Enhanced PCR amplification incorporating 5’ primer flap sequences and free energy values near equilibrium

Oklahoma State University, National Institute for Microbial Forensics & Food and Agricultural Biosecurity, Department of Entomology and Plant Pathology, 127 Noble Research Center, Stillwater, OK 74078.

M. Arif, I. Oikonomakos, D. J. Caasi and F. M. Ochoa-Corona

• The objective of this study is to enhance the sensitivity of PCR-based detection by

combining primer design, optimal thermodynamics and 5’ AT-rich non-complementarysequences.

• Primers with AT-rich non-complementary sequences, i.e. 5′-AATAAATCATAA, located at

the 5’ terminal position were reported to increase PCR amplification yield (1).• Primers with ΔG value circa zero perform well in broad gradients of melting temperature

(Tm) (2).• Primer quality can be qualitatively assessed using reference ∆G values and

bioinformatics tools such as mFOLD and Primer3 during primer design (3).• The polymerase chain reaction (PCR) is a cornerstone technique in molecular biology,

with extended use and application in microbial forensics and agricultural biosecurity.

INTRODUCTION

MATERIALS AND METHODS1. Optimal and suboptimal primers were designed based on the sequence of the

movement protein gene of Tobacco mosaic virus (TMV) and the rDNA subunit ofPythium cryptoirregulare (Pc), using the Web interface software pathway Primer3-mFOLD-BLASTn (Fig.1), (3).

2. Two pairs are optimal, ‘TMV-2’ (ΔG = 0; product size 195 bp) & Pc-1 (ΔG = 0; productsize 434 bp) , and two other pairs are suboptimal ‘TMV-3’ (ΔG = ~1; product size 192

bp) & ‘Pc-2’ (ΔG = ~1; product size 454 bp).

(A)

RESULTSE-mail: francisco.ochoa_corona@okstate.edu and m.arif@okstate.edu

Primer Set

TMV-3;

ΔG = ~1

TMV-2;

ΔG = 0

Increase in PCR

yield (ng/µl)

PCR yield (ng/µl)

without 5’ flap

20.70 37.35 16.65 (80.4%)

PCR yield (ng/µl)

with 5’ flap

23.80 42.35 18.55 (77.9%)

Table 1. DNA quantification of one-step RT-PCR products from

eluted bands using Nanodrop®

Primers having optimal ∆G and 5’ AT-rich non-complementary nucleotides widened the range of

effective annealing temperatures of PCR assays (Fig. 4), improving also sensitivity (Fig. 5), andPCR- product yields (Table 1 & Fig. 6).

Fig. 4. TMV-gradient one step RT-PCR amplification. Tms ranged from 48⁰⁰⁰⁰C to 66⁰⁰⁰⁰C (A & B) and 48⁰⁰⁰⁰C to 62⁰⁰⁰⁰C (C & D). TMV-2 optimal primer set, (A)

without and (B) with 5’ AT-rich non-complementary nucleotides sequences. TMV-3 suboptimal primer set, (C) without and (D) with 5’ AT-rich non-

complementary nucleotides sequences.

(C)

(D)

(A)

(B)

1 Kb 48 48.5 49.6 50.9 53.0 55.6 58.6 61.2 63.2 64.6 65.6 66.0

Temperature in ºC

1 Kb 48 48.4 49.2 50.3 51.9 54.0 56.3 58.3 59.9 60.9 61.7 62.0

Temperature in ºC

200bp

100bp

100bp

200bp100bp200bp

100bp200bp

(A)

(B)

(C)

(D)

100bp200bp

100bp200bp

100bp200bp

100bp200bp

RNA template in ng/reaction

M 500 5 0 5 0.5 0.05 0.005 0.0005 0.00005

RNA template in ng/reaction

M 500 50 5 0.5 0.05 0.005 0.0005 0.00005

(A)

(B)

Fig. 1. (A) Location of TMV-2 optimal (blue) and TMV-3 suboptimal (red) primers in the TMV genome. (B) Location of Pc-1 optimal and

Pc-2 suboptimal primers in the P. cryptoirregulare rDNA subunit.

3. The effect of combining free energy values (ΔG) selected during primer design (Fig. 2)

with and without the addition of 5’ AT-rich non-complementary nucleotides was

measured by one step RT-PCR (for TMV; Fig. 3) and end point PCR (for Pc; notshown) of serially diluted RNA/DNA, and by quantifying the DNA yield using a

Nanodrop® (O.D.260 nm) after elution of excised bands. The effect on DNA yields wasalso quantified by SYBR® Green real time RT-PCR assays.

with 5’ flap

Increase in PCR

yield (ng/µl)

3.10

(15.0%)

5.0 (13.4%) 21.65 (104.6%)

CONCLUSIONS

1. Designing primers having ∆G = 0 and 5’ AT-rich non-complementary nucleotides increased DNA

yields and the sensitivity of one step RT-PCR and PCR detection.2. The addition of 5’ AT-rich non-complementary nucleotides to suboptimal primer assays has the

potential to improve DNA yields.

Fig. 3. RNA isolation from infected tobacco leaves and 10 fold serial dilution for sensitivity assays.

1 µl

9 µl

1 µl 1 µl 1 µl 1 µl 1 µl 1 µl

9 µl 9 µl 9 µl 9 µl 9 µl 9 µl

Serial dilutionRNA isolation

RNeasy plant mini kit

(QIAGEN)

Fig. 2. Optimal energy values of each oligonucleotide primer calculated and plotted using mFOLD. The black dots represent all

the optimal foldings. The colored, dots represent the superposition of all possible suboptimal foldings within p% deviation from

the minimum free energy, the red and green, representing foldings within p3% and p2% respectively and the yellow dots

represent base pairs least likely to form. X and Y axis are the nucleotide position in primer sequence.

TMV-2 Forward Primer TMV-2 Reverse Primer TMV-3 Forward Primer TMV-3 Reverse Primer

(4871)TGATAAAGTTCTTTTTAGAAGTTTGTTTATAGATGGCTCTAGTTGTTAAAGGAAAAGTGAATATCAATGAGTTTATCGACCTGACAAAAATGGAGAAGATCTTACCGTCGATGTTTACCCCTGTAAAGAGT

GTTATGTGTTCCAAAGTTGATAAAATAATGGTTCATGAGAATGAGTCATTGTCAGAGGTGAACCTTCTTAAAGGAGTTAAGCTTATTGATAGTGGATACGTCTGTTTAGCCGGTTTGGTCGTCACGGGCGAGTG

GAACTTGCCTGACAATTGCAGAGGAGGTGTGAGCGTGTGTCTGGTGGACAAAAGGATGGAAAGAGCCGACGAGGCCACTCTCGATCTTACTACACAGCAGCTGCAAAGAAAAGATTTCAGTTCAAGGTCGTT

CCCAATTATGCTATAACCACCCAGGACGCGATGAAAAACGTCTGGCAAGTTTTAGTTAATATTAGAAATGTGAAGATGTCAGCGGGTTTCTGTCCGCTTTCTCTGGAGTTTGTGTCGGTGTGTATTGTTTAT (5401)

1. RT-PCR amplification was carried out in 20 µl containing 10µL 2X reaction mix, 0.5µL RNaseOut, 2µL of each forward and reverseprimer (5µM), 0.4µL SSIII/Platinum Taq, 0.5µL BSA (10ug/ul), 2µL RNA template and nuclease free water 1.6 µL. Real time RT-PCRreactions were also in 20µL volume containing 10µL RT SYBR Green qPCR master mix, 6.4µL nuclease free water, 0.8µL of eachforward and reverse primer (5µM) and 2µL of cDNA.

2. PCR cycling conditions were 50⁰C, 30 min. (cDNA synthesis), initial denaturation 94⁰C, 2 min. for 40 cycles at 94⁰C, 30 sec.,annealing, 61⁰C (TMV-2) 30 sec. & 54⁰C (TMV-3). Polymerization, 30 sec. at 72⁰C and 7 min. final extension. For real time PCR,95⁰C, 10 min. initial denaturation 94⁰C, 2 min. for 40 cycles at 94⁰C, 30 sec., annealing, 54⁰C. Polymerization, 30 sec. at 72⁰C and

7 min. final extension.

LITERATURE CITED

LAB PROTOCOLS

1. Afonina, I., Ankoudinova, I., Mills, A., Lokhov, S., Huynh, P. and Mahoney, W. 2007. Primers with 5′ flaps improve real-time

PCR. Biotechniques 43 (6): 770-774.2. Ochoa Corona, F.M., Locali-Fabris, E. C., and Freitas-Astua, J. 2009. An RT-PCR procedure for detection and surveillance of

Citrus leprosis virus C (CiLV-C) in post-entry quarantine stocks of citrus. Phytopathology 99:S96.3. Ochoa Corona, F.M., Tang, J., Lebas, B.S.M., and Alexander, B. 2007. Validation of primer design for plant virus diagnostics

using the Web-interface pathway Primer3-mFOLD-BLASTn. Phytopathology 97: (7) S86.

Fig. 5. Sensitivity assay of one step RT-PCR. TMV-2 optimal primer set, (A) without and

(B) with 5’ AT-rich non-complementary nucleotides sequences. TMV-3 suboptimal primer

set, (C) without and (D) with 5’ AT-rich non-complementary nucleotides sequences. Lane

M: 1kb ladder, Lane 1-8: 10-fold serial dilutions of isolated TMV RNA starting from 500

ng/reaction.

Major rRNA Transcript

Internal Transcribed Spacer (ITS) Region Intergenic Spacer (IGS) Region

SSU (18S) RNA LSU (28S) RNA5.8S RNA

Region used for the primer design

9 µl

Fig. 6. Real Time PCR amplification of optimal TMV-2 and suboptimal TMV-3 with and without 5’ A/T rich flaps .

(A) TMV-2 & TMV-3

without 5’ flap(B) TMV-3 with &

without 5’ flap

(C) TMV-2 with &

without 5’ flap

TMV-2 without 5’ flap1 ng/rx

TMV-3 without 5’ flap1 ng/rx TMV-3 without 5’ flap

1 ng/rx

TMV-3 with 5’ flap1 ng/rx

TMV-2 without 5’ flap1 ng/rx

TMV-2 with 5’ flap1 ng/rx

TMV-2 without 5’ flap0.1 ng/rx

TMV-3 with 5’ flap0.1 ng/rx TMV-2 with 5’ flap

0.1 ng/rx