Cloning and Expression of Ole e 1

7/30/2019 Cloning and Expression of Ole e 1

1/6

THE OURNALF BIOLOGICALHEMISTRY Vol. 269,No . 21, ssue ofMay 27, p. 15217-15222,19940 1994 by The Ame rican Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

Cloning and Expression ofOZe e I, the Major Allergen fromOlive Tree PollenPOLYMORPHISM ANALYSIS AND TISSUE SPECIFICITY*

(Received forpublication, December 21, 1993, and in revised form, February 24, 1994)Mayte Villalba, Eva Batanero, Rafael I. Monsalve, Manuel A. Gonztilez de laPeiia, Carlos LahozS,and Rosalia Rodriguez9From the D epa rtam ento de B ioqu imica Biologia Molecular , Facul tad de Quimica, Univers idad Complutense,28040 M a d r i d , S p a i n a n d t h e m e p a r t a m e n t o d e Z n m u n o l o g i a , F u n d a c i d n J i m h e z D i a z ,8040 M a d r i d , S p a i n

Ole e I, the major allergen from the olive tree (Oleaeuropaea),is one of the main causes of allergy in Medi-terran ean countries and some areas of North America.The cloning nd sequencing of several cDNAs coding forthe olive allergen have been achieved. cDNA has beensynthesized from to tal pollen RNA and amplified by us-ing the polymerase chain reaction. The nucleotide se-quence data demonstrate the existence of microhetero-geneities in at least 37 positions out of the 145 aminoacids of Ole eI, thus explaining the high degree of poly-morphism exhibited by the natu ral protein. One of thesequenced cDNAs encoding a full-length isoform was n-serted into the plasmid vector pGEX-2T and overex-pressed. The recombinant Ole e I has been produced inEscherichia coli as a fusion protein w ith glutathione S -transferase of Schistosoma japonicum. This chimericprotein was purified by affinity chromatography on aglutathione-Sepharose 4B column and digested withthrombin to release the recombinant allergen. Both hefusion protein and the recombinant Ole e I were recog-nized in Western blot analysis by rabbit polyclonal andmouse monoclonalantisera raised against native Ole e Ias well as by the IgE of olive pollen-sensi tive humansera. This indicates that the ecombinant production ofindividual isoforms may be useful for the improvementof reagents to be used in diagnosis and therapy of IgE-mediated disorders. In addition, Ole eI mRNA has beenobserved to be pollen-specific as shown in a Northernblot analysis.

Type I allergy is a clinical disorder that affects more th an15% of the human population in developed countr ies. The iso-lation and characterizationof prote ins responsible for IgE-me-diated allergies (allergens) have beenmain goal of research inthe las t ew years. Allergens are usually proteins f molecularmass in the rangef 8-50 kDa exhibiting particular features interms of solubility an d stability, many of them being capablefcrossing the gut or respiratory barriers and triggering thegE-mediated reactions.

*This work was supported by Grants PB891087 and PB92/0195from the Direction General de Investigacibn Cientificay TBcnica totheMinisterio de Educacion y Ciencia, Spain. The costs of publication ofthis article were defrayed in part by the payment of page charges. Thisarticle must thereforee hereby markedadvertisement n accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.The nucleo tide eauencels) reDorted in thi sDaDer ha s been su bmittedX76396, an d X76397.to t he GenB ankT MIE MB LataBank with acieskon number(s) 76395,F a : 34-1-3944159.

8 To whom correspondence should be addressed. Tel.: 34-1-3944260;

Mites and both grass and tree pollens are considered themain natural sources producing allergy by inhalation. Amongthem, olive pollen allergy isa major human heal th problem inthe Mediterranean area 1,2). More than 70%of olive-allergicpatients are sensitive toO l e e I, the major allergen from O l e ae u r o p a e a pollen (3).This proteinhas been isolated, purified tohomogeneity, and characte rized by biochemical methods, in-cluding the determinationf its amino cid sequence(4,5).O lee I is an acidic protein, that exhibits two variants of the same145-residue polypeptide chain , glycosylated (20 kDa) and non-glycosylated (18.5 kDa) (6), and shows microheterogeneity a tseveral positions of its primary structure 5 ) .The biological roleof Ole e I in the olive pollen is unknown. In this regard, it isremarkable that O l e e I shows sequence similarity with otherproteins from pollens of nonrelated species. Its amino acid se-quence exhibits 36 an d 38% iden tity with he deduced se-quences of the polypeptides encoded by the UT52 ene fromtomato and the Z m c l 3 gene from maize pollens, respectively(5). The proteinsencoded by these genes seem tolay key rolesin pollen maturation, germination, andor pollen tube growth(7,8). These facts may suggest the potentialiological functionperformed by O l e e I in the pollen grain.Diagnosis a nd treatment of IgE-mediated allergy disordersrequi re the production of large amounts of pure and well de-fined proteins. The use of recombinant DNA technology hasproved to be a convenient tool to obtain homogeneous proteinpreparat ions, which are emarkablyuseful n he case ofpolypeptides as the allergens exhibit highsequence microhet-erogeneity. This approach will also allow the identification ofthe most impor tant residues involved in the immunologicalresponse. Recently, the full- leng th cDNAs of many importantallergens have been obtained and analyzed, including thosefrom pollens of ragweeds (9-121, grasses (13-151, and rees(16-19). However, there is a complete lack of data on cDNAsequences of the Oleaceae allergens, and only scarce data areavailable on the recombinantproduction of pollen allergens inhigh yields (20, 21).

In the study herein presented, thepolymorphism of the se-quence of cDNA encoding the major olive allergen, as well asthe tissuespecificity of its mRNA, has been analyzed. In addi-tion, an immunologically active and soluble recombinant O l e eI allergen has been produced in E scher i ch i a co l i .

MATERIALS AND METHODSIsolation of Ole e I Allergen-Native Ole e I allergen was purifiedfrom olive (0 .europaea) pollen (AllergonA B ) s reported (5).Isolation of Total RNA and cDNA Synthesis-Total RN A was isolated

from olive pollen according t o Ullrich et al . (22) with minor modifica-tions. Pollen 0.5 g) was homogenized in a Polytron homogenizer Brink-mann Instruments) n 0.1 M Tris-HC1, pH 7.5, containing M guanidinethiocyanate,0.5%sodium N-lauroylsarcosine (Fluka ChemieAG), 0.1%15217

atSUNYatSton

yBrookonOctober23,2006

www.jbc.org

Downloadedfrom
http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/http://www.jbc.org/


2/6

15218 Cloning and Expression of Oliveollenllergenantifoam (Sigma), nd 0.14M 2-mercaptoethanol. The clear upernatantwas centrifuged a t a 5.7 M CsCl cushion in 0.01 M EDTA at 40,000 rpmon an SW 60 rotor (Beckman) for 12 h (23). The same procedure wascarried out for the isolation of total RNAfrom different olive tree tissues(stem, leaf, and olive fruit), but an nitial step of crushing in a mortarwith liquid nitrogen was included. Double-stranded cDNA was synthe-sized from 5 pg of total RNA by using a cDNA synthesis kit (Clontech)and oligo(dT) as primer.

PCR'-based Cloning of Olive Allergen cDNA-The oligonucleotideprimers were designed based on the amino acid sequence of Ole e I (5).They were synthesized on an Applied Biosystems DNA synthesizermodel 381A according to standard procedures (23). The sequences anddescriptions of the oligonucleotides are shown in Table I. The DNApool(5 pl) that served as a template and the primers OL-1 and OL-2 weredissolved in PCR standard mixture. After a denaturation step a t 95 "Cfor 15 min, the sample was subjected to 30 cycles of denaturation a t94 "C (60 s ), annealing at 42 "C (90 s) , and extension a t 72 "C (120 s ) ina Techne Thermal Cycler PHC-3 (New Brunswick Scientific) with Tu9DNA polymerase (U. S. Biochemical Corp.). The agarose gel scissionedband was reamplified by using 5 cycles of denaturat ion a t 94 "C (60 s) ,anneal ing a t 47 "C (60 s) , chain extension a t 72 "C (90 s) , and 20 cyclesa t 94 "C (60 s) , 55 "C (90 s) , and 72 "C (90 s) . Each amplification roundwas terminated by holding a t 72 "C for 10 min and gradually cooled toroom temperature. The fragment waspurified by usin g theMagic PCRPrepkit (Promega), phosphorylated with T4 polynucleotide kinase(U. S. Biochemical Corp.), and inse rted into the SmaI s ite of a blunt-ended dephosphorylated pUC18 plasmid. Theransformation ofDH5aF'-competent cells and recombinant selection were achieved bystandard procedures.The cDNA fragment, amplified with primersOL-3 and OL-4 by singthe above PCR procedure, was digested with EcoRI and BamHI andincorporated into an EcoRIIBamHI-digested pUC18 plasmid vector.This was used for transformation and selection of recombinants con-taining a cDNA encoding the full-length amino acid sequence of Ole e I.Sequence Analysis of Ole e I cDNAs-DNAs from several pUC18clones were sequenced by using thedideoxy chain termination method(24) with the Sequenase kit (U..Biochemical Corp.) and (u-~~S-~ATP.Sequencing primers for both strands, M13mp18 universal and reverse,were purchased from New England Biolabs. The sequencing was car-ried out according to the manufacturer's recommendations.Northern Blot-Total RNA(5 pg) rom different tissues (pollen, stem,leaf, and fruit) were fractionated by electrophoresis in 1.2% formalde-hyde-agarose gel and blotted onto Hybond-N nylon membranes (Amer-sham Corp.) by using standardmethods (23). Membranes were prehy-bridized with 50% formamide, 4 x saline/sodium/phosphate/EDTAbuffer, 5 x Denhardt 's solution, 0.5% SDS, and 0.1 mg/ml denaturedherr ing sperm DNA. A 0.4-kilobase fragment, generated from cDNA byPCR with OL-1 and OL-2 primers, was radiolabeled with a commercialrandom-primed kit (Boehringer Mannheim) with [cY-~ 'P]~CTP3,000Cilmmol, Amersham Corp.). This probe was denatured and hybridizedto the immobilized RNA in prehybridization solution for 16 h a t 42 "C.Before autoradiography, blots were washed with 2 x SSC buffer, 0.1%SDSthree times t room temperature and wice a t 68 "C. The filter wasexposed to Kodak x-ray film at -80 "C for 2 h.Construction of Expression Plasmid-After sequencing, the cDNAclone OLE3c, whose deduced amino acid sequence was closest to thatobtained by Edman degradation ofOle e I, was subcloned into theBamHIIEcoRI sites of a pGEX-ST expression vector. Production of therecombinant protein was performed after transforming DH5aF' cellswith the pGEX-2TIOLE3c plasmid. This construction encodes a fusionprotein (GST-OLE3c) consisting of glutathione S-t ransferase fromSchistosoma japonicum and a 6-amino acid peptide (Leu-Val-Pro-Arg-Gly-Ser, a thrombin cleavage site) followed by the Ole e I polypeptidechain.Production and Purification of Recombinant Fusion Protein andThrombin Deatment-Overnight cultures of DH5aF ' cells containingthe recombinant plasmid pGEX-2T/OLE3c were diluted 10-fold withLuria broth medium containing 0.1mg/ml ampicillin. Cells were grownup to an absorbance value a t 600 nm of 0.6. After induction with 1mMisopropyl P-D-thiogalactoside (Sigma), cultures were maintained for 4 hand harvested by centrifugation at 4,000 x g for 20 min a t 4 "C. Thepellet was washed with PBS (10 mM sodium phosphate, pH 7.2,140 mMNaCI, 2.7 mM KCl), resuspended in PBS containing 1%Triton X-100 and1 mM phenylmethanesulfonyl fluoride, and mildly sonicated. The pre-cipitated material was dissolved in 0.1 M glycine/NaOH, pH 9.0, con-'The abbreviations used are: PCR, polymerase chain reaction; PBS,phosphate-buffered saline; bp, base palr(s).

1 2 3 4

1.6-.1o-0.6-0.4-0.2-

FIG. . Northern blot analysis of RNA from olive tree tissues.Five pg of total RNA from different tissues was electrophoresed in a1.2% formaldehyde-agarose gel, trans ferred to a nylon membrane, andprobed with radiolabeled cDNA encoding olive pollen allergen. Lane I ,olive fruit; lane 2, leaf; lune 3, stem; lane4, pollen. Numbers correspondto kilobases of RNA standards (Boehringer Mannheim).taining 8 M urea and fractionated by spin column chromatography onSephadex G-25 (Pharmacia Biotech Inc.) equilibrated in 0.1 M glycine/NaOH, pH 9.0. The eluted protein was stored overnight a t 4 "C. Thisfraction was applied onto a column (5 ml) of glutathione-Sepharose 4Bequilibrated in PBS, 1% Triton X-100 and eluted with 10 mM reducedglutathione in 50 mM Tris-HC1,pH 8.0. Fractionscontaining GST-OLE3c fusion protein were dialyzed against 10 mM Tris-HCI, pH 8.0,and lyophilized. The fusion protein in 50 mM "is-HCI, pH 8.0, contain-ing 5 mM EDTAwas digested with 1NIH unit of bovine thrombin (PierceChemical Co.)/mg of protein a t room temperature for 6 h.

Electrophoresis an d Immunoblotting-Native and recombinant sam-ples were analyzed by SDS-polyacrylamide gel electrophoresis accord-ing to Laemmli (25) in 15% polyacrylamide gels under reducing condi-tions. Proteins were visualized by Coomassie Brilliant Blue staining orelectrophoretically t ransferred onto Immobilon membranes (Millipore)(26) for immunostaining as described (5, 6). For IgE binding analysis,the membranes were incubated overnight a t 4 " C with a pool of olivepollen-allergic patient serum diluted 1:8 in PBS containing 3% skimmilk and 0.1% Tween 20 and then incubated with horseradish peroxi-dase-labeled goat anti-human IgE antibodies (Nordic ImmunologicalLaboratories) diluted 1:1,000 in PBS, 0.05% Tween 20, 1% skim milk(6). Alternatively, the membranes were incubated with abbit polyclonalserum raised against Ole e I (diluted 1:5,000) or with Ole e I-specificmouse monoclonal antibody 19G6 (diluted 1:1,000). Goat anti-rabbitIgG (Bio-Rad) and goat anti-mouse IgG (Pierce Chemical Co.), bothhorseradish peroxidase-labeled, were used a s th e secondary antibody,respectively. The peroxidase reaction was developed alternatively with3,3'-diaminobenzidine HCl, 0.03% H,O, in PBS for 1 min or with theECL Western blotting reagent (Amersham Corp.) as described (5, ).

RESULTSIsolation and Tissue Specificity of Ole e I mRNA-Northernblot analyses were conducted on total RNA purified from pol-len, leaf, stem, and fruit tissues of olive tree. These sampleswere fractionated on formaldehyde-agarose gels, transferredonto nylon membranes, and hybridized with a radiolabeledprobe. The 32P-labeled PCR-amplified cDNA fragment, ob-tained with OL-1 and OL-2 primers and corresponding to the408 bp between residues 9 and 145 of the protein, was used asprobe.An abundant single 0.8-kilobase transcrip t was only de-tected in the pollen tissue since no detectable signal was ob-served in leaf, fruit, or stem tissues (Fig. 1).Thus, the Ole e Iallergen is exclusively expressed in the pollen tissue.Characterization of PCR-amplified Clones Coding fo r Ole eI-TotalRNA from olive pollen was used to synthesize andamplify the Ole e I cDNA. Primers corresponding to the 5' and3' ends of the sequence encoding the olive allergen cDNA clone

atSUNYatStonyBrookonOctober23,2006

www.jbc.org

Downloadedfrom


3/6

Cloning and E xpression of Oliveollenllergen 15219were designed based on the amino acid sequence of the nativeprotein ( 5 ) .The use of degenerate primers covering the lengthof the protein provided very poor yields, and primer dimerproducts appeared. Therefore, two degenerate primers (OL-1and OL-2; see Table I), which covered the region between th eresidue at position 9 and theCOOH-terminal end of the protein(145th position), were used as an initi alpproach (Fig. 2u). Thenucleotide sequences obtained from eight truncated cDNAclones are shown in Fig. 3. These results allowed both theanalysis of the polymorphism of the allergen and thedesign ofa non-degenerate primer complementary to its COOH-terminalend. Accordingly, degenerate and non-degenerate primers(OL-3 and OL-4, respectively; see Table I) were used for asecond'PCR amplification approach to obtainclones expressinga full-length allergen (Fig. 2 b ) . OL-3 corresponds to the NH,-terminal region (first 15 bp) of the protein, and OL-4 corre-sponds to the most abundant nucleotide sequence that matchedthe 3' end of the encoding sequence determined by the firstapproach. Three full-length cDNAs, OLElc, OLE3c, andOLE5c, were obtained by this method. Their sequences areshown in Fig. 3. Both approaches provided cDNA fragmentsthat migrated a s homogeneous products in agarose gel electro-phoresis (Fig. 2 ) . The cDNA fragment corresponding to thefull-length sequence (444 bp) would encode a polypeptide of16-17 kDa. This value s slightly lower than tha t stimated fornon-glycosylated Ole e I by SDS-polyacrylamide gel electro-phoresis (18.5 kDa) (4), but it is in good agreement with thevalue obtained from mass spectrometry (16.6 kDa) (6) and theamino acid sequence of the allergen (16.3 kDa) ( 5 ) .

The amino acid sequences deduced from all of these cDNAs,partially or totally encoding the Ole e I allergen,are shown inFig. 4 in comparison with the sequence obtained from the na-tive protein by Edman degradation. Clones OLE16 and OLE20code for the same amino acid sequence as it occurs in clonesOLE33 and OLE37. A single amino acid exchange (99th posi-tion) is observed between the sequence deduced from cloneOLE3c and that of the natural allergen. All of the sequencesmaintain the glycosylation site described for the protein a tAsn-111. The differences obtained by comparing each of thenucleotide sequences, as well as their deduced amino acid se-quences, ar e shown in Table 11. Heterogeneity appears at 37positions of the primary structure of the olive allergen (Fig.41,but no more than 22 residues are different when deducedamino acid sequences are compared with each other. At least85% identityexists between every pair of polypeptide se-quences. The observed similarity is strongly increased if con-servative changes such as Val/Ile/Leu, Arg/Lys,or GldAsp areconsidered. According to th e IUIS nomenclature for allergens(27), the protein isoforms encoded by the full-length nucleotidesequences here reported, OLE3c, OLE5c, and OLElc, can becalled Ole e 1.2, Olee 1.3,and Ole e 1.4, respectively, since Ole e1.1is assumed for the main sequence obtained by Edman deg-radation.

Expression of Ole e I-encoding cDNA-The expression of therecombinant full-length Ole e I protein was performed in E.coli. The BunHIIEcoRI fragmentof OLE3c was selected to besubcloned and expressed in thepGEX-2T plasmid, which con-tains the glutathione S-t ransferase gene under the control of

TABLEOligonucleotides usedin PCR and sequencingIn the nucleotide sequence, R represents GIA, Y represents C/T, Z represents APTIC, and N represents AfI'lClG. Numbers in parenthesescorrespond to the positions of the peptides in the primary structure of the allergen (5).The BamHI and coRI restriction sites are underlined.OL-4contains a translational stou codon at the 3' end of the seauence.Oligomer Nucleotide sequence Strand Amino acid sequence

OL-1 5'CARTTYCAYATZCARGGNCARGT3' Coding QFHIQGQ (9-15)OL-2 5'ATCATRTTNGGNGGRTACATNCC3' Noncoding MYPPNM (140-145)OL-3 5'CCGGGATCCGARGAYGTNCCNCA3' CodingDVPQ (1-5)OL-4 5'CGGAATTCTCACATGTTGGGCGGGTA3' Noncoding YPPNM (141-145)

3'L'5 3'OL-1 IFIG. . Cloning strategies. a, PCRamplification to obtain the cDNA rag-ment (lane 1, 40 8 bp)encoding Ole eIfrom the residue at position 9 to the car-boxyl terminus of the mature protein byusing primers OL-1 and OL-2. This cDNAfragment was used for the analysis of thepolymorphism. The sequence of the OL-4primer was selected from these data. b ,PCR amplification of cDNA encoding thefull-length protein (lane 2, 44 4 bp) by us-ing primers OL-3 and OL-4. This cDNAwas used for sequence and expression ofthe full-length allergen. Lane m, molecu-lar mass markers (ADNAIHindIII, U. S.Biochemical Corp.). Primer sequences(heavy lines) are given in Table I. 2-stage PCR 1 oL-25 3'5' 408bpdd(a) Clonednto SEQUENCE- NALYSISpUCl8 1OL-4 primerClonednto SEQUENCE'3 c ]pUCl81

loned intopGEX-2T

EXPRESSION


www.jbc.org

Downloadedfrom


4/6

15220 Cloningndxpression o f Oliveollenllergen

OLE33OLE37OLE6OLE20OLE16

OLE19OLE17OLE26OLE3COLElCOLE5COLE33OLE37OLE6OLE16OLE17OLE20OLE19OLE26O M 3 COLElCOLC5C

OLE3OLE37OLE6OLE16OLE20OLE17OLE19OLE26OLE3COLElCOLE5C

OLE33OLE37OLE16OL E

OLE17OLE20OLE19OLE26OLEICOLElCO L E %

OLE33OLE37OLE6OLE16OLE20OLE17OLE1OLE2OLElCOLE3CO LE5 c

OLE33OLE37OLE6OLE16OLE20OLE17OLE19OLE26OLElCOLK3EOLE5c

OLE33OLE37OLE6OLE1OLE20OLE17OLE19OLE26OLE3cOLElCOLESC

OLE33OLE37OLE6OLE16OLE17OL E 2 0OLE19OLE26O U l COLE3cOLE5c

OLE33OLE37OLE6OLE16OLE20OLE19OLE17

OLE3cOLE26

OLE52OLlllC

TTAQ0"0"0"Q"Q-0"G"

"_

".

AQC ATQ CTC M O M OT QAT CAC M Q M T AQ TTC TOT QM TC AC A21 3

cated and full-length isoforms) DNAs. Numbering begins at theFIG. . Nucleotide sequences of olive pollen allergen (trun-GAG codon corresponding o th e NH,-terminal residue (Glu) of th enatur al protein. Dashes indicate identityof nucleotides with respect tothe upper sequence.

the ta c promoter (28). This construction would produce a fusionprotein composed of glutathione S-transferase and theecom-binan t allergen linked through a hexapeptide that contains acleavage sit e for the proteolytic activity of thrombin. The ex-pression of the inserted cDNA fragment generated a recombi-nant protein,GST-OLE3c, with an est imated olecular mass of42 kDa (Fig. 51, which agrees with the molecular mass of 26kDa for glutathione S-transferase (29) and 16.3 kDa for thepolypeptide chain of Ole e I ( 5 ) .Although the yield was about100 mg f fusion prot ei dit er of cell culture, less tha n 2% of thisprotein remained soluble after lytic treatment of the trans-formed cells (Fig. 5 ) .After treatment of the pellet in 8 M urea,spin column separa tion, and olding overnight (30), h e solublematerial was chromatographed over a glutathione-Sepharoseaffin ity column. The eluted GST-OLE3c protein fusion (about25 m d i t e r of cell culture) (Fig. 5 ) was digested with thrombin.The molecular mass of the recombinant Ole e I obtained by theproteolytic treatment agrees well with tha t of the polypeptidechain of the olive allergen (Fig. 5 ) . As a consequence of thecloning, recombinant Ole e I should contain 2 extra residues(Gly-Ser) at the amino terminus.Immunological Characterization of Recombinant Ole e I-The thrombin cleavage product a s well as the GST-OLE3c fu-sion proteinwere used for immunological assays. After Westernblotting and mmunostaining, GST-OLE3c and recombinantOle e I were recognized by a rabbit antiserumobtained agains tOle e I and by the Ole e I-specific monoclonal antibody 19G6(Fig. 6, a and b) .These data demonstrate thexistence of B-cellepitopes shared by the native and theecombinant olive pollenallergen. Finally, IgE antibodies from sera of olive pollen-aller-gic patien ts bind in Western blot analyses to both recombinantOle e I and GST-OLE3c fusion protein (Fig. 6c), indicating thepresence of allergenic epitopes in the expressed molecules.

DISCUSSIONA simple and efficient method h as been employed to cloneolive pollen cDNA molecules, which encode the translated re-

gion of the main allergen Ole e I i n 0. europaea. This methodavoids the tedious screening of a cDNA library. By using thePCR, eight partial- and threeull-length dis tinct olive allergencDNA clones have been synthesized and sequenced. The degreeand natu re f the protein polymorphism were evaluated mainlywith the former sequences. With a full-length open readingframe nucleotide sequence, a construction was designed toachieve the expression of the recombinant allergen.

The sequence data for the amplified cDNA revealed consid-erable heterogeneity for th e Ole e I allergen that would com-prise a family of proteins including a t least ninemembers (twoprotein sequences ar e encoded by two pairs of clones). This is inagreement with the preliminary etection of multiple isoformsin the nati ve rotein observed by reverse-phase high-perform-ance liquid chromatography (4) and isoelectrofocusing (3). Infact, microheterogeneity was demonstrated at 11 positions inthe complete amino acid sequence obtained by Edman degra-dation of the natu ral llergen (5). ome residues detected in thepolypeptide sequence are not deduced from the nucleotidesequences herein described, and many amino acid residuesdeduced from these sequences were not found by Edman deg-radation. Therefore, the existence of a higher degree of poly-morphism in Ole e I th an that reported here cannot be dis-carded even if it can be suggested. PCR artifacts seem unlikelysince the expected error frequency of the Taq polymerase (11

nucleotides/cycle) is much lower than the observed ex-change frequency (311, and the number of silent exchanges isfar from the statis tical probability.

There are two segments in the deduced sequences from po-

atSUNYatSton


www.jbc.org

Downloadedfrom


5/6

Cloning and Expressionof Olive Pollen Allergen 15221

OL13OL15cOLSlOL133OL137OL119OL117

OLIP 6OL16OL116OLIP 0

OL13cOLI5cOLIlCOL13OLE37OL.19OL117

OL16OLIP6OL116o L m

FIG. . Deduced amino acid sequences f the obtained DNAs encoding Ole e I. Sequences are shown in comparison with that obtainedby Edman degradation of the purified Ole e I (5). Microheterogeneities detected in the natura l protein (5) are shown below the main sequence.Dashes indicate identity with respect to the main sequence of Ole e I.TABLE1

Comparison of nucleotide an d deduced amino acid equences of olive pollen allergen cDNAsThe number of differences among airs of nucleotide and amino acid sequences are shown in theupper right and lower left sections, respectively.

OLE3c OLE33 OLE37 OLE26 OLE19 OLE17 OLE6 OLE16 OLE20 OLE5c OLElcOLE3cOLE33OLE37OLE26OLE19OLE17OLE6OLE16OLE20OLE5cOLElc

11107101919191418

30811112020

201519

74811112020

201519-273029

6102122221721

3029282582120

202117

sitions 38 to 51 and 83 to 99 of the olive pollen allergen wherethe microheterogeneity is mainly located. These regions arepredicted by theoretical approaches as the most hydrophilicand antigenic areas of Ole e I (5).These observations enhancethe importance of the immunological study of the individualisoforms to allow the mapping of the allergen epitopes. Thecloning and expression of specific clones seem t o be the mostavailable approach t o obtain well defined nd homogeneous Olee I molecules, since the isolation and purification of each iso-form protein are in practice very difficult (4) due to the highnumber of variants and theirclose similarity.A high degree of polymorphism is characteristic of plant pol-len allergens. Among other examples, grass pollen allergenssuch as LoZ p I1 and LoZ p I11 exist in multiple isoallergenicforms, which are var iant s that appear to be immunologicallyindistinguishable (32).The polymorphism of short ragweed pol-len allergens, Amb a I proteins, which are products of a mul-tigene family (33), has even been analyzed on mRNA isolatedfrom the flower of a single plant (341,demonstrating tha t eachindividual plant can express multiple forms of the allergen inthe pollen grains. Whether this polymorphism stands for dif-ferences in the functional features of these proteins is yet un-known, but it hasbeen demonstrated that few changes in thesequence of an allergen can be detected by individual sera ofhypersensitive patients (19).

cDNA cloning and expression of allergens should provideinformation regarding their structural and functional features

27282631342018181519

52535461595022

128

5154516059477

0813

51545160594770813

45485052564535343411-

55565864635351545444

and elicit new data about how these allergens promote the IgEresponse in affected individuals. We have successfullyex-pressed the olive pollen allergen as a fusion protein composedof glutathione S-transferase and the complete sequence of Olee I. The soluble protein is produced in a igh yield. It seems thatexpression as fusion proteins would be a n efficient way of ob-taining recombinant allergens since Am b a V and Amb t V,obtained by a similar construction as theone herein employed(201, and Lo1 p 11, obtained as a fusion protein with humanferri tin H-chain (211, have recently been produced with highrecoveries. The recombinant Ole e I allergen retained its abilityt o bind IgE from the seraof allergic patients and is lso recog-nized by OZe e I-specific polyclonal and monoclonal antibodies.This indicates that recombinant and natural Ole e I share IgEand IgG determinants. Therefore, the expression at a level ofmilligrams of well defined and immunologically active Ole e Iallergen will allow uture studieson the identification of B- andT-cell epitopes.

RNA blot hybridization analyses demonstrate that the tran -script of this protein is localized exclusivelyn th e pollen tissueand not in other tissuesuch as leaf, stem, and fruit. his couldexplain the absence of hypersensitivity of olive pollen-allergicpatients when they ingest olive fruit or olive oil. Pollen-specificlocalization was also reported for the genes LAT52 from tomato(7 ) and Z m c l 3 from maize (8). The sequences of the proteinsencoded by these genes exhibit 36 and 38% sequence identitywith Ole e I, respectively, and no gaps were included for the

atSUNYatSton


www.jbc.org

Down

loadedfrom


6/6

15222 Cloning and Expression of Oliveollenllergenk D a M 1 2 3 4 5 6."~ ~-66-45-36-29-24-20-14-

a

F T N- ..f --

SF=

bFIG. . SDS-polyacrylamide gel electrophoresis15%acrylam-ide under reducing conditions) analysis of the purification pro-cedure (a) nd thrombin treatmentb ) f the recombinantGST-OZe e I fusion protein.a: unes 1 an d 2, otal cell lysate from E. olistrain without and with pGEX-2T/OLE3c insert, respectively; lune 3,insoluble fraction of sample on lune 2; lune 4 , sample of lune 3 af tersolubilization in 8 M urea; lune 5, ampl e of lune 4 after elution fromG-25 spin column; lune 6, GST-OLE3c eluted from he glutathione-Sepharose 4B olumn;M, olecular ma ss ma rke rs Bio-Rad).b: lune F,GST-OLE3c fusion protein; un e T, ST-OLE3c treated with thromb in;lune N, a t u r a l Ole e I . The arrows indicate the mobil i ty of the GST-

OLE3c fusion protein ( f 3 , gluta thione S- t ransferase (s),gluta thioneS- t ransferase thrombin product (sp) ,and glycosylated ( g )or non-gly-cosylated ( n g )Ole e I.kDa F T N F T N F T N66-45- -36-24-20-14-

a b CFIG.6.Western blotting of the recombinant proteins. anes F:T, n d N a r e a shown in ig. 5b. Mem branes were immunostained withthe following: a,Ole e I-specific rabbit polyclonal antiserum; b, Ole eI-specific mo use monoclonal antibody 19G6; an d c, olive pollen allergen-hypersensit ivehumansera.Molecularmass kDa)markersare n-cluded.

alignment of their amino acid sequences (5). The polypeptideproducts of these genes seem to be involved in some event inpollen germination (7,8). Therefore, although the invivo func-tion of Ole e I remains uncertain, both its specific tissue local-ization and thementioned significant sequence similarity maysuggest that this allergen could be involved in germination.

In conclusion, the cDNA nucleotide sequences herein re-ported establish the existence of multiple mRNA molecules inthe olive tree pollen that code for allergen isoforms. One ofthese cDNAs has been expressed in E . col i , producing a highyield of soluble fusion protein, which was digested with throm-bin, releasing the recombinant allergen. Both the fusion pro-tein and theecombinant Ole e I sha re common immunologicalproperties with the natural allergen. In addition, the expres-sion in E . coli of specific clones of the Ole e I allergen offers thepossibility of obtaining well defined and homogeneous oliveallergen molecules to be used for research, clinical diagnosis,

and therapy f thi s IgE-mediated disorder. The functional anal-ysis of pollen-specific Ole e I-like proteins could also be per-formed with expressed cDNA clones. Finally, the employed ex-pression strategy may be of general interestfor producing largeamounts of recombinant allergens inE . coli.

Acknowledgments-We a r e g r a t e f u l to Drs. J. G. Gavilanes and A.Mar tinez de Pozo for cri tical reading of the ma nus crip t and Dr. C.M pe z- 0 th for oligonucleot ide synthesi s .REFERENCES

1. Bousquet, J. , Guerin. B.. Hewitt, B., Lim, S., and Michel, F. B. (1985) l in .2. Wheeler, A. W (1992) lin. Exp. Allergy 22, 1052-10573. Lauzurica, P., Gurbindo, C., Maruri, N., Galocha, B., Diaz, R., Gonzdlez, J.,Garcia, R., and Lahoz, C. (1988) ol. Immunol. 25, 329-3354. Villalba, M., Mpe z- 0t h. C., Martin-Orozco, E., Monsalve, R. I., Palomino, P.,Lahoz, C., and Rodriguez, R. (1990) iochem. Biophys. Res. Commun . 172,5. Villalba, M., Batanero, E., Mpez-0th. C., Shchez, L.M., Monsalve, R. .,523-528Gonzdlez de la Pefia, M. A,, Lahoz, C., an d Rodriguez, R. (1993) uc J.6. Batanero, E., Villalba, M., and Rodriguez, R. (1994) ol. Immunol. 31,31-37Biochem. 216,86343697. hell, D., Wing, R., Yamaguchi, J., and McCormick, S. (1989)Mol. & Gen.8.Hanson, D. D., Hamilton, D. A., Travis, J. L., Bashe, B. M., and Mascarenhas,9. Rafnar , T., Grifii th, I. J., Kuo, M., Bond, J. F., Rogers, B. L., and map per ,D. G.

Allergy 15,439448

Genet. 217,240-245J. P. (1989) lant Cell 1,173-179(1991) . Biol. Chem. 266, 1229-123610. Ghosh, B., Perry, M. P., and Mars h, B. G. (1991) ene (Amst. ) 101,231-238

11. Rogers, B. L., Morgenstern, J. P., Grifiith, I. J ., Yu, X.-B., Counsell, C. M., King,T. P., Garman, R. D., an d Kuo, M. C. (1991) . Immunol. 147,2547-255212. Grifiith, I. J., Smi th, P. M., Pollock, J., Theerakulpisu t, P.,Avjioglu,A., Davies,S., Hough, T., Singh, M. P., Simpson, R. J., Ward, L. D., and Knox , R. D.13. Perez, M., Ishioka, G. Y., Walker, L. E., and Che snut, R. W (1990) . Biol.(1991) EBS Lett. 279,210-21514. Silvanovich. A,, Astwood,J., Zhang, L., Olsen, E., Kilsil, F., Sehon, A., Moha-Chem. 265, 16210-16215

15. Singh, T., ough, T., Theera kulpisut, P., Avjioglu, A,, Davies, S., Smi th, P. M.,patra, S., and Hill, R. (1991) . Biol. Chem. 266, 1204-1210Taylor,P., impson, R. J., Ward,L. D., McCluskey. J., Puy, R., and Knox , R.B. (1991) roc. Natl. Acad. S ci. U. .A . 88, 1384-138816. Breiteneder, H., Pettenburger,K., Bito, A,, Valenta, R., Kraft, D., Rumpold, H.,Scheiner,0..nd Breitenbach, M. (1989) MB O J . 8, 1935-193817. Valenta, R., Duchene, M., Pette nburger, K., Sillaber, C., Valent, P., Bettelheim,P., Breitenbach, M., Rumpold, H., Kraft, D., and Scheiner ,0.1991) cience253,557-56018. Larsen, J. N., troman, P., and Ipsen, H. (1992) ol. Immunol. 29, 703-71119. Breiteneder, H., Ferreira, F., Hoffman-Sommergruber, K, Ebner, C., Breiten-212,355-362bach, M., Rumpold, H., Kraft, D., and Scheiner,0. 1993) u c J. Biochem.20. Rafnar,T., osh, B., Metzler, W J., Huang, S.-K., Perry, M. P., Mueller, L., nd

21. Sidoli, A., Tamborini, E., Giuntini, I., Levi, S.,Volont.6, G., Pain i, C., De Lalla,Marsh, D. G. (1992) . Biol. Chem. 267,21119-21123C., Siccardi, A. G., Barelle, F. E., Galliani, S., and Arosio, P. (1993) . Biol.Chem. 268,21819-2182522. Ullrich, A,, Shine, J., Chirgwin, J., Pictet, E., Tischer, E., Rutter, W J., andGoodman, H. M. (1977) cience 196, 1313-131823. Sambrook, J., Fritsch, E. F., and Maniat is, T. (1989)Molecular Cloning: ALaboratory Manual, chapters 7 and 11, Cold Sprin g Harbor Laboratory,24. Sanger, F., Nicklen, S., and Coulson, A. R.(1977) roc. Natl. Acad. Sei.U. .A .Cold Spring Harbor, NY74.5463-546725. Laemmli, U. K. (1970) ature 227,680-68526. Towbin, H., Staehelin, T., and Gordon, J. (1979) roc. Natl. Acad.Sci. U. . .27. Marsh, D. G., Goodfriend, L., King, T. P., Lowenstein, H., and Platts-Mills, T.28. Smit h, D. B., and Joh nson, K. S.(1988) ene (Amst. )67.31-4029. Smith, D.B., Davern, K. M., Board, P.G., Tiu, W U., Garcia, E. G., and30. Fror ath, B., Abney, C. C., Berthold, H., Scanarini, M., and Northe mann, WMitchell, G. F. (1986) roc. Natl. Acad. Sci. U. . . 83,870343707

31. Erlich, H. A,, Gelfand, D., and Sninsky, J. J. 1991) cience 252, 1643-1651(1992) ioTechniques 12,558-56332. Johnson, P., and Marsh, D. G. (1965) ature 206,935-93733. Bond, J. F., Garman, R. D., Keating, K. M., Briner, T. J., Rafnar, T., apper,34. Grifiith, I. J., Pollock,J. ,map per , D. G., Rogers, B. L., and Nau1t.A. K. (1991)

, ~

76,43504354A. E. (1988) lin. Allergy 18, 201-209

D. G., an d Rogers, B. L. (1991) . Immunol. 146,33804385Int. Arch. Allergy Immunol.96, 296-304


www.jbc.org

Downloadedfrom

Cloning and Expression of Ole e 1

Documents

Transcript of Cloning and Expression of Ole e 1