify the kinase activity and regulating protein interaction [45] It isinteresting that no FvMAPKKK was found that belonged to the ZIK subfamily which in other specieshas members with a conserved GTPEFMAPE (LV) Y signature The absence of the characteristic ZIKsubfamily feature in F vesca might suggest the presence of a slightly modified RAF domain instead ofthe typical ZIK domain as reported in Vitis [42]

As the last two steps of the MAPK cascade MAPK and MAPKK link upstream kinases anddownstream substrates As dual-specificity kinases MAPKKs can be activated and phosphorylatedby MAPKKKs via phosphorylation of ThrSer residues while MAPKKs also phosphorylate thedownstream MAPKs and activated MAPKs can phosphorylate different substrates including othertranscription factors kinases and cytoskeleton binding proteins [3] The MAPK cascade protein(MAP4K-MAPKKK-MAPKK-MAPK) family is large and the functions of the various members canbe complex Though there are many members identified in the MAPKKK and MAP4K subfamilieslittle is known about the MAPKs and MAPKKs In this study we mainly focused our gene expressionpattern analysis on the MAPK and MAPKK genes We evaluated the expression patterns of all ofthe predicted members of the FvMAPK and FvMAPKK subfamily in different strawberry organs anddevelopmental stages The expression of most of the FvMAPK and FvMAPKK genes was detected in thestrawberry organs investigated possibly reflecting their involvement in a common metabolic andordevelopmental process Among them FvMAPK7 FvMAPK10 and FvMAPKK2 showed significantlyhigher expression in leaves than in other organs and FvMAPKK6 and FvMAPKK7 were specificallyexpressed in leaves whereas the FvMAPK6 transcripts were not be detected in leaves indicatingdifferent functions for divergent family members

Stress-specific increased MAPK genes and kinase activity has been identified when plantsare suffering from a variety of abiotic stresses including drought cold high salinity ozone UVirradiation and oxidative stress [46ndash49] Plant hormones were detected playing a role in trigger stressresponses and developmental pathways with other signaling molecules [4650ndash52] The componentsof MEKK1 MKK2 MPK4 andor MPK6 respond to drought salt or cold stressed were characterizedin A thaliana [2247] We studied the interaction between hormone and gene expression patterns instrawberry fruit FvMAPK5 and FvMAPK8 belong to group II which contains well-characterizedMAPK genes including AtMAPK3 and AtMAPK6 It has been reported that AtMAPK3 can be activatedin response to abiotic stresses and pathogens and AtMAPK6 also plays a role in abiotic and bioticstresses [10395354] Similarly we speculate that FvMAPK5 and FvMAPK8 are important for abioticor biotic stress responses due to their transcriptional activation by cold and drought FvMAPK1FvMAPK9 and FvMAPK10 are clustered in Group I while also includes AtMAPK4 AtMAPK5AtMAPK11 AtMAPK12 and AtMAPK13 AtMPK4 and its upstream MAPKK AtMKK2 are involvedin both biotic and abiotic stresses The expression patterns of FvMAPK1 FvMAPK9 and FvMAPK10were similar in fruits but not in leaves suggesting different functions depending on the organ [55]

In A thaliana AtMPKK3 is up-regulated in response to ABA [46] and FvMPKK5 which showedthe highest homology to AtMPKK3 showed strong activation by ABA in leaves suggesting asimilar function Interestingly AtMKK1AtMKK2 which are activated by salt drought and coldstresses [2223] and their ortholog FvMAPKK3 showed specific activation by salt stress in leaves andsignificant expression changes due to cold and heat stress

Int J Mol Sci 2017 18 1766 14 of 18

4 Materials and Methods

41 Identification of Potential MAPK Cascade Gene Family Members in Strawberry

To identify a complete list of strawberry MAPK cascade genes we used two public databases theNational Centre for Biotechnology Information (NCBI httpwwwncbinlmnihgov) and F vescaBioView Gene Model Database (httpsstrawberryplantandfoodconz)

42 Phylogenetic Analysis of A Thaliana and the Strawberry MAPK Cascade Genes

Phylogenetic analysis was performed using the MEGA 51 software (USA) and theneighbor-joining method Bootstrap values were calculated for 1000 iterations [5657] The A thalianaMAPK cascades gene family database was obtained from TAIR (The A thaliana Information Resourcehttpwwwarabidopsisorg) and used for comparative analysis

43 Plant Material and Fruit Pre-Treatments

F vesca (ldquoHawaii 4rdquo) plants were grown on a growth chamber at 22 plusmn 1 C in a 1311 h darklightphotoperiod Fruit samples were harvested every 6 days starting of the 18 days after flowering (18 2430 36 and 42 DAF) At each developmental stage ten representative fruits were sampled and tissueswere immediately frozen in liquid nitrogen and stored at minus80 C until further use In order to obtaindifferent pre-treatment experimental fruits two stages (18 and 36 DAF) were selected for sucrose andhormone treatments The fruits were cut in half longitudinally and half was used as a control whilethe other half was used for processing The different treatments used in this work were indole-3-aceticacid (IAA) abscisic acid (ABA) and sucrose at a concentration of 100 100 and 50 microM respectively Thehigh and low temperature was 40 C and 4 C All other experiments were performed at 25 C

44 The Processing of Strawberry Leaves under Different Stress and Hormone Treatments

To investigate the induced expression patterns of the FvMAPK and FvMAPKK genes in seedlingleaves in response to various treatments 30 days old soil grown seedlings were used For salt stresstreatment seedlings were irrigated in 100 mM NaCl collected 2 4 6 8 10 and 12 days after salttreatment of leaves without salt stress as control For the drought stress treatment all plants werestopped to water after full irrigation watering then clipping the leaves in 2 4 6 8 10 and 12 daysand no drought stress as the control respectively For the cold treatment seedlings were maintainedat 0 C and leaf material collected at 4 8 12 24 48 and 72 h Leaves cultivated in a growth chamberat 22 plusmn 1 C were used as controls For the hormone treatments plants were sprayed with solutionscontaining 100 microM ABA or 100 microM IAA then leaves were collected after 2 4 6 8 10 and 12 daysPlants that had not been sprayed served as the controls Samples were immediately frozen in liquidnitrogen and stored at minus80 C

45 RNA Extraction and Real-Time PCR Analysis

Total RNA was isolated from strawberry fruits harvested at 18 24 30 36 and 42 DAF usingthe Plant RNA Kit (Omega USA) according to the manufacturerrsquos instructions and total RNA wasreverse transcribed into cDNA using the Invitrogen reverse transcription kit (SuperScriptIII ReverseTranscriptase USA) Real-time PCR was performed to confirm gene expression patterns using a LightCyclerreg 96 SW11 Real Time PCR System (Roche Germany) with SYBR-Green (Takara Dalian China)The primer sequences used are designed based on gene sequences and the Beacon designer softwareand are shown in Table 2 in this study Each reaction consists of 5 microL SYBR 35 microL ddH2O 1 microL dilutedtemplate (1 microL of the generated first-strand cDNA diluted by 9 microL ddH2O) and 025 microL of each of twogene specific primers Thermal cycling conditions were 95 C for 10 min then 40 cycles at 95 C for20 s 54 C for 20 s 72 C for 20 s

Int J Mol Sci 2017 18 1766 7 of 18

The division of the FvMAPK sequences into four distinct groups was consistent with previousreports [1437] FvMAPK1 FvMAPK9 and FvMAPK10 clustered within Group I MAPKs are involvedin both abiotic stress responses and cell division in A thaliana [2324] FvMAPK5 and FvMAPK8belonged to Group II together with AtMPK3 and AtMPK6 and Group III includes FvMAPK11and FvMAPK12 and members from this group in other plant species are known to be regulated byboth biotic and abiotic stresses [25] The largest group was Group IV which included five members(FvMAPK2 FvMAPK3 FvMAPK4 FvMAPK6 and FvMAPK7) with the TDY motif in their T-loopand the absence of the C-terminal CD domain which is consistently present in members of the otherMAPK groups

Int J Mol Sci 2017 18 1766 7 of 18

The division of the FvMAPK sequences into four distinct groups was consistent with previous reports [1437] FvMAPK1 FvMAPK9 and FvMAPK10 clustered within Group I MAPKs are involved in both abiotic stress responses and cell division in A thaliana [2324] FvMAPK5 and FvMAPK8 belonged to Group II together with AtMPK3 and AtMPK6 and Group III includes FvMAPK11 and FvMAPK12 and members from this group in other plant species are known to be regulated by both biotic and abiotic stresses [25] The largest group was Group IV which included five members (FvMAPK2 FvMAPK3 FvMAPK4 FvMAPK6 and FvMAPK7) with the TDY motif in their T-loop and the absence of the C-terminal CD domain which is consistently present in members of the other MAPK groups

Figure 2 Phylogenetic relationships between strawberry MAPK cascade proteins The abbreviations of MAPK cascade proteins are as follows MAPK Mitogen-activated Protein Kinase red lines MAPKK MAPK Kinase green lines MAPKKK MAPKK Kinase blue lines MAP4K MAPKKK Kinase purple lines

Figure 2 Phylogenetic relationships between strawberry MAPK cascade proteins The abbreviationsof MAPK cascade proteins are as follows MAPK Mitogen-activated Protein Kinase red linesMAPKK MAPK Kinase green lines MAPKKK MAPKK Kinase blue lines MAP4K MAPKKKKinase purple lines

Int J Mol Sci 2017 18 1766 8 of 18Int J Mol Sci 2017 18 1766 8 of 18

Figure 3 Phylogenetic relationships between MAPK cascade proteins from Arabidopsis thaliana and strawberry (A) phylogenetic relationship between A thaliana and FvMAPK proteins red lines show TEY group (B) phylogenetic relationship between A thaliana and FvMAPKK proteins green lines show TDY group and (C) phylogenetic relationship between A thaliana and FvMAPKKK proteins MAPKKK forms the largest group of MAPK cascade proteins with 73 members classified into two subfamilies MEKK (green lines) and Raf (red lines) which contain 30 and 43 genes in the Fragaria vesca and A thaliana genomes (D) Phylogenetic relationship between A thaliana and strawberry MAPKKKK proteins

Seven members of the MAPKK subfamily similar to the AtMAPKKs could also be divided into four groups FvMAPKK1 FvMAPKK3 and FvMAPKK5 were most similar to AtMPKK10 AtMPKK6 and AtMPKK3 respectively while FvMPKK2 is homologous to AtMPKK4AtMPKK5 FvMPKK4 -6 and -7 and AtMPKK7 -8 and -9 clustered into the same group (Figure 3B)

MAPKKKs are activated by either phosphorylation by other MAPKKK kinases or by G proteins and G protein-coupled receptors With 73 members the MAPKKK subfamily represented the largest subfamily of a similar size to that in rice (75 members) larger than that in grape (62 members) but smaller than that in A thaliana (80 members) Generally the members of this subfamily can be classified into three groups the MEKK subfamily the ZIK subfamily and the Raf subfamily however only two groups were identified in the strawberry genome In total there were 30 FvMAPKKKs in the MEKK subfamily and 43 in the Raf subfamily with no ZIK members identified (Figure 3C)

Although several MAP4Ks have been reported in plant genomes based on phylogenetic analyses of their kinase domain little is known about the roles of MAPKKKKs in plants Only one member was identified in F vesca (Figure 3D)

22 Expression Profiles of FvMAPKs and FvMAPKKs in Different Organs and Fruit Developmental Stages

Expression profiles provide some useful clues to gene functions To investigate the putative involvement of FvMAPK and FvMAPKK genes in strawberry growth and development the expression patterns of all of these genes were analyzed under normal growth conditions in four different organs (leaves roots stems and fruits) at various developmental stages Of the 19 predicted genes all were expressed in at least one of the four organs (Figure 4) FvMPK7 and FvMPK10 showed high expression in leaves and FvMPK10 and FvMPK11 were highly expressed in fruits FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in all organs while FvMAPKK6 and FvMAPKK7 were only expressed in leaves and FvMAPKK1 and FvMAPKK3 did not express any of the different organs under normal growth conditions

Figure 3 Phylogenetic relationships between MAPK cascade proteins from Arabidopsis thalianaand strawberry (A) phylogenetic relationship between A thaliana and FvMAPK proteins red linesshow TEY group (B) phylogenetic relationship between A thaliana and FvMAPKK proteins greenlines show TDY group and (C) phylogenetic relationship between A thaliana and FvMAPKKKproteins MAPKKK forms the largest group of MAPK cascade proteins with 73 members classifiedinto two subfamilies MEKK (green lines) and Raf (red lines) which contain 30 and 43 genes in theFragaria vesca and A thaliana genomes (D) Phylogenetic relationship between A thaliana and strawberryMAPKKKK proteins

Seven members of the MAPKK subfamily similar to the AtMAPKKs could also be divided intofour groups FvMAPKK1 FvMAPKK3 and FvMAPKK5 were most similar to AtMPKK10 AtMPKK6and AtMPKK3 respectively while FvMPKK2 is homologous to AtMPKK4AtMPKK5 FvMPKK4 -6and -7 and AtMPKK7 -8 and -9 clustered into the same group (Figure 3B)

MAPKKKs are activated by either phosphorylation by other MAPKKK kinases or by G proteinsand G protein-coupled receptors With 73 members the MAPKKK subfamily represented the largestsubfamily of a similar size to that in rice (75 members) larger than that in grape (62 members) butsmaller than that in A thaliana (80 members) Generally the members of this subfamily can beclassified into three groups the MEKK subfamily the ZIK subfamily and the Raf subfamily howeveronly two groups were identified in the strawberry genome In total there were 30 FvMAPKKKs in theMEKK subfamily and 43 in the Raf subfamily with no ZIK members identified (Figure 3C)

Although several MAP4Ks have been reported in plant genomes based on phylogenetic analysesof their kinase domain little is known about the roles of MAPKKKKs in plants Only one member wasidentified in F vesca (Figure 3D)

22 Expression Profiles of FvMAPKs and FvMAPKKs in Different Organs and Fruit Developmental Stages

Expression profiles provide some useful clues to gene functions To investigate the putativeinvolvement of FvMAPK and FvMAPKK genes in strawberry growth and development the expressionpatterns of all of these genes were analyzed under normal growth conditions in four different organs(leaves roots stems and fruits) at various developmental stages Of the 19 predicted genes all wereexpressed in at least one of the four organs (Figure 4) FvMPK7 and FvMPK10 showed high expressionin leaves and FvMPK10 and FvMPK11 were highly expressed in fruits FvMAPKK2 FvMAPKK4 andFvMAPKK5 were expressed in all organs while FvMAPKK6 and FvMAPKK7 were only expressed inleaves and FvMAPKK1 and FvMAPKK3 did not express any of the different organs under normalgrowth conditions

Int J Mol Sci 2017 18 1766 9 of 18Int J Mol Sci 2017 18 1766 9 of 18

Figure 4 Expression patterns of FvMPKs and FvMPKKs in different organs X-axis is the relative expression while Y-axis is MAPK and MAPKK genes white box root blue box stem green box leave red box fruit

We also determined the expression of FvMAPK cascade genes in different fruit developmental stages The transcript levels of FvMAPK2 and FvMAPK12 were lower than any other of the genes in all the different fruit developmental stages For the remaining 10 genes the expression patterns could be roughly divided into three categories FvMAPK3 FvMAPK4 and FvMAPK11 showed the same expression patterns which increased through development FvMAPK1 FvMAPK9 and FvMAPK10 expression however declined during fruit development Finally there were six genes (FvMAPK5 FvMAPK6 FvMAPK7 and FvMAPK8) that showed a high expression in the early stages then a decrease and later an increase in the later stages of fruit development In the FvMAPKKs subfamily only FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in fruits at a detectable level and they had the same expression patterns which gradually rose through fruit development (Figure 5) Since F vesca is a new model for investigating non-climacteric fruit development and ripening we focused on determining the expression profiles of the FvMAPKKK subfamily to different fruit developmental stages The expression profiles of the FvMAPKKK genes revealed a much higher expression in early stages than in later ripening or senescing stages indicating that they are most likely related to signal transduction during development in metabolically active tissues (Figure 6) Some FvMAPKKK transcripts showed higher levels in earlier than later stages of fruit development while others showed the opposite pattern This information can be important for further investigation of the signal transduction pathways involved in the regulation of fruit development and ripening in which different MAPKKK subfamily members may be involved

Figure 4 Expression patterns of FvMPKs and FvMPKKs in different organs X-axis is the relativeexpression while Y-axis is MAPK and MAPKK genes white box root blue box stem green box leavered box fruit

We also determined the expression of FvMAPK cascade genes in different fruit developmentalstages The transcript levels of FvMAPK2 and FvMAPK12 were lower than any other of the genes inall the different fruit developmental stages For the remaining 10 genes the expression patternscould be roughly divided into three categories FvMAPK3 FvMAPK4 and FvMAPK11 showedthe same expression patterns which increased through development FvMAPK1 FvMAPK9 andFvMAPK10 expression however declined during fruit development Finally there were six genes(FvMAPK5 FvMAPK6 FvMAPK7 and FvMAPK8) that showed a high expression in the early stagesthen a decrease and later an increase in the later stages of fruit development In the FvMAPKKssubfamily only FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in fruits at a detectablelevel and they had the same expression patterns which gradually rose through fruit development(Figure 5) Since F vesca is a new model for investigating non-climacteric fruit development andripening we focused on determining the expression profiles of the FvMAPKKK subfamily to differentfruit developmental stages The expression profiles of the FvMAPKKK genes revealed a much higherexpression in early stages than in later ripening or senescing stages indicating that they are most likelyrelated to signal transduction during development in metabolically active tissues (Figure 6) SomeFvMAPKKK transcripts showed higher levels in earlier than later stages of fruit development whileothers showed the opposite pattern This information can be important for further investigation of thesignal transduction pathways involved in the regulation of fruit development and ripening in whichdifferent MAPKKK subfamily members may be involved

Int J Mol Sci 2017 18 1766 10 of 18Int J Mol Sci 2017 18 1766 10 of 18

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis is the relative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental stages The gene expression levels were showed by the color box from blue to red indicating from low to high for each gene 18ndash42 DAF five developmental stages of days after flowering

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis is therelative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental stages ofdays after flowering

Int J Mol Sci 2017 18 1766 10 of 18

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis

is the relative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental

stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental

stages The gene expression levels were showed by the color box from blue to red indicating from

low to high for each gene 18ndash42 DAF five developmental stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental stagesThe gene expression levels were showed by the color box from blue to red indicating from low to highfor each gene 18ndash42 DAF five developmental stages of days after flowering

Int J Mol Sci 2017 18 1766 11 of 18

23 Gene Expression Profiles of FvMAPKs and FvMAPKKs in Response to Hormones and Abiotic Stresses inF vesca Leaves

We investigated whether salt drought low temperature and exogenous application of thehormones indole acetic acid (IAA) and abscisic acid (ABA) would induce expression of the FvMAPKand FvMAPKK genes in seedling leaves using qRT-PCR analysis After cold treatment most of thetested genes showed a large expression increase 48 h after treatment Among them was MAPK2whose expression increased in early stages before decreasing In general drought stress resulted inthe induction of the greatest number of genes and a significantly improved in the process 12 daysIn response to salt stress the expression of five FvMAPK genes (FvMAPK5 -9 -10 -11 and -12) and threeFvMAPKK genes (FvMAPKK1 -3 and -5) increased Interestingly the transcript levels of FvMAPKK3were specifically activated by salt stress and not by the other treatments The expression of FvMAPK3and -12 and FvMAPKK4 -5 and -6 was activated by ABA while the IAA treatment only resulted in achange in FvMAPKK4 expression which was up-regulated two days after treatment (Figure 7)

Int J Mol Sci 2017 18 1766 11 of 18

23 Gene Expression Profiles of FvMAPKs and FvMAPKKs in Response to Hormones and Abiotic

Stresses in F vesca Leaves

We investigated whether salt drought low temperature and exogenous application of the

hormones indole acetic acid (IAA) and abscisic acid (ABA) would induce expression of the

FvMAPK and FvMAPKK genes in seedling leaves using qRT-PCR analysis After cold treatment

most of the tested genes showed a large expression increase 48 h after treatment Among them was

MAPK2 whose expression increased in early stages before decreasing In general drought stress

resulted in the induction of the greatest number of genes and a significantly improved in the

process 12 days In response to salt stress the expression of five FvMAPK genes (FvMAPK5 -9 -10

-11 and -12) and three FvMAPKK genes (FvMAPKK1 -3 and -5) increased Interestingly the

transcript levels of FvMAPKK3 were specifically activated by salt stress and not by the other

treatments The expression of FvMAPK3 and -12 and FvMAPKK4 -5 and -6 was activated by ABA

while the IAA treatment only resulted in a change in FvMAPKK4 expression which was

up-regulated two days after treatment (Figure 7)

Figure 7 Expression patterns of FvMPK and FvMPKK genes after different stress and hormone

treatments of leaves in Fragaria vesca Leaves were harvested every two days (0 2 4 6 8 10 and 12

days) after treatment Abscisic acid (ABA) (100 μM) indole-3-acetic acid (IAA) (100 μM) NaCl (100

mM) and drought treatments Leaves from the low temperature treatment were collected at 0 4 8

12 24 48 and 72 h after cold stress application

24 Expression Patterns of FvMAPK and FvMAPKK Genes in Response to Sucrose Hormones and

Abiotic Stresses in F vesca Fruits

The expression patterns of the FvMAPK and FvMAPKK genes at an early stage (18 DAF days

after flowering) and a late stage (36 DAF) of fruit development in response to exogenous IAA ABA

and sucrose treatment and drought high temperature or low temperature stresses were also

examined by qRT-PCR analyses Almost all showed a higher expression level in the early than in

the later stage It was interesting that the transcript levels of almost all the genes were up-regulated

in response to IAA drought and low temperature treatment at the early stage of fruit development

(18 DAF) During low temperature stress the expression of 17 of the 19 genes increased

significantly at 18 DAF while the transcript levels of FvMAPK3 FvMAPKK1 FvMAPKK3

FvMAPKK6 and FvMAPKK7 were significantly up-regulated by high temperature treatment even

Figure 7 Expression patterns of FvMPK and FvMPKK genes after different stress and hormonetreatments of leaves in Fragaria vesca Leaves were harvested every two days (0 2 4 6 8 10 and12 days) after treatment Abscisic acid (ABA) (100 microM) indole-3-acetic acid (IAA) (100 microM) NaCl(100 mM) and drought treatments Leaves from the low temperature treatment were collected at 0 4 812 24 48 and 72 h after cold stress application

24 Expression Patterns of FvMAPK and FvMAPKK Genes in Response to Sucrose Hormones and AbioticStresses in F vesca Fruits

The expression patterns of the FvMAPK and FvMAPKK genes at an early stage (18 DAF daysafter flowering) and a late stage (36 DAF) of fruit development in response to exogenous IAA ABAand sucrose treatment and drought high temperature or low temperature stresses were also examinedby qRT-PCR analyses Almost all showed a higher expression level in the early than in the later stageIt was interesting that the transcript levels of almost all the genes were up-regulated in responseto IAA drought and low temperature treatment at the early stage of fruit development (18 DAF)During low temperature stress the expression of 17 of the 19 genes increased significantly at 18 DAFwhile the transcript levels of FvMAPK3 FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 weresignificantly up-regulated by high temperature treatment even though the expression of FvMAPKK1

Int J Mol Sci 2017 18 1766 12 of 18

FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions(Figure 8)

Int J Mol Sci 2017 18 1766 12 of 18

though the expression of FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions (Figure 8)

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stress pre-treatments Red and blue boxes indicate high and low expression levels respectively for each gene Six treatments Abscisic acid (ABA) 100 μM indole-3-acetic acid (IAA) 100 μM Suc sucrose 50 μM Dry drought treatment High high temperature (40 degC) Low low temperature (4 degC) Con controlled trials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yet been comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and 1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genome while at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genome even though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome (~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and 5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similar in size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that of A thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based on phylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogenetically characterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Only one MAP4K member was identified in the F vesca genome but the ORF showed strong similarity to ScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles in ovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based on the conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinase subdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to each other FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference in length is usually due to variation in the length of the domain or a variable number of introns and may indicate the absence or presence of motifs which can affect the functional specificity There are 10 and 7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins ranged in size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members of the FvMAPKKK subfamily were distributed to all the

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stresspre-treatments Red and blue boxes indicate high and low expression levels respectively for each geneSix treatments Abscisic acid (ABA) 100 microM indole-3-acetic acid (IAA) 100 microM Suc sucrose 50 microMDry drought treatment High high temperature (40 C) Low low temperature (4 C) Con controlledtrials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yetbeen comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genomewhile at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genomeeven though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome(~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similarin size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that ofA thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based onphylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogeneticallycharacterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Onlyone MAP4K member was identified in the F vesca genome but the ORF showed strong similarity toScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles inovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based onthe conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinasesubdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to eachother FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference inlength is usually due to variation in the length of the domain or a variable number of introns and mayindicate the absence or presence of motifs which can affect the functional specificity There are 10 and7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins rangedin size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members

Int J Mol Sci 2017 18 1766 13 of 18

of the FvMAPKKK subfamily were distributed to all the chromosomes and shared 12ndash34 identitywith each other with a sequence length ranging from 214 to 1403 amino acids A kinase domainin the C-terminal and a long regulatory domain in the N- terminal region were identified in mostFvMAPKKKs suggesting that the specific long regulatory domain exited in the N-terminal of theRAF subfamily may involve in specify the kinase activity and regulating protein interaction [45] It isinteresting that no FvMAPKKK was found that belonged to the ZIK subfamily which in other specieshas members with a conserved GTPEFMAPE (LV) Y signature The absence of the characteristic ZIKsubfamily feature in F vesca might suggest the presence of a slightly modified RAF domain instead ofthe typical ZIK domain as reported in Vitis [42]

As the last two steps of the MAPK cascade MAPK and MAPKK link upstream kinases anddownstream substrates As dual-specificity kinases MAPKKs can be activated and phosphorylatedby MAPKKKs via phosphorylation of ThrSer residues while MAPKKs also phosphorylate thedownstream MAPKs and activated MAPKs can phosphorylate different substrates including othertranscription factors kinases and cytoskeleton binding proteins [3] The MAPK cascade protein(MAP4K-MAPKKK-MAPKK-MAPK) family is large and the functions of the various members canbe complex Though there are many members identified in the MAPKKK and MAP4K subfamilieslittle is known about the MAPKs and MAPKKs In this study we mainly focused our gene expressionpattern analysis on the MAPK and MAPKK genes We evaluated the expression patterns of all ofthe predicted members of the FvMAPK and FvMAPKK subfamily in different strawberry organs anddevelopmental stages The expression of most of the FvMAPK and FvMAPKK genes was detected in thestrawberry organs investigated possibly reflecting their involvement in a common metabolic andordevelopmental process Among them FvMAPK7 FvMAPK10 and FvMAPKK2 showed significantlyhigher expression in leaves than in other organs and FvMAPKK6 and FvMAPKK7 were specificallyexpressed in leaves whereas the FvMAPK6 transcripts were not be detected in leaves indicatingdifferent functions for divergent family members

Stress-specific increased MAPK genes and kinase activity has been identified when plantsare suffering from a variety of abiotic stresses including drought cold high salinity ozone UVirradiation and oxidative stress [46ndash49] Plant hormones were detected playing a role in trigger stressresponses and developmental pathways with other signaling molecules [4650ndash52] The componentsof MEKK1 MKK2 MPK4 andor MPK6 respond to drought salt or cold stressed were characterizedin A thaliana [2247] We studied the interaction between hormone and gene expression patterns instrawberry fruit FvMAPK5 and FvMAPK8 belong to group II which contains well-characterizedMAPK genes including AtMAPK3 and AtMAPK6 It has been reported that AtMAPK3 can be activatedin response to abiotic stresses and pathogens and AtMAPK6 also plays a role in abiotic and bioticstresses [10395354] Similarly we speculate that FvMAPK5 and FvMAPK8 are important for abioticor biotic stress responses due to their transcriptional activation by cold and drought FvMAPK1FvMAPK9 and FvMAPK10 are clustered in Group I while also includes AtMAPK4 AtMAPK5AtMAPK11 AtMAPK12 and AtMAPK13 AtMPK4 and its upstream MAPKK AtMKK2 are involvedin both biotic and abiotic stresses The expression patterns of FvMAPK1 FvMAPK9 and FvMAPK10were similar in fruits but not in leaves suggesting different functions depending on the organ [55]

In A thaliana AtMPKK3 is up-regulated in response to ABA [46] and FvMPKK5 which showedthe highest homology to AtMPKK3 showed strong activation by ABA in leaves suggesting asimilar function Interestingly AtMKK1AtMKK2 which are activated by salt drought and coldstresses [2223] and their ortholog FvMAPKK3 showed specific activation by salt stress in leaves andsignificant expression changes due to cold and heat stress

Int J Mol Sci 2017 18 1766 14 of 18

4 Materials and Methods

41 Identification of Potential MAPK Cascade Gene Family Members in Strawberry

To identify a complete list of strawberry MAPK cascade genes we used two public databases theNational Centre for Biotechnology Information (NCBI httpwwwncbinlmnihgov) and F vescaBioView Gene Model Database (httpsstrawberryplantandfoodconz)

42 Phylogenetic Analysis of A Thaliana and the Strawberry MAPK Cascade Genes

Phylogenetic analysis was performed using the MEGA 51 software (USA) and theneighbor-joining method Bootstrap values were calculated for 1000 iterations [5657] The A thalianaMAPK cascades gene family database was obtained from TAIR (The A thaliana Information Resourcehttpwwwarabidopsisorg) and used for comparative analysis

43 Plant Material and Fruit Pre-Treatments

F vesca (ldquoHawaii 4rdquo) plants were grown on a growth chamber at 22 plusmn 1 C in a 1311 h darklightphotoperiod Fruit samples were harvested every 6 days starting of the 18 days after flowering (18 2430 36 and 42 DAF) At each developmental stage ten representative fruits were sampled and tissueswere immediately frozen in liquid nitrogen and stored at minus80 C until further use In order to obtaindifferent pre-treatment experimental fruits two stages (18 and 36 DAF) were selected for sucrose andhormone treatments The fruits were cut in half longitudinally and half was used as a control whilethe other half was used for processing The different treatments used in this work were indole-3-aceticacid (IAA) abscisic acid (ABA) and sucrose at a concentration of 100 100 and 50 microM respectively Thehigh and low temperature was 40 C and 4 C All other experiments were performed at 25 C

44 The Processing of Strawberry Leaves under Different Stress and Hormone Treatments

To investigate the induced expression patterns of the FvMAPK and FvMAPKK genes in seedlingleaves in response to various treatments 30 days old soil grown seedlings were used For salt stresstreatment seedlings were irrigated in 100 mM NaCl collected 2 4 6 8 10 and 12 days after salttreatment of leaves without salt stress as control For the drought stress treatment all plants werestopped to water after full irrigation watering then clipping the leaves in 2 4 6 8 10 and 12 daysand no drought stress as the control respectively For the cold treatment seedlings were maintainedat 0 C and leaf material collected at 4 8 12 24 48 and 72 h Leaves cultivated in a growth chamberat 22 plusmn 1 C were used as controls For the hormone treatments plants were sprayed with solutionscontaining 100 microM ABA or 100 microM IAA then leaves were collected after 2 4 6 8 10 and 12 daysPlants that had not been sprayed served as the controls Samples were immediately frozen in liquidnitrogen and stored at minus80 C

45 RNA Extraction and Real-Time PCR Analysis

Total RNA was isolated from strawberry fruits harvested at 18 24 30 36 and 42 DAF usingthe Plant RNA Kit (Omega USA) according to the manufacturerrsquos instructions and total RNA wasreverse transcribed into cDNA using the Invitrogen reverse transcription kit (SuperScriptIII ReverseTranscriptase USA) Real-time PCR was performed to confirm gene expression patterns using a LightCyclerreg 96 SW11 Real Time PCR System (Roche Germany) with SYBR-Green (Takara Dalian China)The primer sequences used are designed based on gene sequences and the Beacon designer softwareand are shown in Table 2 in this study Each reaction consists of 5 microL SYBR 35 microL ddH2O 1 microL dilutedtemplate (1 microL of the generated first-strand cDNA diluted by 9 microL ddH2O) and 025 microL of each of twogene specific primers Thermal cycling conditions were 95 C for 10 min then 40 cycles at 95 C for20 s 54 C for 20 s 72 C for 20 s

Int J Mol Sci 2017 18 1766 8 of 18Int J Mol Sci 2017 18 1766 8 of 18

Figure 3 Phylogenetic relationships between MAPK cascade proteins from Arabidopsis thaliana and strawberry (A) phylogenetic relationship between A thaliana and FvMAPK proteins red lines show TEY group (B) phylogenetic relationship between A thaliana and FvMAPKK proteins green lines show TDY group and (C) phylogenetic relationship between A thaliana and FvMAPKKK proteins MAPKKK forms the largest group of MAPK cascade proteins with 73 members classified into two subfamilies MEKK (green lines) and Raf (red lines) which contain 30 and 43 genes in the Fragaria vesca and A thaliana genomes (D) Phylogenetic relationship between A thaliana and strawberry MAPKKKK proteins

Seven members of the MAPKK subfamily similar to the AtMAPKKs could also be divided into four groups FvMAPKK1 FvMAPKK3 and FvMAPKK5 were most similar to AtMPKK10 AtMPKK6 and AtMPKK3 respectively while FvMPKK2 is homologous to AtMPKK4AtMPKK5 FvMPKK4 -6 and -7 and AtMPKK7 -8 and -9 clustered into the same group (Figure 3B)

MAPKKKs are activated by either phosphorylation by other MAPKKK kinases or by G proteins and G protein-coupled receptors With 73 members the MAPKKK subfamily represented the largest subfamily of a similar size to that in rice (75 members) larger than that in grape (62 members) but smaller than that in A thaliana (80 members) Generally the members of this subfamily can be classified into three groups the MEKK subfamily the ZIK subfamily and the Raf subfamily however only two groups were identified in the strawberry genome In total there were 30 FvMAPKKKs in the MEKK subfamily and 43 in the Raf subfamily with no ZIK members identified (Figure 3C)

Although several MAP4Ks have been reported in plant genomes based on phylogenetic analyses of their kinase domain little is known about the roles of MAPKKKKs in plants Only one member was identified in F vesca (Figure 3D)

22 Expression Profiles of FvMAPKs and FvMAPKKs in Different Organs and Fruit Developmental Stages

Expression profiles provide some useful clues to gene functions To investigate the putative involvement of FvMAPK and FvMAPKK genes in strawberry growth and development the expression patterns of all of these genes were analyzed under normal growth conditions in four different organs (leaves roots stems and fruits) at various developmental stages Of the 19 predicted genes all were expressed in at least one of the four organs (Figure 4) FvMPK7 and FvMPK10 showed high expression in leaves and FvMPK10 and FvMPK11 were highly expressed in fruits FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in all organs while FvMAPKK6 and FvMAPKK7 were only expressed in leaves and FvMAPKK1 and FvMAPKK3 did not express any of the different organs under normal growth conditions

Figure 3 Phylogenetic relationships between MAPK cascade proteins from Arabidopsis thalianaand strawberry (A) phylogenetic relationship between A thaliana and FvMAPK proteins red linesshow TEY group (B) phylogenetic relationship between A thaliana and FvMAPKK proteins greenlines show TDY group and (C) phylogenetic relationship between A thaliana and FvMAPKKKproteins MAPKKK forms the largest group of MAPK cascade proteins with 73 members classifiedinto two subfamilies MEKK (green lines) and Raf (red lines) which contain 30 and 43 genes in theFragaria vesca and A thaliana genomes (D) Phylogenetic relationship between A thaliana and strawberryMAPKKKK proteins

Seven members of the MAPKK subfamily similar to the AtMAPKKs could also be divided intofour groups FvMAPKK1 FvMAPKK3 and FvMAPKK5 were most similar to AtMPKK10 AtMPKK6and AtMPKK3 respectively while FvMPKK2 is homologous to AtMPKK4AtMPKK5 FvMPKK4 -6and -7 and AtMPKK7 -8 and -9 clustered into the same group (Figure 3B)

MAPKKKs are activated by either phosphorylation by other MAPKKK kinases or by G proteinsand G protein-coupled receptors With 73 members the MAPKKK subfamily represented the largestsubfamily of a similar size to that in rice (75 members) larger than that in grape (62 members) butsmaller than that in A thaliana (80 members) Generally the members of this subfamily can beclassified into three groups the MEKK subfamily the ZIK subfamily and the Raf subfamily howeveronly two groups were identified in the strawberry genome In total there were 30 FvMAPKKKs in theMEKK subfamily and 43 in the Raf subfamily with no ZIK members identified (Figure 3C)

Although several MAP4Ks have been reported in plant genomes based on phylogenetic analysesof their kinase domain little is known about the roles of MAPKKKKs in plants Only one member wasidentified in F vesca (Figure 3D)

22 Expression Profiles of FvMAPKs and FvMAPKKs in Different Organs and Fruit Developmental Stages

Expression profiles provide some useful clues to gene functions To investigate the putativeinvolvement of FvMAPK and FvMAPKK genes in strawberry growth and development the expressionpatterns of all of these genes were analyzed under normal growth conditions in four different organs(leaves roots stems and fruits) at various developmental stages Of the 19 predicted genes all wereexpressed in at least one of the four organs (Figure 4) FvMPK7 and FvMPK10 showed high expressionin leaves and FvMPK10 and FvMPK11 were highly expressed in fruits FvMAPKK2 FvMAPKK4 andFvMAPKK5 were expressed in all organs while FvMAPKK6 and FvMAPKK7 were only expressed inleaves and FvMAPKK1 and FvMAPKK3 did not express any of the different organs under normalgrowth conditions

Int J Mol Sci 2017 18 1766 9 of 18Int J Mol Sci 2017 18 1766 9 of 18

Figure 4 Expression patterns of FvMPKs and FvMPKKs in different organs X-axis is the relative expression while Y-axis is MAPK and MAPKK genes white box root blue box stem green box leave red box fruit

We also determined the expression of FvMAPK cascade genes in different fruit developmental stages The transcript levels of FvMAPK2 and FvMAPK12 were lower than any other of the genes in all the different fruit developmental stages For the remaining 10 genes the expression patterns could be roughly divided into three categories FvMAPK3 FvMAPK4 and FvMAPK11 showed the same expression patterns which increased through development FvMAPK1 FvMAPK9 and FvMAPK10 expression however declined during fruit development Finally there were six genes (FvMAPK5 FvMAPK6 FvMAPK7 and FvMAPK8) that showed a high expression in the early stages then a decrease and later an increase in the later stages of fruit development In the FvMAPKKs subfamily only FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in fruits at a detectable level and they had the same expression patterns which gradually rose through fruit development (Figure 5) Since F vesca is a new model for investigating non-climacteric fruit development and ripening we focused on determining the expression profiles of the FvMAPKKK subfamily to different fruit developmental stages The expression profiles of the FvMAPKKK genes revealed a much higher expression in early stages than in later ripening or senescing stages indicating that they are most likely related to signal transduction during development in metabolically active tissues (Figure 6) Some FvMAPKKK transcripts showed higher levels in earlier than later stages of fruit development while others showed the opposite pattern This information can be important for further investigation of the signal transduction pathways involved in the regulation of fruit development and ripening in which different MAPKKK subfamily members may be involved

Figure 4 Expression patterns of FvMPKs and FvMPKKs in different organs X-axis is the relativeexpression while Y-axis is MAPK and MAPKK genes white box root blue box stem green box leavered box fruit

We also determined the expression of FvMAPK cascade genes in different fruit developmentalstages The transcript levels of FvMAPK2 and FvMAPK12 were lower than any other of the genes inall the different fruit developmental stages For the remaining 10 genes the expression patternscould be roughly divided into three categories FvMAPK3 FvMAPK4 and FvMAPK11 showedthe same expression patterns which increased through development FvMAPK1 FvMAPK9 andFvMAPK10 expression however declined during fruit development Finally there were six genes(FvMAPK5 FvMAPK6 FvMAPK7 and FvMAPK8) that showed a high expression in the early stagesthen a decrease and later an increase in the later stages of fruit development In the FvMAPKKssubfamily only FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in fruits at a detectablelevel and they had the same expression patterns which gradually rose through fruit development(Figure 5) Since F vesca is a new model for investigating non-climacteric fruit development andripening we focused on determining the expression profiles of the FvMAPKKK subfamily to differentfruit developmental stages The expression profiles of the FvMAPKKK genes revealed a much higherexpression in early stages than in later ripening or senescing stages indicating that they are most likelyrelated to signal transduction during development in metabolically active tissues (Figure 6) SomeFvMAPKKK transcripts showed higher levels in earlier than later stages of fruit development whileothers showed the opposite pattern This information can be important for further investigation of thesignal transduction pathways involved in the regulation of fruit development and ripening in whichdifferent MAPKKK subfamily members may be involved

Int J Mol Sci 2017 18 1766 10 of 18Int J Mol Sci 2017 18 1766 10 of 18

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis is the relative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental stages The gene expression levels were showed by the color box from blue to red indicating from low to high for each gene 18ndash42 DAF five developmental stages of days after flowering

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis is therelative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental stages ofdays after flowering

Int J Mol Sci 2017 18 1766 10 of 18

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis

is the relative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental

stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental

stages The gene expression levels were showed by the color box from blue to red indicating from

low to high for each gene 18ndash42 DAF five developmental stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental stagesThe gene expression levels were showed by the color box from blue to red indicating from low to highfor each gene 18ndash42 DAF five developmental stages of days after flowering

Int J Mol Sci 2017 18 1766 11 of 18

23 Gene Expression Profiles of FvMAPKs and FvMAPKKs in Response to Hormones and Abiotic Stresses inF vesca Leaves

We investigated whether salt drought low temperature and exogenous application of thehormones indole acetic acid (IAA) and abscisic acid (ABA) would induce expression of the FvMAPKand FvMAPKK genes in seedling leaves using qRT-PCR analysis After cold treatment most of thetested genes showed a large expression increase 48 h after treatment Among them was MAPK2whose expression increased in early stages before decreasing In general drought stress resulted inthe induction of the greatest number of genes and a significantly improved in the process 12 daysIn response to salt stress the expression of five FvMAPK genes (FvMAPK5 -9 -10 -11 and -12) and threeFvMAPKK genes (FvMAPKK1 -3 and -5) increased Interestingly the transcript levels of FvMAPKK3were specifically activated by salt stress and not by the other treatments The expression of FvMAPK3and -12 and FvMAPKK4 -5 and -6 was activated by ABA while the IAA treatment only resulted in achange in FvMAPKK4 expression which was up-regulated two days after treatment (Figure 7)

Int J Mol Sci 2017 18 1766 11 of 18

23 Gene Expression Profiles of FvMAPKs and FvMAPKKs in Response to Hormones and Abiotic

Stresses in F vesca Leaves

We investigated whether salt drought low temperature and exogenous application of the

hormones indole acetic acid (IAA) and abscisic acid (ABA) would induce expression of the

FvMAPK and FvMAPKK genes in seedling leaves using qRT-PCR analysis After cold treatment

most of the tested genes showed a large expression increase 48 h after treatment Among them was

MAPK2 whose expression increased in early stages before decreasing In general drought stress

resulted in the induction of the greatest number of genes and a significantly improved in the

process 12 days In response to salt stress the expression of five FvMAPK genes (FvMAPK5 -9 -10

-11 and -12) and three FvMAPKK genes (FvMAPKK1 -3 and -5) increased Interestingly the

transcript levels of FvMAPKK3 were specifically activated by salt stress and not by the other

treatments The expression of FvMAPK3 and -12 and FvMAPKK4 -5 and -6 was activated by ABA

while the IAA treatment only resulted in a change in FvMAPKK4 expression which was

up-regulated two days after treatment (Figure 7)

Figure 7 Expression patterns of FvMPK and FvMPKK genes after different stress and hormone

treatments of leaves in Fragaria vesca Leaves were harvested every two days (0 2 4 6 8 10 and 12

days) after treatment Abscisic acid (ABA) (100 μM) indole-3-acetic acid (IAA) (100 μM) NaCl (100

mM) and drought treatments Leaves from the low temperature treatment were collected at 0 4 8

12 24 48 and 72 h after cold stress application

24 Expression Patterns of FvMAPK and FvMAPKK Genes in Response to Sucrose Hormones and

Abiotic Stresses in F vesca Fruits

The expression patterns of the FvMAPK and FvMAPKK genes at an early stage (18 DAF days

after flowering) and a late stage (36 DAF) of fruit development in response to exogenous IAA ABA

and sucrose treatment and drought high temperature or low temperature stresses were also

examined by qRT-PCR analyses Almost all showed a higher expression level in the early than in

the later stage It was interesting that the transcript levels of almost all the genes were up-regulated

in response to IAA drought and low temperature treatment at the early stage of fruit development

(18 DAF) During low temperature stress the expression of 17 of the 19 genes increased

significantly at 18 DAF while the transcript levels of FvMAPK3 FvMAPKK1 FvMAPKK3

FvMAPKK6 and FvMAPKK7 were significantly up-regulated by high temperature treatment even

Figure 7 Expression patterns of FvMPK and FvMPKK genes after different stress and hormonetreatments of leaves in Fragaria vesca Leaves were harvested every two days (0 2 4 6 8 10 and12 days) after treatment Abscisic acid (ABA) (100 microM) indole-3-acetic acid (IAA) (100 microM) NaCl(100 mM) and drought treatments Leaves from the low temperature treatment were collected at 0 4 812 24 48 and 72 h after cold stress application

24 Expression Patterns of FvMAPK and FvMAPKK Genes in Response to Sucrose Hormones and AbioticStresses in F vesca Fruits

The expression patterns of the FvMAPK and FvMAPKK genes at an early stage (18 DAF daysafter flowering) and a late stage (36 DAF) of fruit development in response to exogenous IAA ABAand sucrose treatment and drought high temperature or low temperature stresses were also examinedby qRT-PCR analyses Almost all showed a higher expression level in the early than in the later stageIt was interesting that the transcript levels of almost all the genes were up-regulated in responseto IAA drought and low temperature treatment at the early stage of fruit development (18 DAF)During low temperature stress the expression of 17 of the 19 genes increased significantly at 18 DAFwhile the transcript levels of FvMAPK3 FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 weresignificantly up-regulated by high temperature treatment even though the expression of FvMAPKK1

Int J Mol Sci 2017 18 1766 12 of 18

FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions(Figure 8)

Int J Mol Sci 2017 18 1766 12 of 18

though the expression of FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions (Figure 8)

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stress pre-treatments Red and blue boxes indicate high and low expression levels respectively for each gene Six treatments Abscisic acid (ABA) 100 μM indole-3-acetic acid (IAA) 100 μM Suc sucrose 50 μM Dry drought treatment High high temperature (40 degC) Low low temperature (4 degC) Con controlled trials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yet been comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and 1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genome while at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genome even though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome (~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and 5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similar in size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that of A thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based on phylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogenetically characterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Only one MAP4K member was identified in the F vesca genome but the ORF showed strong similarity to ScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles in ovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based on the conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinase subdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to each other FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference in length is usually due to variation in the length of the domain or a variable number of introns and may indicate the absence or presence of motifs which can affect the functional specificity There are 10 and 7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins ranged in size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members of the FvMAPKKK subfamily were distributed to all the

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stresspre-treatments Red and blue boxes indicate high and low expression levels respectively for each geneSix treatments Abscisic acid (ABA) 100 microM indole-3-acetic acid (IAA) 100 microM Suc sucrose 50 microMDry drought treatment High high temperature (40 C) Low low temperature (4 C) Con controlledtrials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yetbeen comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genomewhile at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genomeeven though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome(~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similarin size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that ofA thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based onphylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogeneticallycharacterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Onlyone MAP4K member was identified in the F vesca genome but the ORF showed strong similarity toScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles inovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based onthe conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinasesubdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to eachother FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference inlength is usually due to variation in the length of the domain or a variable number of introns and mayindicate the absence or presence of motifs which can affect the functional specificity There are 10 and7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins rangedin size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members

Int J Mol Sci 2017 18 1766 13 of 18

of the FvMAPKKK subfamily were distributed to all the chromosomes and shared 12ndash34 identitywith each other with a sequence length ranging from 214 to 1403 amino acids A kinase domainin the C-terminal and a long regulatory domain in the N- terminal region were identified in mostFvMAPKKKs suggesting that the specific long regulatory domain exited in the N-terminal of theRAF subfamily may involve in specify the kinase activity and regulating protein interaction [45] It isinteresting that no FvMAPKKK was found that belonged to the ZIK subfamily which in other specieshas members with a conserved GTPEFMAPE (LV) Y signature The absence of the characteristic ZIKsubfamily feature in F vesca might suggest the presence of a slightly modified RAF domain instead ofthe typical ZIK domain as reported in Vitis [42]

As the last two steps of the MAPK cascade MAPK and MAPKK link upstream kinases anddownstream substrates As dual-specificity kinases MAPKKs can be activated and phosphorylatedby MAPKKKs via phosphorylation of ThrSer residues while MAPKKs also phosphorylate thedownstream MAPKs and activated MAPKs can phosphorylate different substrates including othertranscription factors kinases and cytoskeleton binding proteins [3] The MAPK cascade protein(MAP4K-MAPKKK-MAPKK-MAPK) family is large and the functions of the various members canbe complex Though there are many members identified in the MAPKKK and MAP4K subfamilieslittle is known about the MAPKs and MAPKKs In this study we mainly focused our gene expressionpattern analysis on the MAPK and MAPKK genes We evaluated the expression patterns of all ofthe predicted members of the FvMAPK and FvMAPKK subfamily in different strawberry organs anddevelopmental stages The expression of most of the FvMAPK and FvMAPKK genes was detected in thestrawberry organs investigated possibly reflecting their involvement in a common metabolic andordevelopmental process Among them FvMAPK7 FvMAPK10 and FvMAPKK2 showed significantlyhigher expression in leaves than in other organs and FvMAPKK6 and FvMAPKK7 were specificallyexpressed in leaves whereas the FvMAPK6 transcripts were not be detected in leaves indicatingdifferent functions for divergent family members

Stress-specific increased MAPK genes and kinase activity has been identified when plantsare suffering from a variety of abiotic stresses including drought cold high salinity ozone UVirradiation and oxidative stress [46ndash49] Plant hormones were detected playing a role in trigger stressresponses and developmental pathways with other signaling molecules [4650ndash52] The componentsof MEKK1 MKK2 MPK4 andor MPK6 respond to drought salt or cold stressed were characterizedin A thaliana [2247] We studied the interaction between hormone and gene expression patterns instrawberry fruit FvMAPK5 and FvMAPK8 belong to group II which contains well-characterizedMAPK genes including AtMAPK3 and AtMAPK6 It has been reported that AtMAPK3 can be activatedin response to abiotic stresses and pathogens and AtMAPK6 also plays a role in abiotic and bioticstresses [10395354] Similarly we speculate that FvMAPK5 and FvMAPK8 are important for abioticor biotic stress responses due to their transcriptional activation by cold and drought FvMAPK1FvMAPK9 and FvMAPK10 are clustered in Group I while also includes AtMAPK4 AtMAPK5AtMAPK11 AtMAPK12 and AtMAPK13 AtMPK4 and its upstream MAPKK AtMKK2 are involvedin both biotic and abiotic stresses The expression patterns of FvMAPK1 FvMAPK9 and FvMAPK10were similar in fruits but not in leaves suggesting different functions depending on the organ [55]

In A thaliana AtMPKK3 is up-regulated in response to ABA [46] and FvMPKK5 which showedthe highest homology to AtMPKK3 showed strong activation by ABA in leaves suggesting asimilar function Interestingly AtMKK1AtMKK2 which are activated by salt drought and coldstresses [2223] and their ortholog FvMAPKK3 showed specific activation by salt stress in leaves andsignificant expression changes due to cold and heat stress

Int J Mol Sci 2017 18 1766 14 of 18

4 Materials and Methods

41 Identification of Potential MAPK Cascade Gene Family Members in Strawberry

To identify a complete list of strawberry MAPK cascade genes we used two public databases theNational Centre for Biotechnology Information (NCBI httpwwwncbinlmnihgov) and F vescaBioView Gene Model Database (httpsstrawberryplantandfoodconz)

42 Phylogenetic Analysis of A Thaliana and the Strawberry MAPK Cascade Genes

Phylogenetic analysis was performed using the MEGA 51 software (USA) and theneighbor-joining method Bootstrap values were calculated for 1000 iterations [5657] The A thalianaMAPK cascades gene family database was obtained from TAIR (The A thaliana Information Resourcehttpwwwarabidopsisorg) and used for comparative analysis

43 Plant Material and Fruit Pre-Treatments

F vesca (ldquoHawaii 4rdquo) plants were grown on a growth chamber at 22 plusmn 1 C in a 1311 h darklightphotoperiod Fruit samples were harvested every 6 days starting of the 18 days after flowering (18 2430 36 and 42 DAF) At each developmental stage ten representative fruits were sampled and tissueswere immediately frozen in liquid nitrogen and stored at minus80 C until further use In order to obtaindifferent pre-treatment experimental fruits two stages (18 and 36 DAF) were selected for sucrose andhormone treatments The fruits were cut in half longitudinally and half was used as a control whilethe other half was used for processing The different treatments used in this work were indole-3-aceticacid (IAA) abscisic acid (ABA) and sucrose at a concentration of 100 100 and 50 microM respectively Thehigh and low temperature was 40 C and 4 C All other experiments were performed at 25 C

44 The Processing of Strawberry Leaves under Different Stress and Hormone Treatments

To investigate the induced expression patterns of the FvMAPK and FvMAPKK genes in seedlingleaves in response to various treatments 30 days old soil grown seedlings were used For salt stresstreatment seedlings were irrigated in 100 mM NaCl collected 2 4 6 8 10 and 12 days after salttreatment of leaves without salt stress as control For the drought stress treatment all plants werestopped to water after full irrigation watering then clipping the leaves in 2 4 6 8 10 and 12 daysand no drought stress as the control respectively For the cold treatment seedlings were maintainedat 0 C and leaf material collected at 4 8 12 24 48 and 72 h Leaves cultivated in a growth chamberat 22 plusmn 1 C were used as controls For the hormone treatments plants were sprayed with solutionscontaining 100 microM ABA or 100 microM IAA then leaves were collected after 2 4 6 8 10 and 12 daysPlants that had not been sprayed served as the controls Samples were immediately frozen in liquidnitrogen and stored at minus80 C

45 RNA Extraction and Real-Time PCR Analysis

Total RNA was isolated from strawberry fruits harvested at 18 24 30 36 and 42 DAF usingthe Plant RNA Kit (Omega USA) according to the manufacturerrsquos instructions and total RNA wasreverse transcribed into cDNA using the Invitrogen reverse transcription kit (SuperScriptIII ReverseTranscriptase USA) Real-time PCR was performed to confirm gene expression patterns using a LightCyclerreg 96 SW11 Real Time PCR System (Roche Germany) with SYBR-Green (Takara Dalian China)The primer sequences used are designed based on gene sequences and the Beacon designer softwareand are shown in Table 2 in this study Each reaction consists of 5 microL SYBR 35 microL ddH2O 1 microL dilutedtemplate (1 microL of the generated first-strand cDNA diluted by 9 microL ddH2O) and 025 microL of each of twogene specific primers Thermal cycling conditions were 95 C for 10 min then 40 cycles at 95 C for20 s 54 C for 20 s 72 C for 20 s

Int J Mol Sci 2017 18 1766 9 of 18Int J Mol Sci 2017 18 1766 9 of 18

Figure 4 Expression patterns of FvMPKs and FvMPKKs in different organs X-axis is the relative expression while Y-axis is MAPK and MAPKK genes white box root blue box stem green box leave red box fruit

We also determined the expression of FvMAPK cascade genes in different fruit developmental stages The transcript levels of FvMAPK2 and FvMAPK12 were lower than any other of the genes in all the different fruit developmental stages For the remaining 10 genes the expression patterns could be roughly divided into three categories FvMAPK3 FvMAPK4 and FvMAPK11 showed the same expression patterns which increased through development FvMAPK1 FvMAPK9 and FvMAPK10 expression however declined during fruit development Finally there were six genes (FvMAPK5 FvMAPK6 FvMAPK7 and FvMAPK8) that showed a high expression in the early stages then a decrease and later an increase in the later stages of fruit development In the FvMAPKKs subfamily only FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in fruits at a detectable level and they had the same expression patterns which gradually rose through fruit development (Figure 5) Since F vesca is a new model for investigating non-climacteric fruit development and ripening we focused on determining the expression profiles of the FvMAPKKK subfamily to different fruit developmental stages The expression profiles of the FvMAPKKK genes revealed a much higher expression in early stages than in later ripening or senescing stages indicating that they are most likely related to signal transduction during development in metabolically active tissues (Figure 6) Some FvMAPKKK transcripts showed higher levels in earlier than later stages of fruit development while others showed the opposite pattern This information can be important for further investigation of the signal transduction pathways involved in the regulation of fruit development and ripening in which different MAPKKK subfamily members may be involved

Figure 4 Expression patterns of FvMPKs and FvMPKKs in different organs X-axis is the relativeexpression while Y-axis is MAPK and MAPKK genes white box root blue box stem green box leavered box fruit

We also determined the expression of FvMAPK cascade genes in different fruit developmentalstages The transcript levels of FvMAPK2 and FvMAPK12 were lower than any other of the genes inall the different fruit developmental stages For the remaining 10 genes the expression patternscould be roughly divided into three categories FvMAPK3 FvMAPK4 and FvMAPK11 showedthe same expression patterns which increased through development FvMAPK1 FvMAPK9 andFvMAPK10 expression however declined during fruit development Finally there were six genes(FvMAPK5 FvMAPK6 FvMAPK7 and FvMAPK8) that showed a high expression in the early stagesthen a decrease and later an increase in the later stages of fruit development In the FvMAPKKssubfamily only FvMAPKK2 FvMAPKK4 and FvMAPKK5 were expressed in fruits at a detectablelevel and they had the same expression patterns which gradually rose through fruit development(Figure 5) Since F vesca is a new model for investigating non-climacteric fruit development andripening we focused on determining the expression profiles of the FvMAPKKK subfamily to differentfruit developmental stages The expression profiles of the FvMAPKKK genes revealed a much higherexpression in early stages than in later ripening or senescing stages indicating that they are most likelyrelated to signal transduction during development in metabolically active tissues (Figure 6) SomeFvMAPKKK transcripts showed higher levels in earlier than later stages of fruit development whileothers showed the opposite pattern This information can be important for further investigation of thesignal transduction pathways involved in the regulation of fruit development and ripening in whichdifferent MAPKKK subfamily members may be involved

Int J Mol Sci 2017 18 1766 10 of 18Int J Mol Sci 2017 18 1766 10 of 18

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis is the relative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental stages The gene expression levels were showed by the color box from blue to red indicating from low to high for each gene 18ndash42 DAF five developmental stages of days after flowering

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis is therelative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental stages ofdays after flowering

Int J Mol Sci 2017 18 1766 10 of 18

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis

is the relative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental

stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental

stages The gene expression levels were showed by the color box from blue to red indicating from

low to high for each gene 18ndash42 DAF five developmental stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental stagesThe gene expression levels were showed by the color box from blue to red indicating from low to highfor each gene 18ndash42 DAF five developmental stages of days after flowering

Int J Mol Sci 2017 18 1766 11 of 18

23 Gene Expression Profiles of FvMAPKs and FvMAPKKs in Response to Hormones and Abiotic Stresses inF vesca Leaves

We investigated whether salt drought low temperature and exogenous application of thehormones indole acetic acid (IAA) and abscisic acid (ABA) would induce expression of the FvMAPKand FvMAPKK genes in seedling leaves using qRT-PCR analysis After cold treatment most of thetested genes showed a large expression increase 48 h after treatment Among them was MAPK2whose expression increased in early stages before decreasing In general drought stress resulted inthe induction of the greatest number of genes and a significantly improved in the process 12 daysIn response to salt stress the expression of five FvMAPK genes (FvMAPK5 -9 -10 -11 and -12) and threeFvMAPKK genes (FvMAPKK1 -3 and -5) increased Interestingly the transcript levels of FvMAPKK3were specifically activated by salt stress and not by the other treatments The expression of FvMAPK3and -12 and FvMAPKK4 -5 and -6 was activated by ABA while the IAA treatment only resulted in achange in FvMAPKK4 expression which was up-regulated two days after treatment (Figure 7)

Int J Mol Sci 2017 18 1766 11 of 18

23 Gene Expression Profiles of FvMAPKs and FvMAPKKs in Response to Hormones and Abiotic

Stresses in F vesca Leaves

We investigated whether salt drought low temperature and exogenous application of the

hormones indole acetic acid (IAA) and abscisic acid (ABA) would induce expression of the

FvMAPK and FvMAPKK genes in seedling leaves using qRT-PCR analysis After cold treatment

most of the tested genes showed a large expression increase 48 h after treatment Among them was

MAPK2 whose expression increased in early stages before decreasing In general drought stress

resulted in the induction of the greatest number of genes and a significantly improved in the

process 12 days In response to salt stress the expression of five FvMAPK genes (FvMAPK5 -9 -10

-11 and -12) and three FvMAPKK genes (FvMAPKK1 -3 and -5) increased Interestingly the

transcript levels of FvMAPKK3 were specifically activated by salt stress and not by the other

treatments The expression of FvMAPK3 and -12 and FvMAPKK4 -5 and -6 was activated by ABA

while the IAA treatment only resulted in a change in FvMAPKK4 expression which was

up-regulated two days after treatment (Figure 7)

Figure 7 Expression patterns of FvMPK and FvMPKK genes after different stress and hormone

treatments of leaves in Fragaria vesca Leaves were harvested every two days (0 2 4 6 8 10 and 12

days) after treatment Abscisic acid (ABA) (100 μM) indole-3-acetic acid (IAA) (100 μM) NaCl (100

mM) and drought treatments Leaves from the low temperature treatment were collected at 0 4 8

12 24 48 and 72 h after cold stress application

24 Expression Patterns of FvMAPK and FvMAPKK Genes in Response to Sucrose Hormones and

Abiotic Stresses in F vesca Fruits

The expression patterns of the FvMAPK and FvMAPKK genes at an early stage (18 DAF days

after flowering) and a late stage (36 DAF) of fruit development in response to exogenous IAA ABA

and sucrose treatment and drought high temperature or low temperature stresses were also

examined by qRT-PCR analyses Almost all showed a higher expression level in the early than in

the later stage It was interesting that the transcript levels of almost all the genes were up-regulated

in response to IAA drought and low temperature treatment at the early stage of fruit development

(18 DAF) During low temperature stress the expression of 17 of the 19 genes increased

significantly at 18 DAF while the transcript levels of FvMAPK3 FvMAPKK1 FvMAPKK3

FvMAPKK6 and FvMAPKK7 were significantly up-regulated by high temperature treatment even

Figure 7 Expression patterns of FvMPK and FvMPKK genes after different stress and hormonetreatments of leaves in Fragaria vesca Leaves were harvested every two days (0 2 4 6 8 10 and12 days) after treatment Abscisic acid (ABA) (100 microM) indole-3-acetic acid (IAA) (100 microM) NaCl(100 mM) and drought treatments Leaves from the low temperature treatment were collected at 0 4 812 24 48 and 72 h after cold stress application

24 Expression Patterns of FvMAPK and FvMAPKK Genes in Response to Sucrose Hormones and AbioticStresses in F vesca Fruits

The expression patterns of the FvMAPK and FvMAPKK genes at an early stage (18 DAF daysafter flowering) and a late stage (36 DAF) of fruit development in response to exogenous IAA ABAand sucrose treatment and drought high temperature or low temperature stresses were also examinedby qRT-PCR analyses Almost all showed a higher expression level in the early than in the later stageIt was interesting that the transcript levels of almost all the genes were up-regulated in responseto IAA drought and low temperature treatment at the early stage of fruit development (18 DAF)During low temperature stress the expression of 17 of the 19 genes increased significantly at 18 DAFwhile the transcript levels of FvMAPK3 FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 weresignificantly up-regulated by high temperature treatment even though the expression of FvMAPKK1

Int J Mol Sci 2017 18 1766 12 of 18

FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions(Figure 8)

Int J Mol Sci 2017 18 1766 12 of 18

though the expression of FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions (Figure 8)

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stress pre-treatments Red and blue boxes indicate high and low expression levels respectively for each gene Six treatments Abscisic acid (ABA) 100 μM indole-3-acetic acid (IAA) 100 μM Suc sucrose 50 μM Dry drought treatment High high temperature (40 degC) Low low temperature (4 degC) Con controlled trials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yet been comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and 1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genome while at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genome even though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome (~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and 5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similar in size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that of A thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based on phylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogenetically characterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Only one MAP4K member was identified in the F vesca genome but the ORF showed strong similarity to ScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles in ovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based on the conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinase subdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to each other FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference in length is usually due to variation in the length of the domain or a variable number of introns and may indicate the absence or presence of motifs which can affect the functional specificity There are 10 and 7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins ranged in size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members of the FvMAPKKK subfamily were distributed to all the

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stresspre-treatments Red and blue boxes indicate high and low expression levels respectively for each geneSix treatments Abscisic acid (ABA) 100 microM indole-3-acetic acid (IAA) 100 microM Suc sucrose 50 microMDry drought treatment High high temperature (40 C) Low low temperature (4 C) Con controlledtrials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yetbeen comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genomewhile at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genomeeven though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome(~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similarin size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that ofA thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based onphylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogeneticallycharacterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Onlyone MAP4K member was identified in the F vesca genome but the ORF showed strong similarity toScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles inovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based onthe conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinasesubdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to eachother FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference inlength is usually due to variation in the length of the domain or a variable number of introns and mayindicate the absence or presence of motifs which can affect the functional specificity There are 10 and7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins rangedin size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members

Int J Mol Sci 2017 18 1766 13 of 18

of the FvMAPKKK subfamily were distributed to all the chromosomes and shared 12ndash34 identitywith each other with a sequence length ranging from 214 to 1403 amino acids A kinase domainin the C-terminal and a long regulatory domain in the N- terminal region were identified in mostFvMAPKKKs suggesting that the specific long regulatory domain exited in the N-terminal of theRAF subfamily may involve in specify the kinase activity and regulating protein interaction [45] It isinteresting that no FvMAPKKK was found that belonged to the ZIK subfamily which in other specieshas members with a conserved GTPEFMAPE (LV) Y signature The absence of the characteristic ZIKsubfamily feature in F vesca might suggest the presence of a slightly modified RAF domain instead ofthe typical ZIK domain as reported in Vitis [42]

As the last two steps of the MAPK cascade MAPK and MAPKK link upstream kinases anddownstream substrates As dual-specificity kinases MAPKKs can be activated and phosphorylatedby MAPKKKs via phosphorylation of ThrSer residues while MAPKKs also phosphorylate thedownstream MAPKs and activated MAPKs can phosphorylate different substrates including othertranscription factors kinases and cytoskeleton binding proteins [3] The MAPK cascade protein(MAP4K-MAPKKK-MAPKK-MAPK) family is large and the functions of the various members canbe complex Though there are many members identified in the MAPKKK and MAP4K subfamilieslittle is known about the MAPKs and MAPKKs In this study we mainly focused our gene expressionpattern analysis on the MAPK and MAPKK genes We evaluated the expression patterns of all ofthe predicted members of the FvMAPK and FvMAPKK subfamily in different strawberry organs anddevelopmental stages The expression of most of the FvMAPK and FvMAPKK genes was detected in thestrawberry organs investigated possibly reflecting their involvement in a common metabolic andordevelopmental process Among them FvMAPK7 FvMAPK10 and FvMAPKK2 showed significantlyhigher expression in leaves than in other organs and FvMAPKK6 and FvMAPKK7 were specificallyexpressed in leaves whereas the FvMAPK6 transcripts were not be detected in leaves indicatingdifferent functions for divergent family members

Stress-specific increased MAPK genes and kinase activity has been identified when plantsare suffering from a variety of abiotic stresses including drought cold high salinity ozone UVirradiation and oxidative stress [46ndash49] Plant hormones were detected playing a role in trigger stressresponses and developmental pathways with other signaling molecules [4650ndash52] The componentsof MEKK1 MKK2 MPK4 andor MPK6 respond to drought salt or cold stressed were characterizedin A thaliana [2247] We studied the interaction between hormone and gene expression patterns instrawberry fruit FvMAPK5 and FvMAPK8 belong to group II which contains well-characterizedMAPK genes including AtMAPK3 and AtMAPK6 It has been reported that AtMAPK3 can be activatedin response to abiotic stresses and pathogens and AtMAPK6 also plays a role in abiotic and bioticstresses [10395354] Similarly we speculate that FvMAPK5 and FvMAPK8 are important for abioticor biotic stress responses due to their transcriptional activation by cold and drought FvMAPK1FvMAPK9 and FvMAPK10 are clustered in Group I while also includes AtMAPK4 AtMAPK5AtMAPK11 AtMAPK12 and AtMAPK13 AtMPK4 and its upstream MAPKK AtMKK2 are involvedin both biotic and abiotic stresses The expression patterns of FvMAPK1 FvMAPK9 and FvMAPK10were similar in fruits but not in leaves suggesting different functions depending on the organ [55]

In A thaliana AtMPKK3 is up-regulated in response to ABA [46] and FvMPKK5 which showedthe highest homology to AtMPKK3 showed strong activation by ABA in leaves suggesting asimilar function Interestingly AtMKK1AtMKK2 which are activated by salt drought and coldstresses [2223] and their ortholog FvMAPKK3 showed specific activation by salt stress in leaves andsignificant expression changes due to cold and heat stress

Int J Mol Sci 2017 18 1766 14 of 18

4 Materials and Methods

41 Identification of Potential MAPK Cascade Gene Family Members in Strawberry

To identify a complete list of strawberry MAPK cascade genes we used two public databases theNational Centre for Biotechnology Information (NCBI httpwwwncbinlmnihgov) and F vescaBioView Gene Model Database (httpsstrawberryplantandfoodconz)

42 Phylogenetic Analysis of A Thaliana and the Strawberry MAPK Cascade Genes

Phylogenetic analysis was performed using the MEGA 51 software (USA) and theneighbor-joining method Bootstrap values were calculated for 1000 iterations [5657] The A thalianaMAPK cascades gene family database was obtained from TAIR (The A thaliana Information Resourcehttpwwwarabidopsisorg) and used for comparative analysis

43 Plant Material and Fruit Pre-Treatments

F vesca (ldquoHawaii 4rdquo) plants were grown on a growth chamber at 22 plusmn 1 C in a 1311 h darklightphotoperiod Fruit samples were harvested every 6 days starting of the 18 days after flowering (18 2430 36 and 42 DAF) At each developmental stage ten representative fruits were sampled and tissueswere immediately frozen in liquid nitrogen and stored at minus80 C until further use In order to obtaindifferent pre-treatment experimental fruits two stages (18 and 36 DAF) were selected for sucrose andhormone treatments The fruits were cut in half longitudinally and half was used as a control whilethe other half was used for processing The different treatments used in this work were indole-3-aceticacid (IAA) abscisic acid (ABA) and sucrose at a concentration of 100 100 and 50 microM respectively Thehigh and low temperature was 40 C and 4 C All other experiments were performed at 25 C

44 The Processing of Strawberry Leaves under Different Stress and Hormone Treatments

To investigate the induced expression patterns of the FvMAPK and FvMAPKK genes in seedlingleaves in response to various treatments 30 days old soil grown seedlings were used For salt stresstreatment seedlings were irrigated in 100 mM NaCl collected 2 4 6 8 10 and 12 days after salttreatment of leaves without salt stress as control For the drought stress treatment all plants werestopped to water after full irrigation watering then clipping the leaves in 2 4 6 8 10 and 12 daysand no drought stress as the control respectively For the cold treatment seedlings were maintainedat 0 C and leaf material collected at 4 8 12 24 48 and 72 h Leaves cultivated in a growth chamberat 22 plusmn 1 C were used as controls For the hormone treatments plants were sprayed with solutionscontaining 100 microM ABA or 100 microM IAA then leaves were collected after 2 4 6 8 10 and 12 daysPlants that had not been sprayed served as the controls Samples were immediately frozen in liquidnitrogen and stored at minus80 C

45 RNA Extraction and Real-Time PCR Analysis

Total RNA was isolated from strawberry fruits harvested at 18 24 30 36 and 42 DAF usingthe Plant RNA Kit (Omega USA) according to the manufacturerrsquos instructions and total RNA wasreverse transcribed into cDNA using the Invitrogen reverse transcription kit (SuperScriptIII ReverseTranscriptase USA) Real-time PCR was performed to confirm gene expression patterns using a LightCyclerreg 96 SW11 Real Time PCR System (Roche Germany) with SYBR-Green (Takara Dalian China)The primer sequences used are designed based on gene sequences and the Beacon designer softwareand are shown in Table 2 in this study Each reaction consists of 5 microL SYBR 35 microL ddH2O 1 microL dilutedtemplate (1 microL of the generated first-strand cDNA diluted by 9 microL ddH2O) and 025 microL of each of twogene specific primers Thermal cycling conditions were 95 C for 10 min then 40 cycles at 95 C for20 s 54 C for 20 s 72 C for 20 s

Int J Mol Sci 2017 18 1766 10 of 18Int J Mol Sci 2017 18 1766 10 of 18

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis is the relative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental stages The gene expression levels were showed by the color box from blue to red indicating from low to high for each gene 18ndash42 DAF five developmental stages of days after flowering

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis is therelative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental stages ofdays after flowering

Int J Mol Sci 2017 18 1766 10 of 18

Figure 5 FvMPK and FvMPKK expression profiles in different fruit developmental stages X-axis

is the relative expression while Y-axis is MAPK and MAPKK genes 18ndash42 DAF five developmental

stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental

stages The gene expression levels were showed by the color box from blue to red indicating from

low to high for each gene 18ndash42 DAF five developmental stages of days after flowering

Figure 6 RNA-seq data showing FvMAPKKK gene expression in different fruit developmental stagesThe gene expression levels were showed by the color box from blue to red indicating from low to highfor each gene 18ndash42 DAF five developmental stages of days after flowering

Int J Mol Sci 2017 18 1766 11 of 18

23 Gene Expression Profiles of FvMAPKs and FvMAPKKs in Response to Hormones and Abiotic Stresses inF vesca Leaves

We investigated whether salt drought low temperature and exogenous application of thehormones indole acetic acid (IAA) and abscisic acid (ABA) would induce expression of the FvMAPKand FvMAPKK genes in seedling leaves using qRT-PCR analysis After cold treatment most of thetested genes showed a large expression increase 48 h after treatment Among them was MAPK2whose expression increased in early stages before decreasing In general drought stress resulted inthe induction of the greatest number of genes and a significantly improved in the process 12 daysIn response to salt stress the expression of five FvMAPK genes (FvMAPK5 -9 -10 -11 and -12) and threeFvMAPKK genes (FvMAPKK1 -3 and -5) increased Interestingly the transcript levels of FvMAPKK3were specifically activated by salt stress and not by the other treatments The expression of FvMAPK3and -12 and FvMAPKK4 -5 and -6 was activated by ABA while the IAA treatment only resulted in achange in FvMAPKK4 expression which was up-regulated two days after treatment (Figure 7)

Int J Mol Sci 2017 18 1766 11 of 18

23 Gene Expression Profiles of FvMAPKs and FvMAPKKs in Response to Hormones and Abiotic

Stresses in F vesca Leaves

We investigated whether salt drought low temperature and exogenous application of the

hormones indole acetic acid (IAA) and abscisic acid (ABA) would induce expression of the

FvMAPK and FvMAPKK genes in seedling leaves using qRT-PCR analysis After cold treatment

most of the tested genes showed a large expression increase 48 h after treatment Among them was

MAPK2 whose expression increased in early stages before decreasing In general drought stress

resulted in the induction of the greatest number of genes and a significantly improved in the

process 12 days In response to salt stress the expression of five FvMAPK genes (FvMAPK5 -9 -10

-11 and -12) and three FvMAPKK genes (FvMAPKK1 -3 and -5) increased Interestingly the

transcript levels of FvMAPKK3 were specifically activated by salt stress and not by the other

treatments The expression of FvMAPK3 and -12 and FvMAPKK4 -5 and -6 was activated by ABA

while the IAA treatment only resulted in a change in FvMAPKK4 expression which was

up-regulated two days after treatment (Figure 7)

Figure 7 Expression patterns of FvMPK and FvMPKK genes after different stress and hormone

treatments of leaves in Fragaria vesca Leaves were harvested every two days (0 2 4 6 8 10 and 12

days) after treatment Abscisic acid (ABA) (100 μM) indole-3-acetic acid (IAA) (100 μM) NaCl (100

mM) and drought treatments Leaves from the low temperature treatment were collected at 0 4 8

12 24 48 and 72 h after cold stress application

24 Expression Patterns of FvMAPK and FvMAPKK Genes in Response to Sucrose Hormones and

Abiotic Stresses in F vesca Fruits

The expression patterns of the FvMAPK and FvMAPKK genes at an early stage (18 DAF days

after flowering) and a late stage (36 DAF) of fruit development in response to exogenous IAA ABA

and sucrose treatment and drought high temperature or low temperature stresses were also

examined by qRT-PCR analyses Almost all showed a higher expression level in the early than in

the later stage It was interesting that the transcript levels of almost all the genes were up-regulated

in response to IAA drought and low temperature treatment at the early stage of fruit development

(18 DAF) During low temperature stress the expression of 17 of the 19 genes increased

significantly at 18 DAF while the transcript levels of FvMAPK3 FvMAPKK1 FvMAPKK3

FvMAPKK6 and FvMAPKK7 were significantly up-regulated by high temperature treatment even

Figure 7 Expression patterns of FvMPK and FvMPKK genes after different stress and hormonetreatments of leaves in Fragaria vesca Leaves were harvested every two days (0 2 4 6 8 10 and12 days) after treatment Abscisic acid (ABA) (100 microM) indole-3-acetic acid (IAA) (100 microM) NaCl(100 mM) and drought treatments Leaves from the low temperature treatment were collected at 0 4 812 24 48 and 72 h after cold stress application

24 Expression Patterns of FvMAPK and FvMAPKK Genes in Response to Sucrose Hormones and AbioticStresses in F vesca Fruits

The expression patterns of the FvMAPK and FvMAPKK genes at an early stage (18 DAF daysafter flowering) and a late stage (36 DAF) of fruit development in response to exogenous IAA ABAand sucrose treatment and drought high temperature or low temperature stresses were also examinedby qRT-PCR analyses Almost all showed a higher expression level in the early than in the later stageIt was interesting that the transcript levels of almost all the genes were up-regulated in responseto IAA drought and low temperature treatment at the early stage of fruit development (18 DAF)During low temperature stress the expression of 17 of the 19 genes increased significantly at 18 DAFwhile the transcript levels of FvMAPK3 FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 weresignificantly up-regulated by high temperature treatment even though the expression of FvMAPKK1

Int J Mol Sci 2017 18 1766 12 of 18

FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions(Figure 8)

Int J Mol Sci 2017 18 1766 12 of 18

though the expression of FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions (Figure 8)

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stress pre-treatments Red and blue boxes indicate high and low expression levels respectively for each gene Six treatments Abscisic acid (ABA) 100 μM indole-3-acetic acid (IAA) 100 μM Suc sucrose 50 μM Dry drought treatment High high temperature (40 degC) Low low temperature (4 degC) Con controlled trials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yet been comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and 1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genome while at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genome even though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome (~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and 5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similar in size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that of A thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based on phylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogenetically characterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Only one MAP4K member was identified in the F vesca genome but the ORF showed strong similarity to ScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles in ovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based on the conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinase subdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to each other FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference in length is usually due to variation in the length of the domain or a variable number of introns and may indicate the absence or presence of motifs which can affect the functional specificity There are 10 and 7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins ranged in size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members of the FvMAPKKK subfamily were distributed to all the

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stresspre-treatments Red and blue boxes indicate high and low expression levels respectively for each geneSix treatments Abscisic acid (ABA) 100 microM indole-3-acetic acid (IAA) 100 microM Suc sucrose 50 microMDry drought treatment High high temperature (40 C) Low low temperature (4 C) Con controlledtrials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yetbeen comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genomewhile at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genomeeven though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome(~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similarin size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that ofA thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based onphylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogeneticallycharacterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Onlyone MAP4K member was identified in the F vesca genome but the ORF showed strong similarity toScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles inovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based onthe conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinasesubdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to eachother FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference inlength is usually due to variation in the length of the domain or a variable number of introns and mayindicate the absence or presence of motifs which can affect the functional specificity There are 10 and7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins rangedin size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members

Int J Mol Sci 2017 18 1766 13 of 18

of the FvMAPKKK subfamily were distributed to all the chromosomes and shared 12ndash34 identitywith each other with a sequence length ranging from 214 to 1403 amino acids A kinase domainin the C-terminal and a long regulatory domain in the N- terminal region were identified in mostFvMAPKKKs suggesting that the specific long regulatory domain exited in the N-terminal of theRAF subfamily may involve in specify the kinase activity and regulating protein interaction [45] It isinteresting that no FvMAPKKK was found that belonged to the ZIK subfamily which in other specieshas members with a conserved GTPEFMAPE (LV) Y signature The absence of the characteristic ZIKsubfamily feature in F vesca might suggest the presence of a slightly modified RAF domain instead ofthe typical ZIK domain as reported in Vitis [42]

As the last two steps of the MAPK cascade MAPK and MAPKK link upstream kinases anddownstream substrates As dual-specificity kinases MAPKKs can be activated and phosphorylatedby MAPKKKs via phosphorylation of ThrSer residues while MAPKKs also phosphorylate thedownstream MAPKs and activated MAPKs can phosphorylate different substrates including othertranscription factors kinases and cytoskeleton binding proteins [3] The MAPK cascade protein(MAP4K-MAPKKK-MAPKK-MAPK) family is large and the functions of the various members canbe complex Though there are many members identified in the MAPKKK and MAP4K subfamilieslittle is known about the MAPKs and MAPKKs In this study we mainly focused our gene expressionpattern analysis on the MAPK and MAPKK genes We evaluated the expression patterns of all ofthe predicted members of the FvMAPK and FvMAPKK subfamily in different strawberry organs anddevelopmental stages The expression of most of the FvMAPK and FvMAPKK genes was detected in thestrawberry organs investigated possibly reflecting their involvement in a common metabolic andordevelopmental process Among them FvMAPK7 FvMAPK10 and FvMAPKK2 showed significantlyhigher expression in leaves than in other organs and FvMAPKK6 and FvMAPKK7 were specificallyexpressed in leaves whereas the FvMAPK6 transcripts were not be detected in leaves indicatingdifferent functions for divergent family members

Stress-specific increased MAPK genes and kinase activity has been identified when plantsare suffering from a variety of abiotic stresses including drought cold high salinity ozone UVirradiation and oxidative stress [46ndash49] Plant hormones were detected playing a role in trigger stressresponses and developmental pathways with other signaling molecules [4650ndash52] The componentsof MEKK1 MKK2 MPK4 andor MPK6 respond to drought salt or cold stressed were characterizedin A thaliana [2247] We studied the interaction between hormone and gene expression patterns instrawberry fruit FvMAPK5 and FvMAPK8 belong to group II which contains well-characterizedMAPK genes including AtMAPK3 and AtMAPK6 It has been reported that AtMAPK3 can be activatedin response to abiotic stresses and pathogens and AtMAPK6 also plays a role in abiotic and bioticstresses [10395354] Similarly we speculate that FvMAPK5 and FvMAPK8 are important for abioticor biotic stress responses due to their transcriptional activation by cold and drought FvMAPK1FvMAPK9 and FvMAPK10 are clustered in Group I while also includes AtMAPK4 AtMAPK5AtMAPK11 AtMAPK12 and AtMAPK13 AtMPK4 and its upstream MAPKK AtMKK2 are involvedin both biotic and abiotic stresses The expression patterns of FvMAPK1 FvMAPK9 and FvMAPK10were similar in fruits but not in leaves suggesting different functions depending on the organ [55]

In A thaliana AtMPKK3 is up-regulated in response to ABA [46] and FvMPKK5 which showedthe highest homology to AtMPKK3 showed strong activation by ABA in leaves suggesting asimilar function Interestingly AtMKK1AtMKK2 which are activated by salt drought and coldstresses [2223] and their ortholog FvMAPKK3 showed specific activation by salt stress in leaves andsignificant expression changes due to cold and heat stress

Int J Mol Sci 2017 18 1766 14 of 18

4 Materials and Methods

41 Identification of Potential MAPK Cascade Gene Family Members in Strawberry

To identify a complete list of strawberry MAPK cascade genes we used two public databases theNational Centre for Biotechnology Information (NCBI httpwwwncbinlmnihgov) and F vescaBioView Gene Model Database (httpsstrawberryplantandfoodconz)

42 Phylogenetic Analysis of A Thaliana and the Strawberry MAPK Cascade Genes

Phylogenetic analysis was performed using the MEGA 51 software (USA) and theneighbor-joining method Bootstrap values were calculated for 1000 iterations [5657] The A thalianaMAPK cascades gene family database was obtained from TAIR (The A thaliana Information Resourcehttpwwwarabidopsisorg) and used for comparative analysis

43 Plant Material and Fruit Pre-Treatments

F vesca (ldquoHawaii 4rdquo) plants were grown on a growth chamber at 22 plusmn 1 C in a 1311 h darklightphotoperiod Fruit samples were harvested every 6 days starting of the 18 days after flowering (18 2430 36 and 42 DAF) At each developmental stage ten representative fruits were sampled and tissueswere immediately frozen in liquid nitrogen and stored at minus80 C until further use In order to obtaindifferent pre-treatment experimental fruits two stages (18 and 36 DAF) were selected for sucrose andhormone treatments The fruits were cut in half longitudinally and half was used as a control whilethe other half was used for processing The different treatments used in this work were indole-3-aceticacid (IAA) abscisic acid (ABA) and sucrose at a concentration of 100 100 and 50 microM respectively Thehigh and low temperature was 40 C and 4 C All other experiments were performed at 25 C

44 The Processing of Strawberry Leaves under Different Stress and Hormone Treatments

To investigate the induced expression patterns of the FvMAPK and FvMAPKK genes in seedlingleaves in response to various treatments 30 days old soil grown seedlings were used For salt stresstreatment seedlings were irrigated in 100 mM NaCl collected 2 4 6 8 10 and 12 days after salttreatment of leaves without salt stress as control For the drought stress treatment all plants werestopped to water after full irrigation watering then clipping the leaves in 2 4 6 8 10 and 12 daysand no drought stress as the control respectively For the cold treatment seedlings were maintainedat 0 C and leaf material collected at 4 8 12 24 48 and 72 h Leaves cultivated in a growth chamberat 22 plusmn 1 C were used as controls For the hormone treatments plants were sprayed with solutionscontaining 100 microM ABA or 100 microM IAA then leaves were collected after 2 4 6 8 10 and 12 daysPlants that had not been sprayed served as the controls Samples were immediately frozen in liquidnitrogen and stored at minus80 C

45 RNA Extraction and Real-Time PCR Analysis

Total RNA was isolated from strawberry fruits harvested at 18 24 30 36 and 42 DAF usingthe Plant RNA Kit (Omega USA) according to the manufacturerrsquos instructions and total RNA wasreverse transcribed into cDNA using the Invitrogen reverse transcription kit (SuperScriptIII ReverseTranscriptase USA) Real-time PCR was performed to confirm gene expression patterns using a LightCyclerreg 96 SW11 Real Time PCR System (Roche Germany) with SYBR-Green (Takara Dalian China)The primer sequences used are designed based on gene sequences and the Beacon designer softwareand are shown in Table 2 in this study Each reaction consists of 5 microL SYBR 35 microL ddH2O 1 microL dilutedtemplate (1 microL of the generated first-strand cDNA diluted by 9 microL ddH2O) and 025 microL of each of twogene specific primers Thermal cycling conditions were 95 C for 10 min then 40 cycles at 95 C for20 s 54 C for 20 s 72 C for 20 s

Int J Mol Sci 2017 18 1766 11 of 18

23 Gene Expression Profiles of FvMAPKs and FvMAPKKs in Response to Hormones and Abiotic Stresses inF vesca Leaves

We investigated whether salt drought low temperature and exogenous application of thehormones indole acetic acid (IAA) and abscisic acid (ABA) would induce expression of the FvMAPKand FvMAPKK genes in seedling leaves using qRT-PCR analysis After cold treatment most of thetested genes showed a large expression increase 48 h after treatment Among them was MAPK2whose expression increased in early stages before decreasing In general drought stress resulted inthe induction of the greatest number of genes and a significantly improved in the process 12 daysIn response to salt stress the expression of five FvMAPK genes (FvMAPK5 -9 -10 -11 and -12) and threeFvMAPKK genes (FvMAPKK1 -3 and -5) increased Interestingly the transcript levels of FvMAPKK3were specifically activated by salt stress and not by the other treatments The expression of FvMAPK3and -12 and FvMAPKK4 -5 and -6 was activated by ABA while the IAA treatment only resulted in achange in FvMAPKK4 expression which was up-regulated two days after treatment (Figure 7)

Int J Mol Sci 2017 18 1766 11 of 18

23 Gene Expression Profiles of FvMAPKs and FvMAPKKs in Response to Hormones and Abiotic

Stresses in F vesca Leaves

We investigated whether salt drought low temperature and exogenous application of the

hormones indole acetic acid (IAA) and abscisic acid (ABA) would induce expression of the

FvMAPK and FvMAPKK genes in seedling leaves using qRT-PCR analysis After cold treatment

most of the tested genes showed a large expression increase 48 h after treatment Among them was

MAPK2 whose expression increased in early stages before decreasing In general drought stress

resulted in the induction of the greatest number of genes and a significantly improved in the

process 12 days In response to salt stress the expression of five FvMAPK genes (FvMAPK5 -9 -10

-11 and -12) and three FvMAPKK genes (FvMAPKK1 -3 and -5) increased Interestingly the

transcript levels of FvMAPKK3 were specifically activated by salt stress and not by the other

treatments The expression of FvMAPK3 and -12 and FvMAPKK4 -5 and -6 was activated by ABA

while the IAA treatment only resulted in a change in FvMAPKK4 expression which was

up-regulated two days after treatment (Figure 7)

Figure 7 Expression patterns of FvMPK and FvMPKK genes after different stress and hormone

treatments of leaves in Fragaria vesca Leaves were harvested every two days (0 2 4 6 8 10 and 12

days) after treatment Abscisic acid (ABA) (100 μM) indole-3-acetic acid (IAA) (100 μM) NaCl (100

mM) and drought treatments Leaves from the low temperature treatment were collected at 0 4 8

12 24 48 and 72 h after cold stress application

24 Expression Patterns of FvMAPK and FvMAPKK Genes in Response to Sucrose Hormones and

Abiotic Stresses in F vesca Fruits

The expression patterns of the FvMAPK and FvMAPKK genes at an early stage (18 DAF days

after flowering) and a late stage (36 DAF) of fruit development in response to exogenous IAA ABA

and sucrose treatment and drought high temperature or low temperature stresses were also

examined by qRT-PCR analyses Almost all showed a higher expression level in the early than in

the later stage It was interesting that the transcript levels of almost all the genes were up-regulated

in response to IAA drought and low temperature treatment at the early stage of fruit development

(18 DAF) During low temperature stress the expression of 17 of the 19 genes increased

significantly at 18 DAF while the transcript levels of FvMAPK3 FvMAPKK1 FvMAPKK3

FvMAPKK6 and FvMAPKK7 were significantly up-regulated by high temperature treatment even

Figure 7 Expression patterns of FvMPK and FvMPKK genes after different stress and hormonetreatments of leaves in Fragaria vesca Leaves were harvested every two days (0 2 4 6 8 10 and12 days) after treatment Abscisic acid (ABA) (100 microM) indole-3-acetic acid (IAA) (100 microM) NaCl(100 mM) and drought treatments Leaves from the low temperature treatment were collected at 0 4 812 24 48 and 72 h after cold stress application

24 Expression Patterns of FvMAPK and FvMAPKK Genes in Response to Sucrose Hormones and AbioticStresses in F vesca Fruits

The expression patterns of the FvMAPK and FvMAPKK genes at an early stage (18 DAF daysafter flowering) and a late stage (36 DAF) of fruit development in response to exogenous IAA ABAand sucrose treatment and drought high temperature or low temperature stresses were also examinedby qRT-PCR analyses Almost all showed a higher expression level in the early than in the later stageIt was interesting that the transcript levels of almost all the genes were up-regulated in responseto IAA drought and low temperature treatment at the early stage of fruit development (18 DAF)During low temperature stress the expression of 17 of the 19 genes increased significantly at 18 DAFwhile the transcript levels of FvMAPK3 FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 weresignificantly up-regulated by high temperature treatment even though the expression of FvMAPKK1

Int J Mol Sci 2017 18 1766 12 of 18

FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions(Figure 8)

Int J Mol Sci 2017 18 1766 12 of 18

though the expression of FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions (Figure 8)

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stress pre-treatments Red and blue boxes indicate high and low expression levels respectively for each gene Six treatments Abscisic acid (ABA) 100 μM indole-3-acetic acid (IAA) 100 μM Suc sucrose 50 μM Dry drought treatment High high temperature (40 degC) Low low temperature (4 degC) Con controlled trials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yet been comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and 1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genome while at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genome even though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome (~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and 5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similar in size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that of A thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based on phylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogenetically characterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Only one MAP4K member was identified in the F vesca genome but the ORF showed strong similarity to ScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles in ovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based on the conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinase subdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to each other FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference in length is usually due to variation in the length of the domain or a variable number of introns and may indicate the absence or presence of motifs which can affect the functional specificity There are 10 and 7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins ranged in size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members of the FvMAPKKK subfamily were distributed to all the

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stresspre-treatments Red and blue boxes indicate high and low expression levels respectively for each geneSix treatments Abscisic acid (ABA) 100 microM indole-3-acetic acid (IAA) 100 microM Suc sucrose 50 microMDry drought treatment High high temperature (40 C) Low low temperature (4 C) Con controlledtrials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yetbeen comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genomewhile at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genomeeven though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome(~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similarin size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that ofA thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based onphylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogeneticallycharacterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Onlyone MAP4K member was identified in the F vesca genome but the ORF showed strong similarity toScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles inovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based onthe conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinasesubdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to eachother FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference inlength is usually due to variation in the length of the domain or a variable number of introns and mayindicate the absence or presence of motifs which can affect the functional specificity There are 10 and7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins rangedin size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members

Int J Mol Sci 2017 18 1766 13 of 18

of the FvMAPKKK subfamily were distributed to all the chromosomes and shared 12ndash34 identitywith each other with a sequence length ranging from 214 to 1403 amino acids A kinase domainin the C-terminal and a long regulatory domain in the N- terminal region were identified in mostFvMAPKKKs suggesting that the specific long regulatory domain exited in the N-terminal of theRAF subfamily may involve in specify the kinase activity and regulating protein interaction [45] It isinteresting that no FvMAPKKK was found that belonged to the ZIK subfamily which in other specieshas members with a conserved GTPEFMAPE (LV) Y signature The absence of the characteristic ZIKsubfamily feature in F vesca might suggest the presence of a slightly modified RAF domain instead ofthe typical ZIK domain as reported in Vitis [42]

As the last two steps of the MAPK cascade MAPK and MAPKK link upstream kinases anddownstream substrates As dual-specificity kinases MAPKKs can be activated and phosphorylatedby MAPKKKs via phosphorylation of ThrSer residues while MAPKKs also phosphorylate thedownstream MAPKs and activated MAPKs can phosphorylate different substrates including othertranscription factors kinases and cytoskeleton binding proteins [3] The MAPK cascade protein(MAP4K-MAPKKK-MAPKK-MAPK) family is large and the functions of the various members canbe complex Though there are many members identified in the MAPKKK and MAP4K subfamilieslittle is known about the MAPKs and MAPKKs In this study we mainly focused our gene expressionpattern analysis on the MAPK and MAPKK genes We evaluated the expression patterns of all ofthe predicted members of the FvMAPK and FvMAPKK subfamily in different strawberry organs anddevelopmental stages The expression of most of the FvMAPK and FvMAPKK genes was detected in thestrawberry organs investigated possibly reflecting their involvement in a common metabolic andordevelopmental process Among them FvMAPK7 FvMAPK10 and FvMAPKK2 showed significantlyhigher expression in leaves than in other organs and FvMAPKK6 and FvMAPKK7 were specificallyexpressed in leaves whereas the FvMAPK6 transcripts were not be detected in leaves indicatingdifferent functions for divergent family members

Stress-specific increased MAPK genes and kinase activity has been identified when plantsare suffering from a variety of abiotic stresses including drought cold high salinity ozone UVirradiation and oxidative stress [46ndash49] Plant hormones were detected playing a role in trigger stressresponses and developmental pathways with other signaling molecules [4650ndash52] The componentsof MEKK1 MKK2 MPK4 andor MPK6 respond to drought salt or cold stressed were characterizedin A thaliana [2247] We studied the interaction between hormone and gene expression patterns instrawberry fruit FvMAPK5 and FvMAPK8 belong to group II which contains well-characterizedMAPK genes including AtMAPK3 and AtMAPK6 It has been reported that AtMAPK3 can be activatedin response to abiotic stresses and pathogens and AtMAPK6 also plays a role in abiotic and bioticstresses [10395354] Similarly we speculate that FvMAPK5 and FvMAPK8 are important for abioticor biotic stress responses due to their transcriptional activation by cold and drought FvMAPK1FvMAPK9 and FvMAPK10 are clustered in Group I while also includes AtMAPK4 AtMAPK5AtMAPK11 AtMAPK12 and AtMAPK13 AtMPK4 and its upstream MAPKK AtMKK2 are involvedin both biotic and abiotic stresses The expression patterns of FvMAPK1 FvMAPK9 and FvMAPK10were similar in fruits but not in leaves suggesting different functions depending on the organ [55]

In A thaliana AtMPKK3 is up-regulated in response to ABA [46] and FvMPKK5 which showedthe highest homology to AtMPKK3 showed strong activation by ABA in leaves suggesting asimilar function Interestingly AtMKK1AtMKK2 which are activated by salt drought and coldstresses [2223] and their ortholog FvMAPKK3 showed specific activation by salt stress in leaves andsignificant expression changes due to cold and heat stress

Int J Mol Sci 2017 18 1766 14 of 18

4 Materials and Methods

41 Identification of Potential MAPK Cascade Gene Family Members in Strawberry

To identify a complete list of strawberry MAPK cascade genes we used two public databases theNational Centre for Biotechnology Information (NCBI httpwwwncbinlmnihgov) and F vescaBioView Gene Model Database (httpsstrawberryplantandfoodconz)

42 Phylogenetic Analysis of A Thaliana and the Strawberry MAPK Cascade Genes

Phylogenetic analysis was performed using the MEGA 51 software (USA) and theneighbor-joining method Bootstrap values were calculated for 1000 iterations [5657] The A thalianaMAPK cascades gene family database was obtained from TAIR (The A thaliana Information Resourcehttpwwwarabidopsisorg) and used for comparative analysis

43 Plant Material and Fruit Pre-Treatments

F vesca (ldquoHawaii 4rdquo) plants were grown on a growth chamber at 22 plusmn 1 C in a 1311 h darklightphotoperiod Fruit samples were harvested every 6 days starting of the 18 days after flowering (18 2430 36 and 42 DAF) At each developmental stage ten representative fruits were sampled and tissueswere immediately frozen in liquid nitrogen and stored at minus80 C until further use In order to obtaindifferent pre-treatment experimental fruits two stages (18 and 36 DAF) were selected for sucrose andhormone treatments The fruits were cut in half longitudinally and half was used as a control whilethe other half was used for processing The different treatments used in this work were indole-3-aceticacid (IAA) abscisic acid (ABA) and sucrose at a concentration of 100 100 and 50 microM respectively Thehigh and low temperature was 40 C and 4 C All other experiments were performed at 25 C

44 The Processing of Strawberry Leaves under Different Stress and Hormone Treatments

To investigate the induced expression patterns of the FvMAPK and FvMAPKK genes in seedlingleaves in response to various treatments 30 days old soil grown seedlings were used For salt stresstreatment seedlings were irrigated in 100 mM NaCl collected 2 4 6 8 10 and 12 days after salttreatment of leaves without salt stress as control For the drought stress treatment all plants werestopped to water after full irrigation watering then clipping the leaves in 2 4 6 8 10 and 12 daysand no drought stress as the control respectively For the cold treatment seedlings were maintainedat 0 C and leaf material collected at 4 8 12 24 48 and 72 h Leaves cultivated in a growth chamberat 22 plusmn 1 C were used as controls For the hormone treatments plants were sprayed with solutionscontaining 100 microM ABA or 100 microM IAA then leaves were collected after 2 4 6 8 10 and 12 daysPlants that had not been sprayed served as the controls Samples were immediately frozen in liquidnitrogen and stored at minus80 C

45 RNA Extraction and Real-Time PCR Analysis

Total RNA was isolated from strawberry fruits harvested at 18 24 30 36 and 42 DAF usingthe Plant RNA Kit (Omega USA) according to the manufacturerrsquos instructions and total RNA wasreverse transcribed into cDNA using the Invitrogen reverse transcription kit (SuperScriptIII ReverseTranscriptase USA) Real-time PCR was performed to confirm gene expression patterns using a LightCyclerreg 96 SW11 Real Time PCR System (Roche Germany) with SYBR-Green (Takara Dalian China)The primer sequences used are designed based on gene sequences and the Beacon designer softwareand are shown in Table 2 in this study Each reaction consists of 5 microL SYBR 35 microL ddH2O 1 microL dilutedtemplate (1 microL of the generated first-strand cDNA diluted by 9 microL ddH2O) and 025 microL of each of twogene specific primers Thermal cycling conditions were 95 C for 10 min then 40 cycles at 95 C for20 s 54 C for 20 s 72 C for 20 s

Int J Mol Sci 2017 18 1766 12 of 18

FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions(Figure 8)

Int J Mol Sci 2017 18 1766 12 of 18

though the expression of FvMAPKK1 FvMAPKK3 FvMAPKK6 and FvMAPKK7 could not be detected under normal growth conditions (Figure 8)

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stress pre-treatments Red and blue boxes indicate high and low expression levels respectively for each gene Six treatments Abscisic acid (ABA) 100 μM indole-3-acetic acid (IAA) 100 μM Suc sucrose 50 μM Dry drought treatment High high temperature (40 degC) Low low temperature (4 degC) Con controlled trials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yet been comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and 1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genome while at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genome even though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome (~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and 5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similar in size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that of A thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based on phylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogenetically characterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Only one MAP4K member was identified in the F vesca genome but the ORF showed strong similarity to ScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles in ovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based on the conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinase subdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to each other FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference in length is usually due to variation in the length of the domain or a variable number of introns and may indicate the absence or presence of motifs which can affect the functional specificity There are 10 and 7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins ranged in size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members of the FvMAPKKK subfamily were distributed to all the

Figure 8 Expression patterns of FvMPK and FvMPKK genes in fruits after different stresspre-treatments Red and blue boxes indicate high and low expression levels respectively for each geneSix treatments Abscisic acid (ABA) 100 microM indole-3-acetic acid (IAA) 100 microM Suc sucrose 50 microMDry drought treatment High high temperature (40 C) Low low temperature (4 C) Con controlledtrials of fruits without any pre-treatments 18d 18 DAF fruits 36d 36 DAF fruits

3 Discussion

Although MAPKs have been studied in other plant species the FvMAPK cascades have not yetbeen comprehensively studied Here we identified 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and1 FvMAPKKKK genes There are only 12 MAPK and 7 MAPKK members in the strawberry genomewhile at least 20 MAPK genes and 10 MAPKK genes have been identified in the A thaliana genomeeven though the genome size of F vesca (240 Mb) is approximately twice that of the A thaliana genome(~125 Mb) The numbers are more comparable to those in V vinifera (~400 Mb) where 14 MAPK and5 MAPKK members have been identified [142] With 73 members the MAPKKK subfamily is similarin size to that of rice (75 members) larger than that of grapevine (62 members) but smaller than that ofA thaliana (80 members) Only a few MAP4K genes have been identified in plant genome based onphylogenetic analysis of the kinase domain [515] At least 10 protein kinases can be phylogeneticallycharacterized as MAP4K in the A thaliana and rice genomes but little is known about their roles Onlyone MAP4K member was identified in the F vesca genome but the ORF showed strong similarity toScMAP4K1 from the wild potato species Solanum chacoense which is known to play important roles inovule seed and fruit development [44] and a similar role is therefore possible in strawberry

The phylogenetic analysis showed that the FvMAPKs can be divided into four groups based onthe conserved residues of the TEYTDY motifs in the activation loop region (T-loop) between the kinasesubdomains VII and VIII [9] Members of the FvMAPK subfamily showed 24ndash89 identity to eachother FvMAPKs and their full-length sequences ranged from 365 to 691 amino acids The difference inlength is usually due to variation in the length of the domain or a variable number of introns and mayindicate the absence or presence of motifs which can affect the functional specificity There are 10 and7 MAPKK members in A thaliana and F vesca respectively The full length FvMAPKK proteins rangedin size from 244 to 518 amino acids and shared 25ndash42 similarity with each other The members

Int J Mol Sci 2017 18 1766 13 of 18

of the FvMAPKKK subfamily were distributed to all the chromosomes and shared 12ndash34 identitywith each other with a sequence length ranging from 214 to 1403 amino acids A kinase domainin the C-terminal and a long regulatory domain in the N- terminal region were identified in mostFvMAPKKKs suggesting that the specific long regulatory domain exited in the N-terminal of theRAF subfamily may involve in specify the kinase activity and regulating protein interaction [45] It isinteresting that no FvMAPKKK was found that belonged to the ZIK subfamily which in other specieshas members with a conserved GTPEFMAPE (LV) Y signature The absence of the characteristic ZIKsubfamily feature in F vesca might suggest the presence of a slightly modified RAF domain instead ofthe typical ZIK domain as reported in Vitis [42]

As the last two steps of the MAPK cascade MAPK and MAPKK link upstream kinases anddownstream substrates As dual-specificity kinases MAPKKs can be activated and phosphorylatedby MAPKKKs via phosphorylation of ThrSer residues while MAPKKs also phosphorylate thedownstream MAPKs and activated MAPKs can phosphorylate different substrates including othertranscription factors kinases and cytoskeleton binding proteins [3] The MAPK cascade protein(MAP4K-MAPKKK-MAPKK-MAPK) family is large and the functions of the various members canbe complex Though there are many members identified in the MAPKKK and MAP4K subfamilieslittle is known about the MAPKs and MAPKKs In this study we mainly focused our gene expressionpattern analysis on the MAPK and MAPKK genes We evaluated the expression patterns of all ofthe predicted members of the FvMAPK and FvMAPKK subfamily in different strawberry organs anddevelopmental stages The expression of most of the FvMAPK and FvMAPKK genes was detected in thestrawberry organs investigated possibly reflecting their involvement in a common metabolic andordevelopmental process Among them FvMAPK7 FvMAPK10 and FvMAPKK2 showed significantlyhigher expression in leaves than in other organs and FvMAPKK6 and FvMAPKK7 were specificallyexpressed in leaves whereas the FvMAPK6 transcripts were not be detected in leaves indicatingdifferent functions for divergent family members

Stress-specific increased MAPK genes and kinase activity has been identified when plantsare suffering from a variety of abiotic stresses including drought cold high salinity ozone UVirradiation and oxidative stress [46ndash49] Plant hormones were detected playing a role in trigger stressresponses and developmental pathways with other signaling molecules [4650ndash52] The componentsof MEKK1 MKK2 MPK4 andor MPK6 respond to drought salt or cold stressed were characterizedin A thaliana [2247] We studied the interaction between hormone and gene expression patterns instrawberry fruit FvMAPK5 and FvMAPK8 belong to group II which contains well-characterizedMAPK genes including AtMAPK3 and AtMAPK6 It has been reported that AtMAPK3 can be activatedin response to abiotic stresses and pathogens and AtMAPK6 also plays a role in abiotic and bioticstresses [10395354] Similarly we speculate that FvMAPK5 and FvMAPK8 are important for abioticor biotic stress responses due to their transcriptional activation by cold and drought FvMAPK1FvMAPK9 and FvMAPK10 are clustered in Group I while also includes AtMAPK4 AtMAPK5AtMAPK11 AtMAPK12 and AtMAPK13 AtMPK4 and its upstream MAPKK AtMKK2 are involvedin both biotic and abiotic stresses The expression patterns of FvMAPK1 FvMAPK9 and FvMAPK10were similar in fruits but not in leaves suggesting different functions depending on the organ [55]

In A thaliana AtMPKK3 is up-regulated in response to ABA [46] and FvMPKK5 which showedthe highest homology to AtMPKK3 showed strong activation by ABA in leaves suggesting asimilar function Interestingly AtMKK1AtMKK2 which are activated by salt drought and coldstresses [2223] and their ortholog FvMAPKK3 showed specific activation by salt stress in leaves andsignificant expression changes due to cold and heat stress

Int J Mol Sci 2017 18 1766 14 of 18

4 Materials and Methods

41 Identification of Potential MAPK Cascade Gene Family Members in Strawberry

To identify a complete list of strawberry MAPK cascade genes we used two public databases theNational Centre for Biotechnology Information (NCBI httpwwwncbinlmnihgov) and F vescaBioView Gene Model Database (httpsstrawberryplantandfoodconz)

42 Phylogenetic Analysis of A Thaliana and the Strawberry MAPK Cascade Genes

Phylogenetic analysis was performed using the MEGA 51 software (USA) and theneighbor-joining method Bootstrap values were calculated for 1000 iterations [5657] The A thalianaMAPK cascades gene family database was obtained from TAIR (The A thaliana Information Resourcehttpwwwarabidopsisorg) and used for comparative analysis

43 Plant Material and Fruit Pre-Treatments

F vesca (ldquoHawaii 4rdquo) plants were grown on a growth chamber at 22 plusmn 1 C in a 1311 h darklightphotoperiod Fruit samples were harvested every 6 days starting of the 18 days after flowering (18 2430 36 and 42 DAF) At each developmental stage ten representative fruits were sampled and tissueswere immediately frozen in liquid nitrogen and stored at minus80 C until further use In order to obtaindifferent pre-treatment experimental fruits two stages (18 and 36 DAF) were selected for sucrose andhormone treatments The fruits were cut in half longitudinally and half was used as a control whilethe other half was used for processing The different treatments used in this work were indole-3-aceticacid (IAA) abscisic acid (ABA) and sucrose at a concentration of 100 100 and 50 microM respectively Thehigh and low temperature was 40 C and 4 C All other experiments were performed at 25 C

44 The Processing of Strawberry Leaves under Different Stress and Hormone Treatments

To investigate the induced expression patterns of the FvMAPK and FvMAPKK genes in seedlingleaves in response to various treatments 30 days old soil grown seedlings were used For salt stresstreatment seedlings were irrigated in 100 mM NaCl collected 2 4 6 8 10 and 12 days after salttreatment of leaves without salt stress as control For the drought stress treatment all plants werestopped to water after full irrigation watering then clipping the leaves in 2 4 6 8 10 and 12 daysand no drought stress as the control respectively For the cold treatment seedlings were maintainedat 0 C and leaf material collected at 4 8 12 24 48 and 72 h Leaves cultivated in a growth chamberat 22 plusmn 1 C were used as controls For the hormone treatments plants were sprayed with solutionscontaining 100 microM ABA or 100 microM IAA then leaves were collected after 2 4 6 8 10 and 12 daysPlants that had not been sprayed served as the controls Samples were immediately frozen in liquidnitrogen and stored at minus80 C

45 RNA Extraction and Real-Time PCR Analysis

Total RNA was isolated from strawberry fruits harvested at 18 24 30 36 and 42 DAF usingthe Plant RNA Kit (Omega USA) according to the manufacturerrsquos instructions and total RNA wasreverse transcribed into cDNA using the Invitrogen reverse transcription kit (SuperScriptIII ReverseTranscriptase USA) Real-time PCR was performed to confirm gene expression patterns using a LightCyclerreg 96 SW11 Real Time PCR System (Roche Germany) with SYBR-Green (Takara Dalian China)The primer sequences used are designed based on gene sequences and the Beacon designer softwareand are shown in Table 2 in this study Each reaction consists of 5 microL SYBR 35 microL ddH2O 1 microL dilutedtemplate (1 microL of the generated first-strand cDNA diluted by 9 microL ddH2O) and 025 microL of each of twogene specific primers Thermal cycling conditions were 95 C for 10 min then 40 cycles at 95 C for20 s 54 C for 20 s 72 C for 20 s

Int J Mol Sci 2017 18 1766 13 of 18

of the FvMAPKKK subfamily were distributed to all the chromosomes and shared 12ndash34 identitywith each other with a sequence length ranging from 214 to 1403 amino acids A kinase domainin the C-terminal and a long regulatory domain in the N- terminal region were identified in mostFvMAPKKKs suggesting that the specific long regulatory domain exited in the N-terminal of theRAF subfamily may involve in specify the kinase activity and regulating protein interaction [45] It isinteresting that no FvMAPKKK was found that belonged to the ZIK subfamily which in other specieshas members with a conserved GTPEFMAPE (LV) Y signature The absence of the characteristic ZIKsubfamily feature in F vesca might suggest the presence of a slightly modified RAF domain instead ofthe typical ZIK domain as reported in Vitis [42]

As the last two steps of the MAPK cascade MAPK and MAPKK link upstream kinases anddownstream substrates As dual-specificity kinases MAPKKs can be activated and phosphorylatedby MAPKKKs via phosphorylation of ThrSer residues while MAPKKs also phosphorylate thedownstream MAPKs and activated MAPKs can phosphorylate different substrates including othertranscription factors kinases and cytoskeleton binding proteins [3] The MAPK cascade protein(MAP4K-MAPKKK-MAPKK-MAPK) family is large and the functions of the various members canbe complex Though there are many members identified in the MAPKKK and MAP4K subfamilieslittle is known about the MAPKs and MAPKKs In this study we mainly focused our gene expressionpattern analysis on the MAPK and MAPKK genes We evaluated the expression patterns of all ofthe predicted members of the FvMAPK and FvMAPKK subfamily in different strawberry organs anddevelopmental stages The expression of most of the FvMAPK and FvMAPKK genes was detected in thestrawberry organs investigated possibly reflecting their involvement in a common metabolic andordevelopmental process Among them FvMAPK7 FvMAPK10 and FvMAPKK2 showed significantlyhigher expression in leaves than in other organs and FvMAPKK6 and FvMAPKK7 were specificallyexpressed in leaves whereas the FvMAPK6 transcripts were not be detected in leaves indicatingdifferent functions for divergent family members

Stress-specific increased MAPK genes and kinase activity has been identified when plantsare suffering from a variety of abiotic stresses including drought cold high salinity ozone UVirradiation and oxidative stress [46ndash49] Plant hormones were detected playing a role in trigger stressresponses and developmental pathways with other signaling molecules [4650ndash52] The componentsof MEKK1 MKK2 MPK4 andor MPK6 respond to drought salt or cold stressed were characterizedin A thaliana [2247] We studied the interaction between hormone and gene expression patterns instrawberry fruit FvMAPK5 and FvMAPK8 belong to group II which contains well-characterizedMAPK genes including AtMAPK3 and AtMAPK6 It has been reported that AtMAPK3 can be activatedin response to abiotic stresses and pathogens and AtMAPK6 also plays a role in abiotic and bioticstresses [10395354] Similarly we speculate that FvMAPK5 and FvMAPK8 are important for abioticor biotic stress responses due to their transcriptional activation by cold and drought FvMAPK1FvMAPK9 and FvMAPK10 are clustered in Group I while also includes AtMAPK4 AtMAPK5AtMAPK11 AtMAPK12 and AtMAPK13 AtMPK4 and its upstream MAPKK AtMKK2 are involvedin both biotic and abiotic stresses The expression patterns of FvMAPK1 FvMAPK9 and FvMAPK10were similar in fruits but not in leaves suggesting different functions depending on the organ [55]

In A thaliana AtMPKK3 is up-regulated in response to ABA [46] and FvMPKK5 which showedthe highest homology to AtMPKK3 showed strong activation by ABA in leaves suggesting asimilar function Interestingly AtMKK1AtMKK2 which are activated by salt drought and coldstresses [2223] and their ortholog FvMAPKK3 showed specific activation by salt stress in leaves andsignificant expression changes due to cold and heat stress

Int J Mol Sci 2017 18 1766 14 of 18

4 Materials and Methods

41 Identification of Potential MAPK Cascade Gene Family Members in Strawberry

To identify a complete list of strawberry MAPK cascade genes we used two public databases theNational Centre for Biotechnology Information (NCBI httpwwwncbinlmnihgov) and F vescaBioView Gene Model Database (httpsstrawberryplantandfoodconz)

42 Phylogenetic Analysis of A Thaliana and the Strawberry MAPK Cascade Genes

Phylogenetic analysis was performed using the MEGA 51 software (USA) and theneighbor-joining method Bootstrap values were calculated for 1000 iterations [5657] The A thalianaMAPK cascades gene family database was obtained from TAIR (The A thaliana Information Resourcehttpwwwarabidopsisorg) and used for comparative analysis

43 Plant Material and Fruit Pre-Treatments

F vesca (ldquoHawaii 4rdquo) plants were grown on a growth chamber at 22 plusmn 1 C in a 1311 h darklightphotoperiod Fruit samples were harvested every 6 days starting of the 18 days after flowering (18 2430 36 and 42 DAF) At each developmental stage ten representative fruits were sampled and tissueswere immediately frozen in liquid nitrogen and stored at minus80 C until further use In order to obtaindifferent pre-treatment experimental fruits two stages (18 and 36 DAF) were selected for sucrose andhormone treatments The fruits were cut in half longitudinally and half was used as a control whilethe other half was used for processing The different treatments used in this work were indole-3-aceticacid (IAA) abscisic acid (ABA) and sucrose at a concentration of 100 100 and 50 microM respectively Thehigh and low temperature was 40 C and 4 C All other experiments were performed at 25 C

44 The Processing of Strawberry Leaves under Different Stress and Hormone Treatments

To investigate the induced expression patterns of the FvMAPK and FvMAPKK genes in seedlingleaves in response to various treatments 30 days old soil grown seedlings were used For salt stresstreatment seedlings were irrigated in 100 mM NaCl collected 2 4 6 8 10 and 12 days after salttreatment of leaves without salt stress as control For the drought stress treatment all plants werestopped to water after full irrigation watering then clipping the leaves in 2 4 6 8 10 and 12 daysand no drought stress as the control respectively For the cold treatment seedlings were maintainedat 0 C and leaf material collected at 4 8 12 24 48 and 72 h Leaves cultivated in a growth chamberat 22 plusmn 1 C were used as controls For the hormone treatments plants were sprayed with solutionscontaining 100 microM ABA or 100 microM IAA then leaves were collected after 2 4 6 8 10 and 12 daysPlants that had not been sprayed served as the controls Samples were immediately frozen in liquidnitrogen and stored at minus80 C

45 RNA Extraction and Real-Time PCR Analysis

Total RNA was isolated from strawberry fruits harvested at 18 24 30 36 and 42 DAF usingthe Plant RNA Kit (Omega USA) according to the manufacturerrsquos instructions and total RNA wasreverse transcribed into cDNA using the Invitrogen reverse transcription kit (SuperScriptIII ReverseTranscriptase USA) Real-time PCR was performed to confirm gene expression patterns using a LightCyclerreg 96 SW11 Real Time PCR System (Roche Germany) with SYBR-Green (Takara Dalian China)The primer sequences used are designed based on gene sequences and the Beacon designer softwareand are shown in Table 2 in this study Each reaction consists of 5 microL SYBR 35 microL ddH2O 1 microL dilutedtemplate (1 microL of the generated first-strand cDNA diluted by 9 microL ddH2O) and 025 microL of each of twogene specific primers Thermal cycling conditions were 95 C for 10 min then 40 cycles at 95 C for20 s 54 C for 20 s 72 C for 20 s

Int J Mol Sci 2017 18 1766 14 of 18

4 Materials and Methods

41 Identification of Potential MAPK Cascade Gene Family Members in Strawberry

To identify a complete list of strawberry MAPK cascade genes we used two public databases theNational Centre for Biotechnology Information (NCBI httpwwwncbinlmnihgov) and F vescaBioView Gene Model Database (httpsstrawberryplantandfoodconz)

42 Phylogenetic Analysis of A Thaliana and the Strawberry MAPK Cascade Genes

Phylogenetic analysis was performed using the MEGA 51 software (USA) and theneighbor-joining method Bootstrap values were calculated for 1000 iterations [5657] The A thalianaMAPK cascades gene family database was obtained from TAIR (The A thaliana Information Resourcehttpwwwarabidopsisorg) and used for comparative analysis

43 Plant Material and Fruit Pre-Treatments

F vesca (ldquoHawaii 4rdquo) plants were grown on a growth chamber at 22 plusmn 1 C in a 1311 h darklightphotoperiod Fruit samples were harvested every 6 days starting of the 18 days after flowering (18 2430 36 and 42 DAF) At each developmental stage ten representative fruits were sampled and tissueswere immediately frozen in liquid nitrogen and stored at minus80 C until further use In order to obtaindifferent pre-treatment experimental fruits two stages (18 and 36 DAF) were selected for sucrose andhormone treatments The fruits were cut in half longitudinally and half was used as a control whilethe other half was used for processing The different treatments used in this work were indole-3-aceticacid (IAA) abscisic acid (ABA) and sucrose at a concentration of 100 100 and 50 microM respectively Thehigh and low temperature was 40 C and 4 C All other experiments were performed at 25 C

44 The Processing of Strawberry Leaves under Different Stress and Hormone Treatments

To investigate the induced expression patterns of the FvMAPK and FvMAPKK genes in seedlingleaves in response to various treatments 30 days old soil grown seedlings were used For salt stresstreatment seedlings were irrigated in 100 mM NaCl collected 2 4 6 8 10 and 12 days after salttreatment of leaves without salt stress as control For the drought stress treatment all plants werestopped to water after full irrigation watering then clipping the leaves in 2 4 6 8 10 and 12 daysand no drought stress as the control respectively For the cold treatment seedlings were maintainedat 0 C and leaf material collected at 4 8 12 24 48 and 72 h Leaves cultivated in a growth chamberat 22 plusmn 1 C were used as controls For the hormone treatments plants were sprayed with solutionscontaining 100 microM ABA or 100 microM IAA then leaves were collected after 2 4 6 8 10 and 12 daysPlants that had not been sprayed served as the controls Samples were immediately frozen in liquidnitrogen and stored at minus80 C

45 RNA Extraction and Real-Time PCR Analysis

Total RNA was isolated from strawberry fruits harvested at 18 24 30 36 and 42 DAF usingthe Plant RNA Kit (Omega USA) according to the manufacturerrsquos instructions and total RNA wasreverse transcribed into cDNA using the Invitrogen reverse transcription kit (SuperScriptIII ReverseTranscriptase USA) Real-time PCR was performed to confirm gene expression patterns using a LightCyclerreg 96 SW11 Real Time PCR System (Roche Germany) with SYBR-Green (Takara Dalian China)The primer sequences used are designed based on gene sequences and the Beacon designer softwareand are shown in Table 2 in this study Each reaction consists of 5 microL SYBR 35 microL ddH2O 1 microL dilutedtemplate (1 microL of the generated first-strand cDNA diluted by 9 microL ddH2O) and 025 microL of each of twogene specific primers Thermal cycling conditions were 95 C for 10 min then 40 cycles at 95 C for20 s 54 C for 20 s 72 C for 20 s

Int J Mol Sci 2017 18 1766 15 of 18

Table 2 Primer sequence information

Gene Sequences 5primerarr3prime Annealing Temperature

MAPK1F TAGCAAGAACAACATCCGAGAC

54 CR GCTCCAGGCGACATATTAGG

MAPK2F ACACCTACACTAGAGACCATC

54 CR TGCCTTCCGTTCCATTCAT

MAPK3F CCTTGGTGGACGGTGTTC

54 CR GGTGGTGGTGGATTGTGG

MAPK4F CTTATCTTGAGGAGCACTATGGAA

54 CR CGTAATACTGAGCCGACAACT

MAPK5F GCGGCAGATTCATCCAGTA

54 CR TGACAATGCTCCTCAGATAGA

MAPK6F GCATCTCCACTTCTACATCTTCA

54 CR TGCCAATCACTTCTTGTATCTCA

MAPK7F ACCGAAGGACGCTTGTTAG

54 CR AGCAGCAGCAGAACCAAT

MAPK8F CATCGTCTGCTCGGTGTT

54 CR GCTCGGCTTCAAGTCTCTAT

MAPK9F CCACCAGATAAGGAGAACTTCAAT

54 CR CGATACCAACGAGTGACAACA

MAPK10F AGTGATAATGCCCGAAGATATGT

54 CR GGATTGAACTTGACCGACTC

MAPK11F GAGAGGAGCATACGGTGTTG

54 CR AGTTAGCATTGATGAGCAGGTT

MAPK12F CTGTGCTGCGATAACTATGGA

54 CR GGTGTTGGAGTGCTTCAG

MAPKK1F TGACTCTCCAGGCATTATTGAA

54 CR GCCACGCCAGAGATTACC

MAPKK2F CTCCACAGACGGCACATC

54 CR GGCGGCTGAGACATACAAAT

MAPKK3F GAAAGGAAGTGGTGGTGTAGT

54 CR GCAAGATATGGTTCAAGAATTGTCT

MAPKK4F ACTGCTCCTCCTCGTCTT

54 CR CGTGCCTTGCTGTTTGA

MAPKK5F GGATGAAGGACTTGGCAGAT

54 CR AACACCGTCTCCACATATAAGG

MAPKK6F CCACCTCCACCACTTACG

54 CR GGCGATCTTGACCTCATTCT

MAPKK7F CTCCACCACTTACGCTCTC

54 CR GACCTCGTTCTTGTTGTTCATT

ActinF TGGGTTTGCTGGAGATGAT

54 CR CAGTTAGGAGAACTGGGTGC

5 Conclusions

MAPK cascades are responsible for protein phosphorylation during signal transduction eventsand typically classify as three protein kinases MAPK MAPK kinase and MAPK kinase kinaseOur study provides a comprehensive overview of the 12 FvMAPK 7 FvMAPKK 73 FvMAPKKK and1 FvMAPKKKK genes identified in the F vesca genome The identification of MAPK cascade proteinsand a comparative analysis with the A thaliana MAPK cascade proteins indicated that the MAPK

Int J Mol Sci 2017 18 1766 16 of 18

cascade genes have been conserved during evolution and suggests that MAPK cascades play vitalroles in fruit development and in responses to abiotic stresses and hormone signal transductionAmong these genes FvMAPK7 FvMAPK10 and FvMAPKK2 showed significantly higher expression inleaves than in other organs and FvMAPK11 and FvMAPKK2 have an up-regulation and significantlyimproved in the later stage of fruit development For various hormones and stresses cold stresshas great influence on gene expression This information will be helpful in the physiological andbiochemical functional characterization of the MAPK cascades in strawberry

Acknowledgments We thank Jocelyn Rose from Cornell University to help to discuss the experiment and reviseour manuscript This work was supported by the National Natural Science Foundation of China (Grant No31370323) the High-Caliber Talents Project of Beijing Municipal Organization Department (2014000026833ZK18)the Beijing Municipal Education Commission (CEFF-PXM2017_014207_000033) and the Beijing Natural ScienceFoundation and Scientific Research Key Program of Beijing Municipal Commission of Education (KZ20130020018)

Author Contributions Heying Zhou and Yu Xing designed and initiated this study Heying Zhou andSuyue Ren carried out the bioinformatics analyses Yuanfang Han and Yu Xing participated in qRT-PCR analysesHeying Zhou and Yu Xing wrote the manuscript Ling Qin and Qing Zhang helped in discussions of themanuscript All authors read and approved the final manuscript

Conflicts of Interest The authors declare no conflict of interest

References

1 Baluška F Mancuso S Signaling in Plants Signaling and Communication in Plants Springer-Verlag New YorkNY USA BerlinHeidelberg Germany 2009 pp 51ndash69

2 Hamel LP Nicole MC Sritubtim S Morency MJ Ellis M Ehlting J Ancient signals Comparativegenomics of plant MAPK and MAPKK gene families Trends Plant Sci 2006 11 4 [CrossRef] [PubMed]

3 Rodriguez MC Petersen M Mundy J Mitogen-activated protein kinase signaling in plants Annu RevPlant Biol 2010 61 621ndash649 [PubMed]

4 Asai T Tena G Plotnikova J Willmann MR Chiu WL Gomez-Gomez L MAP kinase signallingcascade in Arabidopsis innate immunity Nature 2002 415 977ndash983 [CrossRef] [PubMed]

5 Group M Ichimura K Shinozaki K Tena G Sheen J Henry Y Mitogen-activated protein kinasecascades in plants A new nomenclature Trends Plant Sci 2002 7 301ndash308 [CrossRef]

6 Chen Z Gibson TB Robinson F Silvestro L Pearson G Xu B MAP kinases Chem Rev 2001 1012449ndash2476 [CrossRef] [PubMed]

7 Champion A Picaud A Henry Y Reassessing the MAP3K and MAP4K relationships Trends Plant Sci2004 9 123ndash129 [CrossRef] [PubMed]

8 Jonak C Oumlkreacutesz L Boumlgre L Hirt H Complexity cross talk and integration of plant MAP kinase signallingCurr Opin Plant Biol 2002 5 415ndash424 [CrossRef]

9 Mohanta TK Arora PK Mohanta N Parida P Bae H Identification of new members of the MAPKgene family in plants shows diverse conserved domains and novel activation loop variants BMC Genom2015 16 58 [CrossRef] [PubMed]

10 Huang X Luo T Fu X Fan Q Liu J Cloning and molecular characterization of a mitogen-activatedprotein kinase gene from Poncirus trifoliata whose ectopic expression confers dehydrationdrought tolerancein transgenic tobacco J Exp Bot 2011 62 5191ndash5206 [CrossRef] [PubMed]

11 Stulemeijer IJ Stratmann JW Joosten MH Tomato mitogen-activated protein kinases LeMPK1 LeMPK2and LeMPK3 are activated during the Cf-4Avr4-Induced hypersensitive response and have distinctphosphorylation specificities Plant Physiol 2007 144 1481ndash1494 [CrossRef] [PubMed]

12 Zaiumldi I Ebel C Touzri M Herzog E Evrard JL Schmit A TMKP1 is a novel wheat stress responsiveMAP Kinase phosphatase localized in the nucleus Plant Mol Biol 2010 73 325ndash338 [CrossRef] [PubMed]

13 Khokhlatchev AV Canagarajah B Wilsbacher J Robinson M Atkinson M Phosphorylation of the MAPkinase ERK2 promotes its homodimerization and nuclear translocation Cell 1998 93 605ndash615 [CrossRef]

14 Nadarajah K Sidek H The green MAPKs Asian J Plant Sci 2010 9 1ndash10 [CrossRef]15 Kumar K Rao KP Biswas DK Sinha AK Rice WNK1 is regulated by abiotic stress and involved in

internal circadian rhythm Plant Signal Behav 2011 6 316ndash320 [CrossRef] [PubMed]16 Romeis T Protein kinases in the plant defence response Curr Opin Plant Biol 2001 4 407ndash414 [CrossRef]

Int J Mol Sci 2017 18 1766 16 of 18

cascade genes have been conserved during evolution and suggests that MAPK cascades play vitalroles in fruit development and in responses to abiotic stresses and hormone signal transductionAmong these genes FvMAPK7 FvMAPK10 and FvMAPKK2 showed significantly higher expression inleaves than in other organs and FvMAPK11 and FvMAPKK2 have an up-regulation and significantlyimproved in the later stage of fruit development For various hormones and stresses cold stresshas great influence on gene expression This information will be helpful in the physiological andbiochemical functional characterization of the MAPK cascades in strawberry

Acknowledgments We thank Jocelyn Rose from Cornell University to help to discuss the experiment and reviseour manuscript This work was supported by the National Natural Science Foundation of China (Grant No31370323) the High-Caliber Talents Project of Beijing Municipal Organization Department (2014000026833ZK18)the Beijing Municipal Education Commission (CEFF-PXM2017_014207_000033) and the Beijing Natural ScienceFoundation and Scientific Research Key Program of Beijing Municipal Commission of Education (KZ20130020018)

Author Contributions Heying Zhou and Yu Xing designed and initiated this study Heying Zhou andSuyue Ren carried out the bioinformatics analyses Yuanfang Han and Yu Xing participated in qRT-PCR analysesHeying Zhou and Yu Xing wrote the manuscript Ling Qin and Qing Zhang helped in discussions of themanuscript All authors read and approved the final manuscript

Conflicts of Interest The authors declare no conflict of interest

References

1 Baluška F Mancuso S Signaling in Plants Signaling and Communication in Plants Springer-Verlag New YorkNY USA BerlinHeidelberg Germany 2009 pp 51ndash69

2 Hamel LP Nicole MC Sritubtim S Morency MJ Ellis M Ehlting J Ancient signals Comparativegenomics of plant MAPK and MAPKK gene families Trends Plant Sci 2006 11 4 [CrossRef] [PubMed]

3 Rodriguez MC Petersen M Mundy J Mitogen-activated protein kinase signaling in plants Annu RevPlant Biol 2010 61 621ndash649 [PubMed]

4 Asai T Tena G Plotnikova J Willmann MR Chiu WL Gomez-Gomez L MAP kinase signallingcascade in Arabidopsis innate immunity Nature 2002 415 977ndash983 [CrossRef] [PubMed]

5 Group M Ichimura K Shinozaki K Tena G Sheen J Henry Y Mitogen-activated protein kinasecascades in plants A new nomenclature Trends Plant Sci 2002 7 301ndash308 [CrossRef]

6 Chen Z Gibson TB Robinson F Silvestro L Pearson G Xu B MAP kinases Chem Rev 2001 1012449ndash2476 [CrossRef] [PubMed]

7 Champion A Picaud A Henry Y Reassessing the MAP3K and MAP4K relationships Trends Plant Sci2004 9 123ndash129 [CrossRef] [PubMed]

8 Jonak C Oumlkreacutesz L Boumlgre L Hirt H Complexity cross talk and integration of plant MAP kinase signallingCurr Opin Plant Biol 2002 5 415ndash424 [CrossRef]

9 Mohanta TK Arora PK Mohanta N Parida P Bae H Identification of new members of the MAPKgene family in plants shows diverse conserved domains and novel activation loop variants BMC Genom2015 16 58 [CrossRef] [PubMed]

10 Huang X Luo T Fu X Fan Q Liu J Cloning and molecular characterization of a mitogen-activatedprotein kinase gene from Poncirus trifoliata whose ectopic expression confers dehydrationdrought tolerancein transgenic tobacco J Exp Bot 2011 62 5191ndash5206 [CrossRef] [PubMed]

11 Stulemeijer IJ Stratmann JW Joosten MH Tomato mitogen-activated protein kinases LeMPK1 LeMPK2and LeMPK3 are activated during the Cf-4Avr4-Induced hypersensitive response and have distinctphosphorylation specificities Plant Physiol 2007 144 1481ndash1494 [CrossRef] [PubMed]

12 Zaiumldi I Ebel C Touzri M Herzog E Evrard JL Schmit A TMKP1 is a novel wheat stress responsiveMAP Kinase phosphatase localized in the nucleus Plant Mol Biol 2010 73 325ndash338 [CrossRef] [PubMed]

13 Khokhlatchev AV Canagarajah B Wilsbacher J Robinson M Atkinson M Phosphorylation of the MAPkinase ERK2 promotes its homodimerization and nuclear translocation Cell 1998 93 605ndash615 [CrossRef]

14 Nadarajah K Sidek H The green MAPKs Asian J Plant Sci 2010 9 1ndash10 [CrossRef]15 Kumar K Rao KP Biswas DK Sinha AK Rice WNK1 is regulated by abiotic stress and involved in

internal circadian rhythm Plant Signal Behav 2011 6 316ndash320 [CrossRef] [PubMed]16 Romeis T Protein kinases in the plant defence response Curr Opin Plant Biol 2001 4 407ndash414 [CrossRef]

Int J Mol Sci 2017 18 1766 17 of 18

17 Yoo SD Cho YH Tena G Xiong Y Sheen J Dual control of nuclear EIN3 by bifurcate MAPK cascadesin C2H4 signalling Nature 2008 451 789ndash795 [CrossRef] [PubMed]

18 Zhou C Cai Z Guo Y Gan S An Arabidopsis mitogen-activated protein kinase cascade MKK9-MPK6plays a role in leaf senescence Plant Physiol 2009 150 167ndash177 [CrossRef] [PubMed]

19 Tena G Asai T Chiu W-L Sheen J Plant mitogen-activated protein kinase signaling cascades Curr OpinPlant Biol 2001 4 392ndash400 [CrossRef]

20 Xing Y Cao QQ Zhang Q Shen YY Qin L Zhang J MKK5 regulates high light-induced geneexpression of CuZn superoxide dismutase 1 and 2 in Arabidopsis Plant Cell Physiol 2013 54 1217ndash1227[CrossRef] [PubMed]

21 Xing Y Chen W Jia W Zhang J Mitogen-activated protein kinase kinase 5 (MKK5)-mediated signallingcascade regulates expression of iron superoxide dismutase gene in Arabidopsis under salinity stressJ Exp Bot 2015 66 5971ndash5981 [CrossRef] [PubMed]

22 Teige M Scheikl E Eulgem T Doczi R Ichimura K Shinozaki K The MKK2 pathway mediates coldand salt stress signaling in Arabidopsis Mol Cell 2004 15 141ndash152 [CrossRef] [PubMed]

23 Xing Y Jia W Zhang J AtMKK1 mediates ABA-induced CAT1 expression and H2O2 production viaAtMPK6-coupled signaling in Arabidopsis Plant J 2008 54 440ndash451 [CrossRef] [PubMed]

24 Xing Y Jia W Zhang J AtMKK1 and AtMPK6 are involved in abscisic acid and sugar signaling inArabidopsis seed germination Plant Mol Biol 2009 70 725ndash736 [CrossRef] [PubMed]

25 Wang J Ding H Zhang A Ma F Cao J Jiang M A novel Mitogen-activated protein kinase gene inmaize (Zea mays) ZmMPK3 is involved in response to diverse environmental cues J Integr Plant Biol 201052 442ndash452 [CrossRef] [PubMed]

26 Zhang A Zhang J Ye N Cao J Tan M Zhang J ZmMPK5 is required for the NADPH oxidase-mediatedself-propagation of apoplastic H2O2 in brassinosteroid-induced antioxidant defence in leaves of maizeJ Exp Bot 2010 61 4399ndash4411 [CrossRef] [PubMed]

27 Pan J Zhang M Kong X Xing X Liu Y Sun L ZmMPK17 a novel maize group D MAP kinase geneis involved in multiple stress responses Planta 2012 235 661ndash676 [CrossRef] [PubMed]

28 Lee SK Kim BG Kwon TR Jeong MJ Park SR Lee JW Overexpression of the mitogen-activatedprotein kinase gene OsMAPK33 enhances sensitivity to salt stress in rice (Oryza sativa L) J Biosci 2011 36139ndash151 [CrossRef] [PubMed]

29 Jeong MJ Lee SK Kim BG Kwon TR Cho WS Park YT A rice (Oryza sativa L) MAP kinasegene OsMAPK44 is involved in response to abiotic stresses Plant Cell Tissue Organ Cult 2006 85 151ndash160[CrossRef]

30 Rao KP Richa T Kumar K Raghuram B Sinha AK In silico analysis reveals 75 members ofmitogen-activated protein kinase kinase kinase gene family in rice DNA Res 2010 17 139ndash153 [CrossRef][PubMed]

31 Seo S Katou S Seto H Gomi K Ohashi Y The mitogen-activated protein kinases WIPK and SIPKregulate the levels of jasmonic and salicylic acids in wounded tobacco plants Plant J 2007 49 899ndash909[CrossRef] [PubMed]

32 Kiegerl S Cardinale F Siligan C Gross A Baudouin E Liwosz A SIMKK a mitogen-activated proteinkinase (MAPK) kinase is a specific activator of the salt stress-induced MAPK SIMK Plant Cell 2000 122247ndash2258 [CrossRef] [PubMed]

33 Cardinale F Meskiene I Ouaked F Hirt H Convergence and divergence of stress-inducedmitogen-activated protein kinase signaling pathways at the level of two distinct mitogen-activated proteinkinase kinases Plant Cell 2002 14 703ndash711 [CrossRef] [PubMed]

34 Wang J Pan C Wang Y Ye L Wu J Chen L Genome-wide identification of MAPK MAPKK andMAPKKK gene families and transcriptional profiling analysis during development and stress response incucumber BMC Genom 2015 16 386 [CrossRef] [PubMed]

35 Galletti R Ferrari S DeLorenzo G Arabidopsis MPK3 and MPK6 play different roles in basal andoligogalacturonide-or flagellin-induced resistance against Botrytis cinerea Plant Physiol 2011 157 804ndash814[CrossRef] [PubMed]

36 Frye CA Tang D Innes RW Negative regulation of defense responses in plants by a conserved MAPKKkinase Proc Natl Acad Sci USA 2001 98 373ndash378 [CrossRef] [PubMed]

Int J Mol Sci 2017 18 1766 18 of 18

37 Kumar KR Kirti PB A mitogen-activated protein kinase AhMPK6 from peanut localizes to the nucleusand also induces defense responses upon transient expression in tobacco Plant Physiol Biochem 2010 48481ndash486 [CrossRef] [PubMed]

38 Colcombet J Hirt H Arabidopsis MAPKs A complex signalling network involved in multiple biologicalprocesses Biochem J 2008 413 217ndash226 [CrossRef] [PubMed]

39 Reyna NS Yang Y Molecular analysis of the rice MAP kinase gene family in relation to Magnaporthegrisea infection Mol Plant Microbe Interact 2006 19 530ndash540 [CrossRef] [PubMed]

40 Liu Q Xue Q Computational identification and phylogenetic analysis of the MAPK gene family in Oryzasativa Plant Physiol Biochem 2007 45 6ndash14 [CrossRef] [PubMed]

41 Wankhede DP Misra M Singh P Sinha AK Rice mitogen activated protein kinase kinase and mitogenactivated protein kinase interaction network revealed by in-silico docking and yeast two-hybrid approachesPLoS ONE 2013 8 e65011 [CrossRef] [PubMed]

42 Birsen C Ozan K Mitogen-activated protein kinase cascades in Vitis vinifera Front Plant Sci 2015 6 55643 Shulaev V Sargent DJ Crowhurst RN Mockler TC Folkerts O Delcher AL The genome of woodland

strawberry (Fragaria vesca) Nat Genet 2011 43 109ndash116 [CrossRef] [PubMed]44 Major G Daigle C Stafford-Richard T Tebbji F Lafleur E Caron S Characterization of ScMAP4K1

a MAP kinase kinase kinase kinase involved in ovule seed and fruit development in Solanum chacoenseBitt Curr Top Plant Biol 2009 10 27ndash46

45 Boumlgre L Calderini O Binarova P Mattauch M Till S Kiegerl S A MAP kinase is activated late in plantmitosis and becomes localized to the plane of cell division Plant Cell 1999 11 101ndash113 [CrossRef] [PubMed]

46 Hwa CM Yang XC The AtMKK3 pathway mediates ABA and salt signaling in Arabidopsis Acta PhysiolPlantarum 2008 30 277ndash286 [CrossRef]

47 Mizoguchi T Irie K Hirayama T Hayashida N Yamaguchi-Shinozaki K Matsumoto K A geneencoding a mitogen-activated protein kinase kinase kinase is induced simultaneously with genes for amitogen-activated protein kinase and an S6 ribosomal protein kinase by touch cold and water stress inArabidopsis thaliana Proc Natl Acad Sci USA 1996 93 765ndash769 [CrossRef] [PubMed]

48 Berberich T Sano H Kusano T Involvement of a MAP kinase ZmMPK5 in senescence and recoveryfrom low-temperature stress in maize Mol Gen Genet 1999 262 534ndash542 [CrossRef] [PubMed]

49 Doczi R Brader G Pettko-Szandtner A Rajh I Djamei A Pitzschke A The Arabidopsismitogen-activated protein kinase kinase MKK3 is upstream of group C mitogen-activated protein kinasesand participates in pathogen signaling Plant Cell 2007 19 3266ndash3279 [CrossRef] [PubMed]

50 Mockaitis K Howell SH Auxin induces mitogenic activated protein kinase (MAPK) activation in roots ofArabidopsis seedlings Plant J 2000 24 785ndash796 [CrossRef] [PubMed]

51 Liu Y Roles of mitogen-activated protein kinase cascades in ABA signaling Plant Cell Rep 2012 31 1ndash12[CrossRef] [PubMed]

52 Xu J Li Y Wang Y Liu HX Lei L Yang HL Activation of MAPK kinase 9 induces ethylene andcamalexin biosynthesis and enhances sensitivity to salt stress in Arabidopsis J Biol Chem 2008 28326996ndash27006 [CrossRef] [PubMed]

53 Zhang S Klessig DF MAPK cascades in plant defense signaling Trends Plant Sci 2001 6 520ndash527 [CrossRef]54 Yuasa T Ichimura K Mizoguchi T Shinozaki K Oxidative stress activates ATMPK6 an Arabidopsis

homologue of MAP kinase Plant Cell Physiol 2001 42 1012ndash1016 [CrossRef] [PubMed]55 Selim S Sansseneacute J Rossard S Courtois J Systemic induction of the defensin and phytoalexin

pisatin pathways in pea (Pisum sativum) against Aphanomyces euteiches by acetylated and nonacetylatedoligogalacturonides Molecules 2017 22 1017 [CrossRef] [PubMed]

56 Larkin MA Blackshields G Brown NP Chenna R McGettigan PA McWilliam H Clustal W andClustal X version 20 Bioinformatics 2007 23 2947ndash2948 [CrossRef] [PubMed]

57 Tamura K Peterson D Peterson N Stecher G Nei M Kumar S MEGA5 Molecular evolutionarygenetics analysis using maximum likelihood evolutionary distance and maximum parsimony methodsMol Biol Evol 2011 28 2731ndash2739 [CrossRef] [PubMed]

copy 2017 by the authors Licensee MDPI Basel Switzerland This article is an open accessarticle distributed under the terms and conditions of the Creative Commons Attribution(CC BY) license (httpcreativecommonsorglicensesby40)