Neuroscience 294 (2015) 109–115

CLONING AND SEROTONERGIC REGULATION OF RING FINGERPROTEIN38 (rnf38) IN THE BRAIN OF MEDAKA (ORYZIAS LATIPES)

S. MORIYA, * N. B. KHEL AND I. S. PARHAR

Brain Research Institute, Jeffrey Cheah School of Medicine

and Health Sciences, Monash University Malaysia, PJ

46150, Malaysia

Abstract—Serotonin (5-HT) is a key regulator of mood and

sexual behaviors. 5-HT reuptake inhibitors have been used

as antidepressants. Really interesting new gene (RING) fin-

ger proteins have been associated with 5-HT regulation

but their role remains largely unknown. Some RING finger

proteins are involved in the serotonergic system, therefore,

we speculate that the gene expression of RING finger pro-

tein38 (rnf38) is regulated by the serotonergic system. In

the present study, we aimed to identify the full length

sequence of medaka (Oryzias latipes) rnf38 mRNA and

investigate its association with the serotonergic system

using an antidepressant, citalopram (CIT). We identified

the full length rnf38 cDNA, which consisted of 2726 nucleo-

tides spanning 12 exons and the deduced protein sequence

consisting of 518 amino acid residues including a RING fin-

ger domain, a KIT motif and a coiled-coil domain. Medaka

exposed to 10�7 M of CIT showed anxiety-like behavior.

The expressions of 5-HT-related genes, pet1, solute carrier

family 6, member 4A (slc6a4) and tryptophan hydroxylase

(tph2) were significantly low (P< 0.05) in the hindbrain.

On the other hand, rnf38 gene was significantly high

(P< 0.05) in the telencephalon and the hypothalamus.

This shows that 5-HT synthesis and transport in the hind-

brain is suppressed by CIT, which induces rnf38 gene

expression in the forebrain where 5-HT neurons project.

Thus, the expression of rnf38 is negatively regulated by

the serotonergic system. � 2015 The Authors. Published

by Elsevier Ltd. on behalf of IBRO. This is an open access

article under the CC BY-NC-ND license (http://creativecom-

mons.org/licenses/by-nc-nd/4.0/).

Key words: rnf38, RING finger domain, serotonergic system,

citalopram, medaka brain.

INTRODUCTION

Really interesting new gene (RING) finger protein is a

protein which possesses a characteristic zinc-binding

motif (RING finger domain). The RING finger proteins are

http://dx.doi.org/10.1016/j.neuroscience.2015.03.0120306-4522/� 2015 The Authors. Published by Elsevier Ltd. on behalf of IBRO.This is an open access article under the CC BY-NC-ND license (http://creativecomm

*Corresponding author. Tel: +60-3-5514-6376; fax: +60-3-5514-6341.

E-mail address: moriya.shogo@monash.edu (S. Moriya).Abbreviations: CIT, citalopram; FLU, fluoxetine; RING, reallyinteresting new gene; rnf38, RING finger protein38; RO, reverseosmosis; SSRIs, selective serotonin reuptake inhibitors.

109

involved in various cellular processes through protein–

protein or protein–DNA interactions (Saurin et al., 1996;

Borden, 2000). Many RING finger proteins, such as

PJA1, neuroregulin receptor degradation protein-1 and

Parkin play important roles in their ubiquitin-conjugating

enzyme (E2)-dependent E3 ubiquitin ligase activities

(Morett and Bork, 1999; Yu et al., 2002; Tan et al., 2011).

Furthermore, several RING finger proteins such as AO7

and Cbl bind to E2 ubiquitin enzymes and regulate ubiqui-

tination (Lorick et al., 1999; Yokouchi et al., 1999;

Freemont, 2000). Therefore, involvement in ubiquitination

is considered as a general function of RING finger proteins.

On the other hand, several RING finger proteins such as

RING finger protein8 have other functions like transcrip-

tion-stimulating activity (Takano et al., 2004).

RING finger protein 38 (Rnf38) possesses a

conserved RING-H2 domain among species, which

consists of C-X2-C-X(9–39)-C-X(1–3)-H-X(2–3)-H-X2-C-

X(4–48)-C-X2-C where C is cysteine residue, H is

histidine residue and X is any amino acid residue and

binds two zinc atoms (Fig. 1) (Freemont et al., 1991;

Freemont, 1993; Nalepa et al., 2006), and is widely

expressed throughout the body in human, especially

highly expressed in the heart, brain, placenta and the tes-

tis (Eisenberg et al., 2002). The role of Rnf38 remains

unknown.

Serotonin (5-HT) is a key modulator of numerous

physiological processes and behaviors, such as mood,

anxiety and sexual behaviors (Jacobs and Azmitia,

1992; Lucki, 1998), therefore, many genes are regulated

by the serotonergic system (Sillaber et al., 2008; Park

et al., 2012). Antidepressant-related gene 34 (Adgr34),

a RING finger protein, is regulated by the serotonergic

system (Yamada et al., 2000). Adrg34 gene expression

is induced in the rat hippocampus and the frontal cortex

by disruption of the serotonergic system. Furthermore,

another RING finger protein, Rines regulates the sero-

tonergic system by modulating ubiquitination and degra-

dation of monoamine oxidase A, which is the catabolic

enzyme of amine neurotransmitters such as 5-HT

(Kabayama et al., 2013). We speculate that Rnf38 is also

regulated by the serotonergic system in the brain.

Selective serotonin reuptake inhibitors (SSRIs) induce

an increase in extracellular 5-HT by inhibition of reuptake

of 5-HT through serotonin transporter at neurons,

therefore, SSRIs have been used to evaluate effects of

the serotonergic system in fish. Fluoxetine (FLU), which

is one of SSRIs, exposure decreases feeding rates and

growth in fathead minnows (Pimephales promelas)

ons.org/licenses/by-nc-nd/4.0/).

Fig. 1. Schematic structure of RING-H2 domain. C: cysteine residue,

H: histidine residue, X: any amino acid residue and Zn: zinc. Modified

from Nalepa et al. (2006).

110 S. Moriya et al. / Neuroscience 294 (2015) 109–115

(Stanley et al., 2007), exerts negative effects on swimming

and feeding behavior of hybrid striped bass (Moronesaxatiles �Morone chrysops) (Gaworecki and Klaine,

2008), delays the development of sexual characteristics

of maturing western mosquitofish (Gambusia affinis)(Henry and Black, 2008), alters plasma estradiol, and

inhibited egg production in zebrafish (Lister et al., 2009).

In the bluehead wrasse, chronic administration of FLU

causes reduction of aggressive behavior (Semsar et al.,

2004). Furthermore, fish exhibit anxiety-like behavior

against novelty stress and 5-HT levels affect their behavior

(Blaser and Gerlai, 2006; Levin et al., 2007). In zebrafish,

manipulation of 5-HT levels with FLU affects anxiety-like

behavior in the novel tank (Cachat et al., 2010).

The present study was designed to identify the full

length sequence of medaka (Oryzias latipes) rnf38mRNA and correlate the expression of rnf38 gene with

5-HT-related genes, tryptophan hydroxylase (tph2,

regulator of 5-HT synthesis), solute carrier family 6,

member 4A (slc6a4, encodes 5-HT transporter) and

pet1 (transcript factor regulating tph2 and slc6a4) in the

brain by manipulating the serotonergic system using a

SSRI, citalopram (CIT). In addition, we assessed

anxiety-like behavior following CIT treatment to evaluate

the effect of CIT.

EXPERIMENTAL PROCEDURES

Animals

Five-month-old male medaka (O. latipes) were

maintained in fresh water at 27 ± 1.0 �C under a

controlled natural photo regimen (14-h light/10-h dark

cycle). The fish were fed Advanced Fish Diets (ZM,

Winchester, UK) twice daily. All experimental

procedures were performed in accordance with the

guidelines of the Animal Ethics Committee of Monash

University (approval No. SOBSB_MY_2010_64).

Fig. 2. Schematic drawing of the sagittal brain section of the medaka

showing the regions used for gene expression analysis. The Region I

(telencephalic region): the telencephalon, the preoptic area and

olfactory bulb, the Region II (optic tectum): the optic tectum, the

Region III (hypothalamic region): the hypothalamus and midbrain, the

Region IV (cerebellum): the cerebellum and the Region V (hindbrain):

the hindbrain and the spinal cord.

Cloning of full length rnf38 cDNA

Medaka were anesthetized by immersing in a 0.01%

solution of benzocaine (Sigma, St. Louis, MO, USA),

killed by decapitation and the fresh brains were

dissected. Total RNA was isolated from the medaka

whole brain with TRIzol (Invitrogen, Carlsbad, CA, USA)

and converted to cDNA with SuperScript III reverse

transcriptase (Invitrogen) and oligo d(T) primer. Partial

CDS region was amplified with PCR. The primers were

designed based on the genomic sequence of a predicted

medaka rnf38 gene (accession No. ENSORLG00000

003296). The primer sequences were as follows: forward

primer, 50-GGGACAAGATGGAGGACAGTCCCAC-30, and

reverse primer, 50-CAGTTGACGCGACTCAAAGTCAC

TC-30. The PCR reaction was performed in a 20-llreaction mixture containing 1 � HotStarTaq Master Mix

(Qiagen, Hilden, Germany), 0.5 lM each of the primers

and 1 ll of cDNA. The reaction program consisted of

95 �C for 5 min, 35 cycles of 95 �C for 30 s, 60 �C for 30 s

and 72 �C for 2 min followed by 72 �C for 3 min. The

amplified DNA was subjected to direct sequencing using

BigDye Terminator v3.1 Cycle Sequencing kit (Applied

Biosystems, Foster City, CA, USA) and 3130 Genetic

Analyzer (Applied Biosystems).

Full length rnf38mRNA sequence was identified by 30-

and 50-rapid amplification of cDNA end (RACE). Gene-

specific primers were designed based on the identified

partial mRNA sequence. For 30-RACE, 1 lg of total RNA

was converted to cDNA with SuperScript III (Invitrogen)

and 50 pmol of oligo d(T)-containing adapter primer (AP)

in 20-ll volume according to the manufacturer’s

instruction. The converted cDNA was subjected to PCR

in a 10-ll reaction containing 1 � HotStarTaq Master

Mix, 10 pmol each of Abridged universal amplification

primer (AUAP, Invitrogen), and a gene-specific primer

50-CTGTGCGTAGTGTGTATGAGTG-30. The reaction pro-

gram consisted of 95 �C for 5 min, 35 cycles of 94 �C for

30 s, 64 �C for 30 s and 72 �C for 3 min followed by 72 �Cfor 10 min.

For 50-RACE, 1 lg of the total RNA was converted to

cDNA in 20-ll volume with SuperScript III (Invitrogen),

2 pmol of gene-specific primer 50-CTGGACCTCCGAG

GCATCTGCAC-30. Polyadenine was added at the 30 end

of the cDNA with terminal transferase (Roche

Diagnostics, Mannheim, Germany) according to the

manufacturer’s instruction. The polycytosine -tailed cDNA

Table 1. Real-time PCR primers used in this study

Gene Sequence (50–30) Product size (bp)

b-actin GAGCTATGAGCTGCCTGACG 103

GCAGGACTCCATACCAAGGA

pet1 GCGGAGGAAAGCTCATGTTC 139

AGGAACTGCCACAGCTGGAT

slc6a4 CGTGACTTGGTCCAACTTATCC 93

AGCTGGTGCAGACCTGATGA

tph2 TGTTTGATCACCGGAACCAG 88

TCGTTGATGGGACAGAAGGA

rnf38 TGACCCAGCCTTCTTGATTC 138

ATCCTCTGTAACGGTGAACG

S. Moriya et al. / Neuroscience 294 (2015) 109–115 111

was subjected to PCR reaction in 20-ll volume containing

1 � HotStarTaq Master Mix, 10 pmol each of 50-RACE

abridged anchor primer (Invitrogen) and a gene-specific

primer 50-GCGTATGGCATCTCTCTGGTATG-30. The

reaction program consisted of 95 �C for 5 min, 35 cycles

of 94 �C for 30 s, 64 �C for 30 s and 72 �C for 4 min

followed by 72 �C for 10 min. Furthermore, 1 ll of the

PCR reaction mixture was subjected to nested PCR.

Nested PCR was performed in a 20-ll reaction

mixture containing 1 � HotStarTaq Master Mix, 10 pmol

each of AUAP (Invitrogen) and a gene-specific primer

Fig. 3. (A) Deduced amino acid sequence of medaka Rnf38 and predicted do

acids 443–439, RING finger domain is amino acids 466–506. (B) Alignment

mouse (NP_598825), drosophila (XP_082352), and Arabidopsis (NP_56665

50-TAGGAGAAGATGGAGTGGAGG-30. The reaction

program consisted of 95 �C for 5 min, 35 cycles of 94 �Cfor 30 s, 64 �C for 30 s and 72 �C for 4 min followed by

72 �C for 10 min. The complete nucleotide sequence of

rnf38 mRNA was confirmed by a sequence analysis of

each PCR product. A RING finger domain was further

analyzed by the simple modular architecture research

tool (SMART) (Schultz et al., 1998; Letunic et al., 2012).

CIT treatment

CIT (Sigma–Aldrich, St. Louis, MO, USA) was dissolved in

reverse osmosis (RO) water to final concentrations of 0

(control), 10�7 and 10�8 M. Fish were randomly selected

and divided into three groups (N= 10 in each group).

The treatment was performed in the tanks (280 mm

(L) � 210 mm (W) � 180 mm (H)) containing 3 L of water

with different concentrations of CIT. During the

experiment, CIT solution was changed every day for

14 days. Doses 10�7 M and 10�8 M were selected based

on the previous study using male goldfish, where male

goldfish exposed to 1.7 � 10�7 M FLU for 14 days had

disrupted reproductive physiology such as decreased milt

volume and testosterone levels (Mennigen et al., 2010).

This suggests that exposure to 1.7 � 10�7 M SSRI is

mains. Coiled-coil domain is amino acids 412–432, KIL motif is amino

of RING finger domain among human (AF394047), rat (NP_604462),

1). Shaded boxes indicate amino acids involved in zinc coordination.

Fig. 4. Effect of CIT exposure on medaka behavior. (A) Latency to enter top half of the tank. (B) Number of transitions between the top half and

bottom half of the tank. Time spent at the bottom half (C) and the top half (D) of the tank. All of data are presented as mean ± SEM and analyzed by

a one-way ANOVA and Tukey’s post hoc test for multiple comparisons. ⁄P < 0.05.

112 S. Moriya et al. / Neuroscience 294 (2015) 109–115

effective in fish. Therefore, fish were exposed to 10�7 M

and 10�8 M of CIT in this study to investigate the associa-

tion of the serotonergic systemwith rnf38 gene expression.

Anxiety-like behavior test

After 14-day exposure to CIT, the fish (control: N= 9; CIT

(10�8 M): N= 8; CIT (10�7 M): N= 9) were subjected to

the anxiety-like behavior test. Anxiety-like behavior was

tested following our previously published method (Khor

et al., 2013). In brief, a tank with dimensions of 280 mm

(L) � 210 mm (W) � 180 mm (H) was filled with 7 L of

RO water. A camera was set at the side of the tank,

approximately 1 m away. After 14-day exposure, each

fish was transferred into the tank, and behavioral

response to novel environment was recorded for 10 min.

For the behavior analysis, the tank was marked into two

equal top and bottom halves. Parameters analyzed in this

study were latency to enter into the top half of the tank,

the number of transitions between top and bottom halves

and the time spent in the bottom half and top half.

Gene expression analysis of rnf38 and 5-HT-relatedgenes

After completion of behavioral test, fish (control: N= 9;

CIT (10�8 M): N= 8; CIT (10�7 M): N= 8) were

anesthetized by immersing in a 0.01% solution of

benzocaine (Sigma) and killed by decapitation. Fresh

brains were dissected, and embedded in Tissue Tek OCT

compound (Sakura Finetechnical, Tokyo, Japan), and

frozen in powdered dry-ice. Brain sections were cut into

sagittal planes (15 lm) and mounted onto a polyethylene

naphthalate membrane (PEN, Leica Microsystems,

Wetzlar, Germany) attached slide glasses and stored at

�80 �C until use.

The sections were briefly fixed in 70% ethanol and

stained with Cresyl Violet to identify brain nuclei. The

brains were divided into five regions (Fig. 2) by a laser

microdissection system (ArcturusXT, Applied Biosystems,

Foster, CA). Region I (telencephalic region) included the

telencephalon, preoptic area and the olfactory bulbs,

Region II (optic tectum) included the optic tectum, Region

III (hypothalamic region) included the hypothalamus and

the midbrain, Region IV (cerebellum) included the

cerebellum and Region V (hindbrain) included the

hindbrain and the spinal cord. The procedure for the laser

microdissection has been described in detail by Ogawa

et al. (2012). The laser-dissected tissues of each brain

regionattached toPENmembranewerepooled intoamicro-

tube containing 200 ll of TRIzol (Invitrogen, Carlsbad, CA),and total RNA was isolated according to the manufacturer’s

instructions. The entire isolated total RNA was subjected to

cDNA synthesis with High Capacity cDNA Reverse

Transcription Kit (Applied Biosystems, Carlsbad, CA) in

20-ll volume according to the manufacturer’s

instruction.mRNA levels of b-actin, pet1, slc6a4, tph2 and

rnf38 genes were examined by real-time PCR. Real-time

PCR was performed in 10-ll reaction mixtures containing

1 � POWER SYBR Green PCR Master Mix (Applied

Biosystems), 0.2 lM each forward and reverse primer,

and 1-ll cDNA. The primers used are shown in Table 1.

Real-time PCR was performed using a StepOnePlus

(Applied Biosystems) with conditions of 95 �C for 10 min,

Fig. 5. Effect of CIT exposure on 5-HT-related gene expression in

the medaka brain. pet1 (A), slc6a4 (B) and tph2 (C) gene expressions

were examined. The gene expression in the relevant region of control

sample was defined as 1.0. All of data are presented as

mean ± SEM and analyzed by a one-way ANOVA and Tukey’s post

hoc test for multiple comparisons. ⁄P< 0.05.

S. Moriya et al. / Neuroscience 294 (2015) 109–115 113

followed by 40 cycles of 95 �C for 15 s and 60 �C for 1 min

followed by a dissociation step. The levels of each mRNA

typewerenormalized tob-actinmRNAwith theddCtmethod

and the gene expression level in the control sample was

defined as 1.0 for each brain region.

Data analysis

Statistical analysis was performed by a one-way ANOVA

and Tukey’s post hoc test for multiple comparisons using

SPSS 18. P< 0.05 was considered as significant.

RESULTS

Full length rnf38 mRNA sequence

The identified full length rnf38mRNA (Genbank accession

No. KF431968) consisted of 2726 nucleotides spanning 12

exons when compared to themedaka genome. The coding

region starts at the first base of exon 3 and extends to the

60th base of the exon 12. The deduced protein sequence

region consisted of 518 amino acid residues including a

RING finger domain, identified as RING-H2 (C-X2-C-X14-

C-X-H-X2-H-X2-C-X10-C-X2-C) (Fig. 3A). In addition to the

RING finger domain, a KIL motif (K-X2-I/L-X2-I/L) and a

coiled-coil domain was also seen in the deduced

sequence (Fig. 3A). The RING-H2 sequence of Rnf38 is

conserved among the human, rat, mouse, drosophila and

Arabidopsis (Fig. 3B).

Behavior analysis

After 14-day exposure to CIT, the fish (control group,

10�8 M group and 10�7 M group) were subjected to the

behavioral test (Fig. 4). The latency to the top half of the

tank was significantly high in the 10�7 M group compared

to the control group. The number of transitions was

significantly low in the 10�7 M group. The 10�8 M group

revealed no significant difference in the latency and the

number of transitions. The time spent at the bottom half

and top half showed no significant difference in both

groups.

Gene expression analysis

The pet1mRNA levels were significantly low in the 10�7 M

group of the hypothalamic region and the 10�7 M group

and 10�8 M group of the hindbrain (Fig. 5A). The mRNA

levels of slc6a4 and tph2 were significantly low in the

10�7 M group of the hindbrain and no significant

difference was observed in the hypothalamic region

(Fig. 5B,C). rnf38 gene expression was examined in all

of the five regions (Fig. 6). rnf38 gene expression was

significantly increased in the 10�7 M group in the

telencephalic region and hypothalamic region. In the

other regions and concentration, no significant difference

was observed.

DISCUSSION

Full length cDNA of medaka rnf38 was identified and

compared with other species. The RING finger domain,

the KIL motif and the coiled-coil domain were predicted

from the deduced amino acid sequence. The RING-H2

domain of medaka Rnf38 is conserved among a wide

range of eukaryotes, which include the human, rat,

mouse, drosophila and Arabidopsis. The KIL motif

(Eisenberg et al., 2002) is present in a subset of the

RING-H2 domain and is located shortly upstream of the

RING-H2 domain (Macdonald et al., 1999). The coiled-

coil domain (Lupas et al., 1991) is also characterized

close to the RING finger domain region of the human,

rat and mouse (Eisenberg et al., 2002). The coiled-coil

domain is involved in protein–protein/DNA interaction,

which is observed in functional proteins, like some tran-

scription factors, c-fos and tropomyosin (Zuo et al.,

2010; Moore et al., 2011). mPY motif and SH2 binding

Fig. 6. Effect of CIT on rnf38 gene expression in the medaka brain.

The gene expression in the relevant region of control sample was

defined as 1.0. All of data are presented as mean ± SEM and

analyzed by a one-way ANOVA and Tukey’s post hoc test for multiple

comparisons. ⁄P< 0.05.

114 S. Moriya et al. / Neuroscience 294 (2015) 109–115

motif, which are key domains for ubiquitination, were not

present. Therefore, Rnf38 may not be involved in ubiqui-

tination as observed in many RING finger proteins, but

may be involved in other functions such as a transcription

factor (Morett and Bork, 1999; Yu et al., 2002; Tan et al.,

2011). Furthermore, since all functional domains of Rnf38

including the RING finger domain, the KIL motif and the

coiled-coil domain are highly conserved among species,

the role of Rnf38 could also be conserved.

To evaluate the effect of CIT treatment, anxiety-like

behavior test was performed by transferring the fish to

the novel tank after CIT exposure. Behavioral analysis

revealed anxiety-like behavior in the 10�7 M group. The

latency to the top half was increased and the number of

transitions was decreased compared to the control

group. Similar behavioral changes have been observed

in other fish (Blaser and Gerlai, 2006; Levin et al., 2007;

Lister et al., 2009; Cachat et al., 2010). In the bluehead

wrasse, chronic administration of FLU causes reduction

of aggressive behavior (Semsar et al., 2004). In the pre-

sent study, medaka exposed to CIT had low pet1mRNA levels in the hypothalamic region and pet1, slc6a4and tph2 mRNA levels in the hindbrain. In zebrafish, sev-

eral populations of pet1 expressing 5-HT neurons have

been reported in the hypothalamus and the hindbrain

(Lillesaar, 2011). This suggests that 5-HT synthesis and

transport in pet1 expressing 5-HT neurons is suppressed

by CIT exposure. The decreased presynaptic 5-HT could

cause anxiety-like behavior. Furthermore, the pet1expressing 5-HT neurons in the hindbrain may also be

involved in the behavioral changes, since mRNA levels

of the slc6a4 and tph2 were suppressed only in the hind-

brain of the 10�7 M group. On the other hand, behavioral

changes were not observed in the 10�8 M group. This

result is comparable with goldfish experiment exposed

to FLU (Mennigen et al., 2010). This is probably due to

no change of 5-HT synthesis and transport. In fact, there

are no changes in mRNA levels of slc6a4 and tph2 in both

the hypothalamic region and hindbrain of the 10�8 M

group.

The rnf38 was ubiquitously expressed in all regions of

the brain. The rnf38 expression was increased by CIT

only in the telencephalic and the hypothalamic region,

where pet1 expressing 5-HT neurons send projections

in the zebrafish (Lillesaar et al., 2009). This suggests that

the rnf38 gene in the telencephalic and hypothalamic

region is induced by the decline of 5-HT levels.

Induction of Rnf38 may be involved in the anxiety-like

behavior or non-cell autonomous by the decline of 5-HT

levels. Furthermore, the Rnf38 may play a common role

in 5-HT-related physiologies through protein–protein/

DNA interactions among vertebrates because of con-

servation of the amino acid sequence.

CONCLUSION

In this research, the full length sequence of medaka rnf38mRNA was identified and the RING finger domain and the

KIL domain which is accompanied by RING finger domain

was identified. Medaka exposed to CIT exhibited anxiety-

like behavior, suppression of the serotonergic system-

related genes mainly in the hindbrain, and increase of

the rnf38 gene expression in the telencephalic and the

hypothalamic region. It suggests that rnf38 expression is

negatively regulated by the serotonergic system.

Acknowledgments—We thank Dr. Tomoko Soga, Dr. Takashi

Kitahashi and Dr. Satoshi Ogawa for their constructive comments

and Ms. Jalilah Idris and Ms. Asha Thanabalan for their excellent

technical assistance.

This work was supported by grants from Monash University

Sunway Campus (SM-10-01) and Malaysian Ministry of

Higher Education (FRGS/2/2010/SG/MUSM/03/3, FRGS/1/2013/

SKK01/MUSM/03/1, and FRGS/1/2013/SKK01/ MUSM/03/6).

REFERENCES

Blaser R, Gerlai R (2006) Behavioral phenotyping in zebrafish:

comparison of three behavioral quantification methods. Behav

Res Methods 38:456–469.

Borden KL (2000) RING domains: master builders of molecular

scaffolds? J Mol Biol 295:1103–1112.

Cachat J, Stewart A, Grossman L, Gaikwad S, Kadri F, Chung KM,

Wu N, Wong K, Roy S, Suciu C, Goodspeed J, Elegante M,

Bartels B, Elkhayat S, Tien D, Tan J, Denmark A, Gilder T, Kyzar

E, DiLeo J, Frank K, Chang K, Utterback E, Hart P, Kalueff AV

(2010) Measuring behavioral and endocrine responses to novelty

stress in adult zebrafish. Nat Protocols 5:1786–1799.

Eisenberg I, Hochner H, Levi T, Yelin R, Kahan T, Mitrani-

Rosenbaum S (2002) Cloning and characterization of a novel

human gene RNF38 encoding a conserved putative protein with a

RING finger domain. Biochem Biophys Res Commun

294:1169–1176.

Freemont PS (1993) The RING finger. A novel protein sequence

motif related to the zinc finger. Ann N Y Acad Sci 684:174–192.

Freemont PS (2000) RING for destruction? Curr Biol 10:R84–R87.

Freemont PS, Hanson IM, Trowsdale J (1991) A novel cysteine-rich

sequence motif. Cell 64:483–484.

Gaworecki KM, Klaine SJ (2008) Behavioral and biochemical

responses of hybrid striped bass during and after fluoxetine

exposure. Aquat Toxicol 88:207–213.

Henry TB, Black MC (2008) Acute and chronic toxicity of fluoxetine

(selective serotonin reuptake inhibitor) in western mosquitofish.

Arch Environ Contam Toxicol 54:325–330.

Jacobs BL, Azmitia EC (1992) Structure and function of the brain

serotonin system. Physiol Rev 72:165–229.

Kabayama M, Sakoori K, Yamada K, Ornthanalai VG, Ota M,

Morimura N, Katayama K, Murphy NP, Aruga J (2013) Rines E3

S. Moriya et al. / Neuroscience 294 (2015) 109–115 115

ubiquitin ligase regulates MAO-A levels and emotional responses.

J Neurosci 33:12940–12953.

Khor YM, Soga T, Parhar IS (2013) Caffeine neuroprotects against

dexamethasone-induced anxiety-like behaviour in the Zebrafish

(Danio rerio). Gen Comp Endocrinol 181:310–315.

Letunic I, Doerks T, Bork P (2012) SMART 7: recent updates to the

protein domain annotation resource. Nucleic Acids Res

40:D302–D305.

Levin ED, Bencan Z, Cerutti DT (2007) Anxiolytic effects of nicotine in

zebrafish. Physiol Behav 90:54–58.

Lillesaar C (2011) The serotonergic system in fish. J Chem

Neuroanat 41:294–308.

Lillesaar C, Stigloher C, Tannhauser B, Wullimann MF, Bally-Cuif L

(2009) Axonal projections originating from raphe serotonergic

neurons in the developing and adult zebrafish, Danio rerio, using

transgenics to visualize raphe-specific pet1 expression. J Comp

Neurol 512:158–182.

Lister A, Regan C, Van Zwol J, Van Der Kraak G (2009) Inhibition of

egg production in zebrafish by fluoxetine and municipal effluents:

a mechanistic evaluation. Aquat Toxicol 95:320–329.

Lorick KL, Jensen JP, Fang S, Ong AM, Hatakeyama S, Weissman

AM (1999) RING fingers mediate ubiquitin-conjugating enzyme

(E2)-dependent ubiquitination. Proc Natl Acad Sci U S A

96:11364–11369.

Lucki I (1998) The spectrum of behaviors influenced by serotonin.

Biol Psychiatry 44:151–162.

Lupas A, Van Dyke M, Stock J (1991) Predicting coiled coils from

protein sequences. Science 252:1162–1164.

Macdonald DH, Lahiri D, Sampath A, Chase A, Sohal J, Cross NC

(1999) Cloning and characterization of RNF6, a novel RING finger

gene mapping to 13q12. Genomics 58:94–97.

Mennigen JA, Lado WE, Zamora JM, Duarte-Guterman P, Langlois

VS, Metcalfe CD, Chang JP, Moon TW, Trudeau VL (2010)

Waterborne fluoxetine disrupts the reproductive axis in sexually

mature male goldfish, Carassius auratus. Aquat Toxicol

100:354–364.

Moore JR, Li X, Nirody J, Fischer S, Lehman W (2011) Structural

implications of conserved aspartate residues located in

tropomyosin’s coiled-coil core. Bioarchitecture 1:250–255.

Morett E, Bork P (1999) A novel transactivation domain in parkin.

Trends Biochem Sci 24:229–231.

Nalepa G, Rolfe M, Harper JW (2006) Drug discovery in the ubiquitin-

proteasome system. Nat Rev Drug Discov 5:596–613.

Ogawa S, Ng KW, Ramadasan PN, Nathan FM, Parhar IS (2012)

Habenular Kiss1 neurons modulate the serotonergic system in the

brain of zebrafish. Endocrinology 153:2398–2407.

Park JW, Heah TP, Gouffon JS, Henry TB, Sayler GS (2012) Global

gene expression in larval zebrafish (Danio rerio) exposed to

selective serotonin reuptake inhibitors (fluoxetine and sertraline)

reveals unique expression profiles and potential biomarkers of

exposure. Environ Pollut 167:163–170.

Saurin AJ, Borden KL, Boddy MN, Freemont PS (1996) Does this

have a familiar RING? Trends Biochem Sci 21:208–214.

Schultz J, Milpetz F, Bork P, Ponting CP (1998) SMART, a simple

modular architecture research tool: identification of signaling

domains. Proc Natl Acad Sci U S A 95:5857–5864.

Semsar K, Perreault HA, Godwin J (2004) Fluoxetine-treated male

wrasses exhibit low AVT expression. Brain Res 1029:141–147.

Sillaber I, Panhuysen M, Henniger MH, Ohl F, Kuhne C, Putz B, Pohl

T, Deussing J, Paez-Pereda M, Holsboer F (2008) Profiling of

behavioral changes and hippocampal gene expression

in mice chronically treated with the SSRI paroxetine.

Psychopharmacology 200:557–572.

Stanley JK, Ramirez AJ, Chambliss CK, Brooks BW (2007)

Enantiospecific sublethal effects of the antidepressant fluoxetine

to a model aquatic vertebrate and invertebrate. Chemosphere

69:9–16.

Takano Y, Adachi S, Okuno M, Muto Y, Yoshioka T, Matsushima-

Nishiwaki R, Tsurumi H, Ito K, Friedman SL, Moriwaki H, Kojima

S, Okano Y (2004) The RING finger protein, RNF8, interacts with

retinoid X receptor alpha and enhances its transcription-

stimulating activity. J Biol Chem 279:18926–18934.

Tan Y, Yu F, Pereira A, Morin P, Zhou J (2011) Suppression of Nrdp1

toxicity by Parkin in Drosophila models. Biochem Biophys Res

Commun 416:18–23.

Yamada M, Yamada M, Yamazaki S, Takahashi K, Nishioka G, Kudo

K, Ozawa H, Yamada S, Kiuchi Y, Kamijima K, Higuchi T,

Momose K (2000) Identification of a novel gene with RING-H2

finger motif induced after chronic antidepressant treatment in rat

brain. Biochem Biophys Res Commun 278:150–157.

Yokouchi M, Kondo T, Houghton A, Bartkiewicz M, Horne WC, Zhang

H, Yoshimura A, Baron R (1999) Ligand-induced ubiquitination of

the epidermal growth factor receptor involves the interaction of the

c-Cbl RING finger and UbcH7. J Biol Chem 274:31707–31712.

Yu P, Chen Y, Tagle DA, Cai T (2002) PJA1, encoding a RING-H2

finger ubiquitin ligase, is a novel human X chromosome gene

abundantly expressed in brain. Genomics 79:869–874.

Zuo Z, Gandhi NS, Mancera RL (2010) Calculations of the free

energy of interaction of the c-Fos-c-Jun coiled coil: effects of the

solvation model and the inclusion of polarization effects. J Chem

Inf Model 50:2201–2212.

(Accepted 5 March 2015)(Available online 12 March 2015)