Giao Trinh Di Truyen Hoc.pdf
Transcript of Giao Trinh Di Truyen Hoc.pdf
![Page 1: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/1.jpg)
PGS.TS. Khuất Hữu ThanhViện CNSH &CNTP, Đại học Bách Khoa Hà Nội
DI TRUYỀN HỌC
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 2: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/2.jpg)
THÀNH TỰU VÀ NHỮNG VẤN ĐỀTHẾ KỈ 20 CHƯA GIẢI QUYẾT ĐƯỢC
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 3: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/3.jpg)
1- Ph¸t hiÖn cÊu tróc xo¾n kÐp cña DNA
1866 - Haeckel: Ph¸t hiÖn nh©n tÕ bµo chøa c¸c nh©n tè di truyÒn1889 - Altman: T¸ch chiÕt ®îc acid nucleic 1953 - Watson & Crick: Ph¸t hiÖn cÊu tróc xo¾n kÐp cña DNA1070 - Ph¸t hiÖn enzym giíi h¹n1973 - Boyer vµ Cohen tæng hîp thµnh c«ng DNA nh©n t¹o1997- Nh©n b¶n v« tÝnh cõu Doly1999 - Thµnh lËp dù ¸n bé gen ngêi
THÀNH TỰU ĐÃ ĐẠT ĐƯỢC TRONG THẾ KỈ 20
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 4: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/4.jpg)
2- Ph¸t minh m¸y chôp c¾t líp CT/MRIComputer Tomography/Nuclear Magnetic Resonance Image
- N¨m 1972 Godfrey Hounsfield ph¸t minh m¸y chôp c¾t líp CT (n¨m 1979 nhËn gi¶i Nobel cïng Allen Cormack)- N¨m 1982 MRI b¾t ®Çu ®îc øng dông trong chÈn ®o¸n bÖnh
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 5: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/5.jpg)
3- Ph¸t minh vaccin chèng bÖnh ®Ëu mïa (smallpox)
-BÖnh ®Ëu mïa do virus g©y nªn ®îc biÕt tõ thêi cæ ®¹i (n¨m 1157 tríc CN Vua Pharaoh Ramses V chÕt do ®Ëu mïa )-1520-1522: 3,5 triÖu ngêi chÕt do bÞ ®Ëu mïa-ThÕ kØ 17-18: ë Ch©u ¢u kho¶ng 1 triÖu ngêi chÕt do bÞ ®Ëu mïa mçi n¨m-N¨m 1796, Dr. Edward Jenner (Anh) ph¸t minh c¸ch phßng ®Ëu mïa b»ng h¬ nãng vÕt ®Ëu bß chñng lªn ngêi.-1967: WHO thùc hiÖn chiÕn dÞch diÖt trõ bÖnh ®Ëu mïa (10-15 triÖu ngêi/n¨m)-1977:Trêng hîp cuèi cïng ë Somalia-1980: WHO tiÖt trõ bÖnh ®Ëu mïa trªn toµn thÕ giíi
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 6: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/6.jpg)
4- Ph¸t minh vaccin chèng bÖnh b¹i liÖt (Salk vaccin)
- BÖnh b¹i liÖt g©y nªn do Poliovirus, thÕ kØ 190 ph¸t hiÖn mét sè trêng hîp b¹i liÖt- 1916: DÞch b¹i liÖt ë New York Mü lµm 27000 ngêi tµn
tËt, 9000 chÕt. DÞch bÖnh kÐo dµi ®Õn 1955, khi s¶n xuÊt ®îc vaccin míi chÊm døt æ dÞch
- Jonas Salk (Mü) lÇn ®Çu tiªn ph¸t minh vaccin b¹i liÖt (tõ poliovirus sèngtrong ruét khØ)- Th¸ng 4/ 1954: Vaccin b¹i
liÖt (Salk vaccine) s¶n xuÊt víi khèi lîng lín vµ ®îc sö dông thö nghiÖm- Th¸ng 4/1955: 5.000.000
trÎ em ®îc tiªm Salk vaccin
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 7: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/7.jpg)
5 - Ph¸t hiÖn mèi liªn quan gi÷a thuèc l¸vµ bÖnh ung th
-1957: HiÖp héi Ung th Mü ®iÒu tra trong 448 ngêi ung th phæi cã 15 ngêihót thuèc
-1961: Surgeon General Luther Terry ®a ra c¸c sè liÖu vÒ gi¶m sót søc khoÎ dohót thuèc l¸
-1964: Surgeon General Terry tr×nh bµy b¸o c¸o tríc chÝnh phñ Mü vÒ hËu qu¶cña hót thuèc l¸ vµ bÖnh ung th dµy 387 trang víi h¬n 7000 kÕt qu¶ nghiªn cøu
6 - Ph¸t minh thuèc ngõa thai d¹ng uèng
- 1954: LÇn ®Çu tiªn tæng hîp thµnh c«ng progesteron gióp ngõa thai cho phô n÷- 1956: Ph¸t hiÖn mestranol cã thÓ kÕt hîp progesteron gióp kiÓm so¸t chu k× rông trøng vµ tr¸nh thai an toµn b»ng ®êng uèng- 1958: §Ò nghÞ FDA cho phÐp sö dông thuèc ngõa thai d¹ng uèng- 1959: FDA Cho phÐp sö dông thuèc ngõa thai d¹ng uèng
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 8: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/8.jpg)
7 - GhÐp t¹ng
- 1917-1918: GhÐp da - 1946: LÇn ®Çu tiªn ghÐp tuyÕn thîng thËn- 1954: LÇn ®Çu tiªn ghÐp thËn thµnh c«ng- 1960: LÇn ®Çu tiªn ghÐp gi¸c m¹c- 1962: LÇn ®Çu tiªn nèi chi-1967: LÇn ®Çu tiªn ghÐp tim-1968: LÇn ®Çu tiªn ghÐp gan-1978: LÇn ®Çu tiªn ghÐp tuû- ViÖt nam ghÐp gan thµnh c«ng n¨m 2004 cho mét em g¸i 12 tuæi tõ gan cña ngêi bè (sau 36 n¨m)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 9: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/9.jpg)
8 - HIV
12. 1981:CDC b¸o c¸o vÒ suy gi¶m miÔn dÞch do truyÒn m¸u
5.1983: Ph¸t hiÖn HIV I thuéc retrovirus2.1985: CDC ®Ò nghÞ kiÓm tra HIV tríc
khi nhËn hoÆc tiÕp m¸u10.1985: Uû ban søc khoÎ Mü ®a ra kÕ
ho¹ch s¶n xuÊt AZT2.1988: Ph¸t hiÖn virus HIV-II t¹i Mü12.1988: NhiÒu lo¹i thuèc chèng HIV
®îc s¶n xuÊt thö nghiÖm, b¾t ®Çu nghiªn cøu liÖu ph¸p gen chèng HIV
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 10: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/10.jpg)
9 - Ph¸t minh Insulin- Mïa hÌ n¨m 1921 Dr. Banting vµ Dr. Best ph¸t hiÖn Insulin - Th¸ng 1.1922 LÇn ®Çu tiªn sö dông thö nghiÖm Insulin t¸ch chiÕt tõ tuyÕn tuþ cña lîn, bß trong y häc - 1982 thµnh c«ng s¶n xuÊt Insulin ngêi t¸i tæ hîp trong tÕ bµo E. coli
Dr. Banting
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 11: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/11.jpg)
10 - Ph¸t minh Penicillin
-N¨m 1928 Alexander Fleming ph¸t hiÖn Penicillin tõ nÊm Penicillium - N¨m 1940, Dr. Howard Florey vµ Dr. Ernst Chain s¶n xuÊt vµ tinh chÕ penicillin - Trong chiÕn tranh thÕ giíi thø II Penicillin ®· cøu hµng triÖu binh lÝnh kh«ng bÞ nhiÔm trïng- Sau 1945 thêi k× míi cña c«ng nghÖ s¶n xuÊt kh¸ng sinh- N¨m 1951 t×m ra chñng P. chrygenum 1951-B25 sö dông trong s¶n xuÊt c«ng nghiÖp- B»ng kü thuËt g©y ®ét biÕn nh©n t¹o vµchän läc ®· chän t¹o ®îc nhiÒu chñng ho¹t tÝnh cao gÊp hµng ngh×n lÇn chñng ban ®Çu nh E-15, E-15.1, M-88…
Alexander Fleming
Dr. Howard Florey
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 12: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/12.jpg)
11 - LiÖu ph¸p gen1960 Dù ¸n sö dông gen trong ®iÒu trÞ bÖnh ë ngêi1973 Thµnh c«ng tæng hîp DNA nh©n t¹o1990 LÇn ®Çu tiªn sö dông liÖu ph¸p gen chưa bÖnh ë ngêi
( bÖnh thiÕu hôt ADA - Adenosine Deaminase Deficiency )
2000 LiÖu ph¸p gen ®îc coi lµ ph¬ng ph¸p ch÷a bÖnh hiÖu qua cho con ngêi trong t¬ng lai
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 13: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/13.jpg)
Nh©n b¶n v« tÝnh cõu Doly 1997
Nh©n b¶n v« tÝnh ngêi 2002 ?
12 - Nh©n b¶n v« tÝnh ®éng vËt bËc cao
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 14: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/14.jpg)
• 1998 – nh©n b¶n chuét nh¾t• 1998 – nh©n b¶n bß s÷a • 2000 – nh©n b¶n lîn• 2001 – nh©n b¶n mÌo Cc• 2002 – nh©n b¶n thá• 2003 – nh©n b¶n ngùa• 2004 – nh©n b¶n bß tãt
• 1997 – nh©n b¶n Dolly
MỘT SỐ MỐC NHÂN BẢN VÔ TÍNH ĐỘNG VẬT
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 15: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/15.jpg)
NHỮNG THÁCH THỨC LỚN trong thế kỉ 21
1. Chøc n¨ng gen trong bé gen ngêi?2. Ch÷a mét sè lo¹i bÖnh truyÒn nhiÔm?3. Ngêi vµ chuét chØ kh¸c nhau 1% thµnh phÇn
bé gen?4. Nguån gèc cña con ngêi trªn tr¸i ®Êt?5. Cã ngêi ngoµi tr¸i ®Êt?6. VÊn ®Ò t¸i sinh cña con ngêi7. VÊn ®Ò t©m linh
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 16: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/16.jpg)
Chương 1
VẬT CHẤT DI TRUYỀN
I. Lược sử nghiên cứu di truyền họcII. Acid nucleic lµ vËt chÊt mang th«ng tin di truyÒnIII. CÊu tróc DNAIV. CÊu tróc RNAV. VËt chÊt di truyÒn cña mét sè nhãm sinh vËt
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 17: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/17.jpg)
I. Lược sử nghiên cứu di truyền học1865 - G.Mendel phát hiện nhân tố di truyền và các quy luật di truyền1869 - Friedrich Miescher phát hiện acid nucleic.1900 - H.Vries, C.Corren, E.Tschermak t¸i ph¸t hiÖn qui luËt Mendel.1902 - Walter Sutton, Theodor Boveri nªu thuyÕt cÊu tróc NST.1910 - T. Morgan vµ CS ph¸t hiÖn vÞ trÝ x¾p xÕp cña c¸c gen trªn NST.1941 - G.Beadel, E.L. Tatum nªu gi¶ thuyÕt mét gen - mét enzym.1944 - O. Avery, C.McLeod, M.McCarty x¸c ®Þnh gen cÊu t¹o tõ DNA.1953 - J.Watson, F.Crick ph¸t minh cÊu tróc xo¾n kÐp cña DNA. 1958 - M.Meselson, Franklin Stahl ph¸t hiÖn c¬ chÕ t¸i b¶n DNA theo c¬chÕ b¸n b¶o thñ.1966 - Marshall Nirenberg, Gobind Khorana: b¶ng m· di truyÒn.1970 - Hamilton Smith ph¸t hiÖn enzym giíi h¹n (restriction enzyme).1972 - Paul Berg thµnh c«ng t¹o DNA t¸i tæ hîp in vitro.1973 - H.Boyer, S. Cohen lÇn ®Çu tiªn sö dông plasmid t¸ch dßng DNA.1977 - W.Gilbert vµ F.Sanger ph¸t minh ph¬ng ph¸p gi¶i tr×nh tù gen.1995 - Gi¶i tr×nh tù bé gen vi khuÈn Hemophilus influenzae vµ vi khuÈn Mycoplasma genitalium, 1996 - bộ gen nÊm men2003 - Giải trình tự bộ gen người, 2005- bộ gen lúa
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 18: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/18.jpg)
CƠ SỞ PHÂN TỬ CỦA SỰ DI TRUYỀN
DNA RNA PROTEIN
DNA
1
2
3
1. T¸i b¶n DNA 2. Phiªn m·3. Phiªn m· ngîc4. DÞch m·5. BiÓu hiÖn gen
NHIÕm S¾c thÓ
GEN
mRNA
rRNA
tRNA
small RNA
4
Protein cÊu tróc
Thụ thể
Enzym
Kh¸ng sinh
Hocmon
Nh©n tè ®iÒu hoµ...
5
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 19: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/19.jpg)
II. Acid nucleic - vËt chÊt mang th«ng tin di truyÒn
1. ThÝ nghiÖm Griffith (1928)
D¹ng S cã mµng nhÇy cã ®éc tè
D¹ng R kh«ng cã mµng nhÇy, kh«ng sinh ®éc tè
Vi khuÈn staphylococcus pneumoniae cã 2 d¹ng
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 20: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/20.jpg)
D¹ng R
D¹ng S
D¹ng S ®un nãng
D¹ng S ®un nãng + R
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 21: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/21.jpg)
ThÝ nghiÖm1
2. ThÝ nghiÖm Hershey – Chase 1952
ThÝ nghiÖm 2Protein kh«ng ph¶I lµ vËt chÊt di truyÒn
DNA lµ vËt chÊt di truyÒn
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 22: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/22.jpg)
4. Sù ph¸t hiÖn Viroid- N¨m 1980 ph¸t hiÖn Viroid kÝ sinh g©y bÖnh thùc vËt
- Viroid cã cÊu t¹o mét thµnh phÇn duy nhÊt lµ RNA
- Viroid t¹o nªn c¸c khèi u cña mét sè loµi thùc vËt
- CÊu t¹o tõ kho¶ng 250 -300 ribonucleotid
KÕt luËn:
acid nucleic lµ vËt chÊt mang th«ng tin di truyÒn
3. ThÝ nghiÖm bæ xung cña Oswald Avery vµ céng sù 1944- LÆp l¹i c¸c thÝ nghiÖm cña Griffith 1928, bæ xung 2 thÝ nghiÖm sau:
+ TN 1:D¹ng S ®un nãng + R + enzym protease tiªm vµo chuét chuét chÕt+ TN 2: D¹ng S ®un nãng + R + enzym nuclease tiªm vµo chuét chuét sèng
Acid nucleic lµ nh©n tè biÕn n¹p
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 23: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/23.jpg)
CÊu tróc DNA- CÊu tróc baz¬ nit¬, nucleozid vµ nucleotid- CÊu tróc xo¾n kÐp cña ph©n tö DNALiªn kÕt 3’,5’-phosphodiesterLiªn kÕt hydro gi÷a c¸c baz¬ nit¬Kho¶ng c¸ch gi÷a c¸c baz¬ nit¬
§Æc trng cña DNA- TÝnh chÊt håi tÝnh vµ biÕn tÝnh cña DNA- NhiÖt ®é biÕn tÝnh Tm- Tû lÖ A+T / G+C- TrËt tù x¾p xÕp cña c¸c nucleotid- CÊu tróc kh«ng gian cña chuçi xo¾n kÐp
III. CÊu tróc DNA
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 24: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/24.jpg)
1. Baz¬ nit¬ vµ nucleotid- Bazơ nitơ
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 25: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/25.jpg)
dATP (deoxyadenosin triphosphat)
CN
H
C
CCN
H
NH2
32
16
5
4
N
N
C7
89
O
CC
CC H
H
H
H
OH
CH2
H
1'
2'3'
4'
5'OPO
O
O
POO
O
POO
O
3' hydroxyl
5' phosphat
Nucleotid (dNTP:dATP, dGTP, dCTP, dTTP)Bazơ ntơ + Đường + Phosphat
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 26: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/26.jpg)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 27: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/27.jpg)
2. Cấu trúc mạch đơn DNACác nucleotid trong mạch đơn DNA – liên kết phosphodieste
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 28: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/28.jpg)
3. Nguyên lí ChargaffTrong phân tử DNA: số lượng A = T, số lượng G = C
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 29: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/29.jpg)
Liên kết giữa hai mạch đơn phân tử DNA – liên kết hydro
A - T cã 2 liªn kÕt hydro
G - C cã 3 liªn kÕt hydro
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 30: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/30.jpg)
C
A
G
T
AA
G
TTG
CC
A TC G
4. CÊu tróc xo¾n kÐp DNA
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 31: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/31.jpg)
5. M¹ch ®¬n DNA ®îc kÐo dµi theo chiÒu 5’ ®Õn 3’
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 32: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/32.jpg)
Ph©n tö DNA xo¾n kÐp
Vïng giµu A -T biÕn tÝnh sím nhÊt
C¸c sîi DNA ®¬n th¸o xo¾n
NhiÖt ®é caohoÆc pH cao
C¸c s¬i ®¬n DNAt¸ch rêi nhau
6. TÝnh chÊt biÕn tÝnh, håi tÝnh cña DNA
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 33: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/33.jpg)
100
50
0
7050 90oC
PhÇ
n tr
¨m G
-C
tro
ng D
NA
NhiÖt ®é biÕn tÝnh cña DNA (Tm – T melting )
Tm lµ nhiÖt ®é trung b×nh khi hai m¹ch DNA b¾t ®Çut¸ch rêi nhau vµ t¸ch nhau hoµn toµn
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 34: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/34.jpg)
- Tû lÖ G -C cµng cao ph©n tö DNA cã Tm cµng lín- C¸c nucleotid s¾p xÕp liÒn nhau cµng dµi Tm cµng lín
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 35: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/35.jpg)
7. §Æc ®iÓm cÊu tróc c¸c d¹ng DNA
D¹ng A D¹ng B D¹ng Z
ChiÒu xo¾n: Xo¾n ph¶i Xo¾n ph¶i Xo¾n tr¸i
§êng kÝnh: 2.6 nm 2.0 nm 1.8 nm
CÆp baz¬: 11 bp 10.4 bp 12 bp
Mét vßng xo¾n: 2,53 nm 3,54 nm 4,56 nm
C¸ch tÝnh Tm
Víi ®o¹n DNA < 25 cÆp baz¬:
Tm= 2 0C x (A + T) + 4 0C x (G + C)
Víi ®o¹n DNA > 25 c¹p baz¬:
Tm= 81,5 0C + 16,6 (log Na+) + 0,41 (% G +C) – (500/n)- 0,61% FA
FA - formaldehyt
n – tæng sè cÆp baz¬
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 36: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/36.jpg)
DNAA B Z
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 37: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/37.jpg)
IV. CÊu tróc RNA1. Các loại RNA chủ yếu
…
(21-28 nu)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 38: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/38.jpg)
RNA nhỏ có chức năng enzymRibozymRNA bộ gen virusGenomic RNA
Điều hoà phiên mã và dịch mãPri miRNA - primary micro RNAmiRNA - micro RNA
RNA bất hoạtshRNA - short hairpin
Bất hoạt gen, điều hoà phiên mã vàdịch mã
siRNA - small interfering RNA, RNA silencing)
Cắt nối mRNA, rRNA, tRNA; tạo đuôipolyA
snRNA - small nuclear snoRNA - small nucleolar
Tham gia quá trình tổng hợp proteintRNA – transfer RNA
Tham gia quá trình tổng hợp proteinrRNA - ribosomal RNA
Tham gia quá trình tổng hợp proteinmRNA - messenger RNA
Chức năng cơ bảnCác dạng RNA chủ yếu
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 39: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/39.jpg)
RNA ribosom (rRNA): 3 lo¹i16S rRNA (rRNA tiÓu phÇn nhá ribosom)23S rRNA (rRNA tiÓu phÇn lín ribosom)5S rRNA (rRNA tiÓu phÇn lín ribosom)
- C¸c lo¹i rRNA cña eukaryote
- C¸c lo¹i rRNA cña prokaryote
RNA ribosom (rRNA): 4 lo¹i18S rRNA (rRNA tiÓu phÇn nhá ribosom)28S rRNA (rRNA tiÓu phÇn lín ribosom)5, 8S vµ 5S rRNA (rRNA tiÓu phÇn lín ribosom)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 40: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/40.jpg)
2. Thµnh phÇn baz¬ nit¬ cña RNA vµ DNA
RNA DNA
Adenin AdeninCytosin CytosinGuanin GuaninUracil (U) Thymin (T)
Trong ph©n tö RNAuracil - adenin
Trong ph©n tö DNAthymin - adenin
T = A U = A
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 41: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/41.jpg)
5’
3’
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 42: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/42.jpg)
3. CÊu tróc tæng qu¸t mRNA cña prokaryote
5’
3’
uuccuccu AUG
Tr×nh tù Shine-Dalgarno Bé ba më ®Çu (initiation)
Tr×nh tù Shine-Dalgarno (SD) giµu baz¬ pyrimidin (uracil) lµvÞ trÝ kÕt hîp víi 16S rRNA khëi ®Çu tæng hîp protein
AAU
Bé ba kÕt thóc (termination)
Vïng dÞch m· (coding sequence)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 43: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/43.jpg)
4. CÊu tróc tæng qu¸t mRNA cña eukaryote
m7GpppMò
5’ Vïng 5’ kh«ng dÞch m· AUG
Bé ba më ®Çu(initiation codon)
Vïng dÞch m· (coding sequence)
(AAAAAA)n§u«i poly(A)
UGA
Bé ba kÕt thóc (Termination codon)
3’AAUAAA
Vïng 3’ kh«ng dÞch m·
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 44: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/44.jpg)
tRNA vËn chuyÓn c¸c acid amin cho qu¸ tr×nh dÞch m·• §Çu 3’ cã tr×nh tù - CCA g¾n víi acid amin• Bé ba ®èi m· (anticodon) ë vÞ trÝ ph×nh gi÷a (anticodon loop)
5. CÊu tróc tæng qu¸t RNA vËn chuyÓn (mRNA)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 45: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/45.jpg)
V . VẬT CHẤT DI TRUYỀN
CỦA MỘT SỐ NHÓM SINH VẬT1. VËt chÊt di truyÒn cña virus
- DNA xo¾n kÐp (Adenovirus, Herpesvirrus, VR viªm gan B- HBV, phage T, phage λ)
- DNA m¹ch ®¬n ( phage ϕ X174, phage M13…)
- RNA m¹ch ®¬n (VR sëi – paramyxovirus, VR d¹i - Rhadovirus, VRcóm, quai bÞ – myxovirus influenzae, VR sèt xuÊt huyÕt, viªm n·o –Arbovirus, VR viªm gan HAV, HCV, HDV, vµ HEV; VR HIV…)
- RNA m¹ch kÐp ( Reovirus )
2. VËt chÊt di truyÒn cña prokaryote
- DNA m¹ch kÐp (NST ®¬n gi¶n)
- DNA m¹ch kÐp trong plasmid, ty thÓ , l¹p thÓ
3. VËt chÊt di truyÒn cña Eukaryote
- DNA m¹ch kÐp trong nh©n, NST cã cÊu tróc ®iÓn h×nh- DNA trong ty thÓ , l¹p thÓ vµ DNA trong Plasmid ë nÊm men-
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 46: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/46.jpg)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 47: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/47.jpg)
VI. CẤU TRÚC, CHỨC NĂNG NHIỄM SẮC THỂ1. CÊu tróc nhiÔm s¾c thÓ
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 48: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/48.jpg)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 49: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/49.jpg)
2. CÊu tróc nucleosom
+ Nucleosom:- ~200 bp DNA; 2 vßng DNA cuèn chÆt 8 ph©n tö histon-Mét ph©n tö histon H1 dÝnh gi÷a + T©m nucleosom: - KÝch thíc146 bp DNA cuèn 1 3/4 vßng- DNA kh«ng ë d¹ng siªu xo¾n- Cã 4 lo¹i histon H2A, H2B, H3, H4 (mçi lo¹i 2 ph©n tö)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 50: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/50.jpg)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 51: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/51.jpg)
- CÊu tróc mét NST ®¬n gåm: T©m ®éng (C), c¸nh dµi (q), c¸nh ng¾n (p) vµ ®iÓm mót (telomer)- Tuú vÞ trÝ t©m ®éng cã thÓ t¹o nªn c¸c d¹ng t©m c©n, t©m lÖch, t©m mót- H×nh d¹ng, kÝch thíc, sè lîng bé NST ®Æc trng riªng cho mçi loµi. VÝ dô: Ruåi giÊm 2n=8 gåm :1cÆp NST h×nh que;1 cÆp h×nh ch÷ V; 1 cÆp h×nh h¹t, 1cÆp NST giíi tÝnh ë con c¸i 2 chiÕc h×nh que, ë con ®ùc 1 h×nh que vµ mét h×nh mãc nhá h¬n
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 52: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/52.jpg)
1 Mb, 33 gen
Chr 19 kÝch thíc 60 Mb, ~1200 gen
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 53: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/53.jpg)
3. H×nh d¹ng, sè lîng nhiÔm s¾c thÓ
- H×nh d¹ng, kÝch thíc nhiÔm s¾c thÓ ®Æc trng riªng cho tõng loµi sinh vËt, ë kú gi÷a cña c¸c qu¸ tr×nh ph©n bµo mçi nhiÔm s¾c thÓ chia thµnh c¸nh dµi (q) c¸nh ng¾n (p), gi÷a lµ t©m ®éng.- ë k× gi÷a nhiÔm s¾c thÓ cã nhiÒu lo¹i h×nh d¹ng kh¸c nhau: h×nh que, h×nh h¹t, h×nh ch÷ V, ch÷ X, ch÷ Y …- ë ngêi 2n = 46, bß 2n = 60, gµ 2n = 78, ruåi giÊm 2n= 8, lóa 2n = 24, ng« 2n = 20... C¸c giao tö cã bé nhiÔm s¾c thÓ ®¬n béi (n), ë ngêi n = 23, ng« n = 10, bßn = 30...- Sè lîng gen trªn mçi nhiÔm s¾c thÓ ®Æc trng ë mçi loµi sinh vËt
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 54: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/54.jpg)
Chương 2
GEN & BỘ Gen
I . Cấu trúc genII . Tái bản gen (DNA)III. Phiên mã tổng hợp RNAIV. Dịch mã và sinh tổng hợp proteinV . Điều hòa hoạt động và biểu hiện genVI. Cấu trúc nhiễm sắc thể và bộ gen
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 55: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/55.jpg)
Gen3
Gen2
Gen1
A. gen
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 56: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/56.jpg)
Gen lµ g×?- ThuËt ng÷ gen (gene) b¾t nguån tõ ch÷ Hyl¹p Genos : nghÜa lµ nguån gèc - ThuËt ng÷ gen ®îc ®a ra lÇn ®Çu tiªn n¨m 1902 bëi Walter Sutton vµ Theodor Boveri, khi nªu thuyÕt cÊu tróc nhiÔm s¾c thÓ- Kh¸i niÖm gen: gen ®îc hiÓu mét c¸ch chung nhÊt lµ mét ®o¹n DNA (hoÆc RNA) mang th«ng tin di truyÒn x¸c ®Þnh cÊu tróc cña mét chuçi peptid hoÆc mét lo¹i RNA (rRNA, tRNA, siRNA, miRNA, smallRNA, ribozym…)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 57: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/57.jpg)
Gen mang
m· di truyÒn
Gen kh«ng mang
m· di truyÒn
Gen
- Gen m· ho¸ protein (mRNA)
- Gen m· ho¸ rRNA, tRNA, ribozym, small RNA,..
- Gen gi¶ (pseudogene)
- Gen cha râ chøc n¨ng
- C¸c intron
- §o¹n lÆp minnisatellit, microsatellit,
- C¸c tr×nh tù TEL, CEN, Telomer, Spacer, Alu, Intergenic…
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 58: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/58.jpg)
- Gen giả chiếm khoảng 20-30% DNA gen nhân của sinhvật bậc cao- Gen giả là các gen không chức năng, là các bản copy của gen mã hoá protein nhưng không được phiên mãhoặc có phiên mã nhưng không được dịch mã (nguyênnhân chưa rõ)- Cấu trúc gen giả: có thể xuất phát từ các gen nhảy củavirus (retro-transposon), bản copy gen mã hoá protein bịmất 5’ promoter, không có các intron, có đoạn polyA.- Cơ chế hình thành gen giả: chưa rõ
Gen giả (Pseudogenes)
Gen mã hoá protein (Coding gene)
- Gen mã hoá protein chiếm dưới 2% DNA bộ gen- Gen mã hoá protein có cấu trúc điển hình 3 vùng gen: vùng điều khiển, vùng mang mã di truyền - ORF vàvùng kết thúc
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 59: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/59.jpg)
Gen ®iÓn h×nh gåm 3 vïng: - Vïng ®iÒu khiÓn hay vïng promoter (vùng 5’)- Vïng mang m· di truyÒn (Coding sequences)
hay vïng dÞch m· ORF )- Vïng kÕt thóc hay (vïng 3’)
I. CÊu tróc gen
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 60: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/60.jpg)
Vïng 5’ Vïng mang m· di truyÒn (ORF) Vïng 3’
P O
Promoter Operator
+1 Phiªn m·
-60 -40 -35 -10
Upstream element – UE Core Promoter - T©m promoter- 35 (TTGACAT) - 10 hay TATA box ë prokaryote - 75 CAAT box - 25 TATA box ë eukaryote
1. CÊu tróc vïng điều khiển (vùng 5’promoter)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 61: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/61.jpg)
3’
promoter
Gene 1 Gene 2 Gene 3
a. CÊu tróc tæng qu¸t gen (Operon) prokaryote
- Promoters
+Tr×nh tù - 35 (TTGACA) gåm15-20 bp
+Tr×nh tù -10 (TATAAT) gåm 5-9 bp
- §iÓm khëi ®Çu phiªn m· CAT
-Tr×nh tù shine-dalgarno 10 bp (AGGAGG) phÝa trªn béba mở đầu (AUG)
- Terminator
5’Operon
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 62: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/62.jpg)
Vïng 5’ cña prokaryote
-Cã 1 lo¹i o promoter chung cho c¸c gen m· ho¸ mRNA, rRNA, tRNA và small RNA- Promoter ®iÒu khiÓn sù phiªn m· cña tÊt c¶ c¸c cistron (gen cÊu tróc) trong mét OPERON.
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 63: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/63.jpg)
b. CÊu tróc tæng qu¸tgen cña eukaryote
5’
3’
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 64: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/64.jpg)
Gen (DNA)⇒ RNA ⇒ Protein
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 65: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/65.jpg)
Eukaryote cã 3 lo¹i promoter ®iÓn h×nh, ®Æc trng riªng víi tõng nhãm gen cÊu tróc:
Vïng 5’ cña Eukaryote
Vùng mang mã di truyền
Vùng 3’
Vùng promoter
- 5’ UTR trình tự ở đầu 5’ không dịch mã- 3’ UTR trình tự ở đầu 3’ không dịch mã- TATA box vÞ trÝ -30 -35- CAAT box vÞ trÝ -75 gåm kho¶ng 22bp - GC box vÞ trÝ - 90 gåm kho¶ng 20bp- Tr×nh tù phÝa trªn Promoter (Upstream Promoter elements)- Spacer DNA gåm kho¶ng 14-20 nucleotid- Vị trÝ khëi ®Çu phiªn m· kho¶ng 6-20 bp tríc bé ba më ®Çu CAT- TÝn hiÖu g¾n ®u«i PolyA signal (AATAAA)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 66: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/66.jpg)
1. Promoter nhóm I (promoter của gen mã hoá rRNA 18S, 28S và5,8S là vị trí tiếp xúc của enzym RNA polymorase I)
Vùng điều khiển gen của Eukaryote chia làm 3 nhómPromoter khác nhau:
2. Promoter nhóm II (promoter của các gen mã hoḠmRNA là vị trítiếp xúc của enzym RNA polymerase II)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 67: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/67.jpg)
Promoter cña c¸c gen m· ho¸ tRNA)
Promoter cña c¸c gen m· ho¸ 5S rRNA)
Phiªn m·
Phiªn m·
3. Promoter nhóm III ( promoter của các gen mã hoá tRNA, r RNA làvị trí tiếp xúc của enzym RNAplymerase III)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 68: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/68.jpg)
Enhancer vµ silcencer- Lµ tr×nh tù ®iÒu hoµ ho¹t
®éng gen- N»m tríc, sau hoÆc trong
gen- Ho¹t ®éng kh«ng phô
thuéc vµo gen
Promoter và vị trí các trình tự enhancer,silencer
Promoter- VÞ trÝ RNA polymerase tiÕp
cËn DNA- VÞ trÝ tiÕp cËn cña nh©n tè
phiªn m·- KiÓm so¸t ho¹t ®éng gen
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 69: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/69.jpg)
Vïng 5’
§iÓm khëi ®Çu phiªn m·
§iÓm kÕt thóc phiªn m·
Vïng 3’
Phiªn m·
mRNA
Cistron 1 Cistron 2 Cistrron 3 Cistron 4
+1
-C¸c gen tËp hîp thµnh Operon gåm nhiÒu cistron cã chung vïng ®iÒu khiÓn (vïng 5’) vµ vïng kÕt thóc (vïng 3’)
-Phiªn m· tõ ®iÓm khëi ®Çu cña cistron 1 cho ®Õn cistron cuèi cïng
-Kh«ng cã qu¸ tr×nh g¾n mò vµ g¾n ®u«i Poly A; Phiªn m· ®ång thêi víi dÞch m·
OPERON
2. CÊu tróc vïng dÞch m· (translated region- ORF)
a. Vïng dÞch m· cña prokaryote
AUG AUG AUG AUG
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 70: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/70.jpg)
Vïng 5’ Exon 1 Exon 2 Exon 3
Intron 1 Intron 2 Intron 3
§iÓm khëi ®Çu phiªn m·
§iÓm kÕt thóc phiªn m·
§iÓm g¾n ®u«i PolyA
Vïng 3’
Phiªn m·
7mGTiÒn mRNA ®· g¾n mò
TiÒn mRNA ®îc g¾n mò & ®u«i PolyA
AAAAAA7mG
7mGmRNA hoµn chØnh
G¾n mò, g¾n ®u«i PolyA
C¾t Intron, nèi Exon
AUG
AUG UAA
AUGAAAAAA
b. Vïng dÞch m· cña Eukaryote
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 71: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/71.jpg)
CÊu tróc gen eukaryote: gen ph©n ®o¹n exon-intron xen kÏ
Gen m· ho¸histon
Gen m· ho¸factor VIII
KÝch thíc gen = 400 bpgåm exon = 400 bp + intron = 0 bp(Kh«ng cã intron)
Gen m· ho¸β-globin
KÝch thíc gen = 1.660 bpGåm exon 990 bp + intron 670 bp
KÝch thíc kho¶ng ~ 186.000 bp;Gåm exon = ~ 9.000 bp + intron = 9.600bp
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 72: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/72.jpg)
+ Vïng 3’ cña prokaryote vµ eukaryote cã cÊu tróc t¬ng ®èi gièng nhau gåm:
- TÝn hiÖu kÕt thóc
- Mét sè tr×nh tù lÆp ng¾n cha râ chøc n¨ng
- Tr×nh tù kÕt thóc ®Ó ph©n biÖt gen nµy víi gen kh¸c (terminator)
+ Vïng 3’ cña eukaryote cã c¸c tr×nh tù ®Æc hiÖu cho g¾n ®u«i poly Adenin
+ Vïng 3’ kh«ng mang m· di truyÒn, nhng lµ cÊu tróc kh«ng thÓ thiÕu ®îc cña gen. G©y ®ét biÕn nh©n t¹o ëvïng 3’ còng g©y biÕn ®æi cÊu tróc gen, cÊu tróc protein t¬ng øng
3. CÊu tróc vïng 3’
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 73: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/73.jpg)
1. Chu kú tÕ bµo
G1
S
G2
M
- G1:Sinh trëng vµ chuÈn bÞ tæng hîp DNA- S: Tæng hîp DNA & histon- G2: Sinh trëng vµ chuÈn bÞ ph©n chia tÕ bµo- M: Nguyªn ph©n
Thêi gian cña chu k× tÕ bµo kh¸c nhau tuú theo lo¹i tÕ bµo, c¬ quan…- TÕ bµo gan chuét 6 th¸ng - TÕ bµo biÓu m« ruét 0,5 giê
II. Tái bản gen (DNA)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 74: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/74.jpg)
1. C¸c gi¶ thuyÕt vÒ t¸i b¶n DNA
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 75: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/75.jpg)
2. T¸i b¶n DNA(theo c¬ chÕ b¸n b¶o thñ)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 76: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/76.jpg)
a. Ch¹c ba t¸i b¶n ë Prokaryote
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 77: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/77.jpg)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 78: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/78.jpg)
*Binding proteins prevent single strands from rewinding.
5’
3’
5’
3’
3’5’
5’3’
Tái bản gen
- Enzym Primase tổng hợp các đoạn RNA ngắnở các đầu 3’ tạo các RNA mồi (RNA primer)
Helicase
Primase
- Enzym topoisomerase tiếp cận vị trí Ori thực hiện quátrình mở xoắn, enzym helicase cắt các liên kết hydro, protein bám dính SSB bám vào các mạch đơn
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 79: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/79.jpg)
5’3’5’3’
5’
3’
3’5’
Tái bản gen
Enzym DNA polymerase gắn các nucleotid với RNA mồi, tổng hợp các mạch đơn
DNA polymerase
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 80: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/80.jpg)
5’ 5’
5’3’
5’
3’
3’
5’
3’
3’
Đoạn Okazaki
Tái bản gen
- Mạch liên tục tổng hợp theo chiều 5’ đến 3’ cùng chiềutháo xoắn của phân tử DNA- Mạch gián đoạn tổng hợp từng đoạn ngắn 5’ đến 3’ngược chiều tháo xoắn gọi là đoạn Okazaki
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 81: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/81.jpg)
5’
5’ 3’
5’
3’
3’
5’
3’
3’
5’ 5’3’
Tái bản gen
- Mạch liên tục tổng hợp theo chiều 5’ đến 3’ cùng chiềutháo xoắn của phân tử DNA- Mạch gián đoạn tổng hợp từng đoạn ngắn 5’ đến 3’ngược chiều tháo xoắn gọi là đoạn Okazaki
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 82: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/82.jpg)
5’
5’
3’ 3’
5’
3’
5’ 3’
5’
3’
3’
5’
Enzym Exonuclease phân huỷ các RNA mồi
Tái bản gen
Enzym Exonuclease
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 83: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/83.jpg)
Enzym Ligase xúc tác hình thành liên kết phosphoestenối liền các đoạn DNA với nhau
3’
5’
3’
5’ 3’
5’
3’
3’
5’
Tái bản gen
Enzym Ligase
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 84: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/84.jpg)
5’3’5’3’
5’
3’
3’5’
5’
5’3’5’3’ 3’
5’
3’
5’3’
5’
3’
3’5’
5’3’
3’5’ 5’
5’3’5’3’ 3’
5’
3’
5’
5’ 3’
5’3’
3’
5’ 5’3’
5’
3’3’5’
3’
5’ 3’
5’3’
3’
5’
3’5’
3’
5’ 3’
5’3’
3’
5’
Tái bản gen
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 85: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/85.jpg)
C¸c ®iÓm Ori c¸ch nhau kho¶ng 150 kb
Hai ph©n tö DNA míi
b. T¸i b¶n DNA ë Eukaryote
5’3’
3’5’
5’3’
3’5’3’5’
5’3’
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 86: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/86.jpg)
• VÒNG TÁI BẢN CỦA DNA
3’5’
5’ 3’
3’ 5’
5’3’
3’5’
5’3’
- C¸c m¹ch ®¬n DNA chØ ®îc tæng hîp theo mét chiÒu tõ 5’ ⇒ 3’- M¹ch nhanh ®îc tæng hîp liªn tôc, m¹ch chËm tæng hîp tõng ®o¹n ng¾n kho¶ng 1000 nu (®o¹n Okazaki)
Sîi chËm(lagging strand)
Sîi nhanh(leading strand)
§o¹n Okazaki
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 87: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/87.jpg)
1. Phiªn m· cña prokaryotea. CÊu tróc RNA polymerase cña prokaryote
RNA polymerase ë E. coli gåm 5 tiÓu phÇn proteinTiÓu phÇn Sè lîng Vai trßα 2 Cha râ chøc n¨ngβ 1 T¹o liªn kÕt phosphodiesteβ ’ 1 g¾n víi DNA khu«n
α2ββ’σ α2ββ’ + σholoenzym T©m enzym polymerase Nh©n tè sigma
(core polymerase)
III. Phiên mã (transcription)
σ 1 G¾n víi promoter lµ nh©n tèkhëi ®Çu phiªn m·
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 88: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/88.jpg)
b. C¬ chÕ phiªn m· ë Prokaryote
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 89: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/89.jpg)
- Phiªn m· tõ ®Çu ®Õn cuèi ph©n tö DNA chung chotÊt c¶ c¸c ciston trong 1 operon- Phiªn m· ®ång thêi víi dÞch m·
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 90: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/90.jpg)
2. Phiªn m· cña Eukaryotea. Nh©n tè phiªn m· vµ RNA polymerase ë eukaryote
- C¸c nh©n tè phiªn m·lÇn lît ®Õn g¾n vµo vÞ trÝt©m promoter.- Nh©n tè TFII F g¾n víienzym t¹o thµnh phøchîp råi tiÕp xóc víipromoter-Nh©n tè TFII S khëi ®éng phiªn m· lµm ®øt liªn kÕtgi÷a 2 m¹ch DNA (mëxo¾n)- Cã 3 lo¹i RNA polymerase kh¸c nhau t¬ng øng víi 3 nhãmpromoter
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 91: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/91.jpg)
b. Phiªn m· ë eukaryote
(Antisense)
(Sense)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 92: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/92.jpg)
RNAPDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 93: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/93.jpg)
Qu¸ tr×nh g¾n mò vµ g¾n ®u«i plyA cho c¸c mRNA
- C¸c ph©n tö mRNA khi tæng hîp ®îc mét ®o¹n (9-11 nu) ë®Çu 5’ ®îc g¾n 1 ph©ntö 7mGppp gäi lµ mò (cap).- Tríc khi kÕt thóc ®îc g¾n 250-350 nucleotid lo¹i A t¹o thµnh ®u«i polyA
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 94: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/94.jpg)
c. C¬ chÕ phiªn m· ë eukaryote
- RNA ®îc tæng hîp trªn m¹ch khu«n (antisense- kh«ng mang m·) cña gen theo chiÒu 5’ ⇒3’- Mçi gen chØ cã 1 m¹ch khu«n, trªn ph©n tö DNA cã nhiÒu gen, c¸c m¹ch khu«n lµ kh¸c nhau- Ph©n tö tiÒn RNA (preRNA) qua qu¸ tr×nh biÕn ®æi thµnh d¹ng ho¹t ®éng, ra khái nh©n tham gia tæng hîp Protein
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 95: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/95.jpg)
4. CÊu tróc tæng qu¸t RNA th«ng tin (mRNA)a. mRNA cña prokaryote
AUGSD AUGSDTr×nh tù Shine- Dalgarno
vµ bé ba më ®Çu
5’ 3’AUGSD
Cistron 2 Cistron 3
lac I P O lac Z lac Y lac A
AUG AUG AUG
AUGSD AUGSDAUG
Tr×nh tù Shine- Dalgarnovµ bé ba më ®Çu
5’
AUG
Tr×nh tù Shine- Dalgarnovµ bé ba më ®Çu
Bé ba AUG m· ho¸ Met kh«ng cã tr×nh tù SD
Shine- Dalgarno
C¸c gen cïng híng t¹o thµnh Operon (Operon Lac gåm 3 gen m· ho¸ 3 protein enzym gäi lµ 3 cistron). C¸c cistron ®îc phiªn m· ®ång thêi cïng víi qu¸ tr×nh dÞch m·
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 96: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/96.jpg)
5’ m7GpppMò
Vïng 5’ kh«ng dÞch m· AUG
Bé ba më ®Çu(initiation codon)
Vïng dÞch m· (coding sequence)
§u«i poly(A)Bé ba kÕt thóc (Termination codon)
AAUAAAVïng 3’ kh«ng dÞch m·
b. mRNA cña eukaryote
UAA (AAAA)N 3’
5’ 7mGppp AUG
Mét bé ba më ®Çu AUG ë ®Çu 5’
AUG
Bé ba AUG m· ho¸ Met kh«ng lµm nhiÖm vô cña bé ba më ®Çu
AAAAAA
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 97: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/97.jpg)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 98: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/98.jpg)
1. §Æc ®iÓm quá trình phiªn m·
+ Prokaryote
- Phiªn m· ®ång thêi cho tÊt c¶ c¸c cistron
- Kh«ng g¾n mò, kh«ng g¾n ®u«i, kh«ng c¾t intron-nèi exon
- mRNA võa míi tæng hîp cã thÓ cho c¸c ribosom tiÕp xóc ngay, qu¸ tr×nh phiªn m· vµ dÞch m· tiÕn hµnh ®ång thêi
+ Eukaryote
- Phiªn m· riªng biÖt ë mçi gen t¹o c¸c ph©n tö tiÒn mRNA- Cã qu¸ tr×nh g¾n mò, g¾n ®u«i vµ c¾t intron vµ nèi exon t¹o
c¸c mRNA hoµn chØnh- mRNA hoµn chØnh míi ®îc ®a ra ngoµi tÕ bµo chÊt tham
gia tæng hîp protein
III. MÃ DI TRUYỀN VÀ QUÁ TRÌNH DỊCH MÃ
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 99: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/99.jpg)
- M· di truyÒn cã 64 bé ba m· ho¸ h¬n 20 lo¹i acid amin trong tæng hîp protein.
- 4 lo¹i nucleotid A, G, C, U nªn 43 = 64- Bé ba më ®Çu: AUG (m· ho¸ methionin)- Ba bé ba kh«ng m· ho¸ acid amin gäi lµ bé ba kÕt thóc: UAA, UAG, UGA§Æc ®iÓm cña m· di truyÒn:
- æn ®Þnh, kh«ng mang tÝnh ®Æc hiÖu loµi- Cã tÝnh linh ho¹t (nucleotid thø 3 cã thÓ thay ®æi, nªn mét lo¹i acid amin cã thÓ do 2 hoÆc nhiÒu bé ba m·ho¸- M· di truyÒn chØ theo mét chiÒu nhÊt ®Þnh, t¹o nªn c¸c khung ®äc m· kh¸c nhau (khung ®äc m· cã thÓliªn tôc hoÆc c¸ch ®o¹n)
2. M· di truyÒn
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 100: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/100.jpg)
B¶ng m· di truyÒn (Genetic Code)
UUUUUCUUAUUG
CUUCUCCUACUG
AUUAUCAUAAUG
GUUGUCGUAGUG
UCUUCCUCAUCG
CCUCCCCCACCG
ACUACCACAACG
GCUGCCGCAGCG
UAUUACUAAUAG
CAUCACCAACAG
AAUAACAAAAAG
GAUGACGAAGAG
UGUUGCUGAUGG
CGUCGCCGACGG
AGUAGCAGAAGG
GGUGGCGGAGGG
Phe
Leu
Leu
Val
Ile
Met
Ser
Pro
Thr
Ala
Tyr
Stop
His
Gln
Asn
Lys
Asp
Glu
Cys
Arg
Ser
Arg
Gly
StopTrp
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 101: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/101.jpg)
H2N-C-C-OHH
R--
O=ATP
H2N-C-C-O-P-O-riboza-adeninH
R--
O=
acid amin
ADP
tRNA
H2N-C-C-OH
R--
O=
Aminoacyl - tRNA
AMP
3’
Adenyl ho¸
a. S¬ ®å ho¹t ho¸ acid amin
(acid amin d¹ng ho¹t ®éng)
5’
5’
Bé ba ®èi m·
Bé ba ®èi m·
3. C¬ chÕ dÞch m·
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 102: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/102.jpg)
b. S¬ ®å kÕt hîp bé ba ®èi m· (tRNA)víi bé ba m· ho¸ (mRNA)
5’ 3’A U GU A C
3’ 5’ tRNAmet
mRNA
5’ 3’
C U AG
G A U
3’ 5’tRNAleu
mRNA
Baz¬ “linh ho¹t”
Mét tRNAleu cã thÓ “®äc” 2 béba m· ho¸ acid amin leucin
Bé ba më ®Çu trªn mRNA
DNAT A CA T G
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 103: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/103.jpg)
c. S¬ ®å phiªn m· vµ dÞch m· ë eukaryote
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 104: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/104.jpg)
Prokaryote:gen ®ång nhÊt (exon) mét gen- mét protein
Eukaryote gen = intron + exon; mét gen- nhiÒu protein
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 105: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/105.jpg)
* C¸c gen trong cïng Operon cña vi khuÈn do mét vïng ®iªï hoµ, c¸c gen ®¬n cã vïng 5’ riªng* C¸c nh©n tè m«i trêng (chÊt dinh dìng, nhiÖt ®é, chÊt ®éc…) cã thÓ ho¹t ho¸ hoÆc øc chÕ ho¹t ®éng cña gen* C¸c møc ®é ®iÒu hoµ gåm:- §iÒu hoµ ë møc phiªn m·- §iÒu hoµ ë møc dÞch m·- §iÒu hoµ b»ng c¸c gen t¨ng cêng (enhancer) hay gen bÊt ho¹t (silencer)
V. Điều hòa dịch mã
1. §iÒu hoµ ho¹t ®éng gen cña prokaryote
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 106: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/106.jpg)
* C¸c gen trong cïng Operon cña vi khuÈn do mét vïng ®iªï hoµ* C¸c nh©n tè m«i trêng (chÊt dinh dìng, nhiÖt ®é, chÊt ®éc…) cã thÓ ho¹t ho¸ hoÆc øc chÕ ho¹t ®éng cña gen* C¸c møc ®é ®iÒu hoµ gåm:- §iÒu hoµ ë møc phiªn m·- §iÒu hoµ ë møc dÞch m·- §iÒu hoµ b»ng c¸c gen t¨ng cêng (enhancer) hay gen bÊt ho¹t (silencer)
V. §iÒu hoµ dÞch m·
1. §iÒu hoµ ho¹t ®éng gen cña prokaryote
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 107: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/107.jpg)
LacI Promoter LacY LacALacZOperatorCAPBindin
RNAPol.
Repressor
Repressor
mRNA
Lac Operon: Khi cã glucose trong m«i trêng (kh«ng cã lactose)
Kh«ng ®îc phiªn m·
1.1. §iÒu hoµ dÞch m· ë lac Operon
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 108: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/108.jpg)
Lac I Promoter LacY LacALacZOperatorCAP
Repressor
mRNA
Lac
Repressor
Repressor
XRNAPol.
RNAPol.
Phiªn m· víi cêng ®é thÊp
Lac Operon: Khi cã glucose vµ lactose trong m«i trêng
1.1. §iÒu hoµ dÞch m· ë lac Operon
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 109: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/109.jpg)
Repressor Promoter LacY LacALacZOperatorCAP
Repressor
mRNA
CAPcAMP
Lac
Repressor
Repressor
XCAPcAMP
CAPcAMP
RNAPol.
RNAPol.
Lac Operon: Khi chØ cã lactose trong m«i trêng (kh«ng cã Glucose)
1.1. §iÒu hoµ dÞch m· ë lac Operon
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 110: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/110.jpg)
Trp
Trp
Repressor
Repressor
Repressor Promo. trpD trpBLead.Operator trpAtrpCtrpEAten.RNAPol.
mRNA
Operon Trp :Khi m«i trêng cã Tryptophan
1.2. §iÒu hoµ dÞch m· ë Trp - Operon
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 111: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/111.jpg)
Trp
Trp
Repressor
Repressor
Repressor Promo. trpD trpBLead.Operator trpAtrpCtrpEAten.RNAPol.
mRNA
Operon Trp :Khi m«i trêng cã Tryptophan
1.2. §iÒu hoµ dÞch m· ë Trp - Operon
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 112: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/112.jpg)
Repressor
Repressor Promo. trpD trpBLead.Operator trpAtrpCtrpEAten.
mRNA
RNAPol.
RNAPol.
Operon Trp :Khi m«i trêng kh«ng cã Tryptophan
1.2. §iÒu hoµ dÞch m· ë Trp - Operon
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 113: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/113.jpg)
- Khi m«i trêng cã hµm lîng tryptophan cao: chØ cã gen L ®îc phiªn m·, dÞch m· kh«ng ®îc thùc hiÖn. - Khi m«i trêng cã hµm lîng tryptophan thÊp: c¶ 6 gen TrpL, TrpE, TrpD, TrpC, TrpB vµ TrpA ®Òu ®îc phiªn m·,: qu¸ tr×nh dÞch m· thùc hiÖn t¹o mét sè s¶n phÈm trung gian cuèi cïng lµ tryptophan ®îc tæng hîp.
Không phiên mã các gen mã hoá Tryptophan
Phiên mã tạo mRNA
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 114: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/114.jpg)
- Khi enzym RNA polymerase tiÕp xóc víi C1 promoter, gen C1 phiªn m· vµ dÞch m· t¹o protein C1. Protein C1 øc chÕ ho¹t ®éng cña gen Cro lµm cho bé gen phage lamda g¾n víi bé gen tÕ bµo. Phage lamda tån t¹i ë d¹ng sinh tan.
Gen Cro kh«ng ho¹t ®éng
2. §iÒu hoµ ho¹t ®éng gen cña phage
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 115: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/115.jpg)
- Khi enzyme RNA polymerase tiÕp xóc víi Cro promoter lµm cho gen Cro ho¹t ®éng phiªn m· vµ dÞch m· t¹o Cro protein. T¸c ®éng cña Cro-protein lµm cho bé gen phage lamda t¸ch khái bé gen tÕ bµo, t¸i b¶n vµph¸ huû tÕ bµo. Phage lamda tån t¹i ë d¹ng g©y ®éc.
Gen C1 kh«ng ho¹t ®éng
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 116: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/116.jpg)
Mçi gen cÊu tróc cã mét vïng ®iªï hoµ riªng
C¸c møc ®é ®iÒu hoµ ho¹t ®éng gen:
- §iÒu hoµ ë møc phiªn m·- §iÒu hoµ ë møc dÞch m·- §iÒu hoµ b»ng thay ®æi ®é dµi ®u«i polyA- §iÒu hoµ b»ng c¸c enhancer hoÆc silencer- §iÒu hoµ b»ng c¸c protein ®Æc hiÖu (hormon, enzym, P53 protein…)
3. §iÒu hoµ ho¹t ®éng gen cña eukaryote
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 117: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/117.jpg)
NST 16
NST 11
§iÒu hoµ gen m· ho¸ globin ngêi
- C¸c nhãm gen m· ho¸ chuçi anpha n»m trªn nhiÔm s¾c thÓ sè 16 chÞu sù kiÓm so¸t cña enhancer (HS-40).- C¸c nhãm gen m· ho¸ chuçi beta n»m trªn nhiÔm s¾c thÓ sè 11 chÞu sù kiÓm so¸t cña tr×nh tù locus control region (LCR)
α
αβ
β
HbA
α- gene
β- gen
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 118: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/118.jpg)
1.1. §iÒu hoµ dÞch m· ë Lac Operon
+ CÊu tróc Operon Lac
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 119: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/119.jpg)
- Khi m«i trêng kh«ng cã lactose, protein øc chÕ (R) g¾n víi Operator.
- Enzyme RNA polymerase kh«ng tiÕp xóc víi promoter, kh«ng cã qu¸ tr×nh phiªn m· vµ dÞch m·
phiªn m· kh«ng ®îc thùc hiÖn
a. M«i trêng kh«ng cã nh©n tè c¶m øng - Lactose
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 120: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/120.jpg)
- Khi m«i trêng cã lactose. Lactose + protein øc chÕ (R) lµm cho protein øc chÕ (R) thay ®æi cÊu h×nh kh«ng g¾n ®îc víi promoter.
- Enzym RNA polymerase tiÕp xóc víi promoter, qu¸ tr×nh phiªn m· vµ dÞch m· ®îc thùc hiÖn
b. M«i trêng cã nh©n tè c¶m øng- Lactose
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 121: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/121.jpg)
1.2. §iÒu hoµ dÞch m· ë Trp – Operon
+ CÊu tróc Operon Tryptophan
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 122: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/122.jpg)
a. M«i trêng cã Tryptophan:
- Protein øc chÕ g¾n víi tryptophan thay ®æi cÊu h×nh vµ g¾n chÆt víi Operator. Enzym RNA polymerase kh«ng tiÕp xóc víi promoter. Qu¸ tr×nh phiªn m· vµ dÞch m· kh«ng ®îc thùc hiÖn.
Protein øc chÕ (repressor)
Tryptophan
Kh«ng cã qu¸tr×nh phiªn m·
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 123: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/123.jpg)
b. M«i trêng kh«ng cã Tryptophan:
-Protein øc chÕ kh«ng g¾n ®îc víi Operator.
- Enzym RNA polymerase g¾n víi promoter, khëi ®éng phiªn m· tæng hîp mRNA. Qu¸ tr×nh dÞch m· ®îc thùc hiÖn t¹o nªn c¸c s¶n phÈm trung gian lµ 5 lo¹i protein E, D, C, B, A cuèi cïng t¹o nªn tryptophan
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 124: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/124.jpg)
- Khi m«i trêng cã hµm lîng tryptophan cao: chØ cã gen L ®îc phiªn m·, dÞch m· kh«ng ®îc thùc hiÖn. - Khi m«i trêng cã hµm lîng tryptophan thÊp: c¶ 6 gen TrpL, TrpE, TrpD, TrpC, TrpB vµ TrpA ®Òu ®îc phiªn m·,: qu¸ tr×nh dÞch m· thùc hiÖn t¹o mét sè s¶n phÈm trung gian cuèi cïng lµ tryptophan ®îc tæng hîp.
Không phiên mã các gen mã hoá Tryptophan
Phiên mã tạo mRNA
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 125: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/125.jpg)
- Khi enzym RNA polymerase tiÕp xóc víi C1 promoter, gen C1 phiªn m· vµ dÞch m· t¹o protein C1. Protein C1 øc chÕ ho¹t ®éng cña gen Cro lµm cho bé gen phage lamda g¾n víi bé gen tÕ bµo. Phage lamda tån t¹i ë d¹ng sinh tan.
Gen Cro kh«ng ho¹t ®éng
2. §iÒu hoµ ho¹t ®éng gen cña phage
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 126: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/126.jpg)
- Khi enzyme RNA polymerase tiÕp xóc víi Cro promoter lµm cho gen Cro ho¹t ®éng phiªn m· vµ dÞch m· t¹o Cro protein. T¸c ®éng cña Cro-protein lµm cho bé gen phage lamda t¸ch khái bé gen tÕ bµo, t¸i b¶n vµph¸ huû tÕ bµo. Phage lamda tån t¹i ë d¹ng g©y ®éc.
Gen C1 kh«ng ho¹t ®éng
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 127: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/127.jpg)
Mçi gen cÊu tróc cã mét vïng ®iªï hoµ riªng
C¸c møc ®é ®iÒu hoµ ho¹t ®éng gen:
- §iÒu hoµ ë møc phiªn m·- §iÒu hoµ ë møc dÞch m·- §iÒu hoµ b»ng thay ®æi ®é dµi ®u«i polyA- §iÒu hoµ b»ng c¸c enhancer hoÆc silencer- §iÒu hoµ b»ng c¸c protein ®Æc hiÖu (hormon, enzym, P53 protein…)
3. §iÒu hoµ ho¹t ®éng gen cña eukaryote
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 128: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/128.jpg)
NST 16
NST 11
§iÒu hoµ gen m· ho¸ globin ngêi
- C¸c nhãm gen m· ho¸ chuçi anpha n»m trªn nhiÔm s¾c thÓ sè 16 chÞu sù kiÓm so¸t cña enhancer (HS-40).- C¸c nhãm gen m· ho¸ chuçi beta n»m trªn nhiÔm s¾c thÓ sè 11 chÞu sù kiÓm so¸t cña tr×nh tù locus control region (LCR)
α
αβ
β
HbA
α- gene
β- gen
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 129: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/129.jpg)
I. C¸c mèc thêi gian nghiªn cøu bé genB. Bộ gen
1995 Bé gen vi khuÈn ®Çu tiªn ®îc giải trình tù4.1996 X¸c ®Þnh trình tù bé gen nÊm men (Saccharomyces
cerevisiae). KÝch thíc 12 Mb, gåm 5.500 gen12.1998 X¸c ®Þnh trình tù bé gen giun trßn (Caenorhabditis elegan ). KÝch thíc 97 Mb, gåm 19.000 gen
3.2000 X¸c ®Þnh trình tù bé gen ruåi dÊm (Drosophila melanogastes). KÝch thíc 137 Mb, gåm 13.500 gen12. 2000 X¸c ®Þnh trình tù bé gen c©y mï t¹t- Mustard (Arabidopsis thaliana). KÝch thíc 125 Mb, gåm 25.498 gen
6. 2000 Dù ¸n bé gen ngêi hoµn thµnh giai ®o¹n 12. 2001 15/16 bé gen ngêi ®· ®îc x¸c ®Þnh trình tù. KÝch thíc 3000 Mb, gåm khoảng 35.000 ~ 40.000 gen
2002 Bộ gen của 35 loµi vi khuÈn ®îc giải trình tù. KÝch thíc trung bình 0.5-5 Mb; cã tõ vµi trăm ®Õn 2000 gen
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 130: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/130.jpg)
- Bé gen lµ tËp hîp tÊt cả c¸c gen trong mét tÕ bµo, bao gåm gen nh©n vµ gen ngoµi nh©n-Bé gen ơ sinh vËt eukaryote gåm gen nh©n tËp hîp thµnh c¸c cÊu tróc ®Æc thï gäi lµ nhiÔm s¾c thÓ. Gen ngoµi nh©n lµc¸c gen n»m trong ti thÓ, l¹p thÓ…-§èi víi sinh vËt prokaryote gen nh©n cã thÓ chØ lµ mét hoÆc vµi ph©n tö DNA d¹ng vßng, d¹ng sîi hoÆc võa d¹ng vßng võa d¹ng sîi. Gen ngoµi nh©n lµ c¸c gen n»m trong plasmid, ti thÓ, l¹p thÓ, …
II. Kh¸i niÖm bé gen
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 131: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/131.jpg)
- CÊu tróc bé gen vi sinh vËt kh¸c nhau tuú nhãm, cha cã cÊu tróc nhiÔm s¾c thÓ ®iÓn h×nh
- PhÇn lín DNA (RNA) cña bé gen m· ho¸ protein, c¸c gen cïng nhãm chøc n¨ng tËp hîp thµnh operon (E. coli bé gen gåm h¬n 600 operon)
- Virus cã bé gen ®a d¹ng: DNA xo¾n kÐp, DNA m¹ch ®¬n, RNA m¹ch ®¬n, RNA m¹ch kÐp
- Vi khuÈn cã bé gen gåm gen nh©n (lµ 1 nhiÔm s¾c thÓ®¬n, cha cã cÊu tróc ®iÓn h×nh), gen ngoµi nh©n gåm gen plasmid gen ti thÓ, l¹p thÓ vµ c¸c gen nh¶y (Tn)
- NÊm men thuéc eukaryote, bé gen gåm gen nh©n cã 16 nhiÔm s¾c thÓ vµ c¸ gen ngoµi nh©n (gen ty thÓ)
- NÊm sîi cã thÓ ®¬n bµo hoÆc ®a bµo, cÊu tróc bé gen ®¬n gi¶n
II. §Æc ®iÓm cÊu tróc bé gen vi sinh vËt
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 132: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/132.jpg)
-----------------------------------------------------------------------------------------------------------------Bé gen Nhãm KÝch thíc (kb) Sè l¬ng gen------------------------------------------------------------------------------------------------------------------------EukaryoteSaccharomyces cerevisiae NÊm men 13.500 (S) 6.000Caenorhabditis elegans Giun trßn 100.000 (S) 13.500Arabidopsis thaliana Thùc vËt 120.000 (S) 25.000Homo sapiens Ngêi 3.200.000 (S) 40.000ProkaryoteEscherichia coli Vi khuÈn 4.700 (V) 4.000Hemophilus influenzae Vi khuÈn 1.830 (V) 1.703Methanococcus jannaschii Vi khuÈn 1.660 (V) 1.738VirusT4 Bacteriophage 172 (S/V) 300HCMV (herpes group) Virus 229 (S) 200Ty thÓS. cerevisiae mitochondria NÊm men 78 (V) 34H. sapiens mitochondria Ngêi 17 (V) 37Chloroplast Liverwort 121 (V) 136PlasmidF plasmid E. coli 100 (V) 29----------------------------------------------------------------------------------------------------------------------V = vßng ; S = sîi
III. KÝch thíc bé gen cña mét sè nhãm sinh vËt
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 133: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/133.jpg)
IV. CÊu tróc bé gen cña mét sè vi sinh vËt
V« hiÖu ho¸ sù ®iÒu chØnh phiªn m·Nef
Viral protein R, bÊt ho¹t gen ART cña tÕ bµo chñ (ngêi) do ®ã lµm suy yÕu tÕ bµo chñ
Vpr
Viral protein U, tham gia gi¶i phãng virus khái tÕ bµoVpu
Protein quy ®Þnh kh¶ tÝnh l©y nhiÔm cña virusVif
§iÒu hoµ sù biÓu hiÖn gen virusRev
§iÒu chØnh sù phiªn m· tÝch cùc cña virusTat
Glycoprotein vá bao gåm (gp41) vµ (gp120)Env
M· ho¸ c¸c enzym: reverse transcriptase, protease, integrase Pol
Protein lâi: vá capsid (p24), NucleocapsidGag
CÊu tróc bé gen HIV
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 134: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/134.jpg)
S¬ ®å cÊu tróc bé gen cña virus
Adenovirus
RNA
Gen 1 Gen 2 Gen 3
HIV
DNA
Gen 1 Gen 2 Gen 3 Gen 4
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 135: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/135.jpg)
CÊu tróc bé gen SARSBé gen SARS lµ ph©n tö RNA kÝch thíc 29727 bp,gåm 2 khung ®äc më, c¸c gen cã ®Æc ®iÓm c¸ch ®o¹n nh HIV,cã vïng siªu biÕn ®æi,
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 136: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/136.jpg)
Bé gen SARS lÊy tõ bÖnh nh©n Hong Kong
bé gen SARS lÊy tõ bÖnh nh©n ë B¾c kinh
Bé gen SARS lÊy tõ bÖnh nh©n Singapore
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 137: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/137.jpg)
Bộ gen virus b¹i liÖt
Bộ gen virus dại (Rhadovirus)
>7 kbPDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 138: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/138.jpg)
S¬ ®å cÊu tróc bé gen
Operon 1 Operon 2
E. coliPDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 139: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/139.jpg)
CÊu tróc bé gen Haemophilus influenzae
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 140: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/140.jpg)
CÊu tróc gen ti thÓ cña nÊm men vµ ti thÓ trong tÕ bµo ngêi
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 141: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/141.jpg)
V. §Æc ®iÓm cÊu tróc bé gen sinh vËt bËc cao
- TÕ bµo cã nh©n ®iÓn h×nh. CÊu tróc bé gen phøc t¹p gåm gen nh©n (t¹o nªn tõ c¸c nhiÔm s¾c thÓ) gen tÕ bµo chÊt (gen ti thÓvµ gen l¹p thÓ)
- C¸c gen cã chøc n¨ng riªng, kh«ng cã hiÖn tîng t¹o Operon
- Gen m· ho¸ protein chØ chiÕm mét phÇn nhá bé gen (1 – 30 %)
- NhiÔm s¾c thÓ cã cÊu tróc ®iÓn h×nh (ë ngêi <2% gen m· ho¸protein)
- Bé gen gåm 2 nhãm: DNA cã chøc n¨ng (m· ho¸ protein hoÆc RNA) vµ DNA kh«ng cã chøc n¨ng vµ cha râ chøc n¨ng (intron vµ c¸c ®o¹n dÞ nhiÔm s¾c)
- Bé gen gåm 3 nhãm DNA:
- DNA kh«ng lÆp l¹i
- DNA lÆp l¹i Ýt
- DNA lÆp l¹i nhiÒu
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 142: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/142.jpg)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 143: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/143.jpg)
§é dµi telomerë tÕ bµo b¹ch cÇu ngêi biÕn ®éng theo løatuæi
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 144: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/144.jpg)
Hä gen mã hoá Hemoglobin ở người
α
β
ζ ψζ ψα1 α1 α2
ε Gγ Aγ ψβ δ β
4020 60 kbp
Nhiễm sắc thể 16
Nhiễm sắc thể 11
80
Mã hoá 4 dạng Hb của người- HbA α2β2- HbF α2γ2 sau khi sinh 3-6 th¸ng được thay thế bởi HbA - HbGower (hemoglobin ph«i)
Gower I α2ε2 Gower II ζ2ε2
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 145: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/145.jpg)
Sù kh¸c nhau trong cÊu tróc bé gen prokaryote vµ eukaryote (so s¸nh 1 ®o¹n 50kb)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 146: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/146.jpg)
Intergenic DNA 52% gåm:- C¸c gen kh«ng ®îc dÞch m·: Xist, H19, His-1, bic, microRNA...- C¸c tr×nh tù, yÕu tè ®iÒu hoµ nh: promoter, enhancer....- C¸c yÕu tè di truyÒn vËn ®éng (transposable elements) nh : LINE, SINE, ...= 40-45%
86% gen kh«ng râ chøc n¨ng
Intergenic DNA52%
Introns34%
M· di truyÒn m· ho¸protein = 1,7%
tRNA, rRNA, = 0,5%
Satellite DNA (centromer, telomer) = 12%
- Gåm 3,4 109 nucleotid, gåm 30 000-40 000 (32.000) gen m· ho¸ proteintØ lÖ gen m· ho¸ protein kho¶ng 1,7% kÝch thíc bé gen. - Trong bé gen tØ lÖ G-C =41%
Đặc điểm bộ gen người
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 147: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/147.jpg)
Bé gen ngêi gåm 2 phÇn c¬ b¶n: gen nh©n vµ gen ti thÓ
Gen nh©n DNA- Bé gen ngêi chøa hµm lîng DNA ~3 X 109 bp- Kho¶ng ~75% DNA bé gen lµ tr×nh tù DNA kh«ng lÆp l¹i- Trong c¸c gen cã tõ 1 ®Õn trªn 75 exon- KÝch thíc gen rÊt kh¸c nhau tõ <100 ®Õn >2,300,000 bp- Tr×nh tù Alu cã ¬ tÊt c¶ c¸c phÇn cña bé gen
Gen ti thÓ mtDNA- Bé gen ti thÓ lµ ph©n tö DNA xo¾n kÐp, d¹ng vßng kÝch thíc kho¶ng 16.569 bp chøa 44% (G+C)- Gåm 37 gen: 24 gen m· ho¸ tRNA vµ 13 gen m· ho¸ 13 chuçi polypeptid
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 148: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/148.jpg)
+ DNA kh«ng mang m· di truyÒn gåm:
- Vïng kh«ng ®îc dÞch m· (Untranslated regions - UTR)
- C¸c intron
- Vïng intergenic (vïng gi÷a gen, gi÷a c¸c gen)
+ C¸c ®o¹n lÆp (repetitive elements): ALU, LINE, SINE, Retroposons…
*ALU: dµi kho¶ng ~ 300nu.Bé gen ngêi cã 600.000 ®o¹n *Retroposons: mét sè ®o¹n gen virus g¾n vµo bé gen*LINE (Long Intersped Elements). L1 dµi 1-7kb gåm
kho¶ng 50000 ®o¹n*SINE (Short Intersped Elements) nh÷ng ®o¹n lÆp
+ C¸c gen gi¶ (pseudogene) lµ nh÷ng ®o¹n gen mang m·, kh«ng ®îc phiªn m· hoÆc ®îc phiªn m· nhng kh«ng ®îc biÓu hiÖn thµnh protein.
Vïng DNA kh«ng mang m· (Non-Coding) cña Eukaryote
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 149: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/149.jpg)
~93%
Cã 1 sè kh¸c biÖt
~3%
64 bé ba m· ho¸
% DNA mang m·di truyÒnM· di truyÒn
Kh«ng cã intronHÇu hÕt c¸c gen cã intronIntron
3730 000 - 40000Sè lîng gen
Vµi ngµn ph©n tötrong mét tÕ bµo
46 ph©n tö trong mét tÕ bµo, 23 ph©n tö trong giao tö.
Sè ph©n tö DNAtrong bé gen
Mét ph©n tö DNA xo¾n kÐp, d¹ng vßng
23 ph©n tö DNA xo¾n kÐp, d¹ng sîi (ë c¸ thÓ XX) hoÆc 24 (ë c¸ thÓ XY)
Sè ph©n tö DNAtrong bé gen
Gen ti thÓ
16.6 kb
Gen nh©n
3300 MbKÝch thíc
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 150: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/150.jpg)
Chương III
Di truyền vi sinh vật
1. Di truyền virus2. Di truyền vi khuẩn3. Di truyền vi nấm
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 151: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/151.jpg)
1. KÝch thíc bé gen cña mét sè nhãm vi sinh vËt
-----------------------------------------------------------------------------------------------------------Bé gen Nhãm KÝch thíc (kb) Sè l¬ng gen-----------------------------------------------------------------------------------------------------
EukaryoteSaccharomyces NÊm men 13.500 (S) 6.000Streptomyces X¹ khuÈn 10 (S)ProkaryoteEscherichia coli Vi khuÈn 4.700 (V) 4.288Hemophilus influenzae Vi khuÈn 1.830,137 (V) 1.743Methanococcus Vi khuÈn 1.660 (V) 1.738Campylobacter jejuni Vi khuÈn 1.641,481 1.708 Myco. tubeculosis Vi khuÈn 4.115,291 3.924 Neisseria meningitidis Vi khuÈn 2.184,406 2.121 VirusT4 Bacteriophage 172 (S/V) 300HCMV (herpes group) Virus 229 (S) 200Phage lamda Bacteriophage 48,512 > 12V = vßng ; S = sîi
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 152: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/152.jpg)
Nucleic Acid
DNA
RNA
M¹ch ®¬n
A. Di truyền virusI. Bé gen virus
M¹ch kÐp
M¹ch ®¬n
M¹ch kÐp
Positive(sense)
Negative(anti-sense)
AUG GCA CGA
UAC CGU GCU
met ala arg
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 153: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/153.jpg)
* Cha cã cÊu t¹o tÕ bµo, gåm 2 phÇn chÝnh vá protein vµ lâi acid nucleic (bé gen). Cã nhiÒu h×nh d¹ng vµ kÝch thíc rÊt kh¸c nhau: h×nh que, h×nh cÇu , h×nh ®a diÖn nhiÒu mÆt…
* Bé gen ®¬n gi¶n ë mét trong 4 d¹ng c¬ b¶n:- DNA xo¾n kÐp (Adenovirus, Herpesvirrus, VR viªm gan B- HBV, phage T, phage λ)- DNA m¹ch ®¬n ( phage ϕ X174, phage M13…)- RNA m¹ch ®¬n (VR sëi - paramyxovirus, VR d¹i - Rhadovirus, VRcóm, quai bÞ - myxovirus influenzae, VR sèt xuÊt huyÕt, viªm n·o -Arbovirus, VR viªm gan HAV, HCV, HDV, vµ HEV; VR HIV…)- RNA m¹ch kÐp ( Reovirus g©y bÖnh sèt lìi xanh ë cõu )
* Bé gen cã thÓ ë d¹ng m¹ch th¼ng, hoÆc m¹ch vßng
* Sè lîng gen Ýt
* C¸c gen cã kh¶ n¨ng biÕn ®æi m¹nh, gióp virus thÝch øng nhanh víi m«i trêng.
1.1. §Æc ®iÓm di truyÒn bé gen virus
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 154: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/154.jpg)
Virus viªm gan B (HBV)- Bé gen DNA m¹ch kÐp
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 155: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/155.jpg)
Bé gen virus viªm gan B (HBV): DNA
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 156: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/156.jpg)
Virus cóm
Virus RNA
Virus HIV
CÊu tróc c¾t ngang Retrovirus Hepatitis A - HAV
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 157: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/157.jpg)
Virus viªm gan C (Hepatitis C- HCV), bé gen RNA
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 158: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/158.jpg)
Hepatitis CBộ gen RNA khoảng 9500 ribonucleotid
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 159: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/159.jpg)
protein
RNA
polymerase
Mµng lipid
glycoprotein
Virus Sëi, quai bÞ (paramyxovirus
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 160: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/160.jpg)
Phát hiện lần đầu tiên 1930Type A
Gây bệnh ở người, gà vịt, lợn, ngựa
Type B, CGây bệnh suy hô hấp ở người
Virus cúm (Influenza virus)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 161: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/161.jpg)
- RNA gồm 8 đoạn cấu trúc khác nhau- Protein vỏ là glycoprotein gồm: Hemaglutinin (H) (80%)
có chức năng giúp virus xâm nhiễm tế bào chủ vàNeuraminidase (N) (20%) giúp virus rời khỏi tế bàoxâm nhiễm tế bào khác
Influenza virus
(N = 9 typ)
(H = 15 typ)
A(H1N1)A(H3N2)A(H5N1)A(H7N3)
….
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 162: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/162.jpg)
Virus DNA
Bacteriophage T2
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 163: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/163.jpg)
1.2. CÊu tróc bé gen mét sè virus
- Gåm 3 nhãm gen chÝnh gag, pol, env cã ë mäi nhãm virus (Virus g©y ung th cã oncogen)
- Hai ®Çu cã ®o¹n tr×nh tù lÆp l¹i (R hay LTR)
- Cã hiÖn tîng gen kh«ng liªn tôc
- Cã c¸c ®o¹n gen siªu biÕn ®æi
Gen kh«ng liªn tôc cña HIV
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 164: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/164.jpg)
Chøc n¨ng c¸c nhãm gen cña Retrovirus
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 165: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/165.jpg)
Ký hiÖu * chØ gen kh«ng cÇn thiÕt cho sù t¸i b¶n cña virus trong tÕ bµo chñ
V« hiÖu ho¸ sù ®iÒu chØnh phiªn m·Nef*
Viral protein R, bÊt ho¹t gen ART cña tÕ bµo chñ (ngêi) do ®ã lµm suy yÕu tÕ bµo chñ
Vpr*
Viral protein U, tham gia gi¶i phãng virus khái tÕ bµoVpu*
Protein quy ®Þnh kh¶ tÝnh l©y nhiÔm cña virusVif*
Rev
Tat
Glycoprotein vá bao gåm (gp41) vµ (gp120)Env
M· ho¸ c¸c enzym: reverse transcriptase, protease, integrase Pol
Protein lâi: vá capsid (p24), NucleocapsidGag
Gen Chøc n¨ng
§iÒu hoµ sù biÓu hiÖn gen virus
§iÒu chØnh sù phiªn m· tÝch cùc cña virus
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 166: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/166.jpg)
Bé gen HIV -1
vµ
cÊu tróc VirionPDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 167: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/167.jpg)
pol:
p10 - enzym protease
p66/51 -enzym phiªn m· ngîc
(reverse transcriptase)
p32 - enzym tÝch hîp (integrase)
Env:
gp120 - glycoprotein vá ngoµi
gp41 - glycoprotein líp mµng trong
LTR - ®o¹n lÆp dµi
U3 - Tr×nh tù 3’ duy nhÊt
U5 - Tr×nh tù 3’ duy nhÊt
R - tr×nh tù kh«ng cÇn thiÕt (redundant)
TAR - C¶m øng tat- gen ®iÒu chØnh phiªn m·
RRE - C¶m øng rev- ®iÒu hoµ biÓu hiÖn gengag:p17 - protein capsid phôp24 - protein capsid chÝnhp7, p9 - protein nucleocapsid b¸m dÝnh
Chøc n¨ng c¸c nhãm gen cña HIV: RNA
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 168: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/168.jpg)
Bé gen phage Lamda: (DNA)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 169: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/169.jpg)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 170: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/170.jpg)
II. X©m nhiÔm vµ t¸i b¶n cña virus
2.1. Virus sinh tan + Kh¸i niÖm: Virus sinh tan sau khi x©m nhiÔm tÕ bµo, bé gen cña virus g¾n víi bégen cña tÕ bµo t¹o nªn tiÒn virus (provirus)
+ §Æc ®iÓm:- Cã enzym phiªn m· ngîc (nhãm virus RNA) hoÆc kh«ng cã enzym phiªn m· ngîc (nhãm virus DNA) - Thêi gian tån t¹i ë d¹ng provirus phô thuéc lo¹i tÕ bµo, ®iÒu kiÖn ngo¹i c¶nh
1. Virus x©m nhiÔm tÕ bµo
2. RNA virus phiªn m·ngîc t¹o cDNA cña virus
3. Bé gen virus g¾n vµo bégen tÕ bµo t¹o provirus
4. Phiªn m· vµ dÞch m· t¹o protein vá vµ RNA virus
5. L¾p ghÐp t¹o virion, tiÕp tôc chu tr×nh x©m nhiÔm míi
Retrovirus x©m nhiÔm tÕ bµo
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 171: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/171.jpg)
HIV x©m nhiÔm tÕ bµo
Viral RNA vµo tÕ bµo, phiªn m· ngîc t¹o cDNA
Viral cDNA g¾n vµo bégen tÕ bµo t¹o provirus
1
2
3
4
L¾p ghÐp, gi¶i phãng virus
5
CapsidEnzym phiªn m· ngîc
Virus RNA virus
DNA
Provirus
Viral RNA
RNA
Viral proteinTæng hîp RNA ®Æc hiÖu cña virus, vµprotein virus
Phiªn m· ngîc
Viral RNA
X©m nhiÔm vµ t¸i b¶n cña Retrovirus
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 172: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/172.jpg)
X©m nhiÔm cña HIV
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 173: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/173.jpg)
C¬ chÕ HIV x©m nhiÔm tÕ bµo
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 174: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/174.jpg)
2.2. Virus ®éc (virulent)- Bé gen cña virus ®éc sau khi x©m nhiÔm tÕ bµ, t¸i b¶n ngay t¹o nªn c¸c virion.
- C¸c gen cña virus kh«ng ®îc g¾n vµo bé gen tÕ bµo chñ
- Kh«ng cã enzym phiªn m· ngîc
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 175: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/175.jpg)
2.3. Cơ chế của sự sinh tan
- X©m nhiÔm vµ t¸i b¶n cña phage Lamda
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 176: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/176.jpg)
- Vai trß nhiÖt ®é víi cña phage Lamda
+ NhiÖt ®é cao, tia phãng xạ, chất độc ho¸ học… lµm cho
virus sinh tan chuyÓn sang g©y ®éc
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 177: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/177.jpg)
III. T¸i tæ hîp di truyÒn cña virus
1. Virus - virus
2. Virus - vi khuÈn
3. Virus - sinh vËt bËc cao
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 178: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/178.jpg)
IV. T¸i b¶n gen cña mét sè nhãm virus
1. T¸i b¶n gen cña virus DNA m¹ch kÐp (phage T, virus ®Ëu mïa, adenovirus, herpes virus…), t¸i b¶n gen kiÓu Okazaki gièng nh ë vi khuÈn vµ sinh vËt eukaryote
2. T¸i b¶n gen cña virus DNA m¹ch ®¬n (phage X174, phage M13…), t¸i b¶n gen nhê tæng hîp m¹ch (-) t¹o d¹ng t¸i b¶n vßng kÐp, tõ m¹ch (-) tæng hîp bé gen virus
3. T¸i b¶n gen cña virus RNA m¹ch ®¬n (Retrovirus, HIV, virus cóm…), t¸i b¶n gen nhê enzym phiªn m· ngîc tæng hîp cDNA m¹ch kÐp sau ®ã phiªn m· t¹o RNA cña bé gen
4. T¸i b¶n gen cña virus RNA m¹ch kÐp (Reovirus), t¸i b¶n gen gièng nh virus RNA m¹ch ®¬n do chØ cã mét m¹ch mang th«ng tin di truyÒn ®îc ®a vµo tÕ bµo
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 179: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/179.jpg)
B. Di truyền vi khuẩnI. §Æc ®iÓm di truyÒn vi khuÈn1. §Æc ®iÓm chung
- Bé gen vi khuÈn cã 1 sîi DNA m¹ch kÐp d¹ng vßng, hoÆc th¼ng gäi lµ NST ®¬n ( single chromosome ) hoÆc cã DNA d¹ng vßng vµ d¹ng sîi cßn gäi lµ NST kÐp
- KÝch thíc bé gen kh¸c nhau tuú loµi. VÝ dô: NST ®¬n ởMycoplasma ~750 kb, Escherichia coli – 5 Mb,Streptomyces -10 Mb; nhiÔm s¾c thÓ kÐp nh Burkholderia pseudomallei(3.6 vµ 2.4 Mb), Rhodobacter spheroides (3Mb vµ 1Mb) mét sè vi khuÈn cã bé gen d¹ng sîi rÊt lín ~ 1000 Mb ở vi khuÈn Borrelia burgdorferi
- C¸c gen cïng híng trao ®æi chÊt tạo thµnh c¸c Operon- Gen ®ång nhÊt gåm, toµn bé gen mang m· di truyÒn- Ngoµi gen nh©n cßn cã mét sè gen n»m trong c¸c c¬ quan
tö trong tÕ bµo chÊt nh plasmid, vµ mét sè gen n»mtrong c¸c c¬ quan tö (l¹p thÓ)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 180: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/180.jpg)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 181: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/181.jpg)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 182: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/182.jpg)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 183: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/183.jpg)
KÝch thíc bé gen mét sè loµi vi khuÈn (Mb)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 184: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/184.jpg)
S¾p xÕp bé gen cña vi khuÈn
S¬ ®å s¾p xÕp bé gen E.coli
Sù thay ®æi tr¹ng th¸i cÊu tróc bégen vi khuÈn
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 185: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/185.jpg)
CÊu tróc bé gen E. coli (chromosom E. coli)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 186: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/186.jpg)
CÊu tróc bé gen vi khuÈn S. typhimurium
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 187: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/187.jpg)
- C¸c vßng DNA kÝch thíc nhá, tù t¸i b¶n vµ cho phÐp cµi g¾n DNA ngo¹i lai - Mang c¸c gen kh¸ng chÊt kh¸ng sinh- Mang c¸c gen s¶n sinh ®éc tè (toxin gene)- Plasmid giíi tÝnh (F plasmid) gióp qu¸ tr×nh giao n¹p- Ph©n lo¹i plasmid theo nhiÒu c¸ch+ Plasmid tù nhiªn hay plasmid nh©n t¹o: ColE1, F , pBR322, pUC….+ Dùa vµo plasmid giíi tÝnh chia lµm 2 lo¹i: F+ vµ F- ( plasmid tiÕp hîp hay kh«ng tiÕp hîp)+ Dùa vµo kÝch thước vµsè lîng b¶n sao trong 1 tÕ bµo: Plasmid nhá (5-10 kb) cã 50-100 copy/1tÕ bµo, streptomyces cã1000plasmidPlasmid lín (50-200 kb) cã kho¶ng 1- 10 copy/ 1tÕ bµo+ Dùa vµo c¸c gen sinh kh¸ng sinh, c¸c gen sinh ®éc tè…
2. §Æc ®iÓm di truyÒn plasmid cña vi khuÈn
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 188: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/188.jpg)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 189: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/189.jpg)
Plasmid tù nhiªn Plasmid nh©n t¹o
Plasmid cña E. coli mang c¸c gen kh¸ng chÊt kh¸ng sinh vµc¸c gen nh¶y Tn 3, Tn 5, Tn 10
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 190: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/190.jpg)
3. T¸i tæ hîp ë vi khuÈn
1. T¸i tæ hîp gi÷a c¸cplasmid trong 1 tÕbµo
2. T¸i tæ hîp Plasmid víi bé gen vi khuÈnt¹o Episom
3. T¸i tæ hîp Plasmid víi bé gen ®éng vËtthùc vËt(Agrobacterium)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 191: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/191.jpg)
4. §Æc ®iÓm di truyÒn c¸c ®o¹n xen IS (Insertion sequences)
vµ gen nh¶y Transposon (Tn)
- IS lµ c¸c ®o¹n DNA nhá cã thÓ thay ®æi vÞ trÝ trªn bé gen vi khuÈn- §o¹n xen cã thÓ g©y ®ét biÕn ë mét Operon hoÆc bé gen, khi t¸ch khái Operon hoÆc bé gen trë l¹i tr¹ng th¸i b×nh thêng- §o¹n xen lµ mét thµnh phÇn quan träng cña c¸c gen nh¶y Transposon (Tn)- KÝch thíc c¸c gen nh¶y kh¸c nhau Tn3 = 3,5kb; Tn25 = 13,7 kb Tn21 =19 kb; Tn4 = 22 kb- Gen nh¶y thêng chøa c¸c gen kh¸ng chÊt kh¸ng sinh hoÆc sinh ®éc tè t¹o nªn hiÖn tîng nhên thuèc ë vi khuÈn
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 192: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/192.jpg)
1. ChuyÓn vËt chÊt di truyÒn gi÷a c¸c thÕ hÖ
- Ph©n chia tÕ bµo
- H×nh thµnh bµo tö
2. ChuyÓn vËt chÊt di truyÒn trong cïng thÕ hÖ
- BiÕn n¹p (Transformation)
- T¶i n¹p (Transduction )
- Giao n¹p (Conjugation)
II. C¬ chÕ chuyÓn vËt chÊt di truyÒn ëvi khuÈn
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 193: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/193.jpg)
Ph©n chia cñatÕ bµo vi khuÈn
1. ChuyÓn vËt chÊt di truyÒngi÷a c¸c thÕ hÖ
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 194: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/194.jpg)
Qu¸ tr×nh h×nhthµnh bµo töcña vi khuÈn
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 195: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/195.jpg)
2.1. BiÕn n¹p (Transformation)
a. ThÝ nghÝÖm GrÝffÝth 1928 (BÝÕn n¹p tù nhݪn)
D¹ng S cã mµng nhÇy, sinh ®éc tè
D¹ng R kh«ng cã mµng nhÇy, kh«ng sinh ®éc tè ®éc tè
2. ChuyÓn vËt chÊt di truyÒn trong cïng thÕ hÖ
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 196: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/196.jpg)
D¹ng R
D¹ng S
D¹ng S ®un nãng
D¹ng S ®un nãng + R
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 197: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/197.jpg)
b. C¬ chÕ biÕn n¹p
- Cã ®iÓm thô c¶m trªn mµng tÕ bµo cho phÐp DNA biÕn n¹p vµo tÕ bµo
-TiÕp xóc trùc tiÕp gi÷a DNA biÕn n¹p víi bé gen tÕ bµo nhËn
- Cã ®o¹n t¬ng ®ång gi÷a DNA biÕn n¹p víi DNA bé gen tÕ bµo
- T¸i tæ hîp gi÷a DNA biÕn n¹p vµ DNA bé gen
- DNA biÕn n¹p g¾n víi bé gen tÕ bµo lµm cho tÕ bµo cã c¸c ®Æc ®iÓm míi
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 198: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/198.jpg)
c. BiÕn n¹p nh©n t¹o
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 199: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/199.jpg)
2.2. T¶i n¹p (Transduction )
a. ThÝ nghiÖm t¶i n¹p (Zinder , Lederberg 1952)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 200: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/200.jpg)
Phage T2
TÕ bµo (D) cã gen a+ vµ b+
Phage T2 mang gen a+
Phage T2 mang gen b+
Phage T2 mang gen b+
Phage T2 mang gen a+
TÕ bµo (R) cã gen a -
TÕ bµo (R) ®¸nhËn gen a+
b. T¶i n¹p chung
- Kh¸i niÖm
- C¬ chÕ:
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 201: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/201.jpg)
c. T¶i n¹p ®Æc hiÖu
- Kh¸i niÖm
- C¬ chÕ
X©m nhiÔm E.coli cã thÓ chuyÓn gen thr+
cho tÕ bµo nhËn
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 202: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/202.jpg)
C¬ chÕ t¸i tæ hîp vµ t¶i n¹p
gi÷a phage λ vµ E. coli
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 203: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/203.jpg)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 204: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/204.jpg)
d. C¬ chÕ t¶i n¹p
- Cã sù tham gia cña nh©n tè t¶i n¹p lµ virus
- Thùc chÊt lµ qu¸ tr×nh t¸i tæ hîp kÐp
+ T¸i tæ hîp gi÷a virus víi vi khuÈn thÓ cho (D) t¹o nªn virus t¸i tæ hîp mang gen cña thÓ cho (D)
+ T¸i tæ hîp gi÷a virus t¸i tæ hîp mang gen cña thÓcho (D) víi vi khuÈn thÓ nhËn (R) lµm cho mét gen hoÆc vµi gen cña vi khuÈn thÓ cho (D) ®îc chuyÓn sang vi khuÈn thÓ nhËn (R)
T¶i n¹p chung lµ chuyÓn mét gen bÊt k×, cßn t¶in¹p ®Æc hiÖu lµ chØ chuyÓn mét gen nhÊt ®Þnh nµo ®ã
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 205: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/205.jpg)
e. §iÒu kiÖn cña t¶i n¹p
- Cã sù tham gia cña nh©n tè t¶i n¹p lµ virus
- Thùc chÊt t¶i n¹p lµ qu¸ tr×nh t¸i tæ hîp kÐp
+ T¸i tæ hîp gi÷a virus víi vi khuÈn thÓ cho (D) t¹o nªn virus t¸i tæ hîp mang gen cña thÓ cho (D)
+ T¸i tæ hîp gi÷a virus t¸i tæ hîp mang gen cña thÓcho (D) víi vi khuÈn thÓ nhËn (R) lµm cho mét gen hoÆc vµi gen cña vi khuÈn thÓ cho (D) ®îc chuyÓn sang vi khuÈn thÓ nhËn (R)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 206: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/206.jpg)
- 1953 William Hayes ph¸t
hiÖn nh©n tè giíi tÝnh (F) ë vi
khuÈn E.coli
- TÕ bµo cã nh©n tè F gäi lµ
tÕ bµo F+ vµ tÕ bµo kh«ng cã
nh©n tè F gäi lµ tÕ bµo F -
- Nh©n tè giíi tÝnh F cã thÓ
t¸i tæ hîp víi nhiÔm s¾c thÓ
t¹o episom, h×nh thµnh nªn
tÕ bµo Hfr (t¸i tæ hîp cao)
2.3. Giao n¹p (Conjugation)
a. Nh©n tè giíi tÝnh F
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 207: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/207.jpg)
T¸i tæ hîp nh©n tè giíi tÝnh F víi bé gen t¹o episomvµ h×nh thµnh tÕ bµo Hfr
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 208: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/208.jpg)
3.2. Giao n¹p gi÷a F+ víi F-
3.3. Giao n¹p gi÷a Hfr vµ tÕ bµo F -
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 209: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/209.jpg)
3.4. C¬ chÕ giao n¹p gi÷a Hfr vµ tÕ bµo F -
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 210: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/210.jpg)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 211: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/211.jpg)
C. Di truyền vi nấm
I. Di truyền nấm men
II. Di truyền nấm mốc
III. Di truyền Neurospora crassa
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 212: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/212.jpg)
Chương 4
CÁC QUY LUẬT DI TRUYỀN
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 213: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/213.jpg)
Hiện tượng di truyền?
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 214: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/214.jpg)
Gregor Mendel thầy tu, nhà tự nhiên học, pháthiện quy luật di truyền cácđặc điểm ở đậu Hà lan1865
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 215: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/215.jpg)
A. Một số khái niệm cơ bản1. Kh¸i niÖm- Di truyÒn nhiÔm s¾c thÓ lµ sù di truyÒn cña c¸c tÝnh
tr¹ng x¸c ®Þnh bëi c¸c gen n»m trªn NST. - C¸c tÝnh tr¹ng ®îc di truyÒn qua c¸c thÕ hÖ mang tÝnh quy luËt, trªn c¬ së sù ph©n ly ®éc lËp, tæ hîp tù do cña c¸c NST trong nguyªn ph©n, gi¶m ph©n vµ thô tinh.
- Gen (gene): nh©n tè di truyÒn qui ®Þnh c¸c ®Æc ®iÓm tÝnh chÊt cña sinh vËt: nh h¹t vµng, lôc...
- Alel (alelle): C¸c tr¹ng th¸i kh¸c nhau cña mét gen, tr¹ng th¸i tréi gäi lµ alen tréi (cßn gäi lµ gen tréi), tr¹ng th¸i lÆn gäi lµ alen lÆn (cßn gäi lµ gen lÆn).
- KiÓu gen (genotype): tËp hîp c¸c gen trong c¬ thÓ, thêng chØ xÐt ®Õn mét sè gen ®ang nghiªn cøu.
- TÝnh tr¹ng: lµ ®Æc ®iÓm, tÝnh chÊt do gen qui ®Þnh- KiÓu h×nh (phenotype): lµ c¸c tÝnh tr¹ng do kiÓu gen qui
®Þnh ®îc biÓu hiÖn
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 216: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/216.jpg)
B. C¸c qui luËt di truyÒn nhiễm sắc thể
1. Quy luËt di truyÒn Mendela/ §Æc ®iÓm chung- N¨m 1865 Gregor Mendel ngêi ®Çu tiªn kh¸m ph¸ qui
luËt vÒ sù di truyÒn c¸c tÝnh tr¹ng, - N¨m 1900 c«ng tr×nh nghiªn cøu trªn 16 loµi thùc vËt
kh¸c nhau cña 3 nhµ khoa häc Hugo Vries (Hµ Lan), E. Correns (§øc) vµ E. Tschermak (¸o) c¸c qui luËt di truyÒn Mendel ®îc t¸i ph¸t hiÖn.
- C«ng tr×nh nghiªn cøu cña Gregor Mendel ®îc tËp hîp thµnh 3 quy luËt di truyÒn:1. Quy luËt tÝnh tréi2. Quy luËt ph©n ly tÝnh tr¹ng3. Quy luËt ph©n ly ®éc lËp
- TØ lÖ ph©n li ®Æc trng 1 cÆp tÝnh tr¹ng 3 :1- TØ lÖ ph©n li ®Æc trng 2 cÆp trÝnh tr¹ng 9:3:3:1
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 217: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/217.jpg)
b/ S¬ ®å lai
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 218: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/218.jpg)
c/ C¬ së ph©n tö cña quy luËt di truyÒn Mendel
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 219: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/219.jpg)
2. C¸c quy luËt di truyÒn liªn kÕt gen2.1. Di truyÒn liªn kÕt gen hoµn toµn
- T. Morgan vµ céng sù chøng minh c¸c gen x¾p xÕp theo ®êng th¼ng trªn nhiÔm s¾c thÓ.
- C¸c gen trªn cïng nhiÔm s¾c thÓ t¹o nªn mét nhãm liªn kÕt gen, mçi nhiÔm s¾c thÓ lµ mét nhãm liªn kÕt gen. - P kh¸c nhau bëi 2 cÆp gen
P AB x abAB ab
GP AB abF1 AB
abG F1 AB, abF2 AB AB AB ab
AB ab ab abTØ lÖ ph©n ly kiÓu gen 1: 2 :1TØ lÖ ph©n ly kiÓu h×nh 3: 1
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 220: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/220.jpg)
- P kh¸c nhau bëi 3 cÆp genP ABD x abd
ABD abdGP ABD abdF1 ABD
abdGF1 ABD, abdF2 ABD ABD ABD abd
ABD abd abd abd
TØ lÖ ph©n li kiÓu gen 1: 2 :1TØ lÖ ph©n li kiÓu h×nh 3:1
NhËn xÐt: Liªn kÕt hoµn toµn dÉn ®Õn c¸c phÐp lai 2 hay nhiÒu cÆp gen cho tØ lÖ ph©n li kiÓu gen, kiÓu h×nh t gièng nhau.
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 221: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/221.jpg)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 222: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/222.jpg)
2.2. Di truyÒn liªn kÕt gen hoµn toµn cã ho¸n vÞ gen
- N¨m 1931 c¸c thÝ nghiÖm cña H. B. Creighton vµ B. Mc. Clintock trªn c©y ng« vµ thùc nghiÖm cña C. Stern trªn ruåi giÊm ®· ®a ra nh÷ng b»ng chøng tÕ bµo häc cña trao ®æi chÐo.- Qui íc mét ®¬n vÞ Morgan hay 1 Centi Morgan (cM) b»ng 1% tÇn sè ho¸n vÞ gen. TÇn sè ho¸n vÞ gen biÓu hiÖn kho¶ng c¸ch gi÷a c¸c gen trªn nhiÔm s¾c thÓ. - TÇn sè ho¸n vÞ gen (f%)
f%= Sè c¸ thÓ t¸i tæ hîp X 100Tæng sè c¸ thÓ thu ®îc ë ®êi con
(XÐt trêng hîp c¸c gen tréi n»m trªn 1 nhiÔm s¾c thÓ)
- Tõ tÇn sè trao ®æi chÐo cã thÓ x¸c ®Þnh kho¶ng c¸ch c¸c gen trªn NST, lËp ®îc b¶n ®å liªn kÕt gen
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 223: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/223.jpg)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 224: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/224.jpg)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 225: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/225.jpg)
3. C¸c quy luËt di truyÒn giíi tÝnh vµ di truyÒn liªn kÕt víi giíi tÝnh
2.3.1. Di truyÒn giíi tÝnh
a/ C¬ chÕ x¸c ®Þnh giíi tÝnh+ Giíi tÝnh do NST giíi tÝnh qui ®Þnh:
cã 4 kiÓu x¸c ®Þnh giíi tÝnh chñ yÕu:
- KiÓu X – Y: ngêi, ®v, tv...NST thêng + XY = ®ùcNST thêng + XX = c¸i
- KiÓu X – 0: C«n trïng, rÖp c©y, giun tròn...NST thêng + XO = ®ùcNST thêng + XX = c¸i
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 226: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/226.jpg)
Nhiễm sắc thể giới tính người
Bản đồ nhiễm sắc thể người
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 227: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/227.jpg)
- KiÓu Z – W: Chim, gµ...NST thêng + ZZ = ®ùcNST thêng + ZW = c¸i
- KiÓu §¬n béi – Lìng béi: ong..NST ®¬n béi = ®ùcNST lìng béi = c¸i
+ Giíi tÝnh do m«i trêng qui ®Þnh:vÝ dô : c¸ sÊu tØ lÖ ®ùc c¸i do nhiÖt ®é Êp trøng
b/ Di truyÒn nhiÔm s¾c thÓ giíi tÝnh kh«ng b×nh thêngg©y nªn c¸c bÖnh lÝChromosome 21: Down’s syndromeXXY: Klinefelter syndromeYYX: Jacobs syndromeXXX: poly-X syndrome XO : Turner’s syndrome
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 228: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/228.jpg)
2. Di truyÒn liªn kÕt giíi tÝnhGen x¸c ®Þnh tÝnh tr¹ng thêng n»m trªn NST giíi tÝnh X- C¸c gen x¸c ®Þnh bÖnh m¸u khã ®«ng, mï mµu, mÊt kh¶
n¨ng miÔn dÞch… do mét gen lÆn n»m trªn NST giíi tÝnh X
- TÝnh tr¹ng do gen lÆn n»m trªn NST X kh«ng cã gen l¨nt¬ng øng trªn NST Y
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 229: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/229.jpg)
Mèo cái dị hợp tử có lông tam thể, do gen xác địnhmàu lông liên kết trên NST giới tính X, ít (không) gặpmèo đực tam thể
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 230: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/230.jpg)
Gen chỉ có trên nhiễm sắc thể Y: có chùm lông tai, di truyền theo bố
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 231: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/231.jpg)
4. C¸c quy luËt di truyÒn t¬ng t¸c gen
+ T¬ng t¸c gen ?
- Mét cÆp tÝnh tr¹ng do 2 hay nhiÒu cÆp gen kiÓm so¸t
- T¹o nªn c¸c tØ lÖ ph©n li ®Æc trng riªng nh 9:7, 9:6:1,
12:3:1, 9:3:4, 15:1....
VÝ dô 1:
P: BÝ qu¶ trßn x BÝ qu¶ trßn
AAbb aaBB
F1 AaBb (Qu¶ dÑt) x AaBb (Qu¶ dÑt)
F2 9(A-B-): 3(A-bb), 3(aaB-): 1 (aabb)
9/16 Qu¶ dÑt 6/16 Qu¶ trßn 1/16 Qu¶ dµi
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 232: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/232.jpg)
VÝ dô 2:P: Chuét l«ng ®en (BBCCx Chuét l«ng tr¾ng (bbcc) F1: BbCc x¸m x BbCc x¸mF2: 9 ®en : 3 x¸m:4 tr¾ng
B: x¸c ®Þnh s¾c tè ®enb: x¸c ®Þnh s¾c tè x¸mC: H×nh thµnh s¾c tèc: kh«ng t¹o thµnh s¾c tè
cc > B/b
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 233: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/233.jpg)
+ TØ lÖ ph©n li trong t¬ng t¸c gi÷a 2 cÆp gen(n»m trªn c¸c cÆp NST kh¸c nhau)
AaBb x AaBb
9: 6: 11aabb3(aaB-)3(A-bb9(A-B-)
12: 3: 11aabb3(aaB-)3(A-bb9(A-B-)
13: 31aabb3(aaB-)3(A-bb9(A-B-)
15:11aabb3(aaB-)3(A-bb9(A-B-)
9: 3: 41aabb3(aaB-)3(A-bb9(A-B-)
9: 71aabb3(aaB-)3(A-bb9(A-B-)
9:3:3:11aabb3(aaB-)3(A-bb)9(A-B-)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 234: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/234.jpg)
- Hệ nhóm máu MN có 2 allel: LM và LN
Kiểu gen LMLM có nhóm máu MKiểu gen LMLN có nhóm máu MNKiểu gen LNLN có nhóm máu N
5. Quy luËt di truyÒn ®ång tréi
- Nhãm m¸u ë ngêi, ®éng vËt di truyÒn ®ång tréi- ë ngêi hÖ nhãm m¸u ABO do 3 allel qui ®Þnh: IB, IA, iO
KiÓu gen IA IA vµ IA iO cã nhãm m¸u AKiÓu gen IB IB vµ IB iO cã nhãm m¸u BKiÓu gen IA IB, cã nhãm m¸u ABKiÓu gen iO iO, cã nhãm m¸u O
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 235: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/235.jpg)
P:
F1:
F2:
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 236: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/236.jpg)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 237: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/237.jpg)
6. Quy luật di truyền dãy đa allel
+ Sự di truyền tính trạngmàu mắt người
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 238: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/238.jpg)
+ Di truyền tính trạng mµu h¹t lóa m× do d·y ®a alel A1 A2 vµ a1 a2 kiÓm so¸t → mµu h¹t thay ®æi tõ ®á thÉm ®Õn tr¾ng
P H¹t mµu ®á ®Ëm x H¹t kh«ng mµu A1 A1 A2 A2 a1 a1 a2 a2
F1 A1 a1 A2 a2 (hång) x A1 a1 A2 a2 (hång) F2 KiÓu h×nh ë F2: 15 cã mµu: 1 kh«ng mµu
1 H¹t mµu ®á ®Ëm (cã 4 alel tréi)4 H¹t mµu ®á (cã 3 alel tréi)6 H¹t mµu hång (cã 2 alel tréi)
4 H¹t cã mµu hång nh¹t (cã 1 alel tréi)1 H¹t kh«ng mµu (cã 4 alel lÆn)
- TØ lÖ ph©n li kiÓu gen F2: 1: 4: 6: 4: 1
+ T¬ng t¸c d·y ®a allel có thể t¹o nªn c¸c tØ lÖ ph©n ly khác: 15:1, 63:1, 1:62:1....
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 239: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/239.jpg)
I. Di truyền ti thể
1. CÊu tróc ti thÓ (Mitochondria)
- Ti thÓ ®îc Altaman ph¸t hiÖn 1894 - Cã h×nh bÇu dôc, kÝch thíc 0,5 -1,0 µm (lín nhÊt 7 µm )- CÊu tróc tõ 2 líp mµng, t¹o thµnh c¸c xoang (tói)- Mçi tÕ bµo ®éng vËt, thùc vËt cã vµi tr¨m ti thÓ, trong mçi ti thÓ
C. Qui luật di truyÒn ngoµi nhân
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 240: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/240.jpg)
2. Di truyÒn ti thÓ
- Trong mçi ti thÓ cã nhiÒu b¶n sao hÖ gen ti thÓ (mtDNA) - KÝch thíc mtDNA kh¸c nhau: S. Cerevisiae cã mtDNA (84 kb); ë ngêi, chuét vµ mét sè ®éng vËt cã vó kÝch thíc mtDNA kho¶ng 16,5 kb, ë thùc vËt cã bé gen ti thÓrÊt lín (ë ng« kho¶ng 570 kb).
- Bé gen ti thÓ ë ®éng vËt cã vó cã cÊu tróc t¬ng ®èi gièng nhau, mçi mtDNA gåm 37 gen.- Cã 13 gen m· ho¸protein, 22 gen m· ho¸tRNA vµ 2 gen m· ho¸rRNA.
Bé gen ti thÓ ngêi
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 241: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/241.jpg)
3. Chøc n¨ng ti thÓ- Ti thÓ lµ tr¹m chuyÓn ho¸ n¨ng lîng chøa trong
c¸c chÊt dinh dìng thµnh d¹ng n¨ng lîng sö dông cho mäi ho¹t ®éng sèng cña tÕ bµo (ATP)
- Ti thÓ lµ n¬i diÔn ra qu¸ tr×nh oxi ho¸ photphorin ho¸ gåm 3 qu¸ tr×nh: chu tr×nh KREBS (gi¶i phãng ®iÖn tö), d·y h« hÊp (truyÒn ®iÖn tö) vµ photphorin ho¸ (tæng hîp ATP)
- §ét biÕn g©y biÕn ®æi cÊu tróc gen ti thÓ cã thÓ g©y mét sè bÖnh ë ngêi
M-TerAT-del8042D thõa acid lacticMTCO2
Ter-KA-G7444TËt ®iÕc do thÇn kinh thÝnh gi¸c
MTCO1
W-TerG-A5920Chøng lêi vËn ®éngMTCO1
aaBiÕn ®æi
VÞ trÝBÖnhGene
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 242: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/242.jpg)
LeuThrLeuLeuLeuCUU,CUC,CUA,CUG
IleMetMetMetIleAUUIleMetMetMetIleAUA
ArgArgSerStopArgAGA,AGGStopTripTripTripStopUGA
Thùc vËtNÊm men
Ruåi giÊm
§éng vËt cã vó
M· di truyÒn cña gen ti thÓM· ditruyÒn gen nh©n
Bé bam· ho¸
M· di truyÒn cña mtDNA cña ti thÓ cã mét sè kh¸c biÖt víi m· di truyÒn cña c¸c gen nh©n ë c¶ sinh vËt prokaryote vµ sinh vËt eukaryote.
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 243: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/243.jpg)
II. Di truyền lạp thể
1. CÊu tróc l¹p thÓ (Plastide)
+ L¹p thÓ ®îc Schimper m« t¶ 1885+ L¹p thÓ gåm 2 nhãm:
- B¹ch l¹p gåm c¸c l¹p thÓ kh«ng chøa s¾c tè: bét l¹p (amiloplast) - n¬i tæng hîp tinh bét; l¹p dÇu (oleoplast) – n¬i tæng hîp chÊt bÐo vµ l¹p ®¹m (proteinoplast)- n¬i tËp trung protein. L¹p bét thêng gÆp trong rÔ, th©n, h¹t
- S¾c l¹p gåm c¸c l¹p thÓ chøa s¾c tè gåm lôc l¹p (chloroplast) chøa chlorofin vµ l¹p cµ rèt chøa caroten (carotenoidoplast) t¹o nªn c¸c mµu vµng ®á, da cam…+ Lôc l¹p cã vai trß quan träng trong quang hîp, cã h×nh cÇu, ®Üa, bÇu dôc; kÝch thíc 4 -6 µm + Lôc l¹p chøa 80% protein kh«ng hoµ tan liªn kÕt víi lipit t¹o thµnh d¹ng lipoprotein
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 244: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/244.jpg)
CÊu tróc lôc l¹p
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 245: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/245.jpg)
2. Di truyÒn l¹p thÓ- Trong l¹p thÓ cã hÖ gen l¹p thÓ (cpDNA), t¬ng ®èi
gièng nhau vÒ thµnh phÇn vµ cÊu tróc DNA.- HÖ gen l¹p thÓ (cpDNA) lín h¬n gÊp 9 -10 lÇn hÖ gen ti thÓ (mtDNA). Bộ gen lạp thể thực vật có kích thước lớn(100-200 kb), một số gen có vai trò trong quá trình quanghợp ở thực vật. C¸c loµi t¶o kh¸c nhau cpDNA cã kÝchthíc tõ 22 kb ®Õn kho¶ng 300kb. CÊu tróc DNA l¹p thÓd¹ng xo¾n kÐp, trÇn.- Mçi lôc l¹p cã nhiÒu b¶n sao cpDNA. Ch¼ng h¹n, trïng roi Euglena mçi tÕ bµo cã 15 lôc l¹p mçi lôc l¹p cã 40 b¶n sao cpDNA, mçi tÕ bµo c©y thuèc l¸ cã kho¶ng 150 b¶n sao cpDNA.
- HÖ gen lạp thể của Arabidopsis có 90 gem mã hoáprotein tham gia pha sáng và phatối của quang hợp, 8 gen mã hoá rRNA, và 37 gen mã hoá 37 tRNA .
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 246: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/246.jpg)
-HÖ gen l¹p thÓ qui ®Þnh mét sètÝnh tr¹ng mµu s¾c, di truyÒnkh«ng chÆt chÏ tuú thuéc sùph©n chia tÕ bµo chÊt
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 247: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/247.jpg)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 248: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/248.jpg)
III. Đặc đỉem di truyền ngoài nhiễm sắc thể
- Gen ngoµi nhiÔm s¾c thÓ di truyÒn kh«ng phô thuéc vµo quyluËt di truyÒn nhiÔm s¾c thÓ, mang c¸c ®Æc ®iÓm ®Æc trng riªng:- KÕt qu¶ di truyÒn c¸c tÝnh tr¹ng kh«ng æn ®Þnh (vÝ dô c¸c vÖt kh«ng mµu trªn l¸ c©y v¹n niªn thanh…)- KÕt qu¶ phÐp lai thuËn nghÞch lµ kh¸c nhauVÝ dô: lai lõa c¸i x ngùa ®ùc → con la
lai lõa ®ùc x ngùa c¸i → con bacdo lai c¸ chÐp c¸i x c¸ diÕc ®ùc → c¸ nhng (cã r©u)lai c¸ chÐp ®ùc x c¸ diÕc c¸i → c¸ nhng (kh«ng r©u)
- TÝnh tr¹ng do c¸c gen ngoµi nhiÔm s¾c thÓ m· ho¸ vÉn tån t¹i khi ®· thay nh©n tÕ bµo b»ng mét nh©n cã cÊu tróc di truyÒn kh¸c.- HiÖn tîng bÊt thô ®ùc tÕ bµo chÊt (cytoplasmic male sterility - CMS) cã ý nghÜa quan träng trong c«ng t¸c t¹o gièng c©y lai ë ng« vµ nhiÒu loµi thùc vËt kh¸c
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 249: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/249.jpg)
+ HiÖn tîng bÊt thô ®ùc tÕ bµo chÊt ë ng« vµ c¸c loµi thùc vËt kh¸c ®îc gi¶i thÝch theo c¸c c¬ chÕ kh¸c nhau.
a. Gi¶ thuyÕt ®¬n nh©n tè: gi¶i thÝch bÊt thô ®ùc tÕ bµo chÊt do sù t¬ng t¸c gi÷a mét cÆp gen nh©n vµ gen kiÓm so¸t trong tÕ bµo chÊt. - Trong nh©n cã gen (Rf) phôc håi h÷u thô vµ gen (rf) kh«ng phôc håi h÷u thô- Trong tÕ bµo chÊt cã gen kiÓm so¸t (cytS) g©y bÊt thô h¹t phÊn, gen kiÓm so¸t (cytN) x¸c ®Þnh h¹t phÊn b×nh thêng.- Gen Rf kh«ng lµm thay ®æi cÊu tróc vµ tÝnh chÊt cña gen cytS, mµ cã t¸c dông øc chÕ sù biÓu hiÖn bÊt thô ®ùc.
b. Gi¶ thuyÕt ®a nh©n tè: Mét sè cÆp gen trong nh©n tÕ bµo vµ gen kiÓm so¸t trong tÕ bµo chÊt cã sù t¬ng t¸c g©y nªn hiÖn tîng bÊt thô ®ùc tÕ bµo chÊt, ë ng« cã tõ 3 -5 gen nh©n tham gia x¸c ®Þnh tÝnh bÊt thô tÕ bµo chÊt (Nikoro, Xidorov 1966).
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 250: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/250.jpg)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 251: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/251.jpg)
Chương 5:
CÁC QUY LUẬT BIẾN DỊ
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 252: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/252.jpg)
A. Thường biến- Những biến đổi kiểu hình do điều kiện ngoại cảnh thayđổi, không có
sự biến đổi kiểu gen.- Thường biến không di truyền được- Thường biến có vai trò trong sự thích nghi của sinh
vật với điều kiện
B. Đột biếnĐột biến chia lµm nhiÒu lo¹i kh¸c nhau:- Theo vật chất di truyền: đột biến gen và đột biếnNST (đột biến số lượng và đột biến cấu trúc)- Theo ảnh hưởng của đột biến đối với sinh vật: gồm3 loại: trung tính, có lợi và có hại (đột biến gây chết, đột biến giảm sống)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 253: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/253.jpg)
-C-A-A- -C-A-A-
-C-A-G- -C-A-C-
glutamin glutamin
glutamin histidin
- Thay đổi một nucleotid tronggen làm thay đổi bộ ba mãhoá trong mRNA, thay đổiacid amin trong phân tửprotein
I. ĐỘt biẾn gen1. Cơ chế đột biến gen
- Ví dụ: Thay đổi nucleotid trongbộ 3 thứ 6 của gen mã hoá globingây bệnh hồng cầu liềm
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 254: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/254.jpg)
Bình thường ACA-ATG-GTA-CGA Cys-Tyr-His-Ala
Thêm 1 nu ACA-GAT-GGT-ACG Cys-Leu-Pro-Val
Mất 1 nu ACA-TGG-TAC-GA Cys-Tyr-Met-Leu
Protein DNA
- Đột biến do thêm hoặc bớt 1 hoặc một số nucleotid tronggen làm thay đổi cấu trúc protein
Bình thường ACA-ATG-GTA-CGA Cys-Tyr-His-Ala
AGG-GGG-CTAThêm ACA-AGG-GGG-CTA-ATG Cys-Ser-Pro-Asp-Tyr
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 255: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/255.jpg)
Bình thường ACA-ATG-GTA-CGA Cys-Tyr-His-Ala
Tạo bộ ba stop ACA-ATT-GTA-CGA Cys
- Thay đổi 1 nucleotid tạo nên bộ ba kết thúc sớm
- Gây biến đổi GC ⇒ AT do gây mất nhóm amin Cytosin⇒ Uracil
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 256: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/256.jpg)
Mạchbình thường
Biến đổiG/Cthành A/T
Tiếp tục tái bản
Biến đổi GC ⇒ AT
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 257: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/257.jpg)
Biến đổiA/T thành G/C
Biến đổi AT ⇒ GC: do tác động của 5-Br
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 258: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/258.jpg)
2. HËu qu¶ ®ét biÕn gen
- ThiÕu hôt miÔn dÞch tæ hîp trÇm träng (ADA)- ThiÕu m¸u hång cÇu liÒm (Sickle Cell Anemia )- BÖnh a ch¶y m¸u (hemophilia A, B)- BÖnh x¬ nang vµ viªm phæi cÊp (CF- Cystic fibrosis )- BÖnh gi¶m trÝ nhí (Parkinsons) - BÖnh run rÈy (Gaucher)- BÖnh nh¶y móa (Huntington)- BÖnh rèi lo¹n chuyÓn ho¸ Cholesterrol- BÖnh tim bÈm sinh (Heart disease )- BÖnh ung th (Cancer )- BÖnh tiÓu ®êng (Diabetes )
……………………………………
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 259: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/259.jpg)
a. §ét biÕn cÊu tróc nhiÔm s¾c thÓ: MÊt ®o¹n, lÆp ®o¹n, chuyÓn ®o¹n, ®¶o ®o¹n ®Òu g©y c¸c dÞ d¹ng, c¸c rèi lo¹n cña c¬ thÓ
II. Đột biến nhiễm sắc thể1. Cơ chế đột biến nhiễm sắc thể
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 260: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/260.jpg)
§µn bµ bÞ hãi
C¬ chÕ ®¶o ®o¹n
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 261: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/261.jpg)
b. §ét biÕn sè lîng nhiÔm s¾c thÓ
- ë ngêi :3 nhiÔm s¾c thÓ sè 21: g©y héi chøng Down
XXY: g©y héi chøng Klinefelter YYX: g©y héi chøng Jacobs XXX: g©y héi chøng siªu c¸iXO : g©y héi chøng Turner
- ë ®éng vËt: nhiÒu ®ét biÕn dÞ d¹ng, chÕt yÓu- ë thùc vËt: t¹o c¸c d¹ng c©y ®a béi ch½n, ®a béi lÎ…cã n¨ng xuÊt cao phÈm chÊt tèt: nh da hÊu 3n, chuèi 3n, lóa m× 6n..
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 262: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/262.jpg)
3 NST sè 21 héi cøng Down, tû lÖ1/900
3 NST sè 13 héi chøng –Patau, tû lÖ 1/15000 trÎmíi sinh, chÕt tríc 6 th¸ng tuæi
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 263: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/263.jpg)
Héi chøng Turner XO Héi chøng Klinefelter XXY
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 264: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/264.jpg)
BÖnh Huntington (bÖnh nh¶y móa) do ®ét biÕn NST g©y nªn
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 265: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/265.jpg)
III. Nguyªn nh©n g©y ®ét biÕn
1/ T¸c nh©n vËt lÝ+ Tia bøc x¹ kh«ng ion ho¸
- Tia UV (tia tö ngo¹i) 136 - 4000 A0, n¨ng lîng thÊp - Tia UV t¹o nªn dimer thymin, g©y ®ét biÕn ë vi
sinh vËt, h¹t phÊn....
+ Tia bøc x¹ ion ho¸ (hay tia phãng x¹ ion ho¸) gåm 2 lo¹i:
- Tia cã b¶n chÊt sãng ®iÖn tõ víi bíc sãng cùc ng¾n gåm tia r¬nghen (tia X) vµ tia gamma (γ).
- Tia cã b¶n chÊt lµ c¸c h¹t gåm tia alpha (α), tia beta (β), vµ c¸c proton, n¬tron. + NhiÖt ®é
- NhiÖt ®é qu¸ cao hoÆc qu¸ thÊp cã thÓ g©y biÕn tÝnh DNA t¹o nªn c¸c ®ét biÕn
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 266: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/266.jpg)
- dimer thymin do t¸c ®éng cña tia UV
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 267: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/267.jpg)
2/ T¸c nh©n ho¸ häc g©y ®ét biÕn+ Acid nit¬ (HNO2)
- Acid nit¬ cã t¸c dông g©y biÕn ®æi ho¸ häc c¸c baz¬nit¬, lµm cho nhãm amin (-NH2) trong c¸c baz¬ nit¬ cña DNA bÞ thay thÕ b»ng nhãm hydroxyl (- OH) hay oxy (O2). - C¸c baz¬ Adenin (A) bÞ khö amin trë thµnh hypoxantin (Hy), hypoxantin cã xu híng ghÐp ®«i víi cytosin thµnh cÆp Hy - C, g©y ®ång ho¸n A = T → G ≡ C.
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 268: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/268.jpg)
+ C¸c hîp chÊt g©y alkyl ho¸- C¸c chÊt g©y alkyl ho¸ nh ethylmethan sunfonat (EMS), nitromethylure (NMU), ethylenimin (EI) g©y alkylho¸ guanin (G) vµ thymin (T) dÉn ®Õn ghÐp ®«i sai, g©y ®étbiÕn A=T → G ≡ C vµ G ≡ C → A=T.+ C¸c chÊt g©y ®ét biÕn nhãm acridin- C¸c chÊt g©y ®ét biÕn nhãm acridin nh proflavincã thÓ g©y biÕn tÝnh DNA t¹o nªn c¸c ®ét biÕn gen, do thªmvµo 1 nucleotid bÊt k×.
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 269: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/269.jpg)
IV. C¬ chÕ ph©n tö cña ®ét biÕn- Thay thÕ cÆp nucleotid nµy b»ng cÆp nucleotid kh¸c- MÊt 1 hoÆc mét sè nucleotid (mÊt ®o¹n)- Thªm 1 hoÆc mét sè nucleotid (thªm ®o¹n)- Thay thÕ 1 hoÆc mét sè nucleotid kh¸c (chuyÓn ®o¹n)- §øt m¹ch DNA (®øt ®¬n, ®øt kÐp)….
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 270: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/270.jpg)
V. C¬ chÕ söa ch÷a ®ét biÕn trong tÕ bµo- §ét biÕn do t¸c nh©n g©y ®ét biÕn vµ ®ét biÕn do “ghÐp nhÇm” c¸c nucleotid khi t¸i b¶n DNA (vai trß cña DNA polymerase) cã tÇn sè cao 10-4 - 10-5
.
- Trong tÕ bµo cã c¸c c¬ chÕ söa ch÷a sai sãt trong t¸Ib¶n DNA, lµm gi¶m tÇn sè ®ét biÕn gen cßn 10-8 - 10-9
-C¸c c¬ chÕ söa ch÷a ®ét biÕn gåm1. C¬ chÕ quang phôc ho¹t: söa c¸c dimer thymin
l¹i tr¹ng th¸i b×nh thêng2. C¬ chÕ enzym (pha tèi): Vai trß cña DNA
polymerase I c¾t bá c¸c nucleotid ghÐp sai, thay b»ng c¸c nucleotid theo ®óng nguyªn lÝ Chargaff
3. C¬ chÕ SOS: gióp ph©n tö DNA t¸i b¶n, hoÆc phiªn m· bá qua c¸c dimer thymin, c¸c ®o¹n bÞ tænth¬ng hoÆc nhê hÖ thèng c¸c enzym ®äc – söa phôc håi c¸c sai sãt.
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 271: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/271.jpg)
a/ Söa ch÷a c¸c dimer thymin trong pha s¸ng
ATGCUGCATTGATAGTACGGCGTAACTATC
dimer thymin
AT AGTACGGCGTAACTATC
ATGCCGCATTGATAGTACGGCGTAACTATC
ATGCCGCATTGATAGTACGGCGTAACTATC
Enzyme nuclease c¾t bákho¶ng 30 nucleotid
DNA polymerase β
DNA ligase
(~30 nucleotid)
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 272: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/272.jpg)
b/ Söa ch÷a ®ét biÕn b»ng con ®êng khö amin
Mét sè trêng hîp g¾n sai trong RNA t¹o cÆp A- C , cã thÓ ®îc söa ch÷a b»ng lo¹i nhãm amin
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 273: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/273.jpg)
VI. øng dông ®ét biÕn trong thùc tiÔn
- C©y trång xö lÝ t¸c nh©n g©y ®ét biÕn lµ tia X, tia (γ), DMS, DES, EMS... m« ph©n sinh, ®Ønh chåi, m« l¸ hoÆc cñ. VÝ dô: xö lÝ ®Ønh chåi chuèi b»ng tia (γ) 1-2,5 Krad, khoai lang xö lý th©n b»ng tia (γ) liÒu lîng 20 Krad.-C¸c lo¹i h¹t kh« xö lý ho¸ chÊt, tia X, tia (γ).... VÝ dô, h¹t cµchua xö lý EMS 0,8% ë 240C trong 24 giê, h¹t ®Ëu t¬ng xölý tia (γ) 10 - 20 Krad- C¸c gièng lóa ®ét biÕn n¨ng suÊt cao, chèng chÞu s©u bÖnh, chÞu rÐt, cøng c©y DT 10, DT 11, Xu©n sè5, sè6 (ViÖt Nam); ®Ëu Hµ Lan ®ét biÕn n¨ng suÊt cao, chÝn sím chèng nÊm (Thuþ §iÓn, Nga, Mü , §øc); ®Ëu t¬ng chÞu nãng, chÞu h¹n M103, DT 84 (ViÖt Nam),hµm lîng protein cao, lipÝt cao (Nga, Mü, §øc)...- Xö lÝ sèc nhiÖt t¹o nªn mét sè gièng c¸ håi, c¸ tr×nh c¸c tr¹ch tam béi (3n), lín nhanh, n¨ng suÊt cao
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com
![Page 274: Giao Trinh Di Truyen Hoc.pdf](https://reader037.fdocuments.net/reader037/viewer/2022102609/577cce131a28ab9e788d3da3/html5/thumbnails/274.jpg)
Sö dông ®ét biÕn trong s¶n xuÊt kh¸ng sinh penicilin
PDF created with FinePrint pdfFactory Pro trial version www.softwarelabs.com