Genomes. Definition Complete set of instructions for making an organism Complete set of instructions...
-
date post
20-Dec-2015 -
Category
Documents
-
view
217 -
download
1
Transcript of Genomes. Definition Complete set of instructions for making an organism Complete set of instructions...
![Page 1: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/1.jpg)
GenomesGenomes
![Page 2: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/2.jpg)
Definition Complete set of instructions for making an Complete set of instructions for making an
organismorganism• master blueprints for all enzymes, cellular structures master blueprints for all enzymes, cellular structures
& activities & activities An organism‘s complete set of DNAAn organism‘s complete set of DNA All the DNA contained in the cell of an organismAll the DNA contained in the cell of an organism The collection of DNA that comprises an
organism. Total genetic information carried by a single set Total genetic information carried by a single set
of chromosomes in a haploid nucleusof chromosomes in a haploid nucleus
![Page 3: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/3.jpg)
Genome sequencing chronology
Year
OrganismSignificance
Genome size (bp)
Number of
genes
1977
Bacteriophage fX174
First genome
5,386 11
1981
Human mitochondria
First organelle
16,500 37
1995
Haemophilus influenzae Rd
First free-living organism
1,830,137
~3,500
1996
Saccharomyces cerevisiae
First eukaryote
12,086,000
~6,000
![Page 4: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/4.jpg)
Genome sequencing chronologyYear
OrganismSignificance
Genome size (bp)
Number of
genes
1998
Caenorhab-ditis elegans
First multi-cellular organism
97,000,000~19,00
0
1999
Human chromosome 22
First human chromosome
49,000,000 673
2000
Drosophila melanogaster
First insect
150,000,000
~14,000
2000
Arabidopsis thaliana
First plant genome
150,000,000
~25,000
![Page 5: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/5.jpg)
Genome size
![Page 6: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/6.jpg)
VirusA subcellular parasite with genes of DNA or RNA and which replicates inside the host cell upon which it relies for energy and protein synthesis. In addition, it has an extra-cellular form in which the virus genes are contained inside a protective coat
![Page 7: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/7.jpg)
The Baltimore classification systemBased on genetic contents and replication strategies of viruses. According to the Baltimore classification, viruses are divided into the following seven classes:
1. dsDNA viruses 2. ssDNA viruses 3. dsRNA viruses 4. (+) sense ssRNA viruses (codes directly for protein) 5. (-) sense ssRNA viruses 6. RNA reverse transcribing viruses 7. DNA reverse transcribing viruses
"ds" represents "double strand" and "ss" denotes "single strand".
![Page 8: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/8.jpg)
Plant DNA viruses are rareCauliflower mosaic virusSpherical, kills Cauliflower and Brussel Sprouts
Most plant viruses are small and comprised of ssRNA
Rod shaped, attacks tomato, pepper, beets, turnips, tobacco2,130 identical proteins surround the ssRNA~10,000bp, ~10 genes
Plant Viroids
Plant Viruses
![Page 9: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/9.jpg)
Highly complementary circular ssRNA No protein coat
Smaller than viruses (few hundreds of bases) Smallest known virus is 3.2 kbp in size
RNA does not code for any known protein Some even lack the AUG initiation codon
Replication mechanism is unknown Viroids cannot recognize and infect host cell
Relies on cells being weak or injured Proposed that viroids are "escaped introns"
Viroids are usually transmitted by seed or pollen Infected plants can show distorted growth
The first viroid to be identified was the Potato spindle tuber viroid (PSTVd) Some 33 species have been identified
Plant Viroids
![Page 10: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/10.jpg)
Procaryotic genomes Generally 1 circular chromosome (dsDNA) Usually without introns Relatively high gene density (~2500 genes per
mm of E. coli DNA) Often indigenous plasmids are present
1. Eschericia coli
2. Agrobacterium tumefaciens
![Page 11: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/11.jpg)
Eschericia coli It is a free living, gram negative
bacterium It is a normal resident of the large
intestine in healthy people It grows best with incubation at 37°C
in a culture medium that approximates the nutrient available in the human digestive tract
It is a type of probiotic organism because it crowds out disease causing bacteria.
It also makes vitamin K which humans require to be healthy.
Some strains make people sick. The toxic strains are responsible for about half of all cases of traveler's diarrhea.
![Page 12: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/12.jpg)
Eschericia coli It replicates once every 22 It replicates once every 22
minutes, giving rise to 30 minutes, giving rise to 30 generations and more than 1 generations and more than 1 billion cells in 11 hoursbillion cells in 11 hours
Its growth falls into several Its growth falls into several distinct phases (lag, distinct phases (lag, logaritmic, stationary and logaritmic, stationary and death)death)
The individual cells are The individual cells are invisible to the naked eye, invisible to the naked eye, after plating onto solid after plating onto solid medium, each cell divides to medium, each cell divides to form a visible colony of form a visible colony of identical daughter cells in 12-identical daughter cells in 12-24 hours24 hours
![Page 13: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/13.jpg)
Eschericia coli It provides a relatively simple and
well understood genetic improvement in which to isolate foreign DNA
Its primary genetic complement is contained on a single chromosome which locations and sequences of a large number of its genes are known
The genetic code is nearly universal Under the best circumstances, the
uptake of a specific foreign gene is a relatively rare occurrence and is thus most easily accomplished in a large populations that are reproducing rapidly
![Page 14: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/14.jpg)
Eschericia Coli genome Single chromosome of
approximately 5 million base pairs (5 Mbp)
4288 protein coding genes:• Average ORF 317 amino
acids• Average gene size 1000
bp• Very compact: average
distance between genes 118bp
Contour length of genome: 1.7 mm
It can accept foreign DNA derived from any organism
Some genes are arranged in the plasmid
![Page 15: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/15.jpg)
Agrobacterium tumefaciens
![Page 16: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/16.jpg)
Agrobacterium tumefaciensAgrobacterium tumefaciens Agrobacterium tumefaciensAgrobacterium tumefaciens is a is a
gram-negative soil gram-negative soil phytopathogenphytopathogennon-sporing, motile, rod-shaped bacterium, closely related to Rhizobium which forms nitrogen-fixing nodules on clover and other leguminous plants.
AgrobacteriumAgrobacterium affect most affect most dicotyledonous plants in nature, dicotyledonous plants in nature, resulting in crown gall tumors at resulting in crown gall tumors at the soil-air junction upon tissue the soil-air junction upon tissue woundingwounding
Agrobacterium has the broadest host range of any plant pathogenic bacterium
![Page 17: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/17.jpg)
Agrobacterium tumefaciensAgrobacterium tumefaciens Most of the genes involved in
crown gall disease are not borne on the chromosome of A. tumefaciens but on a large plasmid, termed the Ti (tumour-inducing) plasmid.
It is important to note that only a small part of the plasmid (the T-DNA) enters the plant; the rest of the plasmid remains in the bacterium to serve further roles. When integrated into the plant genome, the genes on the T-DNA code for:production of cytokinins production of indoleacetic acid synthesis and release of novel plant metabolites - the opines and agrocinopines.
![Page 18: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/18.jpg)
Agrobacteria that causes Agrobacteria that causes neoplastic diseases in plantsneoplastic diseases in plants
Agrobacterium rhizogenesAgrobacterium rhizogenes (hairy root (hairy root disease).disease).
AgrobacteriumAgrobacterium rubirubi (cane gall disease) (cane gall disease) AgrobacteriumAgrobacterium tumefacienstumefaciens (crown gall (crown gall
disease)disease) AgrobacteriumAgrobacterium vitisvitis (crown gall of grape (crown gall of grape))
![Page 19: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/19.jpg)
What will What will Agrobacterium Agrobacterium tumefacienstumefaciens affect in plants? affect in plants?
Crown gall disease is not Crown gall disease is not generally fatal, but it will generally fatal, but it will reduce plant vigor and reduce plant vigor and crop yield, and crown crop yield, and crown galls will attract other galls will attract other phytopathogens or pests.phytopathogens or pests.
In some cases, necrosis In some cases, necrosis or apoptosis is observed or apoptosis is observed after after AgrobacteriumAgrobacterium infection.infection.
![Page 20: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/20.jpg)
The discovery of The discovery of AgrobacteriumAgrobacterium
In 1897, Fridiano Cavara identified a In 1897, Fridiano Cavara identified a flagellate, bacilloid bacterium as a casual flagellate, bacilloid bacterium as a casual agent of crown gall of grape.agent of crown gall of grape.
This organism is This organism is Agrobacterium vitisAgrobacterium vitis, , causing the growth of neoplastic tumors causing the growth of neoplastic tumors on the stem and crown of grapevines and on the stem and crown of grapevines and inducing necrotic lesions on grape roots.inducing necrotic lesions on grape roots.
![Page 21: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/21.jpg)
Historical discoveries about Historical discoveries about agrobacteriumagrobacterium
Turn of 20Turn of 20thth century – found causes crown gall century – found causes crown gall diseasedisease
1940’s – crown gall tissue cultured due to 1940’s – crown gall tissue cultured due to hormone autotrophyhormone autotrophy
1970’s – pathogenicity transferred between 1970’s – pathogenicity transferred between bacteria via conjugation – evidence of plasmid bacteria via conjugation – evidence of plasmid involvement involvement
1980’s T-DNA was first engineered to carry useful 1980’s T-DNA was first engineered to carry useful genes into plants using methods that ‘hijacked’ genes into plants using methods that ‘hijacked’ the natural processthe natural process
![Page 22: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/22.jpg)
Evidence for plasmid involvement in Evidence for plasmid involvement in the virulence of agrobacteriumthe virulence of agrobacterium
1. Relationship between virulence and specific plasmids in different agrobacterium strains
2. Loss of virulence with loss of plasmids when grown at high temp (plus restoration of virulence when same plasmids replaced)
3. Virulence transferred when plasmids transferred between virulent and non-virulent strains
4. Stable nature of hormone autotrophy in infected host plant tissues indicated that this was genetically determined and could result from genetic transfers between agrobacterium and its host
5. Fragments of agrobacterium plasmids (T-DNA) were found in the DNA of diseased tissues
6.6. Plants regenerated from diseased tissues were bred to Plants regenerated from diseased tissues were bred to produce offspring which inherited the T-DNA in a Mendelian produce offspring which inherited the T-DNA in a Mendelian manner. manner.
7.7. This indicated that the T-DNA was integrated into nuclear This indicated that the T-DNA was integrated into nuclear DNADNA
![Page 23: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/23.jpg)
Autoradiogram of a Southern blot of DNA extracted from cured crown gall cells probed with T-DNA showing the presence of T-DNA within the plant genome.
Lanes 1 & 2: T-DNA extracted from agrobacterium Ti plasmid Lanes 3, 5 & 6: DNA extracted from gall cellsLane 4: DNA from non-infected plant tissue
![Page 24: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/24.jpg)
Agrobacterium lives in intercellular spaces of the plant
![Page 25: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/25.jpg)
Steps of Agrobacterium-plant cell interaction
1. Cell-cell recognition2. Signal transduction and transcriptional
activation of vir genes3. Conjugal DNA metabolism4. Intercellular transport5. Nuclear import6. T-DNA integration
![Page 26: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/26.jpg)
Agrobacterium tumefaciens Agrobacterium tumefaciens genomegenome
• Genome size (chromosome) is about Genome size (chromosome) is about 6 Mb • A large (~250kbp) plasmid called Tumor-inducing A large (~250kbp) plasmid called Tumor-inducing
(Ti) plasmid)(Ti) plasmid)• Plasmid contains genes responsible for the diseasePlasmid contains genes responsible for the disease• Portion of the Ti plasmid is transferred between Portion of the Ti plasmid is transferred between
bacterial cells and plant cells bacterial cells and plant cells T-DNA (Transfer T-DNA (Transfer DNA)DNA)
• T-DNA integrates stably into plant genomeT-DNA integrates stably into plant genome• Single stranded T-DNA fragment is converted to Single stranded T-DNA fragment is converted to
dsDNA fragment by plant celldsDNA fragment by plant cell Then integrated into plant genomeThen integrated into plant genome 2 x 23bp direct repeats play an important role in 2 x 23bp direct repeats play an important role in
the excision and integration processthe excision and integration process
![Page 27: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/27.jpg)
Agrobacterium tumefaciensAgrobacterium tumefaciens
What is naturally encoded in T-DNA?What is naturally encoded in T-DNA?• Enzymes for auxin and cytokinin synthesisEnzymes for auxin and cytokinin synthesis
Causing hormone imbalance Causing hormone imbalance tumor tumor formation/undifferentiated callusformation/undifferentiated callus
Mutants in enzymes have been characterizedMutants in enzymes have been characterized
• Opine synthesis genes (e.g. octopine or Opine synthesis genes (e.g. octopine or nopaline)nopaline)
Carbon and nitrogen source for Carbon and nitrogen source for A. tumefaciensA. tumefaciens growth growth Insertion genes Insertion genes
• Virulence (vir) genesVirulence (vir) genes• Allow excision and integration into plant genomeAllow excision and integration into plant genome
![Page 28: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/28.jpg)
Plasmids
Naturally Extra chromosomal circular DNAs
They exist separate from the main chromosome They replicate within the host cells Their size vary form ~ 1,000 to 250,000 base pairs They can be divided into two broad groups according to
how tightly their replication in regulated: 1. stringent plasmids (low copy number plasmids: 1-2 plasmids/cell)
only replicate along with the main bacterial chromosome and so exist as single copy, or at most several copies within
the cell 2. Relaxed plasmid (multi copy number plasmids)
replicate autonomously of the main chromosome and have copy numbers
of 10 - 500 per cells
![Page 29: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/29.jpg)
pBR322pBR322
The plasmid pBR322 is one of the most commonly used E.coli cloning vectors. pBR322 is 4361 bp in length and contains: (1) the replicon rep responsible for the replication of
plasmid (source – plasmid pMB1); (2) rop gene coding for the Rop protein, which promotes conversion of the unstable RNA I – RNA II complex to a stable complex and
serves to decrease copy number (source – plasmid pMB1); (3) bla gene, coding for beta-lactamase that confers resistance to ampicillin (source – transposon Tn3); (4) tet gene,
encoding tetracycline resistance protein (source – plasmid pSC101).
![Page 30: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/30.jpg)
Genetic structure of the Ti plasmidGenetic structure of the Ti plasmid
TL TRAux Cyt Opines
Oncogenes
![Page 31: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/31.jpg)
Left Border and Right Border
(Tumor-inducing)
transfer
![Page 32: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/32.jpg)
Ti plasmid of Ti plasmid of A. tumefaciensA. tumefaciens
![Page 33: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/33.jpg)
1. Auxin, cytokinin, opine synthetic genes transferred to plant
2. Plant makes all 3 compounds
3. Auxins and cytokines cause gall formation
4. Opines provide unique carbon/nitrogen source only A. tumefaciens can use!
![Page 34: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/34.jpg)
Saccharomyces cerevisiae NonpathogenicNonpathogenic Rapid growth (generation Rapid growth (generation
time ca. 80 min)time ca. 80 min) Dispersed cellsDispersed cells Ease of replica plating and Ease of replica plating and
mutant isolationmutant isolation Can be grown on defined Can be grown on defined
media giving the media giving the investigator complete investigator complete control over environmental control over environmental parametersparameters
Well-defined genetic systemWell-defined genetic system Highly versatile DNA Highly versatile DNA
transformation systemtransformation system
![Page 35: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/35.jpg)
Saccharomyces cerevisiae Strains have both a stable Strains have both a stable
haploid and diploid statehaploid and diploid state Viable with a large number Viable with a large number
of markers of markers Recessive mutations are Recessive mutations are
conveniently manifested in conveniently manifested in haploid strains and haploid strains and complementation tests can complementation tests can be carried out with diploid be carried out with diploid strainsstrains
The ease of The ease of gene gene disruptions disruptions and single step and single step gene replacements offers an gene replacements offers an outstanding advantage for outstanding advantage for experimentationexperimentation
![Page 36: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/36.jpg)
Saccharomyces cerevisiae Yeast genes can functionally be
expressed when fused to the green fluorescent protein (GFP) thus allowing to localize gene products in the living cell by fluorescence microscopy
The yeast system has also proven an invaluable tool to clone and to maintain large segments of foreign DNA in yeast artificial chromosomes (YACs) being extremely useful for other genome projects and to search for protein-protein interactions using the two-hybrid approach
Transformation can be carried out directly with short single-stranded synthetic oligonucleotides, permitting the convenient productions of numerous altered forms of proteins
![Page 37: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/37.jpg)
Genome of diploid Saccharomyce cerevisiae cell
Characteristic Chromosomes Plasmid MitochondiralRelative amount (%) 85 5 10Number of copies 2 x 1660-100 ~50 (8-130)Size (kbp) 14.000 6,318 70-76
Yeast genome
![Page 38: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/38.jpg)
Yeast plasmid
![Page 39: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/39.jpg)
The yeast genome S. cerevisiae contains a haploid set of 16 well-characterized
chromosomes, ranging in size from 200 to 2,200 kb Total sequence of chromosomal DNA is 12,8 Mb 6,183 ORFs over 100 amino acids long First completely sequenced eukaryote genome Very compact genome:
• Short intergenic regionsShort intergenic regions• Scarcity of intronsScarcity of introns• Lack of repetitive sequencesLack of repetitive sequences
Strong evidence of duplication:• Chromosome segmentsChromosome segments• Single genesSingle genes
RedundancyRedundancy: non-essential genes provide selective : non-essential genes provide selective advantageadvantage
![Page 40: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/40.jpg)
Eucaryotic genomesEucaryotic genomes Located on several chromosomesLocated on several chromosomes
Relatively low gene density (50 genes per Relatively low gene density (50 genes per mm of DNA in humans)mm of DNA in humans)
Carry organellar genomeCarry organellar genome
![Page 41: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/41.jpg)
Plant genomes Plant contains three genomesPlant contains three genomes Genetic information is divided in the chromosome.Genetic information is divided in the chromosome. The size of genomes is species dependentThe size of genomes is species dependent The difference in the size of genome is mainly due to a The difference in the size of genome is mainly due to a
different number of identical sequence of various size different number of identical sequence of various size arranged in sequencearranged in sequence
The gene for ribosomal RNAs occur as repetitive The gene for ribosomal RNAs occur as repetitive sequence and together with the genes for some transfer sequence and together with the genes for some transfer RNAs in several thousand of copiesRNAs in several thousand of copies
Structural genes are present in only a few copies, Structural genes are present in only a few copies, sometimes just single copy. Structural genes encoding sometimes just single copy. Structural genes encoding for structurally and functionally related proteins often for structurally and functionally related proteins often form a gene familyform a gene family
The DNA in the genome is replicated during the The DNA in the genome is replicated during the interphase of mitosisinterphase of mitosis
![Page 42: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/42.jpg)
![Page 43: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/43.jpg)
Arabidopsis thaliana A weed growing at the roadside of A weed growing at the roadside of
central Europecentral Europe It has only 2 x 5 chromosomesIt has only 2 x 5 chromosomes It is just 70 MbpIt is just 70 Mbp It has a life cycle of only 6 weeksIt has a life cycle of only 6 weeks It contains 25,498 structural genes It contains 25,498 structural genes
from 11,000 familiesfrom 11,000 families The structural genes are present in The structural genes are present in
only few copies sometimes just one only few copies sometimes just one proteinprotein
Structural genes encoding for Structural genes encoding for structurally and functionally related structurally and functionally related proteins often form a gene familyproteins often form a gene family
![Page 44: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/44.jpg)
Peculiarities of plant genomes Huge genomes reaching tens of billions of base Huge genomes reaching tens of billions of base
pairspairs Numerous polyploid formsNumerous polyploid forms Abundant (up to 99%) non coding DNA which Abundant (up to 99%) non coding DNA which
seriously hinders sequencing, gene mapping and seriously hinders sequencing, gene mapping and design of genedesign of gene
Poor morphological, genetics, and physical Poor morphological, genetics, and physical mapping of chromosomesmapping of chromosomes
A large number of “small-chromosome” in which A large number of “small-chromosome” in which the chromosome length does not exceed 3 the chromosome length does not exceed 3 μμmm
The number of chromosomes and DNA content in The number of chromosomes and DNA content in many species is still unknownmany species is still unknown
![Page 45: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/45.jpg)
Size of the genome in plants and human
GenomeGenome Arabidopsis Arabidopsis thalianathaliana
Zea maysZea mays Vicia fabaVicia faba HumanHuman
NucleusNucleus 70 Millions70 Millions 3900 3900 MillionsMillions
14500 14500 MillionsMillions
2800 2800 MillionsMillions
PlastidPlastid 0.156 0.156 MillionsMillions
0.136 0.136 MillionsMillions
0.120 0.120 MillionsMillions
MitochondMitochondrionrion
0.370 0.370 MillionsMillions
.570 .570 MillionsMillions
.290 .290 MillionsMillions
.017 .017 MillionsMillions
![Page 46: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/46.jpg)
Organisation of the genome into chromosome
The nuclear genome is organized into chromosomeThe nuclear genome is organized into chromosome Chromosomes consist of essentially one long DNA Chromosomes consist of essentially one long DNA
helix wound around nucleosome helix wound around nucleosome At metaphase, when the genome is relatively At metaphase, when the genome is relatively
inactive, the chromosome are most condensed and inactive, the chromosome are most condensed and therefore most easily observed cytologically, therefore most easily observed cytologically, counted or separatedcounted or separated
Chromosomes provide the means by which the Chromosomes provide the means by which the plant genome constituents are replicated and plant genome constituents are replicated and segregated regularly in mitosis and meiosissegregated regularly in mitosis and meiosis
Large genome segments are defined by their Large genome segments are defined by their conserved order of constituent genesconserved order of constituent genes
![Page 47: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/47.jpg)
Genome compositionGenome composition1.1. HeterochromatinHeterochromatin Darkly staining portions of Darkly staining portions of
chromosomes, believed due to high chromosomes, believed due to high degree of coilingdegree of coiling
Non-genic DNANon-genic DNAa. Centromere a. Centromere ~ “middle” of Chromosomes~ “middle” of Chromosomes spindle attachment sitesspindle attachment sitesb. Telomeresb. Telomeres1. ends of chromosome1. ends of chromosome2. important for the stability of 2. important for the stability of chromosomeschromosomes tipstips..
2. Euchromatin2. Euchromatin Lightly staining portion of Lightly staining portion of
chromosomeschromosomes It represents most of the genomesIt represents most of the genomes It contains most of genesIt contains most of genes..
![Page 48: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/48.jpg)
Ploidy and chromosome numberPloidy and chromosome number
OrganismOrganism PloidyPloidy Chromosome Chromosome numbernumber
CornCorn Diploid (2X)Diploid (2X) 2020
TomatoTomato Diploid (2X)Diploid (2X) 2424
ArabidopsisArabidopsis Diploid (2X)Diploid (2X) 1010
PotatoPotato Tetraploid (4X)Tetraploid (4X) 4848
WheatWheat Hexaploid (6X)Hexaploid (6X) 4242
![Page 49: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/49.jpg)
Organization of Plant GenomeOrganization of Plant Genome Protein coding geneProtein coding gene
PPortion of genome which encodes for most of the transcribed genes (Protein coding genes)
Non coding gene Non coding gene 1. Intron1. Intron
2. 2. Regulatory elements of genes3. Multiple copies of genes, including pseudogenes4. Intergenic sequences5. Interspersed repeats
![Page 50: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/50.jpg)
Organization of Plant GenomeOrganization of Plant GenomeMost plants contain quantities of DNA that greatly
exceed their needs for coding and regulatory functions
Very small percentage of the genome may encode for genes involved in protein production
Based on kinetics: Low-copy-number DNALow-copy-number DNA
DNA sequences DNA sequences encodes for most of the transcribed genes (Protein coding genes)
Medium-copy-number DNA Medium-copy-number DNA DNA sequences that encode ribosomal RNA (Tandemly repeated expressed DNA)
High-copy-number DNAHigh-copy-number DNAIIt is composed of highly repetitive sequences (Repetitious t is composed of highly repetitive sequences (Repetitious DNA)DNA)
![Page 51: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/51.jpg)
Gene classification
coding genesnon-coding genes
Messenger RNA
Proteins
Structural RNA
Structural proteins Enzymes
transfer RNA
ribosomal RNA
otherRNA
Chromosome(simplified)
intergenic region
![Page 52: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/52.jpg)
Protein Coding GenesProtein Coding GenesSegment of DNA which can be transcribed and
translated to amino acid
![Page 53: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/53.jpg)
Transcribed region ≈ Open Reading Transcribed region ≈ Open Reading Frame (ORF)Frame (ORF)• long (usually >100 aa)long (usually >100 aa)• ““known” proteins known” proteins likely likely
Basal signalsBasal signals• Transcription, translationTranscription, translation
Regulatory signalsRegulatory signals
Protein Coding GenesProtein Coding Genes
![Page 54: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/54.jpg)
Protein Coding GenesProtein Coding Genes Plant contains about 10 000 – 30 000 structural genesPlant contains about 10 000 – 30 000 structural genes They are present in only a few copies, sometimes just one They are present in only a few copies, sometimes just one
(single copy gene)(single copy gene) They often form a gene familyThey often form a gene family The transcription of most structural genes is subject to very The transcription of most structural genes is subject to very
complex and specific regulationcomplex and specific regulation The gene for enzymes of metabolism or protein The gene for enzymes of metabolism or protein
biosynthesis which proceed in all cells are transcribed biosynthesis which proceed in all cells are transcribed more oftenmore often
Most of the genes are switched off and are activated only in Most of the genes are switched off and are activated only in certain organ and then often only in certain cellscertain organ and then often only in certain cells
Many genes are only switched on at specific timesMany genes are only switched on at specific times
House keeping gene:
The genes which every cell needs for such basic functions independent of its specialization
![Page 55: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/55.jpg)
What do the genes encode?
Genes for basic cellular functions such as translation, transcription, replication and repair share similarity
among all organisms
Basic functions
Yeast – simplest eukaryote
Worm –programmed development
Fly – complex development
Arabidopsis – plant life cycle
+
Microbes highly specialized
Gene families expand to meet biological needs.
![Page 56: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/56.jpg)
PseudogenesPseudogenes
Nonfunctional copies of genes
Formed by duplication of ancestral gene, or reverse transcription (and integration)
Not expressed due to mutations that produce a stop codon (nonsense or frame-shift) or prevent mRNA processing, or due
to lack of regulatory sequences
![Page 57: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/57.jpg)
Tandemly Repeated DNA Tandemly Repeated DNA
A large number of identical repeated DNA A large number of identical repeated DNA sequencessequences
It spread over the entirely chromosomeIt spread over the entirely chromosome There is variation within species for the number of There is variation within species for the number of
copies in allelic arrayscopies in allelic arrays Variations in the lengths of tandemly repeat units Variations in the lengths of tandemly repeat units
have been used as a sources of molecular markerhave been used as a sources of molecular marker It is divided into:It is divided into:
1. Tandemly repeated expressed DNA1. Tandemly repeated expressed DNA
2. Tandemly repeated non expressed DNA 2. Tandemly repeated non expressed DNA (Repetitious DNA)(Repetitious DNA)
![Page 58: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/58.jpg)
Tandemly Repeated Expressed Tandemly Repeated Expressed Genes Genes
Genes which are duplicated and clustered Genes which are duplicated and clustered at many location of the genomeat many location of the genome
Ribosomal 18S, 58S, 25S and 5S RNA Ribosomal 18S, 58S, 25S and 5S RNA genes are highly reiterated in clusters genes are highly reiterated in clusters and form at sites called nucleolus and form at sites called nucleolus organizers (NOR)organizers (NOR)
They are also observed for tDNA and They are also observed for tDNA and histones histones
![Page 59: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/59.jpg)
Tandemly Repeat non expressed Tandemly Repeat non expressed DNADNA
Simple-sequence DNASimple-sequence DNA Moderately repeated DNA (mobile DNA)Moderately repeated DNA (mobile DNA)
Repetitive sequences which are unable to be expressed but found in
huge amount in the genome
![Page 60: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/60.jpg)
Simple Sequence DNASimple Sequence DNA
Very sort sequences repeated many times in tandem in large clusters
It is also called as satellite DNA
It often lies in heterochromatin especially in in centromeres and telomerescentromeres and telomeres
It is divided into 2 groups:It is divided into 2 groups:
Mini satellite : Variable number tandem repeat (VNTR) Mini satellite : Variable number tandem repeat (VNTR)
Micro satellite : Simple sequence repeat (SSR)Micro satellite : Simple sequence repeat (SSR)
It is used in DNA fingerprinting to identify It is used in DNA fingerprinting to identify individualsindividuals
![Page 61: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/61.jpg)
Tandemly repeated DNATandemly repeated DNA
Microsatellite (SSR: Simple sequence Microsatellite (SSR: Simple sequence repeat)repeat)• Unit size: at most 5 bpUnit size: at most 5 bp• ATATATATATATATATATATAATATATATATATATATTATATATATAT
MinisatelliteMinisatellite• Unit size: up to 25 bpUnit size: up to 25 bp• ATTGCTGTATTGCTGTATTGCTGTATTGCTGTATTGCTGTATTGCTGT
![Page 62: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/62.jpg)
Mobile DNA (Jumping gene)Mobile DNA (Jumping gene)
Move within genomes Most of moderately repeated DNA sequences
found throughout higher eukaryotic genomes Some encode enzymes that catalyze movement 2 types:
a. Transposonb. Retrotransposon
Units of DNA which are predisposed to move to another location, sometimes involving
replication of the unit, with the help of products of genes on the elements or on related element
![Page 63: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/63.jpg)
Transposon DNATransposon DNAInvolves copying of mobile DNA element Involves copying of mobile DNA element
and insertion into new site in genomeand insertion into new site in genome
Molecular parasite: “selfish DNA”Molecular parasite: “selfish DNA” They probably have significant effect on evolution They probably have significant effect on evolution
by facilitating gene duplication, which provides by facilitating gene duplication, which provides the fuel for evolution, and exon shufflingthe fuel for evolution, and exon shuffling
![Page 64: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/64.jpg)
Retrotransposon (retroelement)Retrotransposon (retroelement) Transposon like segment of DNATransposon like segment of DNA Retroviruses lacking the sequence encoding the structural Retroviruses lacking the sequence encoding the structural
envelope proteinenvelope protein Major component of plant genomeMajor component of plant genome Size ranges from 1 to 13 kb in lengthSize ranges from 1 to 13 kb in length Widely distributed over the chromosomes of many plant Widely distributed over the chromosomes of many plant
species genespecies gene
RetrovirusA virus of higher organism whose genome is RNA, but
which can insert a DNA copy its genome into host chromosome
![Page 65: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/65.jpg)
50-80% of plant genomes are Transposable Element
Mobile elements
![Page 66: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/66.jpg)
Plant genome sizes
![Page 67: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/67.jpg)
Small difference in gene number, although rice genome is 3x the size
Predicted Gene numbers
![Page 68: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/68.jpg)
![Page 69: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/69.jpg)
Peter J. Russell, iGenetics: Copyright © Pearson Education, Inc., publishing as Benjamin Cummings.
Eukaryotic cellsEukaryotic cells
![Page 70: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/70.jpg)
Mitochondrial genome (mtDNA)Mitochondrial genome (mtDNA) Number of mitochondria in plants can be between 50-Number of mitochondria in plants can be between 50-
20002000 One mitochondria consists of 1 – 100 genomes (multiple One mitochondria consists of 1 – 100 genomes (multiple
identical circular chromosomes). identical circular chromosomes). They are one large and several smaller They are one large and several smaller
Size ~ 200 kb to 2,500 kb in plantsSize ~ 200 kb to 2,500 kb in plants Mt DNA is replicated before or during mitosisMt DNA is replicated before or during mitosis
Transcription of mtDNA yielded an mRNA which did not Transcription of mtDNA yielded an mRNA which did not contain the correct information for the protein to be contain the correct information for the protein to be
synthesized. synthesized. RNA editing is existed in plant mitochondriaRNA editing is existed in plant mitochondria
Over 95% of mitochondrial proteins are encoded in the Over 95% of mitochondrial proteins are encoded in the nuclear genome.nuclear genome.
Often A+T rich genomesOften A+T rich genomes
![Page 71: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/71.jpg)
Chloroplast genome (ctDNA)Chloroplast genome (ctDNA) Multiple circular molecules, similar to procaryotic Multiple circular molecules, similar to procaryotic
cyanobacteria, although much smaller (0.001-0.1%of the cyanobacteria, although much smaller (0.001-0.1%of the size of nuclear genomes)size of nuclear genomes)
Cells contain many copies of plastids and each plastid Cells contain many copies of plastids and each plastid contains many genome copies contains many genome copies
Size ranges from 120 kb to 160 kbSize ranges from 120 kb to 160 kb Plastid genome has changed very little during evolution. Plastid genome has changed very little during evolution.
Though two plants are very distantly related, their Though two plants are very distantly related, their genomes are rather similar in gene composition and genomes are rather similar in gene composition and arrangementarrangement
Some of plastid genomes contain introns Some of plastid genomes contain introns Many chloroplast proteins are encoded in the nucleus Many chloroplast proteins are encoded in the nucleus
(separate signal sequence)(separate signal sequence)
![Page 72: Genomes. Definition Complete set of instructions for making an organism Complete set of instructions for making an organism master blueprints for all.](https://reader036.fdocuments.net/reader036/viewer/2022062421/56649d425503460f94a1db73/html5/thumbnails/72.jpg)
DNA for chloroplast proteins can be come DNA for chloroplast proteins can be come from the nucleus or chloroplast genomefrom the nucleus or chloroplast genome
Buchannan et al. Fig. 4.4