1

Functional Expression of Sodium-Dependent Glucose Transporter in Amelogenesis

H. Ida-Yonemochi, K. Otsu, H. Harada, and H. Ohshima

Appendix

Appendix Materials and Methods

Immunohistochemistry

Immunohistochemistry was performed using the Envision+/HRP system (Dako, Glostrup,

Denmark). The primary antibodies used in this study are anti-SGLT1, SGLT2, GLUT2,

Na+-K+-ATPase, enamelin, Ki67 and HIF-1 as listed in Appendix Table 1. When needed,

antigens were exposed by autoclaving the samples in citric acid buffer (pH 6.0) at 121°C for 5

minutes, followed by treatment with 0.3% hydrogen peroxide in methanol for 30 minutes at

room temperature to block endogenous peroxidase activity. To visualize the reaction products,

sections were treated with 0.02% 3,3’-diaminobenzidine (Dohjin Laboratories, Kumamoto,

Japan) in 0.05 M Tris-HCl buffer (pH 7.4) containing 0.005% hydrogen peroxide and were

counterstained with hematoxylin. For control experiments, primary antibodies were replaced

with pre-immune rabbit serum or mouse immunoglobulin Gs (IgGs). For immunofluorescent

staining, paraffin sections were treated with anti-SGLT1, SGLT2, Na+-K+-ATPase, GLUT2 and

HIF-1, and incubated with FITC-conjugated anti-rabbit IgG (diluted to 1:500; Vector

Laboratories, Burlingame, CA, USA) or Texas Red-conjugated anti-mouse IgG + IgM (diluted to

1:500; Rockland, Gilbertsville, PA, USA). For immunofluorescent staining, stained sections were

analyzed with a confocal laser scanning microscope (FV300, Olympus, Tokyo, Japan). After

image acquisition, contrast and brightness were adjusted using Photoshop CS4 (Adobe Systems,

Inc., San Jose, CA, USA).

2

For immunohistochemistry with anti-SGLT1 and anti-SGLT2 antibody at the

electron-microscopic level, the immunostaining procedure was the same as described above,

except for the inhibition of endogenous peroxidase. The immunostained sections were

subsequently postfixed in 1% osmium tetroxide reduced with 1.5% potassium ferrocyanide,

dehydrated in an ascending series of ethanol, and finally embedded in Epon 812 (Taab, Berkshire,

UK). Ultrathin sections (70 nm thick) were double-stained with uranyl acetate and lead citrate

and examined with an H-7650 transmission electron microscope (Hitachi High-Technologies

Corp., Tokyo, Japan).

Mouse incisor and molar organ cultures

Incisors were dissected from the lower jaws of ICR mice (CLEA Japan) on postnatal day 1 and

were put onto membrane filters (0.1 μm pore size, OMNIPORETM, Millipore, Bedford, MA,

USA) in a Trowell system and cultured for 4 days at 37°C in Dulbecco’s Modified Eagle’s

Medium (DMEM; Gibco BRL, Grand Island, NY, USA) with 10% fetal bovine serum, 100

μg/ml ascorbic acid (Seikagaku Kogyo, Tokyo, Japan) and 100 U/ml penicillin-streptomycin

(Gibco BRL). For molar organ culture, mandibular molar buds were dissected from ICR

embryonic mice at E13.5 and were grown for 10 days at 37°C in a Trowell system as described

above. After cultivation +/− exogenous reagents, the explants were fixed in 4% PFA and were

embedded into paraffin. For histological analysis, we made serial paraffin sections of whole

explants in the mesial-distal direction and compared them with the sections, including most

differentiated ameloblasts.

For the cell proliferation assay using Ki67 immunoreactivity, we selected dental

epithelial tissue areas of 0.013 mm2 from apical bud lesion, and the number of Ki67-positive

cells was normalized to total cells of the areas.

3

Cells and cell culture

A mouse dental epithelial cell line, mHAT-9a was maintained in DMEM/Ham’s F12 medium

(Invitrogen, Carlsbad, CA, USA) containing B-27 supplement (Invitrogen) with 20 ng/ml EGF

(R&D Systems, Minneapolis, MN, USA), 25 ng/ml FGF2 (R&D Systems) and 1%

penicillin-streptomycin (Gibco BRL). In some experiments, exogenous reagents were added into

the culture medium when the cells reached 80% confluence, and the cultures were incubated for

2 or 3 days.

Cell proliferation assay

For the quantitation of the viable cell number, mHAT-9a cells were plated in 96-well plates at a

density of 5 x 103 cells/well and were incubated with 500 µM phloridzin or 50 µM ouabain for

24 hrs. Then, 10 l of the Cell Counting Kit-8 (CCK-8, Dohjin Laboratories, Kumamoto, Japan)

was added to each well, and the plate was incubated for 4 hrs. The absorbance value was

measured by a GloMax system (Promega Corp., Wisconsin, USA) at a wavelength of 450 nm.

Small interfering RNA experiment

Small interfering RNA (siRNA) transfection to mHAT-9a cells was performed using

Lipofectamine TM RNAiMAX (Invitrogen). Control siRNA and Sglt2 siRNA were purchased

from Santa Cruz Biotech Inc. (sc-37007, sc-61540; CA, USA). Each siRNA (10 nM) was applied

to the cells and cultured for 48 hrs.

Quantitative real-time PCR analysis

cDNA was synthesized using the Prime Script 1st strand cDNA Synthesis Kit (Takara, Otsu,

Japan). Amplification condition of real-time PCR was as follows: 30 s at 95°C; 50 cycles of

95°C for 5 s and 60°C for 30 s; dissociation for 15 s at 95°C; and 30 s at 60°C.

4

Western immunoblotting

mHAT-9a cells were lysed in RIPA buffer [50 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA, 1%

Triton X-100, and 1% phosphatase inhibitor cocktail (Nacalai Tesque, Kyoto, Japan)]. Cell

lysates were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis

(SDS-PAGE) and then electrophoretically transferred to PVDF membranes (Bio-Rad, MA, USA).

For immunodetection, the following antibodies were used: anti--tubulin (Proteintech, IL, USA),

anti-SGLT1, anti-SGLT2 and anti-HIF-1. The Envision+/HRP system (Dako) was used and

antigens were detected using Western BLoT Quant HRP Substrate (Takara). Signals were acquired

using the ImageQuant LAS 4000mini system (GE Healthcare, Chicago, USA).

5

Appendix Table 1. List of antibodies for immunohistochemistry (IHC),

immunocytochemistry (ICC) and western blotting (WB).

Primary antibody

Name Type Resource Dilution for

IHC/ICC

Dilution for

WB

SGLT1 Rabbit polyclonal Abcam, ab14686 1:100 1:500

SGLT2 Rabbit polyclonal Abcam, ab85626 1:200 1:1000

GLUT2 Rabbit polyclonal Santa Cruz, sc-9117 1:200

Na+-K+-ATPase 1 Mouse monoclonal Abcam, ab7671 1:400

Enamelin Rabbit polyclonal Uchida et al., 1991. 1:1000

Ki67 Rat monoclonal Dako, M77249 1:100

HIF-1 Rabbit polyclonal Novus, NB100-479 1:100 1:1000

-tubulin Mouse monoclonal Proteintech, 66031-1 1:2000

Reference: Enamelin (Uchida T, Tanabe T, Fukae M, Shimizu M, Yamada M, Miake K, Kobayashi S.

1991. Immunochemical and immunohistochemical studies, using antisera against porcine 25 kDa

amelogenin, 89 kDa enamelin and the 13-17 kDa nonamelogenins, on immature enamel of the pig and rat.

Histochem. 96:129-138.)

6

Appendix Table 2. The primers used for quantitative real-time PCR analysis

Molecule Primer sequence Amplicon size Entrez Gene ID

β-actin

Forward 5'- GTGGGAATGGGTCAGAAGGA -3' 120 bp NM 007393

Reverse 5'- CTTCTCCATGTCGTCCCAGT -3'

Amelogenin (Am)

Forward 5'-GAAATGGGGACCTGGATTTT-3' 255 bp XM 006528691

Reverse 5'-GTGATGAGGCTGAAGGGTGT-3'

Klk4

Forward 5'- ACCCCAACTTCAACGATCCT -3' 207 bp NM 019928

Reverse 5'- ACGCCACTGAGAGATTCACA -3'

Mmp20

Forward 5'- AAGCAACCCCATGATCAGGA -3' 245 bp NM 013903

Reverse 5'- GGGCCATCTGTATTGCCTTG -3'

Nestin

Forward 5'- GACCAGGTGCTTGAGAGACT -3' 140 bp BC062893

Reverse 5'- ACCTGGTCCTCTGCTTCTTC -3'

Sglt1 (Slc5a1)

Forward 5'- AACAGCGCCAGTACTCTCTT -3' 130 bp AF208031

Reverse 5'- GTACCCAGGCAATGCTGATG -3'

Sglt2 (Slc5a2)

Forward 5'- GTAGCACGCTCTTCACCATG -3' 89 bp AY033886

Reverse 5'- CACCCAGAGCCTTCCAACTA -3'

Glut1 (Slc2a1)

Forward 5'-AATGCAGACTTGTGGCCTCT -3' 150 bp NM 011400

Reverse 5'-CCTCGAAGCTTCTTCAGCAC -3'

Glut2 (Slc2a2)

Forward 5'- CTGCACCATCTTCATGTCGG -3' 115 bp NM 031197

Reverse 5'- ACCTGGCCCAATCTCAAAGA -3'

Na+-K+ -ATPase 1

Forward 5'- ATCTGGTGGAGGTGAAAGGG -3' 147 bp BC025618

Reverse 5'- CCAAGGGGTTCTCGTTTGTG -3'

Hif-1

Forward 5'- TGGAACATGATGGCTCCCTT -3' 267 bp NM 001313919

Reverse 5'- TTCTGCTGCCTTGTATGGGA -3'

7

Appendix Figure 1. Whole image of the expression of SGLT1, SGLT2, and Na+-K+-ATPase in the

maxillary incisor at 3 weeks.

8

(A) Whole image of the maxillary incisor at 3 weeks shown in Figure 1A. (B, C) Double

immunofluorescent staining for SGLT1/Na+-K+-ATPase and SGLT2/Na+-K+-ATPase in the ameloblasts at

the secretory (B) and maturation (C) stages shown in Figure 1B. SGLT1 and SGLT2 are visualized with

FITC (green), and Na+-K+-ATPase is stained with Texas Red (red). Single and merged images. am,

ameloblast; si, stratum intermedium; pl, papillary layer. Bars, 500 μm (A), 25 μm (B, C).

9

Appendix Figure 2. The expression of SGLT1, SGLT2, and Na+-K+-ATPase in the maxillary molar

tooth germ.

SGLT2 starts to localize in the enamel organ cells from cap stage molar germs (E, H) and is strongly

immunopositive in the ameloblasts at the secretory and maturation stage, enamel organ cells (K, N), and

10

odontoblasts (K). SGLT1 is not observed in the molar tooth germs at embryonic stage (A, D, G).

Na+-K+-ATPase is strongly immunolocalized in the stratum intermedium of secretory and maturation

stages similar to that of maxillary incisor at the postnatal stage (L, O). eo, enamel organ; am, ameloblast;

si, stratum intermedium; dp; dental papilla/pulp. Bars, 50 μm (A, D, G); 100 μm (J, M).

11

Appendix Figure 3. Organ culture of mandibular incisor tooth germ with SGLT1/2 inhibitor,

phloridzin and sotagliflozin.

Macroscopic view of the explants of P1 mandibular incisors after 4 days of culture and HE stained

sections. The histological features of the phloridzin-treated explants are similar among the concentration

of 50 to 500 µM. Cell death is not observed in the 500 µM phloridzin-treated explant. In contrast, the

12

dental epithelial cells in the sotagliflozin-treated explants are about to die at the concentration of 50 µM.

Therefore, we used 500 µM phloridzin for in vitro culture experiments in the present study. de, dental

epithelium; dp, dental pulp. Bars, 50 μm.

13

Appendix Figure 4. Growth of molar tooth germ is disturbed by SGLT1/2 inhibitor.

Macroscopic view of the explants of E13.5 mandibular molars after 10 days of culture (A, D). HE

staining (B, D). Real-time PCR analysis of molar explants (C, E). Treatment with SGLT1/2 inhibitors,

phloridzin (500 µM, A-C) and sotagliflozin (10 µM, D, E). The control explants show the differentiation

of preameloblasts and preodontoblasts. In contrast, the phloridzin-treated explants show disturbance of

14

their differentiation (A, B). The cusp shape of explants becomes rounded in the phloridzin-treated molars

(B). mRNA expression of ameloblast-differentiation markers tends to reduce in the phloridzin- and

ouabain-treated molars (C). Sotagliflozin-treated molars show similar morphological changes with

phloridzin-treated molars (D, E). iee, inner enamel epithelium; pa, preameloblast; po, preodontoblast; dp;

dental papilla. Bars, 100 μm (B, upper, D); 50 m (B, lower). C: n = 5, 1-way ANOVA analysis. E: n = 4,

Student’s t-test.

15

Appendix Figure 5. The effects of extracellular glucose concentration on the expression of Sglt1 and

Sglt2 in ameloblast-lineage cells in vitro.

Real-time PCR analysis of ameloblast-lineage cells in low- and high-glucose condition. The mRNA

expressions of Sglt1, Sglt2, Na+-K+-ATPase and Glut1 were not significantly changed by glucose-free and

high-glucose conditions. n = 5, 1-way ANOVA analysis.