University of Groningen

CXCR3 signaling in the brainde Jong, Eilardus Koen

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.

Document VersionPublisher's PDF, also known as Version of record

Publication date:2007

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):de Jong, E. K. (2007). CXCR3 signaling in the brain: elucidating the expression and regulation of itsligands. s.n.

CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license.More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne-amendment.

Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.

Download date: 10-10-2021

- 69 -

Chapter 3:

Expression, sorting and transport of

neuronal CCL21 in large-dense core

vesicles

Eiko K. de Jong ,Vesna S. Stanulovic, Michel Meijer, Klaas Sjollema1, Hendrikus W.G.M.

Boddeke, Knut Biber

Department of Medical Physiology, University Medical Center Groningen, University of

Groningen, Groningen, The Netherlands 1 University Medical Imaging Center, University of Groningen, Groningen, The Netherlands

In preparation

- 70 -

Abstract

Currently, neurons are considered to contribute actively to immunological signaling after

brain injury. A possible candidate molecule in this neuro-glia signaling is the chemokine

CCL21. CCL21 is rapidly expressed by damaged neurons and activates microglia, the major

immunocompetent cells of the brain. This microglial activation is sometimes observed remote

from the primary lesion suggesting a signal which is transported.

Imaging of cultured primary cortical neurons and NG108 neuroblastoma cell line transfected

with EGFP-tagged CCL21, shows that CCL21 is packed into vesicles and transported

throughout neuronal processes to reach presynaptic structures. Using time-lapse confocal

microscopy, moving vesicles were detected in these cells. The majority of these CCL21-

EGFP loaded vesicles are detected in the processes of neurons where they move

predominantly in anterograde direction. Using fluorescent tags, it is shown that CCL21-EGFP

is co-localized with neuropeptide Y (NPY) in dense-core secretory vesicles and excluded

from the VAMP-2 containing synaptic vesicles.

This study shows that CCL21 is packed in dense core vesicles and is actively transported

throughout the whole neuron thus showing that neurons can actively direct and transport

inflammatory factors to specific (distant) sites.

Introduction

In order to protect nervous tissue from potential harmful immune reactions, the brain

maintains an anti-inflammatory environment and may thus be considered an immune-

privileged organ (see for recent review: (Bechmann et al., 2007;Galea et al., 2007)). Although

often misunderstood, this term does not imply the lack of an immune system in the brain, but

means that brain immunity is kept under tight control. It is very clear today that similar to the

peripheral immune system inflammatory factors like cytokines and chemokines are functional

in the brain (Adler et al., 2005;Biber et al., 2006;Rebenko-Moll et al., 2006). These factors are

found in the brain pre-dominantly during brain disease (Biber et al., 2006;Lucas et al.,

2006;Minami and Satoh, 2005). However, several cytokines are also expressed in healthy

brain, indicating a cytokine-dependent function in brain homeostasis (Banisadr et al.,

2005;Kapsimalis et al., 2005). Endogenous brain cells (glia and neurons) are potential cellular

sources for various inflammatory factors like cytokines or chemokines, and especially their

expression and function in neurons has recently gained much interest (Adler et al.,

2005;Banisadr et al., 2005). The brain is the most complex organ in the body and particularly

neurons dispose over various systems to sort, transport and target a large number of different

- 71 -

signaling molecules to specific release sites in order to mediate communication. Generally

neurotransmitters are found in synaptic vesicles that undergo recycling at synaptic sites (von

Gersdorff and Matthews, 1994;von Gersdorff and Matthews, 1999). Neurohormones,

neuropeptides and neurotrophins are localized in larger vesicles which can be sorted either to

the constitutive release pathway or to secretory granules (large dense core vesicles) of the

regulated release pathway (Brigadski et al., 2005;Lessmann et al., 2003;Mowla et al.,

1999;Salio et al., 2006). Despite the knowledge on classical neuronal signals, little is yet

known about possible sorting of inflammatory signals in neurons. We have recently shown

that under stress conditions, neurons specifically express the microglia activating chemokine

CCL21 (Biber et al., 2001;de Jong et al., 2005). Moreover, neuronal CCL21 was found in

vesicle like structures that were generally distributed across the neurons up to pre-synaptic

sites (de Jong et al., 2005). Accordingly, CCL21 was suggested to be a neuronal signal to

induce microglia activation at distant sites from a primary lesion (de Jong et al., 2005). A pre-

requisite for this, however, would be the sorting of neuronal CCL21 that would allow its

directed release.

We therefore have here addressed the question which neuronal vesicle type contains CCL21.

Co-expression studies of fluorescent-labeled CCL21 with markers of neuronal vesicles as well

as detailed live-imaging analysis of CCL21-loaded vesicles indicate that CCL21, in primary

neurons and in differentiated neuroblastoma cells, is sorted to secretory granules of the

regulated release pathway. Vesicles loaded with CCL21 are sorted into neuronal processes.

Taken together our data indicate that neuronal CCL21 is sorted and transported in large-dense

core vesicles, a system that may allow neurons the targeted release of CCL21, thus

corroborating our assumption that neuronal CCL21 is a signal to activate microglia at distant

sites from a primary lesion.

Materials and Methods

Chemicals

Media, sera and reagents used for cell culture and transfection were purchased from Gibco

(Breda, The Netherlands). TA vectors pCRII were from Invitrogen (Leek, The Netherlands).

Enhanced green fluorescent protein (pEGFP)-N2 vector was from Clontech (Alphen aan den

Rijn, The Netherlands). All other chemicals were from Sigma-Aldrich (Bornhem, Belgium).

Antibodies: rabbit anti CCL21 (Pepro-Tech, London, UK), mouse anti-GFP - 1:500

(Chemicon, Temekula, USA), rabbit anti-MAP2 – 1:500 (Chemikon), mouse anti-b3tubuline -

- 72 -

1:500 (Chemikon). Antibody binding was visualized using secondary antibodies coupled to

ALEXA488-, ALEXA633- (Molecular Probes, Breda, NL) or to cyanine 3 (Cy3) (Jackson

Immuno-Research West Grove)

Cell culture

Generally, cell cultures were maintained at 37°C in a humidified atmosphere containing 5%

CO2.

NG108 cells

NG108 neuroblastoma-glioma cells were cultured and transfected in culture medium (DMEM

with 10% fetal calf serum, 0.01% penicillin/streptomycin, 1% sodium pyruvate). Neuronal

differentiation of NG108 cells was done by transferring to differentiation medium (DMEM

with 0,5% FCS, 0.01% penicillin/streptomycin, 1% sodium pyruvate, 5-N ethylcarboxamide

adenosine (NECA)10-5 M , 3-isobutyl-1-methylxantine (IBMX) 10-6 M.

Cortical Neurons

Cultures of cortical neurons were established as described before (Biber et al, 2001). In brief,

pregnant mice (NMRI) were anesthetized with isoflurane, sacrificed by cervical dislocation

and ED 16 embryos were removed. Cortices were dissected in ice cold HBSS supplemented

with 30% glucose. After meninges were removed, cortices were placed in a 0,25% trypsin

solution at 37°C for 20 min. Subsequently, tissue was gently dissociated by trituration and

then filtered through a cell strainer (70 µm, Falcon). After one washing step (100x g for 10

min), neurons were seeded on poly-D-lysine (10 µg/ml)-coated glass or on Lab-TekTM II

Chambered Coverglass (Nunc, Sanbyo) at a density of 5×104/cm2 in complete Neurobasal

medium (Neurobasal medium containing 2% B27, 0.01% Penicilline/ Streptomycin, Sodium

Pyruvate and 2mM GlutaMax). Medium was refreshed by replacing half of the volume with

fresh complete Neurobasal medium.

Plasmids

The expression vector for pCCL21EGFP fusion protein was previously described (de Jong et

al., 2005). The following primers have been used to amplify the full or N-terminal deleted

CCL21 for subcloning into Xho I – BamH I sites of pmRFP-N1: CCL21F 5'-

ATACTCGAGATGGCTCAGATGACTCTGAGCCTC; CCL21del1F 5'-

- 73 -

ATACTCGAGATGCCCATCCCGGCAATCCTG; and CCL21R 5'-

GGTGGATCCGCTCCTCTTGAGGGCTGTGTCTGTTC, in corresponding plasmids

pCCL21mRFP, pdel1CCL21mRFP.

Plasmids: pmRFP-N1, pNPY-mRFP and pVAMP2-mRFP were kind gift from dr. R. Toonen,

VUMC, The Netherlands.

Transfection

Plasmids were transfected in to NG108 cells and primary cortical neurons using transfection

lipid jetPEI (Qbiogene, MP Biomedicals, Amsterdam, The Netherlands) according to the

instructions of the manufacturer. NG108 cells were transfected in culture medium for 12h and

transferred to differentiation medium. Primary cortical neurons were transfected on DIV (days

in vitro) 4-6 with a slight modification of the protocol. Briefly, conditioned medium was

collected and kept warm at 37°C. Cells were rinsed with Neurobasal medium (without

additives) once. After rinsing, JetPEI transfection was performed in neurobasal medium

(without additives) for 1h. After transfection, cells were rinsed three times with neurobasal

after which the cells were cultured in the original conditioned medium.

Western blot analysis

A denaturing 10% SDS-PAGE gel was used to resolve NG108 protein extract. The gel was

blotted overnight in 25 mM ethanolamine/glycine pH 9.5 to Hybond-ECL nitrocellulose

membrane (Amersham Biosciences, Arlington Heights, IL). Blocking in TBST (50 mM Tris

pH 7.5, 150 mM NaCl, 0.1% Tween), containing 5% low-fat milk powder (Nutricia, Cuijk,

The Netherlands) was followed by overnight incubation with rabbit anti-CCL21 - 1:500

(Pepro Tech) or monoclonal GFP 1:500 (Chemicon). After washing, the membrane was

incubated at room temperature for 2.5 h in TBST, containing 1% milk powder and secondary

horseradish peroxidase-conjugated antibody (Amersham Biosciences). Chemiluminescence

was developed by ECLplus Western blotting Detection System (Amersham Biosciences) and

visualised by exposing X-ray films (Kodak). Recombinant CCL21 was used as a positive

control (Pepro Tech).

Immunocytochemistry

Cells were fixed in 4% para-formaldehyde for 10 min, washed in PBS, blocked in PBS

containing 10% FCS and incubated overnight with primary antibodies (against CCL21, GFP,

MAP2, beta-3-tubulin). Antibody binding was visualized using secondary antibodies coupled

- 74 -

to ALEXA488-, ALEXA633- or to cyanine 3 (Cy3). Control experiments for all

immunocytochemical stainings were done by incubating cells in the absence of primary

antibodies.

Fluorescence imaging

Imaging of the immunofluorescent stainings and the different versions of the CCL21 fusion

proteins was performed on a Leica AOBS_TCS SP2 confocal laser scanning microscope

using a 63x NA 1.4 oil immersion objective (Leica Microsystems, Rijswijk, NL) with filters

for wavelengths 488, 543 and 633 nm for GFP, CY3 and ALEXA633 respectively.

Timelapse Imaging.

Vesicular CCL21 transport was visualised in transfected NG108 and primary cultured

neurons. Cells were grown on Lab-TekTM II Chambered Coverglass (Nunc) at 37°C in a

humidified atmosphere containing 5% CO2. Imaging was performed using a live-cell imaging

set-up (Solamere®, Salt Lake City, USA). The system consists of an Argon and Krypton laser

(Dynamic Laser, Salt Lake City, USA) with controlled power output. Selection of the

different laser lines was done with an AOTF which was connected to a CSU10 spinning

nipkow disk (Yokogawa, Tokyo, Japan). Lab-Tek chambers were placed in a motorized xyz

stage of a DM IR2 Leica microscope which was placed in a custom made incubation chamber

with an 37°C humidified atmosphere containing 5% CO2. A Stanford Photonics XR MEGA-

10 Gen III iCCD camera (Stanford Photonics, Palo Alto, USA) was used for acquisition. The

setup was controlled by ‘InVivo’ software (Media Cybernetics, Bethesda, USA)

Images were acquired at 3 frames per second (3 Hz) with 260 ms integration time per image

using a 63x NA1.4 oil immersion objective +1.5 Optovar (Leica Microsystems, Rijswijk,

NL).

Data analysis

Acquired time series were corrected for background noise and were deconvoluted using

Huygens Pro Software (SVI, Hilversum, NL). Vesicles were tracked using the M-trackJ

plugin (E.Meijering, Erasmus MC, Rotterdam, NL) for ImageJ (Abramoff MD, 2004;Rasband

WS, 2006).

A vesicle was regarded as moving when it moved for at least 3 frames in the same direction.

They were divided in three classes based on their type of movement (anterograde, retrograde

and bi-directional) using the distance to origin function of MtrackJ. For every vesicle the

- 75 -

average speed was calculated by dividing the total travelled distance by the total time.

Correction for non moving periods was applied.

Results

The N-terminus of CCL21 is responsible for vesicle sorting

In order to study the distribution of CCL21 in neurons, two CCL21-fusion proteins (CCL21-

EGFP and CCL21-mRFP) have been constructed. Using NG-108 cells as a neuronal cell line

model, it was observed that transient transfection revealed punctuate, vesicular expression of

both fluorescent labelled CCL21-fusion products (Fig. 1A for CCL21-EGFP and Fig. 2 for

CCL21-mRFP). In contrast the expression of the fluorescent label only, resulted in ubiquitous

cytoplasmic distribution not only in NG-108 cells (Fig. 1A for CCL21-EGFP and Fig. 2 for

CCL21-mRFP) but also in primary neurons (data not shown).

Since vesicles may contain multiple proteases it was investigated whether the CCL21-fusion

protein remained intact by western blot analysis in transfected NG-108 cells, employing anti-

CCL21 and anti-GFP antibodies. As expected, anti-GFP antibody recognised EGFP (27 kDa)

in pEGFP transfected NG108 cells and additionally the 42 kDa CCL21-EGFP fusion protein

in pCCL21-EGFP transfected cells (Fig. 1B). When anti-CCL21 antibody was used it

recognised recombinant CCL21 (15kDa) (positive control) and the 42 kDa CCL21-EGFP

fusion protein from pCCL21-EGFP transfected cells (Fig. 1C). Further control experiments in

NG-108 cells and primary cortical neurons revealed a complete overlay of the

immunocytochemical staining for anti-CCL21- and anti-EGFP-antibodies in CCL21-EGFP

transfected cells (data not shown). These experiments show two things: a) The sorting of

CCL21 is not due to the attached label (both labels show the same); b) the fusion protein stays

intact after sorting.

- 76 -

Figure 1. CCL21 is sorted into vesicle like structures. (A) Overview of differentiated NG108 cells transfected with CCL21-EGFP (top two panels) or EGFP (lower two panels). (B) Westernblot showing anti-EGFP staining of transfected NG108 cells. Lane 1 represents NG108 cells transfected with EGFP, lane 2 represents NG108 cells transfected with CCL21-EGFP, lane 3 is protein marker. (C) Westernblot showing anti-CCL21 staining of transfected NG108 cells. Lane 1 is an insert showing recombinant CCL21, lane 2 cells transfected with CCL21-EGFP and lane 3 is protein marker. BF is brightfield. Similar results have been shown in two independent westernblotting experiments.

- 77 -

Vesicle sorting is often due to specific motives (signal peptide) in proteins. An analysis of the

protein sequence of murine CCL21 using the signal peptide finder SignalP 3.0

(http://www.cbs.dtu.dk/services/SignalP/) (Bendtsen et al., 2004) revealed the possible

presence of a 23 amino acid long signal peptide at the N-terminal region of CCL21 with the

amino acid sequence “MAQMMTLSLLSLVLALCIPWTQG”.

In order to investigate whether the N-terminal region of CCL21 was responsible for the

vesicle sorting of CCL21 a N-terminal deletion (-57 amino acids) was made of the CCL21-

EGFP fusion protein (pCCL21delN-mRFP). Expression of pCCL21delN-mRFP resulted in

ubiquitous cytoplasmic distribution of the pCCL21delN-mRFP fusion protein, not

distinguishable from the expression of mRFP alone (Fig. 2). Thus CCL21 lacking its N-

terminus lost its ability to get sorted into vesicles.

Figure 2. The N-terminus of CCL21 is responsible for sorting into vesicles. Overview of cells transfected with CCL21-mRFP (top two panels), mRFP alone (middle two panels) or with an N-terminally deleted fusion construct (CCL21del-mRFP, lower two panels). BF is brightfield. The panels depicted here show typical results from three independent experiments.

- 78 -

Expression of CCL21-EGFP vesicles in primary neurons

In order to investigate where CCL21-EGFP containing vesicles are localized in primary

cortical neurons, these cells have been transfected with CCL21-EGFP (green fluorescent

signal) and analysed by fluorescence microscopy and immunohistochemical staining (red

fluorescent signal). The use of various neuronal markers identified CCL21-EGFP expressing

cells as neurons (Figure 3). CCL21-EGFP co-localized with neuronal tau (Fig. 3A,

arrowheads), tubulin (Fig. 3B, arrowheads) and synaptophysin (Fig. 3C, arrowheads). It

should be noted that CCL21-EGFP vesicles did not only overlap with synaptophysin staining

(Fig. 3C, arrowheads) but were also frequently observed in direct vicinity of synaptophysin-

positive sites (Fig. 3C, arrows). This staining pattern taken together with earlier findings

clearly show that CCL21-EGFP containing vesicles can be observed throughout neurons.

Figure 3. next page CCL21-EGFP expression in primary cortical neurons. In order to identify CCL21-EGFP transfected cells, they were stained for various neuronal markers (in red) such as tau (A), beta-3-tubulin (B) and synaptic marker synaptophysin (C). Arrowheads indicate the CCL21-EGFP protein (green); arrows in (C) indicate some synaptophysin and CCL21-EGFP in direct vicinity. The panels here show typical results from three independent experiments.

- 79 -

- 80 -

CCL21-EGFP is sorted into dense core vesicles.

In order to further characterise the nature of the CCL21-EGFP containing vesicles, VAMP2-

mRFP and NPY-mRFP expression plasmids were used. VAMP2 is a vesicular marker that

facilitates synaptic vesicle fusion with the plasma membrane and in neurons it is

predominantly localized in small synaptic vesicles (de Wit et al., 2001). Since neuropeptide-Y

(NPY) is specifically stored in dense core vesicles (DCV) (de Wit et al., 2001;Taraska et al.,

2003), it was used as a specific DCV marker. Co-transfection experiments using pCCL21-

EGFP (see Fig. 4A for CCL21-EGFP-signal alone) and pNPY-mRFP (see Fig. 4B for pNPY-

RFP-signal alone) revealed a nearly complete overlap of both fluorescent markers in NG-108

cells (see Fig. 4C for overlay). Similar results have been obtained in primary neurons (see Fig.

4D for overlay). Although the majority of the pCC21-EGFP and pNPY-mRFP signal

overlapped, few vesicles showed either only pCCL21-EGFP or only pNPY-mRFP

fluorescence (see arrowheads in Fig. 4D). In contrast, co-expression of pCCL21-EGFP (see

Fig. 4E for CCL21-EGFP-signal alone) and pVAMP-2-mRFP (see Fig. 4F for pVAMP2-

RFP-signal alone) did not show co-localization of both markers, neither in NG-108 cells (see

Fig. 4G for overlay) nor in primary neurons (see Fig. 4H for overlay).

Figure 4. next page CCL21 is sorted into large dense core vesicles. Differentiated NG108 cells and primary cortical neurons were transfected with CCL21-EGFP and pNPY-mRFP (A-D) or CCL21-EGFP and pVAMP2-mRFP (E-H) and subsequently analyzed for co-localization. Differentiated NG108 cells cotransfected and analyzed for (A) CCL21-EGFP in green, (B) pNPY-mRFP in red, (C) overlay of A and B showing overlay of the two signals in yellow. Differentiated NG108 cells cotransfected and analyzed for (E) CCL21-EGFP in green, (F) pVAMP2-mRFP in red, (G) overlay of E and F showing overlay of the two signals in yellow. (D) Co-localization of CCL21-EGFP and pNPY-mRFP in cortical neurons shown in yellow. Arrows indicate few spots were co-localization was not clearly detectable. (H) No co-localization could be observed in primary cortical neurons transfected with CCL21-EGFP and pVAMP2-mRFP. The panels depicted here show typical results obtained from three independent experiments.

- 81 -

- 82 -

Live-cell imaging of CCL21-EGFP-containing vesicles in NG-108 cells and primary

neurons

Live-cell imaging, using a laser scanning microscope coupled to a Nipkow spinning disc and

a high speed camera, allowed us to acquire images at 3Hz for prolonged periods of time.

Vesicles were visualised in NG-108 cells (data not shown) and primary cortical neurons as a

punctuated green signal throughout the cells, that showed complex transport behaviour

(Figure 5). In figure 5, a panel of nine frames indicates the movements of CCL21-EGFP

containing vesicles in primary cortical neurons at regular intervals. Individual vesicles were

observed in axons as well as dendrites and moved anterogradely (arrow 1) or retrogradely or

bi-directionally (arrow 2). In the first frame, the location of the soma is depicted with an

asterisk (*).

Figure 5. CCL21-EGFP vesicles move throughout neurons. Primary cortical neurons were transfected with CCL21-EGFP and subsequently analyzed for the presence of moving CCL21-EGFP-filled vesicles. Images were taken at 3Hz and vesicles were tracked for up to 4 min. These frames represent 44 sec from one experiment. Asterisk in frame 1 indicates the orientation of the soma. Examples of anterograde (1) and bi-directional (2) movements are indicated.

- 83 -

In total, 395 randomly selected individual vesicles were tracked and in figure 6 a total

overview of their movements is depicted. Figure 6 shows the frequency (in % of total) of a

specific vesicle velocity. Positive velocity values indicate anterograde transport and negative

velocity values indicate retrograde transport. In this figure, dendritic and axonal anterograde

or retrograde movements are shown. In axons, the majority of movements was in anterograde

direction (87% vs 13% retrograde); in dendrites anterograde and retrograde movements were

similar).

Figure 6. Vesicles move predominantly in anterograde direction. This figure shows a frequency curve illustrating the percentage of vesicles (y-axis) that moved at a certain speed (x-axis) in axons (red) and dendrites (blue). Positive velocity values indicate anterograde direction, negative velocity values indicate retrograde direction. The data represent the tracking results from 395 randomly selected individual vesicles in 6 transfected neurons.

Discussion

Neurons are the primary signal transducing cells in the brain. They mediate their signaling via

numerous synapses. In order to maintain synaptic transmission, neurons transport various

classes of signaling molecules to specific synaptic release sites. Evidence from the last couple

of years clearly shows that neurons not only communicate with other neurons, but that there is

0

5

10

15

20

25

30

35

-3,0 to -2,8

-2,8 to -2,6

-2,6 to -2,4

-2,4 to -2,2

-2,2 to -2,0

-2,0 to -1,8

-1,8 to -1,6

-1,6 to -1,4

-1,4 to -1,2

-1,2 to -1,0

-1,0 to -0,8

-0,8 to -0,6

-0,6 to -0,4

-0,4 to -0,2

-0,2 to 0,0

0,0 to 0,2

0,2 to 0,4

0,4 to 0,6

0,6 to 0,8

0,8 to 1,0

1,0 to 1,2

1,2 to 1,4

1,4 to 1,6

1,6 to 1,8

1,8 to 2,0

2,0 to 2,2

2,2 to 2,4

2,4 to 2,6

2,6 to 2,8

2,8 to 3,0

Speed(um/s)

Frequency(%

)

Dendrite

Axon

- 84 -

also directed information exchange with glia cells (Volterra and Meldolesi, 2005). Moreover

it has been recognized that neurons express various inflammatory mediators that control brain

immunity (Cardona et al., 2006;Hoek et al., 2000). It has been described that neuronal injury

may lead to microglia activation at distant sites from the primary injury. However, it has yet

not been elucidated whether neurons are capable of targeting their inflammatory signals in

order to trigger microglia activity at specific locations. Recent evidence showed that

endangered neurons specifically express the chemokine CCL21 which activates microglia via

chemokine receptor CXCR3. Furthermore, it has been reported that the lack of CCL21-

CXCR3 signaling may inhibit the microglia response after neuronal injury (Biber et al.,

2001;de Jong et al., 2005;Dijkstra et al., 2004;Rappert et al., 2002;Rappert et al., 2004).

CCL21 was moreover localized in vesicle like structures that were observed throughout

neurons (de Jong et al., 2005). Accordingly, CCL21 is considered a neuronal signal that

induces microglia activation at distant sites from a primary lesion (de Jong et al., 2005),

leading to the hypothesis that neurons express CCL21 and sort it to vesicles.

Neuronal CCL21 is targeted to secretory granules

Since there are various neuronal systems to sort and transport signaling molecules we have

determined the type of vesicle that contains CCL21 in primary cortical neurons. It is shown

here that 1) Expression of two different CCL21-fluorescent fusion proteins yields a punctate

localization indicative of vesicles, clearly distinguishable from the cytoplasmic expression of

the fluorescent protein alone. 2) Removal of the N-terminal part of CCL21 abrogated its

sorting into vesicles. Bioinformatics verified the presence of a 23 amino acid N-terminal

signal peptide. 3) CCL21-EGFP containing vesicles have been observed throughout

transfected primary neurons and co-localized with NPY-positive vesicles, a marker for large-

dense core vesicles (de Wit et al., 2001;Pelletier et al., 1984;Taraska et al., 2003) but not with

synaptic vesicle marker VAMP2. 4) CCL21-EGFP filled vesicles moved in axons

predominantly in anterograde direction. Targeting of CCL21-EGFP to both dendrites and

axons as well as transport behavior of CCL21-EGFP vesicles resembled that of large-dense

core vesicles containing other cargo (de Wit et al., 2001;Lessmann et al., 2003;Salio et al.,

2006)

Based on these findings it is concluded that neurons sort CCL21 into large-dense core

vesicles, the secretory granules of the regulated release pathway(Lessmann et al.,

2003;Thomas and Davies, 2005). Thus, neurons sort CCL21 into the same system that is used

- 85 -

for neurotrophins, neurohormones, and neuropetides, showing that neurons are capable to

regulate and target the release of inflammatory signals.

Implications for neuroimmunology

So far the cargo of large-dense core vesicles has exclusively been discussed in the context of

neuron-neuron communication (Lessmann et al., 2003;Salio et al., 2006) and others. Since the

only two other neuronal cytokines (IL-6 and TGF-β) that where also found in large-dense core

vesicles so far facilitate the survival of neurons, they also have been discussed in this

perspective (Moller et al., 2006;Specht et al., 2003). However, currently neurons are more and

more seen as active contributors to the local immune environment (Cardona et al., 2006;Galea

et al., 2007;Hoek et al., 2000). It seems reasonable to assume that such a contribution is

mediated by a cellular machinery which allows specific targeting and release of inflammatory

factors. Our data corroborate this assumption, thereby adding a new aspect to large-dense core

vesicle function, namely the targeting of inflammatory mediators in neuron-glia

communication. The cargo of large-dense core vesicles can be targeted towards pre-, post-

synaptic sites as well as somatodendritic sites (Lessmann et al., 2003;Li et al., 2005;Salio et

al., 2006). However, for CCL21 it is not yet known where it is released and how this release is

regulated.

The microglia activating chemokine CCL21 is by far not the only inflammatory mediator

present in neurons. Various reports clearly show that neurons may also express several other

cytokines and chemokines like IL-1β, IL-6, TGF-β, CXCL10, CXCL12, CCL2, CX3CL1

(Copray et al., 2001;Juttler et al., 2002;Moller et al., 2006;Specht et al., 2003). Little is yet

known, however, about the sub-cellular localization of these signaling molecules in neurons.

The findings of IL-6 and TGF-β in large-dense core vesicles and the description of neuronal

CCL2 and CXCL12 that co-localize with other neurotransmitters and neuropeptides in

synaptic regions (Moller et al., 2006;Specht et al., 2003) indicates that CCL21 is not the only

targeted inflammatory signal in neurons.

So far neurons have generally been implicated to be solely targets of immunological activity

in the brain, subject to activated immune cells. It now becomes more and more clear that

neurons actively contribute to the inflammatory milieu of the nervous system. The data

presented here strongly indicate that neurons not only sort and target signaling molecules for

neuron-neuron interaction, but that they also target inflammatory mediators that control

microglia activity in a similar way. It is proposed here that neurons can now thus be seen as

immune-modulators in the brain.

- 86 -

Conclusion

CCL21 expression in nervous tissue is exclusively found in damaged neurons, which is a

unique feature of this chemokine. The presented findings on CCL21-expression in large-dense

core vesicles imply that neurons can target and release this chemokine at specific sites,

supporting the assumption that neuronal CCL21 is a specific messenger used under

circumstances of neuronal degeneration and subsequent neuroinflammation.

- 87 -

Reference List

Abramoff MD (2004) Image Processing with ImageJ. (Magelhaes PJ, Ram SJ, eds), pp 36-42.

Adler MW, Geller EB, Chen X, Rogers TJ (2005) Viewing chemokines as a third major system of communication in the brain. AAPS J 7:E865-E870.

Banisadr G, Gosselin RD, Mechighel P, Kitabgi P, Rostene W, Parsadaniantz SM (2005) Highly regionalized neuronal expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) in rat brain: Evidence for its colocalization with neurotransmitters and neuropeptides. J Comp Neurol 489:275-292.

Bechmann I, Galea I, Perry VH (2007) What is the blood-brain barrier (not)? Trends Immunol 28:5-11.

Bendtsen JD, Nielsen H, von Heijne G, Brunak S (2004) Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 340:783-795.

Biber K, de Jong EK, van Weering HR, Boddeke HW (2006) Chemokines and their receptors in central nervous system disease. Curr Drug Targets 7:29-46.

Biber K, Sauter A, Brouwer N, Copray SC, Boddeke HW (2001) Ischemia-induced neuronal expression of the microglia attracting chemokine Secondary Lymphoid-tissue Chemokine (SLC). Glia 34:121-133.

Brigadski T, Hartmann M, Lessmann V (2005) Differential vesicular targeting and time course of synaptic secretion of the mammalian neurotrophins. J Neurosci 25:7601-7614.

Cardona AE, Pioro EP, Sasse ME, Kostenko V, Cardona SM, Dijkstra IM, Huang D, Kidd G, Dombrowski S, Dutta R, Lee JC, Cook DN, Jung S, Lira SA, Littman DR, Ransohoff RM (2006) Control of microglial neurotoxicity by the fractalkine receptor. Nat Neurosci 9:917-924.

Copray JC, Mantingh I, Brouwer N, Biber K, Kust BM, Liem RS, Huitinga I, Tilders FJ, Van Dam AM, Boddeke HW (2001) Expression of interleukin-1 beta in rat dorsal root ganglia. J Neuroimmunol 118:203-211.

de Jong EK, Dijkstra IM, Hensens M, Brouwer N, van Amerongen M, Liem RS, Boddeke HW, Biber K (2005) Vesicle-mediated transport and release of CCL21 in endangered neurons: a possible explanation for microglia activation remote from a primary lesion. J Neurosci 25:7548-7557.

de Wit H, Lichtenstein Y, Kelly RB, Geuze HJ, Klumperman J, van der Sluijs P (2001) Rab4 regulates formation of synaptic-like microvesicles from early endosomes in PC12 cells. Mol Biol Cell 12:3703-3715.

Dijkstra IM, Hulshof S, van der Valk P, Boddeke HW, Biber K (2004) Cutting edge: activity of human adult microglia in response to CC chemokine ligand 21. J Immunol 172:2744-2747.

Galea I, Bechmann I, Perry VH (2007) What is immune privilege (not)? Trends Immunol 28:12-18.

- 88 -

Hoek RM, Ruuls SR, Murphy CA, Wright GJ, Goddard R, Zurawski SM, Blom B, Homola ME, Streit WJ, Brown MH, Barclay AN, Sedgwick JD (2000) Down-regulation of the macrophage lineage through interaction with OX2 (CD200). Science 290:1768-1771.

Juttler E, Tarabin V, Schwaninger M (2002) Interleukin-6 (IL-6): a possible neuromodulator induced by neuronal activity. Neuroscientist 8:268-275.

Kapsimalis F, Richardson G, Opp MR, Kryger M (2005) Cytokines and normal sleep. Curr Opin Pulm Med 11:481-484.

Lessmann V, Gottmann K, Malcangio M (2003) Neurotrophin secretion: current facts and future prospects. Prog Neurobiol 69:341-374.

Li H, Waites CL, Staal RG, Dobryy Y, Park J, Sulzer DL, Edwards RH (2005) Sorting of vesicular monoamine transporter 2 to the regulated secretory pathway confers the somatodendritic exocytosis of monoamines. Neuron 48:619-633.

Lucas SM, Rothwell NJ, Gibson RM (2006) The role of inflammation in CNS injury and disease. Br J Pharmacol 147 Suppl 1:S232-S240.

Minami M, Satoh M (2005) Role of chemokines in ischemic neuronal stress. Neuromolecular Med 7:149-155.

Moller JC, Kruttgen A, Burmester R, Weis J, Oertel WH, Shooter EM (2006) Release of interleukin-6 via the regulated secretory pathway in PC12 cells. Neurosci Lett 400:75-79.

Mowla SJ, Pareek S, Farhadi HF, Petrecca K, Fawcett JP, Seidah NG, Morris SJ, Sossin WS, Murphy RA (1999) Differential sorting of nerve growth factor and brain-derived neurotrophic factor in hippocampal neurons. J Neurosci 19:2069-2080.

Pelletier G, Guy J, Allen YS, Polak JM (1984) Electron microscope immunocytochemical localization of neuropeptide Y (NPY) in the rat brain. Neuropeptides 4:319-324.

Rappert A, Bechmann I, Pivneva T, Mahlo J, Biber K, Nolte C, Kovac AD, Gerard C, Boddeke HW, Nitsch R, Kettenmann H (2004) CXCR3-dependent microglial recruitment is essential for dendrite loss after brain lesion. J Neurosci 24:8500-8509.

Rappert A, Biber K, Nolte C, Lipp M, Schubel A, Lu B, Gerard NP, Gerard C, Boddeke HW, Kettenmann H (2002) Secondary lymphoid tissue chemokine (CCL21) activates CXCR3 to trigger a Cl- current and chemotaxis in murine microglia. J Immunol 168:3221-3226.

Rasband WS (2006) ImageJ, US NIH Bethesda, Maryland.

Rebenko-Moll NM, Liu L, Cardona A, Ransohoff RM (2006) Chemokines, mononuclear cells and the nervous system: heaven (or hell) is in the details. Curr Opin Immunol 18:683-689.

Salio C, Lossi L, Ferrini F, Merighi A (2006) Neuropeptides as synaptic transmitters. Cell Tissue Res 326:583-598.

Specht H, Peterziel H, Bajohrs M, Gerdes HH, Krieglstein K, Unsicker K (2003) Transforming growth factor beta2 is released from PC12 cells via the regulated pathway of secretion. Mol Cell Neurosci 22:75-86.

- 89 -

Taraska JW, Perrais D, Ohara-Imaizumi M, Nagamatsu S, Almers W (2003) Secretory granules are recaptured largely intact after stimulated exocytosis in cultured endocrine cells. Proc Natl Acad Sci U S A 100:2070-2075.

Thomas K, Davies A (2005) Neurotrophins: a ticket to ride for BDNF. Curr Biol 15:R262-R264.

Volterra A, Meldolesi J (2005) Astrocytes, from brain glue to communication elements: the revolution continues. Nat Rev Neurosci 6:626-640.

von Gersdorff H, Matthews G (1994) Dynamics of synaptic vesicle fusion and membrane retrieval in synaptic terminals. Nature 367:735-739.

von Gersdorff H, Matthews G (1999) Electrophysiology of synaptic vesicle cycling. Annu Rev Physiol 61:725-752.

- 90 -