Immunobiology Zeitschrift für Immunitätsforschung

Edi to r s

D . BlTTER-SUERMANN, H a n n o v e r • M . P. DlERICH, Innsb ruck • M . FELDMANN, L o n d o n S. H . E . K A U F M A N N , U l m • E . KLEIN, S tockho lm • W . KÖHLER, Jena • U . KOSZINOWSKI, U l m P. KRAMMER, H e i d e l b e r g • A . LANZAVECCHIA, Basel • M . LOOS, M a i n z • T . LUGER, M ü n s t e r P. MATZINGER, Bethesda • W . R. MAYR, Aachen • L . J. O L D , N e w Y o r k • J. J. OPPENHEIM Freder ick • H . H . PETER, F re ibu rg • K . PFIZENMAIER, Stuttgart • M . RÖLLINGHOFF, Erlangen D . SCHENDEL, M ü n c h e n • V . SCHIRRMACHER, Heide lberg • C . SORG, M ü n s t e r • R. VAN FURTH, Le iden • H . WAGNER, M ü n c h e n • H . WEKERLE, Mar t ins r i ed • G . W l C K , Innsbruck • R. ZINKERNAGEL, Z ü r i c h

E d i t o r - i n - C h i e f

D . GEMSA, M a r b u r g

E d i t o r i a l A d v i s o r y Board

R. AVERDUNK, B e r l i n • J. F . BACH, Paris • H . BALNER, R i j s w i j k • R. BENNER, Rot te rdam H . v. BOEHMER, Basel • G . BONNARD, Bern • D . G . BRAUN, Basel • V . BRAUN, T ü b i n g e n J. BROSTOFF, L o n d o n • A . COUTINHO, Paris • T . D I AM A NTSTEIN, B e r l i n • W . DRÖGE He ide lbe rg • P. DUKOR, Basel • P. ERB, Basel • H . - D . FLAD, Borstel • O . GÖTZE, G ö t t i n g e n E. GÜNTHER, G ö t t i n g e n • U . H A D D I N G , M a i n z • H . H A H N , B e r l i n • K . H Ä L A , Innsbruck G . J. HÄMMERLING, He ide lbe rg • K . U . HARTMANN, M a r b u r g • H . ZUR HAUSEN, Heide lberg M . HESS, Be rn • J. KALDEN, Erlangen • T . J. KINDT, N e w Y o r k • E . KOWNATZKI, F re iburg W . LEIBOLD, H a n n o v e r • K . LENNERT, K i e l • F . LILLY, N e w Y o r k • J. L l N D E M A N N , Z ü r i c h E . MACHER, M ü n s t e r • H . METZGER, Bethesda • V . TER MEULEN, W ü r z b u r g • H . J. MÜLLER-E B E R H A R D , H a m b u r g • W . MÜLLER-RUCHHOLTZ, K i e l • H . PETERS, G ö t t i n g e n • E . PlCK, T e l A v i v • O . PROKOP, B e r l i n • M . QUASTEL, Beer Sheva • J. P. REVILLARD, L y o n • E . P. RlEBER, M ü n c h e n • E . RÜDE, M a i n z • E . SCHÖPF, F re ibu rg • H . G . SCHWICK, M a r b u r g • K . SETHI, He ide lbe rg • G . SUNSHINE, L o n d o n • N . TALAL, San Francisco • G . T I L L , A n n A r b o r • G . UHLENBRUCK, K ö l n • M . WAGNER, Jena • P. WERNET, D ü s s e l d o r f

Vol. 182

Gustav Fischer Verlag • Stuttgart • New York • 1990/1991

Universitäts-Bibüothek München

ISSN Immunobiology • Zeitschrift für Immunitätsforschung • 0171-2985 © Gustav Fischer Verlag • Stuttgart • New York • 1990/1991 Alle Rechte vorbehalten Printed by Druckerei Ungeheuer + Ulmer K G G m b H + Co, Ludvvigsburg Printed in Germany

Contents Volume 182 • 1990/1991

Original Papers

ASKEW, D . , C . J . BURGER, and K . D . ELGERT: Modulation of Alloreactivity by Mac-1 + ,

-2 + , and -3 + Macrophages from Normal and Tumor-Bearing Hosts: Flow Cyto-fluorometrically Separated Macrophages 1

BARBE, FI., J . G . M . C . D A M O I S E A U X , E. A . D Ö P P , and C . D . DIJKSTRA: Characterization

and Expression of the Antigen Present on Resident Rat Macrophages Recognized by Monoclonal Antibody ED2 88

B U G , M . , H . M U N O Z O V A , G . Russ, B . BUSOVA, F . V L C E K , and J . ROVENSKY: Reduced

Expression of H L A - D P Antigens on P W M Stimulated T Lymphocytes in Patients Suffering from Psoriasis Vulgaris 197

BUSSIERE, J . L . , G . G . M A T H E R , and J . H . E X O N : Effect of Cyclosporine on 3-

Methylcholanthrene-Induced Carcinogenesis and Immune Responses in the Rat . . . . 205 DELEMARRE, F . G . A . , N . KORS, and N . V A N ROOIJEN: Elimination of Spleen and of

Lymph Node Macrophages and Its Difference in the Effect on the Immune Response to Particulate Antigens 70

D O L E Z A L , J. and T. H R A B A : Model-Based Analysis of C D 4 + Lymphocyte Dynamics in HIV-infected Individuals. I I . Evaluation of the Model Based on Clinical Observa­tions 178

FERNANDEZ, j . E . , A. C O N C H A , A . A R A N E G A , F . R U I Z - C A B E L L O , T. CABRERA, and F .

G A R R I D O : H L A Class I and I I Expression in Rhabdomyosarcomas 440 FOKKENS, W . ] . , D . M . BROEKHUTS-FLUITSMA, E . RIJNTJES, T. M . V R O O M , and E . C. M .

H O E I S M I T : Langerhans Cells in Nasal Mucosa of Patients with Grass Pollen Allergy . . 135 G I R A R D , R., L . P H A L E N T E , R. C H A B Y , T . P E D R O N , and G . B U T T I N : The Splenic Pool of

Mouse Stem Cells: in vitro Differentiation and Expression of the BP-1 Alloantigen on Cells of the Lymphoid and Myeloid Lineages 56

G Ö M E Z - R E I N O , J . J., J . M A R T I N E Z - L A S O , J . L . V I C A R I O , E. P A Z - A R T A L , A . A R A G O N , J .

M . M A R T I N - V I L L A , M . D . D E J U A N , P . PEREZ-ACIEGO, and A . A R N A I Z - V I L L E N A :

lmmunogenetics of Systemic Lupus Erythematosus in Spanish Patients: Differential H L A Markers . . . . ' 465

G O N G , J.-H., H . R E N Z , H . SPRENGER, M . N A I N , and D . GEMSA: Enhancement of

Tumor Necrosis Factor-a Gene Expression by Low Doses of Prostaglandin E 2 and Cyclic GMP !" 44

G R A N D I A , A. A. , H . DE VISSER, J. D . A . V A N E M B D E N , R. V A N DER Z E E , W. B . V A N DEN

BERG, and M . P. H A Z E N B E R G : Natural Antibodies to 65 k D Mycobacterial Heat Shock Protein in Rats do not Correlate wi th Susceptibility for Mycobacterium tuberculosis Induced Adjuvant Arthritis 127

GROSCHWITZ, M . , N . SEPP, H . K O I L E R , and G . W I C K : Expression of Class I I - M H C

Antigens in the Dermis of Patients with Progressive Systemic Sclerosis 234 H A M I L T O N , G . , M . PRETTENHOFER, A . Z O M M E R , S. H O P B A U E R , P . G Ö T Z I N G E R , F . X .

G N A N T , and R. FÜGGER: Intraoperative Course and Prognostic Significance of Endotoxin, Tumor Necrosis Factor-alpha and Interleukin-6 in Liver Transplant Recipients 425

HASLOV, K. R., M . B . F A U N T L E R O Y , P . W. STASHAK, C. E . T A Y L O R , and P. J . B A K E R :

T Cells Regulate the I g M Antibody Response of BALB/c Mice to DextranBl355 . . . 100 HIEMSTRA, P. S., J. A . KRAMPS, T. M . DE VREEDE, F. C. BREEDVELD, and M . R. D A H A :

Inhibition of Polymorphonuclear Leukocyte-Mediated Endothelial Cell Detachment by Antileukoprotease: A Comparison with Other Proteinase Inhibitors 117

INGLES-ESTEVE, J., F. L O Z A N O , M . P L A N A , J . A L B E R O L A - I L A , L . PLACES, and J. VIVES:

The Protein Kinase C-Independent Human B Cell Proliferation Induced via Surface Immunoglobulins is Unaffected by CD45 Monoclonal Antibodies 152

ISHIKURA, H . and M . E. D O R F : Thymic Stromal Cells Induce Hapten-Specific, Geneti­cally Restricted Effector Suppressor Cells in vivo 11

484 • Contents

IwABUcHi, K. , J. O H G A M A , K. O G A S A W A R A , C. I W A B U C H I , I . N E G I S H I , R . A . G O O D ,

and K. O N O E : Distribution of MEL-14 + Cells in Various Lymphoid Tissues 161 JANSE, E. M . and S. H . M . JEURISSEN: Ontogeny and Function of Two Non-Lymphoid

Cell Populations in the Chicken Embryo 472 K A R A S H I M A , A . , K. T A N I G U C H I , Y . Y O S H I K A I , and K. N O M O T O : Alteration in Natural

Defense Activity Against NK-Susceptible B16 Melanoma Cells after Treatment wi th Corynebacterium parvum 414

MEBIUS, R. E., J. BAUER, A. J. T. TWJSK, J. BREVE, and G. K R A A L : The Functional

Activity of High Endothelial Venules: A Role for the Subcapsular Sinus Macrophages in the Lymph Node 277

N A G Y , E. V. , K. K A L M A N , J. SZABO, G. B A K O , L . GERGELY, and A . L E Ö V E V : Sera but

not Immunoglobulins of Ophthalmic Graves' Patients Stimulate Human Embryonal Fibroblasts' Biosynthetic Activity in Culture 405

N I K O L O V A , E., M . STAYKOVA, M . K A R A D J O V A , D . R A I C H E V A , and I . G O R A N O V :

Kinetics of M H C Class I I and Transferrin Receptor Expression by Colostral Cells Stimulated in vitro with Concanavalin A and Myelin Basic Protein 174

PELLETIER, H . , N . - O . OLSSON, G. L I Z A R D , and F. M A R T I N : Cytotoxic Activity of

Lymphocytes Infiltrating Progressive and Regressive Tumor Variants from a Rat Colonic Cancer 188

PöcsiK, E., R. M I H A L I K , M . R E T I , E. G Y Ö D I , K. P Ä L Ö C Z I , K. M A Y E R , M . KASSAI, M .

H E R O L D , C. H U B E R , G. G. PETRANYI , and M . B E N C Z Ü R : Differences in N o n - M H C

Restricted Cytotoxic Activities of Human Peripheral Blood Lymphocytes after Trans­fusion with Allogeneic Leukocytes or Platelets Possessing Class I and/or Class I I M H C Molecules ' 22

RITTER, G., E. BOOSFELD, M . J. CALVES, H . F. O E T T G E N , L . J. O L D , and P. O .

L I V I N G S T O N : Antibody Response to Immunization with Purified GD3 Ganglioside and GD3 Derivatives (Lactones, Amide and Gangliosidol) in the Mouse 32

RUPPERT, J., D . FRIEDRICHS, H . X U , and J. H . PETERS: IL-4 Decrease the Expression of

the Monocyte Differentiation Marker C D 14, Paralleled by an Increasing Accessory Potency 449

SCHWAEBLE, W . , E. FEIFEL, C. ESTALLER, A . BARBIERI , M . M Ö L G G , V. K O I S T I N E N , E. H .

WEISS, and M . P. D I E R I C H : Human Complement Factor H : Molecular Cloning and c D N A Expression Reveals Variability in the Factor H-Related m R N A Species of 1.4 kb 307

S i m M A C H E R , U . , H . - D . V O L K , S. J A H N , K. N E U H A U S , F. K U H N , and R. V O N B A E H R :

Characterization of Human Lymphocytes Separated from Fetal Liver and Spleen at Different Stages of Ontogeny 256

SOMMERMEYER, H . , R. SCHWINZER, V. K A E V E R , and K. RESCH: Cholera Toxin-Mediated

Inhibition of Signalling in Jurkat Cells is followed by, but not Due to a Loss of T Cell Receptor Complex 266

STADE, B. G., G. MESSER, G. R I E T H M Ü L L E R , and J. P. J O H N S O N : Structural Characteris­

tics of the 5' Region of the Human I C A M - 1 Gene 79 VOGETSEDER, W . and M . P. D I E R I C H : Intercellular Adhesion Molecule-1 ( I C A M - 1 ,

CD54) is Associated with Actin-Filaments 143 W A G N E R , H . M . , H . U . BEUSCHER, M . R Ö L L I N G H O F F , and W . S O L B A C H : Interferon-v

Inhibits the Efficacy of Interleukin 1 to Generate a Th2-Cell Biased Immune Response Induced by Leishmania major 292

W I N K L E R , D . F., K . R. MYERS, H . D . H O C H S T E I N , J. T. U L R I C H , and J. R. W U N D E R L I C H :

Bacterial Lipopolysaccharide Acts Synergistically with Selected Macromolecular Poly-anions to Induce MHC-Nonrestricted Cytotoxic Cells 216

Letters to the Editor

F O N T A L I N , L . N . and I . Y u . C H E R N Y A K H O V S K A Y A : Recent State of Cyclophosphamide-Induced Skin Allograft Tolerance in Mice 323

Contents • 485

M A V U M I , H . and R. A . G O O D 325

F O N T A L I N , L . N . and I . Y u . C H E R N Y A K H O V S K A Y A 330

Special Report

W H O N O M E N C L A T U R E C O M M I T T E E : Nomenclature for Factors of the H L A System, 1990 334

Z E M M O U R , J . and P . P A R H A M : H L A Class I Nucleotide Sequences, 1991 3 4 7 M A R S H , S. G . E . and J . G . B O D M E R : H L A Class I I Nucleotide Sequences, 1991 3 6 9

Announcements 4 8 2

Author's Index

A L B E R O L A - I L A , J . 152

A L B E R T , E . D . 3 3 4

A R A G O N , A . 465

A R A N E G A , A . 4 4 0

A R N A i z - V I L L E N A, A . 465

ASKEW, D . 1

B A E H R , R . V O N 2 5 6

B A K E R , P . J . 100

B A K O , G . 405

BARBE, E . 88

BARBIERI , A . 3 0 7

B A U E R , J . 2 7 7

B E N C Z Ü R , M . 2 2

BEUSCHER, H . U . 2 9 2

B O D M E R , J . G . 334 , 3 6 9

B O D M E R , W. F . 3 3 4

BOOSFELD, E . 3 2

BREEDVELD, F . C . 1 1 7

BREVE, J . 2 7 7

BROEKHUIS-FLUITSMA,

D . M . 135

B U G , M . 197

BURGER, C . J . 1

BuSovA, B. 197 BUSSIERE, J . L . 2 0 5

B U T T I N , G . 5 6

CABRERA, T . 4 4 0

CALVES, M . J . 32

C H A B Y , R . 56

C H E R N Y A K H O V S K A Y A , I . Y u .

323 , 3 3 0

C O N C H A , A . 4 4 0

D A H A , M . R . 1 1 7

D A M O I S E A U X , J . G . M . C . 88

D E L E M A R R E , F . G . A . 70

D I E R I C H , M . P . 143, 3 0 7

DIJKSTRA, C . P . 88

D Ö P P , E . A . 88

D O L E Z A L , J . 178

D O R F , M . E . 1 1 D U P O N T , B. 3 3 4

ELGERT, K . D . 1

E R L I C H , H . A . 3 3 4

ESTALLER, C . 3 0 7

E X O N , J . H . 205

F A U N T L E R O Y , M . B. 100

FEIFEL, E . 3 0 7

F E R N A N D E Z , J . E . 4 4 0

FOKKENS, W. J. 135

F O N T A L I N , L . N . 3 2 3 , 3 3 0

FRIEDRICHS, D . 4 4 9

FÜGGER, R . 425

G A R R I D O , F . 4 4 0

GEMSA, D . 4 4

GERGELY, L . 405

G I R A R D , R . 56

G N A N T , F . X . 425

G Ö T Z I N G E R , P. 4 2 5

G Ö M E Z - R E I N O , J . J . 4 6 5

G O N G , J . - H . 4 4

G O O D , R . A . 1 6 1 , 325

G O R A N O V , I . 174

G R A N D I A , A. A . 127

GRUSCHWITZ, M . 2 3 4

G Y Ö D I , E . 2 2

H A M I L T O N , G . 4 2 5

H A S L 0 V , K . R . 100

H A Z E N B E R G , M . P . 127

H E R O L D , M . 22

HlEMSTRA, P . S. 1 1 7

H O C H S T E I N , H . D . 2 1 6

HOEFSMIT, E . C . M . 135

H O F B A U E R , S. 4 2 5

H R A B A , T . 178

H U B E R , C . 2 2

INGLES-ESTEVE, J . 152

ISHIKURA, H . 1 1

I W A B U C H I , C . 161

I W A B U C H I , K . 161

J A H N , S. 2 5 6

JANSE, E . M . 4 7 2

JEURISSEN, S. H . M . 4 7 2

J O H N S O N , J . P. 79

J U A N , M . D . DE 4 6 5

KAEVER, V . 2 6 6

K A L M A N , K . 405

K A R A D J O V A , M . 174

K A R A S H I M A , A. 4 1 4

KASSAI, M . 2 2

KOFLER, H . 2 3 4

K O I S T I N E N , V . 3 0 7

KORS, N . 7 0

K R A A L , G . 2 7 7

KRAMPS, J . A . 1 1 7

K U H N , F . 2 5 6

L E Ö V E Y , A . 405

L I V I N G S T O N , P. O . 32

L I Z A R D , G . 188

L O Z A N O , F . 152

M A C H , B . 3 3 4

M A R S H , S. G . E . 3 3 4 , 369

M A R T I N , F . 188

M A R T I N - V I L L A , J . M . 465

M A R T I N E Z - L A S O , J . 465

M A T H E R , G . G . 2 0 5

M A Y E R , K . 2 2

M A Y R , W. R . 3 3 4

M A Y U M I , H . 3 2 5

M E B I U S , R . E . 2 7 7

MESSER, G . 7 9

M I H A L I K , R . 2 2

M Ö L G G , M . 3 0 7

MuftozovA, H . 1 9 7 MYERS, K . R . 2 1 6

N A G Y , E . V . 4 0 5

N A I N , M . 4 4

N E G I S H I , I . 161

N E U H A U S , K . 2 5 6

N I K O L O V A , E . 174

N O M O T O , K . 4 1 4

O E T T G E N , H . F . 3 2

O G A S A W A R A , K . 161

O H G A M A , J . 161

O L D , L . J . 3 2

OLSSON, N . - O . 188

O N O E , K . 161

P A L Ö C Z I , K . 2 2

P A R H A M , P. 3 3 4 , 3 4 7

P A Z - A R T A L , E . 4 6 5

P E D R O N , T . 5 6

PELLETIER, H . 188

PEREZ-AciEGO, P. 465

PETERS, J . H . 4 4 9

PETRÄNYI , G . G . 2 2

P H A L E N T E , L . 5 6

PLACES, L . 152

P L A N A , M . 152

PöcsiK, E . 2 2 PRETTENHOFER, M . 425

Author's Index • 4 8 7

R A I C H E V A , P. 174

R E N Z , H . 4 4

RESCH, K . 2 6 6

RETT, M . 22

R I E T H M Ü L L E R , G . 7 9

RIJNTJES, E. 135

RITTER, G . 32

R O L L I N G HOFF, M . 2 9 2

RoVENSKY, J . 197

R U I Z - C A B E L L O , F . 4 4 0

RUPPERT, J . 4 4 9

Russ, G . 197

SASAZUKI, T . 3 3 4

SCHREUDER, G . M . T . 3 3 4

SCHWAEBLE, W . 3 0 7

SCHWINZER, R. 2 6 6

SEPP, N . 234

SETTMACHER, U . 2 5 6

SOLBACH, W . 2 9 2

SOMMERMEYER, H . 2 6 6

SPRENGER, H . 44

STADE, B . G . 79

STASHAK, P. W . 100

STAYKOVA, M . 174

STROMINGER, J . L . 334

SVEJGAARD, A. 334

SZABO, J . 405

T A N I G U C H I , K . 414

T A Y L O R , C . E . 100

TERASAKI , P. I . 334

TWISK, A. J . T . 277

U L R I C H , J . T . 216

V A N E M B D E N , j . P. A . 127

V A N D E N BERG, W . B . 127

V A N DER ZEE, R . 127 V A N R O O I J E N , N . 70

V I C A R I O , J . L . 465

VISSER, H . DE 127

VIVES, J . 152 V L C E K , F . 197

VOGETSEDER, W . 143

V O L K , H . - D . 256

VREEDE, T . M . DE 117

V R O O M , T . M . 135

W A G N E R , H . M . 292

WEISS, E . H . 307

W I C K , G . 234

W I N K L E R , D . F . 216

W U N D E R L I C H , J . R. 216

X u , H . 449

YOSHTKAI , Y . 414

Z E M M O U R , J . 347 Z O M M E R , A . 425

Subject Index

Accessory potency, monocyte differ­entiation 449

Actin-filaments, I C A M - 1 143 Allergy, Langerhans cells 135 Alloreactivity, macrophages 1 Antibody ED2, rat macrophages 88 Antibody response, dextran Bl355 . . . . 100 Antibody response, ganglioside 32 Antileukoprotease, endothelial cell de­

tachment 117 Arthritis, Mycobacterium tuberculosis . . 127

B cell proliferation, protein kinase C . . . 152 Bacterial lipopolysaccharide, cytotoxic

cells . . . . . . 216 BP-1 alloantigen, lymphoid and myeloid

lineages 56

Carcinogenesis, cyclosporine 205 C D 14, monocyte differentiation 449 C D 4 + lymphocyte dynamics, HIV-infec­

ted individuals 178 C D 4 + lymphocyte dynamics, model ba­

sed analysis 178 CD45 monoclonal antibodies, protein k i ­

nase C 152 Chicken embryo, non-lymphoid cell po­

pulations 472 Cholera toxin, T cell receptor complex . . 266 Class I I - M H C antigens, progressive sy­

stemic sclerosis 234 Cloning of complement factor H 307 Colonic cancer, cytotoxic activity of

lymphocytes 188 Colostral cells, M H C class I I expression . 174 Complement factor H , cloning and

c D N A expression 307 Corynebacterium parvum, natural de­

fense ativity 414 Cyclic GMP, tumor necrosis factor-a

gene expression 44 Cyclophosphamide, skin allograft toler­

ance 323 Cyclosporine, carcinogenesis 205 Cytotoxic activities, peripheral blood

lymphocytes 22 Cytotoxic activity of lymphocytes, tu­

mor variants 188 Cytotoxic cells, MHC-nonrestricted . . . 216

Dextran B1355, antibody response . . . . 100

Endothelial cell detachment, antileuko­protease 117

Endotoxin, liver transplant recipients . . 425 Fetal liver, human lymphocytes 256 Fibroblasts, ophthalmic Graves' patients . 405

Ganglioside, antibody response 32 Grass pollen allergy, Langerhans cells . . 135 Graves' patients, fibroblasts 405

Hapten-specific suppressor cells 11 Heat shock protein 127 High endothelial venules, sinus macro­

phages 277 HIV-infected individuals, C D 4 + lym­

phocyte dynamics 178 H L A class I and I I expression, Rhabdo­

myosarcomas 440 H L A class I , nucleotide sequences . . . . 347 H L A class I I , nucleotide sequences . . . 369 H L A markers, systemic lupus erythema­

tosus 465 H L A system nomenclature 334 H L A - D P antigens, psoriasis vulgaris . . . 197 Human lymphocytes, characterization . . 256

I C A M - 1 gene, structural characteristics . 79 I C A M - 1 , actin-filaments 143 IL-4, monocyte differentiation 449 Immune responses, cyclosporine 205 Intercellular adhesion molecule-1 . . . . 143 Interferon-y, Leishmania major 292 lnterleukin 1, Leishmania major 292 Interleukin-6, liver transplant recipients . 425

Langerhans cells, grass pollen allergy . . . 135 Leishmania major, immune response . . . 292 Leukocyte-mediated endothelial cell de­

tachment 117 Liver transplant recipients, tumor necro­

sis factor-a and Interleukin-6 425 Lymph node macrophages, elimination . 70 Lymph node, sinus macrophages 277 Lymphoid and myeloid lineages, BP-1

alloantigen 56 Lymphoid tissues, M E L - 1 4 + cells . . . . 161

Macrophages, alloreactivity 1 Macrophages, lymph node 277 Macrophages, monoclonal antibody

ED2 88 Macrophages, tumor-bearing host . . . . 1

Subject Index • 489

M E L - 1 4 + cells, lymphoid tissues 161 Melanoma cells, Cory nebacteri urn

parvum 414 M H C class I I expression, colostra! cells . 174 MHC-nonrestricted cytotoxic cells, bac­

terial lipopolysaccharide 216 Monocyte differentiation, CD14 449 Mouse stem cells 56 Mycobacterial heat shock protein . . . . 127 Mycobacterium tuberculosis, arthritis . . 127

Natural defense activity, Corynebacte­rium parvum 414

NK-susceptible B16 melanoma cells . . . 414 Non-lymphoid cell populations, chicken

embryo 472 N o n - M H C restricted cytotoxic activi­

ties 22 Nucleotide sequences, H L A class I . . . . 347 Nucleotide sequences, H L A class I I . . . 369

Ophthalmic Graves' patients, fibroblasts 405

Particulate antigens, lymph node macro­phages 70

Peripheral blood lymphocytes, cytotoxic activities 22

Progressive systemic sclerosis, class I I -M H C antigens 234

Prostaglandin E 2 , tumor necrosis factor-ex gene expression 44

Protein kinase C, B cell proliferation . . . 152

Proteinase inhibitors 117 Psoriasis vulgaris, H L A - D P antigens . . 197

Resident rat macrophages, antibody ED2 . !" 88

Rhabdomyosarcomas, H L A class I and I I expression 440

Sinus macrophages, high endothelial ve­nules 277

Skin allograft tolerance, cyclophospha-mide-induced 323

Spleen macrophages, effect on the im­mune response 70

Spleen, human lymphocytes 256 Suppressor cells, thymic stromal cells . . 11 Systemic lupus erythematosus, H L A

markers 465

T cell receptor complex, cholera toxin . . 266 T cell receptor complex, loss 266 T cells, antibody response to dextran

B1355 100 Thymic stromal cells, suppressor cells . . 11 Tolerance, cyclophosphamide-induced . 323 Transferrin receptor expression, colostral

cells 174 Tumor necrosis factor-a gene expression,

prostaglandin E 2 44 Tumor necrosis factor-a, liver transplant

recipients 425 Tumor variants, cytotoxic activity of

lymphocytes 188 Tumor-bearing host, macrophages . . . . 1

ImmunobioL, vol. 182, pp. 307-322 (1991)

' I ns t i tu t für Hygiene, Innsbruck, Austria, 2 Institut für Immunologie, München , Germany, and 3 Red Cross Blood Transfusion Center, Helsinki, Finland

Human Complement Factor H : Molecular Cloning and cDNA Expression Reveals Variability in the Factor H -Related mRNA Species of 1.4 kb

W I L H E L M SCHWAEBLE 1 " , ELISABETH FEIFEL 1 , C O R N E L I A ESTALLER 2 , A N T O N I A BARBIERI *, M A R T I N M Ö L G G 1 , VESA K O I S T I N E N 3 , ELISABETH H . WEISS 2 , and M A N F R E D P. D I E R I C H 1

Received December 21, 1990 • Accepted in Revised Form February 18, 1991

Abstract

Previously, we have shown that three different m R N A species of 4.3 kb, 1.8 kb and 1.4 kb, related to human complement factor H , are constitutively expressed in the human liver. Probing w i t h our c D N A clone H-46 which represents 920 bp of the 3' end of the 4.3 kb m R N A of factor H on human liver R N A , we always detected the 4.3 kb and the additional, abundantly expressed m R N A species of 1.4 kb in length, indicating that the 1.4 kb transcript is highly homologous to the 3' end of the classical factor H m R N A of 4.3 kb. Using H-46 as a probe, several c D N A clones were isolated from a liver c D N A library and sequenced. The open reading frame of the novel m R N A species encodes a peptide consisting of five internal short consensus repeat motifs (SCR), identifying the translational product to be a member of the SCR family. Sequence comparison wi th c D N A clones derived from liver R N A of a different donor provided evidence for variability in the factor H related proteins encoded by the 1.4 kb m R N A species.

Interestingly, this variability was found to be restricted to the three carboxyterminal SCR domains. Expression data indicate that our variant is not recognized by the monoclonal antibody 3D11.

Introduction

Factor H is a regulatory protein of the complement system which controls the alternative pathway of complement activation by competing for the interaction of C3b wi th factor B and dislodging the Bb fragment of factor B from the active alternative pathway convertase (C3bBb) (1-3).

Factor H also serves as a cofactor for factor I in the conversion of C3b to inactivated C3b, iC3b (4). The binding site for C3b has been located on a

"'Recipient of a fellowship from «Deutscher Akademischer Austauschdienst» Sonderpro­gramm Gentechnologie.

: : : : 'This study was supported by a grant from the Austrian F W F (P6920), is a part of E . F I : I I I-L'S, C. ESTALLER'S and M . M Ö L G G ' S Ph.D. thesis and of A . BAKBIERI 'S M . D . thesis.

308 • WlLHIiLM SCH\VAI£BLI£ et al.

M r 38,000 aminoterminal fragment obtained by limited tryptic digestion of the major M r 150,000 factor H serum protein (5).

In addition, this M r 38,000 fragment shows a cofactor activity in the factor I-mediated conversion of C3b to iC3b, while the remainder of the molecule is inactive in this respect (6).

For human factor H three different m R N A species are abundantly expressed in liver: 4.3 kb, 1.8 kb and 1.4 kb (7). The 4.3 m R N A codes for the major factor H serum protein of M r 150,000 - termed H gp!50 - and has been completely sequenced (8, 9). The sequence analysis of the 1.8 kb m R N A showed that this species is largely identical to the 5' portion of the 4.3 kb m R N A (8-11). A partial analysis of the factor H gene strongly suggests that the 1.8 kb and the 4.3 kb m R N A arise by alternative splicing from a single structural gene (12).

Factor H has been shown to be highly homologous to other regulatory proteins of the complement system such as the C4 binding protein (C4bp), the decay accelerating factor (DAF), the membrane cofactor protein (MCP) and the complement receptors type 1 (CR1) and type 2 (CR2). Characteris­tically, the amino acid sequence of these proteins has a structure of numerous internal domains, termed «short consensus repeats» (SCR). Each SCR covers a stretch of approximately 60 amino acids with a framework of four completely conserved cysteine residues along with highly conserved residues for glycine, tryptophan, tyrosine and proline (13-15).

The translational product of the 4.3 kb m R N A - Hgpl50 - is composed of twenty such SCRs, while the 1.8 kb m R N A encodes the first seven repeating units of the aminoterminal portion of Hgpl50, plus four unique amino acids at the COOH-terminal sequence. The genes encoding factor H and the other above-mentioned complement regulatory proteins have been localized to chromosome 1 forming a tightly linked gene cluster named the RCA (regulation of complement activation) cluster (16).

Recently, we identified a novel truncated factor H protein as the likely translational product of the 1.8 kb m R N A in fresh human plasma by Western blot analysis with monoclonal and polyclonal antibodies directed against the aminoterminal portion of H (7).

After purification by combined affinity chromatography and HPLC, we were able to show that this novel truncated factor H serum protein also has cofactor activity for the cleavage of C3b (17). The identity of this novel, truncated factor H protein with the translational product of the 1.8 kb m R N A was confirmed by eucaryotic expression of a full length c D N A clone of the 1.8 kb factor H m R N A species (9).

We have previously shown that in human liver R N A , a third factor H related m R N A species of 1.4 kb strongly hybridizes to our c D N A clone H-46 (H-46 represents 920 basepairs of the 3' end of the 4.3 kb mRNA) . This m R N A species is only detectable in liver tissue, while the 4.3 kb and the 1.8 kb mRNA species of factor H are also expressed in fibroblasts, monocytes, endothelial cells and lung tissue (18).

Factor H-Related 1.4 kb m R N A Species • 309

In this report, we present a novel nucleotide sequence (H-69) for this factor H-related m R N A species and compare the sequence to other c D N A transcripts which we isolated in parallel from a different c D N A library (19). Procaryotic expression indicates that the significant variation observed for the factor H-related 1.4 kb m R N A leads (in the case of H-69) to a loss of the epitope recognized by monoclonal antibody 3D 11 which was shown to react wi th the classical factor H molecule of M r 150,000 and the two polypeptides encoded by the other variants of this factor H-related 1.4 kb m R N A species.

Materials and Methods

cDNA cloning and sequencing of H-69 and H-69/2

The c D N A clone H-69 was isolated from a commercially available human liver c D N A library in X-gtl0 (Clontech, Palo Al to , C A , USA) which was screened wi th our factor H -specific c D N A clone H-46. c D N A clone H-69/2 was isolated from a human liver primer extension c D N A library in which the oligo dT primer was replaced by a 21 bp long oligonucleotide, termed oligo 1.4/1,(3' G C C CCG A C C A G G T G G G G A G G G 5') derived from H-69 (see Fig. 2) to initiate the synthesis of the first strand. For the c D N A synthesis, poly ( A + ) R N A was selected from total R N A preparations of human liver tissue using the « m R N A Purification Kit» (Pharmacia, Freiburg, Germany). First and second strand synthesis was carried out using the «You-Prime c D N A Synthesis Kit» (Pharmacia). Double-stranded c D N A was subcloned in X.-gt 10 using the « c D N A cloning systemA-gtl0» (Amersham, Aylesbury, U K ) . The library was screened with a second 18 bp long oligonucleotide, termed oligo 1.4/2, (3* C T A C A C A A A C A G G A C T T C 5 ' ) derived from H-69 5 to oligo 1.4/1. From five hybridizing plaques, H-69/2 showing the largest c D N A insertion was analyzed further. The c D N A insertions contained in H-69 and H-69/2 were amplified in a polymerase chain reaction (PCR) using «X-gtl0 Screening Amplimer sets» (Clontech). They were then digested with either EcoRI , or EcoRI and Rsal, or EcoR I and Hind I I I and subcloned into M13 for sequencing by the Sanger dideoxy chain termination method (20). The sequencing strategy chosen for H-69 and H-69/2, is shown in Figure 1. Sequencing of H-69 and H-69/2 was performed with T7 polymerase and the reagent kit (Pharmacia).

Northern blot analysis

From human liver tissue, R N A was prepared according to the method of CHIRCAVIN et al. (21). Twenty (ig of total R N A was separated on a formaldehyde-containing agarose gel and blotted to Hybond N nylon filters (Amersham). Agarose gel electrophoresis, R N A transfer and hybridization of the blots were done by standard techniques (20). The D N A probes were labeled with P" -dATP using the random priming method (22).

The probes utilized in these studies are H-69/2 (coding for the novel 5' sequence of the factor H related 1.4 kb m R N A ) , a 292 bp Hind I I I subfragment of H-69 (representing the 3' end of H-69), and a 718 bp long A l u l subfragment of the factor H specific c D N A clone R2a (8) which codes for SCR domains 12-16.

Hybridization was performed at 65 °C in the absence of formamide. The final washing step was done in 0.1 xSSC for 1 h at 65 °C.

Procaryotic and eucaryotic expression and Western blot analysis

For procaryotic expression, the c D N A contained in H-69 was digested with EcoRI , yielding a 1060 bp-long subfragment of H-69 which encodes, wi th the exception of 13 aminoterminal amino acids, the mature translational product of the 1.4 kb m R N A species.

310 • W I L H E L M SCHWAEBLE et al.

This fragment was subcloned into the EcoRI site of the procaryotic expression vector pAX (23). The expression of clone p A X - H - 6 9 , containing the EcoRI fragment of H-69 in the correct reading frame and orientation, was induced by adding 1 ml of a 100 m M isopropyl-ß-D-thiogalactoside solution (IPTG) to a 100 ml bulk culture for at least 3 h before harvesting.

The expression of the fusion protein encoded by H-46 (which was isolated from a human liver library cloned in the procaryotic expression vector pEX2 (11)) was induced according to the method by STANLEY and L u z i o (24) by shifting a bulk culture of H-46 to 42 °C for 90 min. The bacteria were pelleted and lysed in 1/10 of the original volume of 50 m M TRIS/HC1 p H 6.8 containing 5% SDS, 1 % mercaptoethanol, 10% glycerol.

The eucaryotic expression of the c D N A clone pFH1.4a was achieved by COS-cell transfec-tion. Therefore, pFH1.4a and the vector C D M 8 as control D N A were transfected into COS cells by electroporation using the «Gene PulserTM apparatus» (Bio-Rad, Munich, Germany) following the recommendations of the supplier. Briefly, 0.8 ml of COS cell suspension (1 x 107

cells/ml) were mixed with 60 jig D N A . Electroporation was performed in 272 m M sucrose, 7 m M N a 2 H P 0 4 p H 7.4 and 1 m M M g C l 2 with 380 V and 250 F in the cold. The cells were then diluted with DMEM/25 m M HEPES medium containing 10 % FCS and cultured in 9 cm petri dishes. After 24 h, the medium was changed to D M E M containing 1 x Nutridoma H U (Boehringer Mannheim). Supernatants were collected 72 h after the pulse, concentrated 20-fold, and assayed for the expression the translational product of 1.4 kb m R N A .

For Western blot analysis, 80 ui of concentrated supernatant of COS cell transfectants, 2 u.1 of serum and 20 ul of the bacterial lysates were electrophoresed on a 7.5% SDS-polyacryl-amide gel and blotted to nitrocellulose according to the method of T O W B I N et al. (25).

Individual lanes were stained with mAb 3D11 and a polyclonal goat anti-factor-H-antibody using peroxidase-conjugated anti-mouse IgG and peroxidase-conjugated anti-goat IgG, respectively, according to standard procedures.

Results

cDNA cloning and sequencing of H-69 and H-69/2

To isolate c D N A clones representing the unknown factor H related m R N A species of 1.4 kb, H-46 was used to screen a human liver c D N A library in \-gt\0. From 60,000 plaques, twenty hybridizing clones were isolated. From these, c D N A insertions were amplified in a polymerase chain reaction (PCR) using oligonucleotides corresponding to the poly-linker region of X-gtl0. Amplified inserts were digested with EcoRI, subcloned in the bacteriophage M l 3 and sequenced from both ends (see Fig. I ) . From those, nineteen were identified to be incomplete transcripts of the known 4.3 kb mRNA, while one - designated H-69 - was shown to have a 35 portion almost identical to that of the 4.3 kb mRNA, preceded by a unique 5* portion with only a slight degree of homology to the sequence of factor H (see Fig. 2).

Since neither a 5' untranslated region nor a translational start codon was contained at the 5' end of H-69, we used an oligonucleotide (3* GCC CCG A C C A G G T G G GGA GGG 5') corresponding to the 5' portion of the H-69 sequence for a primer extension c D N A synthesis in order to obtain a c D N A covering the full length of the 1.4 kb m R N A species. One primer extension clone, termed H-69/2, was sequenced extending the 5' end of H-69 for a length of 166 bp (see Fig. 1).

Factor H-Related 1.4 kb m R N A Species • 311

H-69 /2

3'

> 4 •

4

• 4-• Figure 1. Subcloning and sequencing strategy used for the sequence analysis of the c D N A clones H-69/1 and H-69/2. The arrows mark the extent and direction of the D N A sequence determination below the restriction map wi th the following enzymes: E = EcoRI ; R = Rsal; H = Hind I I I . H-69/1 and H-69/2 overlap for a stretch of 270 bp.

H-69 /1

The complete nucleotide sequence and the derived amino acid sequence, encoded by the c D N A clones H-69 and H-69/2 are shown in Figure 2. The combined nucleotide sequence of 1173 bp revealed an open reading frame of 993 bp starting with A T G at position 22 and ending with a stop codon (TAG) at position 1012. The coding sequence of the 1.4 kb m R N A covered by H-69 and H-69/2 is flanked by a 5' and a 3' untranslated region of 21 and 162 nucleotides, respectively. The 3' untranslated region includes a poly-adenylation signal ( A T T A A A ) located 40 nucleotides downstream from the translational termination codon. With exception of four nucleotide exchanges and one insertion (see Fig. 2), the sequence of the 3* untranslated region of H-69 is identical to the 3' untranslated region of the 4.3 kb m R N A species of factor H , represented by H-46 .

Moreover, the sequence homology extends into the protein coding region which is nearly identical for a stretch of 557 bp encoding the three SCR domains SCR 18, 19, 20 of classical factor H (see Fig. 2). Regarding the criteria given by V O N H E I J N F (26), the peptide sequence, encoded by the open reading frame of the 1.4 kb m R N A species, indicates an 18 amino acid-long leader peptide prior to the 312 amino acids of the mature protein.

Including the leader sequence, the molecular weight for the primary translational product was calculated to be 37,663 and 35,750 for the mature protein, respectively. As shown in Figure 3, the mature protein is composed of five approximately 60-amino acid-long short consensus repeats (SCR) which are typically observed in complement regulatory proteins (13-16). The three carboxyterminal SCRs of the protein encoded by H-69 and H -69/2 show five amino acid exchanges in comparison to the carboxyterminal SCR's of the major M r 150,000 factor H protein, namely SCR-18-20. In

312 WlLHliLM SCHWAI-BLI-: et al.

comparison, only a low degree of homology was observed between the SCRs 6 and 7 of the classical factor H protein of M r 150,000 and the two novel SCR domains 1 and 2 of the aminoterminal portion of the protein encoded by the 1.4 kb mRNA.

Interestingly, the derived amino acid sequence of H-69 contains only one potential glycosylation site (NIS) in position 108, while the two other variants of the 1.4 kb m R N A (pFH1.4a and b) and H-46 (representing the 4.3 kb m R N A species) encode an additional, potential glycosylation site (NWT) in position 176.

M W L L V S V I L I S R I H-69 ATAAGATTGGAACTACCAAGCATGTGGCTCCTGGTCAGTGTAATTCTAATCTCACGGATA 60 pFH1.4a 96

1 10 S S V G G E A T F C D F P K I N H G I L

H-69 TCCTCTGTTGGGGGAGAAGCAACATTTTGTGATTTTCCAAAAATAAACCATGGAATTCTA 12 0 pFH1.4a 156

20 30 Y D E E K Y K P F S Q V P T G E V F Y Y

H-69 TATGATGAAGAAAAATATAAGCCATTTTCCCAGGTTCCTACAGGGGAAGTTTTCTATTAC 18 0 pFH1.4a 216

40 50 S C E Y N F V S P S K S F W T R I T C T

H-69 TCCTGTGAATATAATTTTGTGTCTCCTTCAAAATCATTTTGGACTCGCATAACATGCACA 24 0 pFH1.4a 276

60 70 E E G W S P T P K C L R L C F F P F V E

H-69 G AAGAAGGATGGTCACCAACACCAAAGTGTCTCAGACTGTGTTTCTTTCCTTTTGTGGAA 300 pFH1.4a 336

80 90 N G H S E S S G Q T H L E G D T V Q I I

H-69 AATGGTCATTCTGAATCTTCAGGACAAACACATCTGGAAGGTGATACTGTGCAAATTATT 3 60 pFH1.4a 396 o l i g o 1.4/2

100 110 C N T G Y R L Q N N E N N I S C V E R G

H-69 TGCAACACAGGATACAGACTTCAAAACAATGAGAACAACATTTCATGTGTAGAACGGGGC 420 pFH1.4a 456 o l i g o GCCCCG 1.4/1

120 130 W S T P P K C R S T D T S C V N P P T V

H-69 TGGTCCACCCCTCCCAAATGCAGGTCCACTGACACTTCCTGTGTGAATCCGCCCACAGTA 4 8 0 pFH1.4a 516 H-46 C 216 o l i g o ACCAGGTGGGGAGGG 1.4/1

140 150 Q N A H I L S R Q M S K Y P S G E R V R

H-69 CAAAATGCTCATATACTGTCGAGACAGATGAGTAAATATCCATCTGGTGAGAGAGTACGT 54 0 pFH1.4a T G 576 H-46 T G 276

Y V 160 170

Y Q C R S P Y E M F G D E E V M C L N G H-69 TATCAATGTAGGAGCCCTTATGAAATGTTTGGGGATGAAGAAGTGATGTGTTTAAATGGA 600 pFH1.4a 636 H-46 336

Figure 2. Nucleotide and deduced amino acid sequence of c D N A clones H-69 and H-69/2 in comparison with another variant of the human factor related 1.4 kb m R N A species (pFHl .4a) and the 4.3 kb mRNA. species represented by our c D N A clone H-46.

Factor H-Related 1.4 kb m R N A Species • 313

Northern blot analysis with H-69 and H-69/2 and fragments specific for the related 1.4 and the 4.3 kb mRNA species of factor H

To examine whether H-69 is a faithful transcript of the 1.4 m R N A species, we established 3' and 5' specific subfragments of H-69 to probe human liver RNA.

A 3' specific subfragment was isolated by using an internal unique Hind Ill-restriction site in position 882 resulting in a 292 bp 3' fragment.

180 190 N W Q E P P Q C K D S Q G K C G P P P P

H-69 AACTGGCAGGAACCACCTCAATGCAAAGATTCTCAGGGAAAATGTGGGCCCCCTCCACCT 660 pFH1.4a AC AC 696 H-46 AC ACA 396

T T 200 210

I D N G D I T S F P L S V Y A P A S S V H-69 ATTGACAATGGGGACATTACTTCATTCCCGTTGTCAGTATATGCTCCAGCTTCATCAGTT 720 pFH1.4a 756 H-46 456

220 230 E Y Q C Q N L Y Q L E G N K R I T C R N

H-69 GAGTACCAATGCCAGAACTTGTATCAACTTGAGGGTAACAAGCGAATAACATGTAGAAAT 780 pFH1.4a 816 H-4 6 516

240 250 G Q W L E P P K C L H P C V I S R E I M

H-69 GGACAATGGCTAGAACCACCAAAATGCTTACATCCGTGTGTAATATCCCGAGAAATTATG 84 0 pFH1.4a TC 876 H-46 TC 576

S 260 270

E N Y N I A L R W T A K Q K L Y L R T G H-69 GAAAATTATAACATAGCATTAAGGTGGACAGCCAAACAGAAGCTTTATTTGAGAACAGGT 900 pFH1.4a 936 H-46 C 636

280 290 E S A E F V C K R G Y R L S S R S H T L

H-69 GAATCAGCTGAATTTGTGTGTAAACGGGGATATCGACTTTCATCACGTTCTCACACATTG 9 60 pFH1.4a T 996 H-46 T T 696

V 300 310

R T T C W D G K L E Y P T C A K R * H-69 CGAACAACATGTTGGGATGGGAAACTGGAGTATCCAACTTGTGCAAAAAGATAGAATCAA 102 0 pFH1.4a 1056 H-46 756

H-69 TCATAAAATGCACACCTTTATTCAGAACTTTAGTATTAAATCAGTTCTTAATTTCATTTT 1080 pFH1.4a A 1116 H-46 G C 816

H-69 TAA-GTATTGTTTTACTCCTTTTTATTCATACGTAAAATTTTGGATTAATTGGTGAAAATG 114 0 pFH1.4a T 1176 H-46 .T.T T 876

H-69 TAATTATAAGCTGAGACCGGTGGCTCTCTTCTT 117 3 pFH1.4a 1209 H-46 936 The sequences corresponding to the oligonucleotides oligo 1.4/1 (used for the primer extension c D N A synthesis of H-69/2) and oligo 1.4/2 (used for screening the primer extension c D N A library) are marked.

MWLLVSVILISRISSVGG EATfß-Dfftl—

RL:

TS

DSQGK:

FP-FVE--

:i/-N"TVQ

MGILYDEEKYKPFS

GH--

HlftHIL-

GDIT—S 7PLSV-

J-ESSGQTHLEGDTV3II

•QVP-TG-WYYSE

•PSGERVRYQ-

yhP-ASSI/EYQ

HP: VISREIMENY IALRWTAKQKL YOTSAEFV-CKRGYUSSRSHTL--RTT: J)GKLEY3

ICf\KR 20

-E-MFVSPSKSFWTRIT:TEE

fcWLY

NNENNIS-

(BMFGDEEVM--

-QLEGNK--RIT:RN-G3(I

UER

LN

-SPTPC

—STP3

<

--QEPP3

--LEP3

<

1'

fcSTD 2'

18

19

Figure 3. Assignment of the protein sequence derived from H-69 and H-69/2 to five homology subunits of about 60 amino acids each. Identical amino acids present in several of the five homologous regions are boxed. Gaps denoted by «-» have been introduced to maximize homology and to allow space for the regions with short inserted sequences. The potential glycosylation site (NIS) in position 108 is underlined.

Factor H-Related 1.4 kb m R N A Species -315

h u m a n l i v e r RNA

9.5 >

7.5 >

4.4 >

2.4 >

1.4

kb

a b c

Figure 4. Northern blots of human liver R N A hybridized with different c D N A fragments. Twenty ug of total R N A each was separated on an agarose gel. Lane a was hybridized with H -69/2 coding for the novel 5' sequence of the 1.4 kb m R N A species. Lane b was hybridized with a 292 bp long Hind I I I restriction fragment representing the 3' coding and the 3' untranslated region of H-69. Lane c was hybridized with a 718 bp A l u I fragment representing the coding region for SCR 12-16 of the 4.3 kb m R N A of factor H .

This subfragment completely represents the 3' untranslated region in addition to 130 bp of the SCR 20 coding region of H-69. This 3 J fragment of H-69 hybridizes with both, the 4.3 and the 1.4 kb m R N A species (see Fig. 4, lane b). This result confirms the c D N A sequencing data showing that both mRNA species share the same 3* region.

Probing primer extension clone H-69/2 (coding for the novel 5' sequence of the 1.4 kb derived c D N A ) on total liver R N A , we exclusively detected the 1.4 kb m R N A species (see Fig. 4, lane a). This result shows that the 1.4 kb mRNA must have given rise to the unique 5' sequence linked to a segment which is shared by both, the 4.3 kb factor H m R N A and related 1.4 kb m R N A species.

Further confirmation for the direct linkage of SCR 1 and 2 of the 1.4 kb mRNA to the conserved sequence of SCR 18, 19 and 20 was obtained by probing with a subfragment of the 4.3 kb c D N A (718 bp A l u l fragment)

316 • W I L H E L M S C H W A L B L L et al.

representing the coding region for SCR domains 12 to 16 (see Fig. 6). This probe exclusively hybridizes with the 4.3 kb and not with the 1.4 kb m R N A species (see Fig. 4, lane c).

Thus, the Northern blot results confirm that H-69 and H-69/2 are faithful reverse transcripts of the 1.4 kb m R N A species sharing a nearly identical 3' portion with the 4.3 kb long factor H mRNA, followed by a novel 5' portion of 456 nucleotides.

Procaryotic expression and Western blot analysis of the recombinant proteins encoded by H-69 and H-46

For procaryotic expression, H-69/1 was subcloned into the EcoR I site of the procaryotic expression vector p A X 4 C .

Clone pAX-H-69, which was shown to contain the insertion in the correct reading frame and orientation, was used for expression of the ß-galactosidase/H-69 fusion protein. In parallel, the expression of the fusion protein encoded by H-46 (cloned in pEX2 (11)) was induced according the method by STANLEY and Luzio (24).

1 2 3 4 5 6 7 8 9

Figure 5. Western blot analysis of the translational products encoded by different variants of the 1.4 kb m R N A species, the 3' coding region of the 4.3 kb m R N A of factor H , and of the translational products represented in human plasma. In lanes l and 4, bacterial lysate and the galactosidase encoded by pEX2 (lane l ) and p A X C4 (lane 4) were exposed to a polyclonal anti-factor H-antibody as a negative control. The fusion protein encoded by H-46 was stained with the polyclonal (lane 2) and the monoclonal anti-factor-H-antibody mAb 3D 11 (lane 3) while the fusion protein encoded by pAX-H-69 was only stained with the polyclonal antibody (lane 5), but not with m A b 3 D l l (lane 6). In lane 8, concentrated supernatant from COS cells transfected with pFH1.4a was stained with m A b 3 D l l , while supernatant from COS cells transfected with the vector C D M 8 alone remained blank (lane 7). In lane 9, 2 id of human plasma were stained with m A b 3 D l l .

Factor H-Related 1.4 kb m R N A Species -317

SCR

1 2 3 4 5 6 7 8 9 1 0 11 1 2 1 3 14 15 16 17 18 1 9 2 ° i l pCH 4.3

H -46 j 7 " 2 3 4 5 6 7 I i pCH 1.8

- f r a g m e n t of pCH 4.3

A lu I A lu

V 2' 18 19J20JHI

H-69

H - 6 9 / 2

H ind III EcoR

• u n t r a n s l a t e d r e g i o n s - f r a g m e n t of H - 6 9

Figure 6. Diagram of the three m R N A species related to human factor H . The specific untranslated regions and the SCR repeat units encoded by the different m R N A species are boxed. The c D N A clones (pCH4.3 and H-46 for the 4.3 kb m R N A , pCH1.8 for the 1.8 kb m R N A , H-69 and H-69/2 for the 1.4 kb m R N A ) and subfragments representing the different m R N A species are marked as lines.

After induction, the bacteria were lysed and the total lysate was separated on a 7.5 % SDS-polyacrylamide gel. To exclude any possible crossreactivity of the antibodies used with ß-galactosidase or bacterial polypeptides in the Western blot analysis, proteins were also prepared from a p A X C 4 clone and a pEX2 clone without any c D N A insertion. As a positive control, human plasma was collected from four different donors in presence of 0.5 mM PMSF, 5 m M E D T A and 50 m M 6-aminohexanoic acid (EACA) to prevent any possible protein degradation. As shown in Figure 5, the polyclonal antibody stained both fusion proteins encoded by H-46 and pAX-H-69 while the extracts of the vector recombinant bacteria remained blank.

In contrast, the monoclonal antibody 3D 11 only stained the fusion protein generated by H-46, but not the fusion protein of pAX-H-69 (Fig. 5, lanes 3 and 6). Again, the negative controls remained blank whereas, m A b 3 D l l stained the classical M r 150,000 factor H protein, the two polypeptides of M r 37,000 and 39,000 in human plasma, and the eucaryotic expression products of pFH1.4a, which is a full length c D N A clone of the

318 • Wii.Hi ;.i.M SCHWAHUI.I : et al.

1.4 kb factor H mRNA, but differs in five amino acid residues from the H-69 sequence (see Fig. 5).

Discussion

The Northern blot analysis and the c D N A sequencing have confirmed that the overlapping c D N A clones H-69 and H-69/2 represent faithful reverse transcripts of a novel factor H-related mRNA species of 1.4 kb, which is abundantly expressed in human liver. The open reading frame of H-69 codes for a peptide with one potential N-glycosylation site (NIS) in position 108. For the nonglycosylated, mature protein, the molecular weight was calculated to be 36,000. The primary structure of this protein is comprised of five SCR domains. The three carboxyterminal repeats are nearly identical with the carboxyterminal sequence of the major factor H protein of Mr 150,000. The sequence coding for the two novel aminotermi­nal SCR domains was shown to be unique for the 1.4 kb m R N A species in human liver by probing with primer extension c D N A clone H-69/2.

In parallel to this work, we describe full length c D N A clones (pFH1.4a-f) derived from the 1.4 kb m R N A species which code for two distinct, presumably allelic transcripts (19).

The clone described here was isolated from a different c D N A library and differs from the pFH1.4 clones and the 4.3 kb factor H transcript in the three carboxyterminal SCR domains and the 3' untranslated region (Table 1). Thus, this c D N A represents another variant of the factor H-like protein encoded by the 1.4 kb mRNA species.

Interestingly, no differences were observed in the 5' sequence of the 1.4 kb m R N A coding for the two unique N-terminal domains, and no variation was found in the sequence of the different c D N A isolates representing the 4.3 kb m R N A (H-46, this paper; R2a (8); pFH4.3 (9)). The derived amino acid sequence of H-69 differs in three positions to the peptide sequence encoded by pFH1.4b, and in five amino acid residues to the peptide encoded by pFH1.4a (see Table 1). Although the pFH sequences share two potential aminoglycosylation sites in position 108 and 176 with classical factor H , the variant encoded by H-69 has only the recognition sequence

Table 1. Amino acid exchanges caused by nucleotide substitutions within three different variants of the factor H related 1.4 kb m R N A species and the 3' portion of the 4.3 kb m R N A of factor H (H-46)

Pos. 139 Pos. 141 Pos. 178 Pos. 187 Pos. 239 Pos. 278

pFH1.4a T A T = T y r GTG=Val A C G = T h r A C G = T h r TCA=Ser GCT=Ala pFH1.4b C A T = H i s CTG=Leu A C A = T h r A C G = T h r TCA=Ser GCT=Ala H-69 C A T = H i s CTG=Leu C A G = G l n C A G = G l n CTA=Leu GCT=Ala H-46 T A T = T y r GTG=Val A C G = T h r A C A = T h r TCA=Ser GTT=Val

Factor H-Related 1.4 kb m R N A Species • 319

( N W Q instead of N W T ) in position 176. It is likely that the function of the three carboxyterminal repeats in the polypeptides encoded by the 1.4 kb m R N A species differs from the one carried by the carboxyterminus of classical factor H .

From a mouse liver c D N A library, four different classes of factor H related transcripts have recently been isolated and sequenced (27). Like the factor H related 1.4 kb m R N A species in man (18), these transcripts were found to be exclusively expressed in R N A preparations from liver tissue while the 4.4 kb factor H m R N A species of the mouse is also expressed in kidney, spleen, thymus and L cells (28).

With respect to the functional importance of the protein encoded by the human 1.4 kb mRNA species, it was of interest to learn that one of these factor H-related transcripts of the mouse, represented by the c D N A clone 13G1, shows remarkable similarities to the human 1.4 kb m R N A species:

(i) Similar to the reported human 1.4 kb mRNA species, the m R N A which has given rise to 13G1, encodes a peptide of similar size consisting of five SCR motifs. The two aminoterminal domains were shown to be unique while the three following SCRs have stringent homology to the carboxyter­minal domains of the mouse classical factor H . In contrast to the human factor H related transcript, the protein encoded by 13G1 contains two SCR repeats homologous to SCR 19 of the classical factor H followed by one SCR 20 homologous domain.

(ii) As observed for the 1.4 kb m R N A in man, c D N A 13G1 shares a nearly identical 3' untranslated region with the 4.4 kb factor H mRNA. However, both use a different 5' untranslated region and leader sequence. Nucleotide and amino acid sequence comparison of the human and the mouse mRNA species shows that the polypeptide sequence is more con­served than the nucleotide sequence.

The polypeptide encoded by H-69 was investigated by the expression of a fusion protein (pAX-H-69) in E. coli in comparison with the homologous fragment of similar size derived from the carboxyterminus of the classical factor H c D N A (H-46 representing SCR 17-20). Whereas a polyclonal anti-factor-H-antibody detected both fusion proteins in a Western blot analysis, the monoclonal antibody 3D11 only stained the fusion protein of H-46, but not the fusion protein encoded by pAX-H-69. When mAb 3D11 was used to look for a translational product of the 1.4 kb m R N A species in human plasma, classical factor H of M r 150,000 and in addition, two bands with a Mr of 39,000 and 37,000 were stained (see Fig. 5). This doublet was also seen with polyclonal antibodies directed against H and was detected regardless of whether the samples were run under reducing conditions or not. Moreover, the eucaryotic expression of both pFHl .4 variants (pFH1.4a and b) resulted in the synthesis of the two polypeptides of M r 39,000 and 37,000 which were stained with mAb 3D11 (19). We therefore assume that the two smaller polypeptides detected in human plasma by mAb 3D 11 and polyclonal antibodies are encoded by the factor H related 1.4 kb mRNA species and that the epitope recognized by mAb 3D 11 must

320 • W I L H E L M SCHWAKKLL et al.

be localized on SCR 18-20. The mAb 3D11 failed to bind to the fusion protein encoded by pAX-H-69 whereas a similar fragment of classical factor H expressed with the same fusion partner and the eucaryotic expression products of pFHl.4a/b were stained, indicates that this reagent does not recognize the variant represented by the H-69 c D N A .

The missing N-glycosylation site can not be responsible since procaryo-tic expression products do not have this modification. Thus, the three amino acid residues at position 178, 188 and 239 with unique substitutions in the H-69-encoded polypeptide, are part of the epitope recognized by 3D11. Screening human sera with polyclonal factor H reagents and the mAb 3D11 showed variations in the expression in the small factor H related polypeptides (unpublished results).

Since the donor of the liver used for c D N A construction is not known, we could not directly test the plasma proteins. In conclusion, our results indicate variations in the factor H-related polypeptides encoded by the 1.4 kb m R N A species detected by c D N A sequencing and by staining with the mAb 3D11. The posttranslational modification or processing event leading to the two polypeptides encoded by one 1.4 kb m R N A commonly detected in human sera, is not clear. I t still remains to be clarified whether this novel factor H related serum protein has any of the functions of classical factor H known so far.

We are most grateful to Dr . R. B. SFM and Dr . A . J. D A Y , M R C Immunochemistry Unit , Oxford, U K , for helpful discussion.

References

1. W H A L E Y , K. , and S. R U D D Y . 1976. Modulation of C3b hemolytic activity by a plasma protein distinct from C3b inactivator. Science 193: 1011.

2. W H A L E Y , K. , and S. R U D D Y . 1976. Modulation of the alternative complement pathway by ß lHglobu l in . J. Exp. Med. 144: 1147.

3. C O N R A D , D . H . , J. R . C A R L O , and S. R U D D Y . 1978. Interaction of ß l H globulin with cell bound C3b: Quantitative analysis of binding and influence of alternative pathway components on binding. J. Exp. Med. 147: 1792.

4. P A N G B U R N , M . K., R . D . SCHREIBER, and H . J. M Ü L L E R - E B E R H A R D . 1977. Human

• complement C3b inactivator: isolation, characterisation, and demonstration of an absolute requirement for the serum protein 1H for cleavage of C3b and C4b in solution. J. Exp. Med. 146: 257.

5. A L S E N Z , J., J. D . LAMBRIS , T. F. S C H U L Z , and M . P . D I E R I C H . 1984. Localisation of the

complement component C3b binding site and the cofactor activity for factor I in the 38 kDa tryptic fragment of factor H . Biochem. J. 224: 389.

6. A L S E N Z , J., T. F. S C H U L Z , J . D . LAMBRIS, R. B. S I M , and M . P . D I E R I C H . 1985. Structural

and functional studies on complement factor H with different enzymes and monoclonal anti-factor H antibodies. Biochem. J. 232: 841.

7. SCHWAEBLE, W . , J . Z W I R N E R , T. F. S C H U L Z , R . P . L I N K E , M . P . D I E R I C H , and E. H . WEISS.

1987. Human complement factor H : Expression of an additional truncated gene product of 43 kDa in human liver. Eur. J. Immunol. 17: 1485.

8. R I P O C H E , J., A . J. D A Y , T. J. R . H A R R I S , and R . B. S I M . 1988. The complete aminoacid

sequence of human complement factor H . Biochem. J. 249: 593.

Factor H-Related 1.4 kb m R N A Species • 321

9. ESTALLER, C , W . SCHWAEBLE, M . P. D I E R I C H , and E. H . WEISS. 1991. Human comple­

ment factor H : Two factor H serum proteins are derived from alternatively spliced transcripts. Eur. J. Immunol. , in press.

10. KIRSTENSEN, T., R. A . WETSEL, and B. F . T A C K . 1986. Structural analysis of human

complement factor H : homology with C4b binding protein, -glycoprotein I and the Ba fragment of factor B. J. Immunol. 1 3 6 : 3407.

1 1 . S C H U L Z , T. F., W . SCHWAEBLE, K . K . STANLEY, E. H . WEISS, and M . P. D I E R I C H . 1986.

Human complement factor H : isolation of c D N A clones and partial c D N A sequence of the 38 kDa tryptic fragment containing the binding site for C3b. Eur. J. Immunol. 1 6 : 1351.

12. M C A L E E R , M . A. , J. R I P O C H E , O. D O M I N G U E Z , W . SCHWAEBLE, and R. B. S IM. 1989.

Partial gene structure for human factor H includes an alternative splice region. Abstract 24-17, International Congress of Immunology, p. 140. Gustav Fischer Verlag, Stuttgart.

13. H O L E R S , V. M . , J. L . C O L E , D . M . L U B L I N , T. SEYA, and J. P. A T K I N S O N . 1985. Human

C3b-regulatory proteins. A new multi-gene family. Immunol. Today 6 : 188. 14. R E I D , K . B. M . , D . R. BENTLEY, R^ D . C A M P B E L L , L . P. C H E N G , R. B. S I M , T.

KIRSTENSEN, and B. F. T A C K . 1986. Complement system proteins which interact with C3b or C4b. Immunol. Today 7 : 230.

15. R E I D , K . B. M . , and A. J. D A Y . 1989. Structure-function relationship of the complement components. Immunol. Today 1 0 : 177.

16. K L I C K S T E I N , L . B M W . W . W O N G , J. A . S M I T H , J. H . WEIS , J . G. W I L S O N , and D . T.

F E A R O N . 1987. Demonstration of long homologous repeating domains that are composed of the short consensus repeats characteristic of C3/C4 binding proteins. J. Exp. Med. 1 6 5 : 1095.

17. MISASI , R., H . P. H U E M E R , W . SCHWAEBLE, E. SOLDER, C. L A K C H E R , and M . P. D I E R I C H .

1989. Human complement factor H : an additional gene product of 43 kDa isolated from human plasma shows cofactor activity for the cleavage of the third component of complement. Eur. J. Immunol. 1 9 : 1765.

18. SCHWAEBLE, W . , H . SCHWAIGER, R. A . B R O O I M A N S , A , BARBIERI , j . M Ö S T , M . T I E F E N ­THALER, M . H I R S C H - K A U F F M A N N , D . F. L A P P I N , M . R. D A H A , K . W H A L E Y , and M . P. D I E R I C H . 1991. Human complement factor H : tissue specificity in the expression of three different m R N A species. Eur. J. Biochem., in press.

19. ESTALLER, C , W . SCHWAEBLE, V. K O I S T I N E N , M . P. D I E R I C H , and E. H . WEISS. 1991. Cloning of the 1.4 kb m R N A species of human factor H reveals a novel member of the SCR-family, related to the carboxyterminus of the classical 150 kDa molecule. J. Immunol., in press.

20. M A N I A T I S , T., E. F. FRISCH, and J. SAMBROOK. 1982. Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor Press, New York.

21. C H I R G W I N , J . M . , A . E. PRZYBYLA, R.J . M A C D O N A L D , and W . J . RUTTER. 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18: 5294.

22. FEINBERG, A. P., and B. VOGELSTEIN. 1983. A technique for radiolabeling D N A restric­tion endonuclease fragments to high specific activity. Anal. Biochem. 1 3 7 : 266.

23. N A G A I , K . , and H . C. THOGERSEN. 1984. Generation of ß-globin by sequence-specific proteolysis of a hybrid protein produced in Escherichin coli. Nature 3 0 9 : 810.

24. STANLEY, K . K . and J. P. L U Z I O . 1984. Construction of a new family of high efficiency bacterial expression vectors: identification of c D N A clones coding for human liver proteins. E M B O J. 3 : 1429.

25. T o w B I N , H . , T. S T A E H L I N , and J. G O R D O N . 1979. Elcctrophoretic transfer of proteins from Polyacrylamide gels to nitrocellulose sheets: procedures and some applications. Proc. Nat l . Acad. Sei. USA^76: 4350.

26. V O N HEIJNE, G. 1987. Sequence analysis in molecular biology. Academic Press, London.

27. V I K , D . P., J. B. K E E N L Y , P. M U N O Z - C A N O V E S , D . D . C H A P L I N , and B. F. T A C K . 1990.

Identification and sequence analysis of four complement factor H related transcripts in mouse liver. J. Biol. Chem. 2 6 5 : 3193.

3 2 2 • W l l . H E L M SCHWAEBLE et al.

28 . M U N O Z - C A N O V E S , P., B . F. T A C K , and D . P . V I K . 1989. Dexamethasone and retinoic acid increase the level of murine H m R N A . Complement Inflamm. 6 : 3 7 2 .

Dr. W I L H E L M SCHWAEBLE, Department of Internal Medicine, Verfügungsgebäude für Forschung, Obere Zahlbacher Straße 6 3 , 6 5 0 0 Mainz, Germany