Hemoglobin Beta-subunit (HBB)
description
Transcript of Hemoglobin Beta-subunit (HBB)
![Page 1: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/1.jpg)
Hemoglobin Beta-subunit (HBB)
Josh Bram and Wilton Smith
![Page 2: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/2.jpg)
What is Hemoglobin?• Oxygen (and CO2) transporter
for all vertebrates• Tetramer composed of four
protein subunits (two alpha and two beta subunits)
• Four Iron-containing haeme centers carry one oxygen molecule each
• Beta-subunit mutations cause:– Sickle-cell anemia– Beta-thalessemia
• 146 amino acid protein subunit
![Page 3: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/3.jpg)
Hemoglobin - β Mutation Diseases
Sickle Cell Anemia• Mutation causing beta-
globin units to stick together in masses and deform Red Blood Cells
• RBCs take crescent shape and have many consequences
• These include premature death and blocking of small blood vessels
Beta Thalassemia• Either a decrease or
absence of beta-globin production
• Prevents Red Blood Cells from having enough Hemoglobin to supply oxygen to the body
• In mice, leads to sickly and weak individuals, or stillborn offspring
![Page 4: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/4.jpg)
Peromyscus leucopus
![Page 5: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/5.jpg)
Primer Design
• Targeted Intron 2 (~700 base pairs)• Forward Primer (E2E3F):
5’ ctccatgtggatcctgagaac 3’– GC%: 52.38 – 21 base pairs– Melting point: 55° C
• Reverse Primer (E2E3R): 5’ acgatcatattgcccaggag 3’
– GC%: 50.00– 20 base pairs– Melting Point: 55° C
![Page 6: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/6.jpg)
DNA Extraction
• Qiagen DNeasy Blood & Tissue Kit• Two samples of P. leucopus extracted– Sample 1 extracted after 20 minute incubation– Sample 2 extracted after extended incubation
• Both DNA samples yielded amplification results at one time or another; however, sample 2 proved to be a more reliable DNA source
![Page 7: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/7.jpg)
Polymerase Chain Reaction (PCR)
• 6.25 μL Mastermix– Mix composed of parts:
• 50 x 1.25 μL 10x buffer = 62.5 μL• 50 x 1.25 μL dNTP = 62.5 μL• 50 x 0.1 μL Taq Polymerase = 5 μL
• 4.25 μL dH2O• 1.00 μL DNA• 0.50 μL PF• 0.50 μL PR
![Page 8: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/8.jpg)
Initial Identification
• Six sample PCR– Sample DNA 1 at 50˚C,
55˚C, and 60˚C– Sample DNA 2 at 50˚C,
55˚C, and 60˚C
• Successful gene amplification for Sample DNA 2 at 60˚C PCR (well seven)
2 kb1.5 kb
1 kb700 bp500 bp300 bp100 bp
![Page 9: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/9.jpg)
What happened?
• Only Sample DNA 2 used for future PCR reactions
• Gene amplification failed to occur at 60˚C (or any temperature)
• Possible errors in PCR mix setup, PCR machine setup, random error, denatured primers
![Page 10: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/10.jpg)
Successfully Identified
• PCR run at multiple primer concentrations (1X, 1.5X, 2X) for Sample DNA 2
• Successful gene amplification for across all primer concentrations (wells two, three, and four)
1, 1.5, and 2x primer concentrations all show amplification at approx. 700 bp
![Page 11: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/11.jpg)
Initial 50 μL PCR products
• 50 μL PCR reactions for eventual sequencing
• All PCR ingredient volumes multiplied by four for 50 μL PCR
• Wells two and three show the HBB PCR products (1X and 1.5X Primer concentrations)
HBB PCR Prodcuts, approx. 700 bp
![Page 12: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/12.jpg)
PCR Product Cleanup for Analysis
• Used Qiagen PCR Purification Kit• Cleanup up PCR Product to send for
sequencing• Sent 5 μL of each primer, 10 μL of PCR product• Sent to Penn State sequencing facility in
Chandlee building
![Page 13: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/13.jpg)
HBB Sequence
![Page 14: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/14.jpg)
HBB Forward Primer
• Compared to Mus sequence
![Page 15: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/15.jpg)
HBB Reverse Primer
• Compared to Mus sequence
![Page 16: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/16.jpg)
BLAST Results
![Page 17: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/17.jpg)
Population Samples
• Six Population Sample PCR at 60˚C– TK20806– TK20808– TK20809– TK20813– TK20852– TK20857
• All samples showed gene amplification
East
West
![Page 18: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/18.jpg)
5E (806) vs 9W (852)
![Page 19: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/19.jpg)
Conserved vs Unconserved
![Page 20: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/20.jpg)
Site 179
Depending on reading frame: Cys to Tyr, Val to Met, Leu to Leu
![Page 21: Hemoglobin Beta-subunit (HBB)](https://reader030.fdocuments.net/reader030/viewer/2022033022/5681624d550346895dd298d5/html5/thumbnails/21.jpg)
Bibliography
• http://www.uniprot.org/uniprot/P68871• http://ghr.nlm.nih.gov/gene/HBB• http://
biotools.umassmed.edu/bioapps/primer3_www.cgi• http://www.ncbi.nlm.nih.gov/genbank/• http://www.megasoftware.net/• http://nucleobytes.com/index.php/4peaks• http://
bioinformatics.picr.man.ac.uk/research/software/tools/sequenceconverter.html