Cloning and Expression of a cholera toxin Beta subunit in ... · PDF fileCloning and...
Transcript of Cloning and Expression of a cholera toxin Beta subunit in ... · PDF fileCloning and...
Cloning and Expression of a cholera toxin Beta subunit in Escherichia coli
Habib Zeighami1, Morteza Sattari
1*
1*Department of Bacteriology,
Tarbiat Modares University,
Tehran, Iran [email protected]
Abstract Cholera is an acute infection of the intestine caused by the bacterium Vibrio cholerae. This bacterium, a member of the
family Vibrionaceae, is a facultatively anaerobic, Gram-negative, non-spore-forming curved rod, about 1.4–2.6 mm long,
capable of respiratory and fermentative metabolism. Cholera characterized by numerous, voluminous watery stools, often
accompanied by vomiting (bicarbonate loss). One of the most important virulence factors of cholera is enterotoxins
(ctxAB). Beta subunit (CTB) is a pentameric non-toxic portion of cholera toxin, responsible for the holotoxin binding to
the GM1-ganglioside receptor present on most nucleated cells. When conjugated to autoantigens, the CTB dramatically
increases their tolerogenic potential after oral administration. In this study Hypertoxigenic Vibrio cholera strain was used
for amplification of CTB gene. At first PCR with specific primer were done for CTB gene and amplified this gene by Pfu
enzyme. Then we did double digestion and insersion of CTB gene in pET-28 vector and DH5α for cloning. After cloning
pET plasmids which contain CTB gene plasmids extracted from bacteria and transformed to expression host and then
select the positive colony. After that we culture the positive bacteria and induct with IPTG then done SDS-PAGE and
Western blotting for protein determination. Our results show that use of expression host such as Escherichia coli witch
easily growth can be used for production of CTB protein. Although optimal conditions for expression included choice of
host strain, temperature used for culturing, and concentration of antibiotic and inducer. Beta subunit has many important
scientific applications. There is a great deal of interest in the use of CTB as an adjuvant for vaccines targeted for delivery
to the mucousa-associated lymphatic tissues. Because of Beta subunit of Vibrio cholera entrotoxin has multi function
such as in oral vaccine preparation it seems that we can use prokaryotic system (such as Escherichia coli) for production
of this protein.
Key words: Cloning, CTB, Escherichia coli Expression, pET-28, Vibrio cholera
Introduction
Cholera toxin B subunit (CTB) is the pentameric
non-toxic portion of cholera toxin (CT),
responsible for the holotoxin binding to the GM1
ganglioside receptor present on most nucleated
cells [1, 2, 3, and 4]. When conjugated to
autoantigens, the CTB dramatically increases
their tolerogenic potential after oral
administration [1-11].
In many developing countries, cholera is an
important cause of disease and mortality in
children, and therefore, represents an important
public health problem in the world today[1]. The
symptoms of cholera are mainly induced by
cholera toxin (CT), an 85 kDa protein composed
of A (CTA) and B (CTB) subunits combined in
an AB5 holotoxin. CTA, composed of 2
polypeptides (22 and 5 kDa), is responsible for
the toxic activity, through the activation of
cellular adenylate cyclase by Gs-ADP
ribosylation. As a result, cAMP accumulates in
the intestinal mucosal cells, leading to the
characteristic severe diarrhea of cholera [2, 3].
CTB (11.6 kDa) binds to the GM1 ganglioside at
cellular surface and promotes the endocytosis of
CT. CTB has been described as a potent
immunogen in the intestinal and nasal mucosal
sites [4–7], a mucosal adjuvant for oral and nasal
vaccines [8,9] and a transmucosal carrier
PROCEEDINGS OF THE 3RD INTERNATIONAL CONFERENCE ON ENERGY AND DEVELOPMENT - ENVIRONMENT - BIOMEDICINE
ISBN: 978-960-474-148-9 19 ISSN: 1790-5095
delivery system for induction of oral tolerance
when conjugated to autoantigens and allergens
[7,8, 9 and 12].
CTB is a pentameric non-toxic portion of cholera
toxin, responsible for the holotoxin binding to
the GM1-ganglioside receptor present on most
nucleated cells. When conjugated to
autoantigens,
the CTB dramatically increases their tolerogenic
potential after oral administration [8–14]. This
effect is probably mediated by the ability of CTB
to act as a mucosal carrier system [9], although
CTB might also have direct effects on the
immune system [15, 16]. Recent studies have
showed that CTB is an effective mucosal
adjuvant in potentiating immune responses or
increasing immunological tolerance to
corresponding antigens [13, 15–19]. These
investigations indicate that CTB is a powerful
edible vaccine if expressed in large-scale
production in an edible tissues or organism [20].
CTB is not only a candidate vaccine antigens but
also can function as an effective carrier to
facilitate induction of mucosal immune response
and has been used as a mucosal carrier molecule
for chemically or genetically conjugated
autoantigens for the induction of oral
tolerance[5].
We synthesized the CTB gene (ctxB) using of
Escherichia coli. Recombinant 6XHis-tagged
CTB (rCTB) was expressed in E.coli (BL21) and
characterized by SDS-PAGE and Western blot
analyses. In the present study, we report high
yield expression of recombinant CTB fused to a
C-terminal and N- terminal His-tag in E.coli.
Materials and methods
1. Bacterial strains, vector and media
Bacterial strains was kindly provided from
Institute Pasture, Tehran, Iran. Vector, media and
E. coli strains DH5α and BL-21(DE3) pLysS
were obtained from Invitrogen and Novagen
(USA). Plasmid pET-28a as expression vector
was purchased from Novagen. Bacteria were
cultured in LB broth or on agar (Merck,
Germany) with or without 30 µg kanamycin/ml
(Sigma, USA).
2. Isolation of CTB
The genomic DNA from Vibrio cholera 62013
was extracted using a genomic DNA extraction
kit (Fermentas, Lithonia). The specific primers
were designed according to CTB sequences of
Vibrio cholera 62013 from NCBI. The full
coding sequence of CTB was amplified by
polymerase chain reaction (PCR) using specific
primers containing Hind III and XhoI sites. The
sequence of the forward primer was: 5'-
ATTAAGCTTCCATGATTAAATTAAAATTT
GG -3' and reverse was: 5'-
ATCCTCGAGATTTGCCATACTAATTGCG-
3'. Amplifications were carried out in 25 µl
volumes containing 0.6 l M of each primer, 2.5
µl PCR buffer, 1.5 mM MgSO4, 0.2 mM
nucleotide (dATP, dCTP, dGTP, and dTTP), 2.5
U of Pfu DNA polymerase (Fermentas) and 300
ng genomic DNA. PCR was carried out in a
master gradient thermocycler (Eppendorf,
Germany).The gene amplification conditions
were as follows: 94°C (6 min), 30 cycles
consisting of 94°C (60 s), 55°C (60 s), and 72°C
(60 s) and an additional extension time at 72°C
(5 min). PCR product was separated by
electrophoresis on 1% (w/v) agarose gel
(Fermentas) and the desired fragment was
recovered from the gel using high pure PCR
purification kit (Roche, Germany) [23].
3. Cloning and construction of expression
plasmid
The purified fragment and the vector were
digested by respective restriction enzymes. The
fragment was ligated to the pET-28a vector. The
ligation product was transformed into competent
E. coli DH5α and transformants were selected on
LB agar plates containing 30 µg kanamycin/ml.
The selected clones were further analyzed by
restriction enzymes and PCR and finally
sequenced by a commercial facility using
universal forward and reverse T7-promoter and
PROCEEDINGS OF THE 3RD INTERNATIONAL CONFERENCE ON ENERGY AND DEVELOPMENT - ENVIRONMENT - BIOMEDICINE
ISBN: 978-960-474-148-9 20 ISSN: 1790-5095
T7-terminator primers (TAG Copenhage A/S
Symbion, Denmark).
4. Expression
For expression, the recombinant plasmid, pET-
28a/CTB, was transformed into competent E.
coli BL-21 (DE3) pLysS. E.coli cells harboring
expression vector pET-28a/CTB were grown in
LB medium supplemented with kanamycin (30
µg/ml) at 37°C to an OD600 = 0.7. For
induction, IPTG (Sigma, USA) was added to a
final concentration of 1 mM and the culture was
grown at 37°C for 4 h. The cells were
subsequently harvested and suspended and
product was verified using 12% (w/v) SDS-
PAGE.
5. Western blot analysis
The proteins separated by SDS-PAGE were
blotted onto polyvinylidene difluoride (PVDF)
membrane (Hi-bond Amersham Biosciences,
USA) by using a semidry blotter unit (Labconco,
Kansas City, Mo.). The membrane was blocked
by 1% (w/v) skim milk according to standard
procedures. The native immune serum was
diluted to 1:1,000 in phosphate-buffered saline
(PBS)-0.1% (v/v) Tween 20 and incubated 3 h at
4°C with shaking. Block membranes were
washed with PBS-Tween 20 and then incubated
with affinity purified goat anti-rabbit
immunoglobulin G (heavy and light chain)
horseradish peroxidase (HRP) conjugate
antibody (Bio-Rad), at a 1:2,500 dilution in PBS-
Tween 20. Membranes were then washed three
times with PBS-Tween 20 and development
using DAB solution (Sigma, USA) [23].
Results
Construction of the pET-28a/CTB Specific
primers were designed to amplify CTB gene
from the Vibrio cholera strain 62013. The
expected size of the PCR product, approximately
375 bp, was obtained (Fig. 1). Existence of insert
(CTB) in recombinant vector, pET-28a/CTB,
was also detected by digestion using XhoI and
Hind III restriction enzymes and finally the
identity and orientation of CTB in the construct
were confirmed by DNA sequencing (Data not
shown).
Fig1. Electrophoresis of PCR product on agarose gel (1% w/v).
Lane 1, 1 kb DNA size marker, lane 2, 3 and 4, Single expected band
of CTB (approximately 375 bp)
The E. coli BL21 (DE3) pLysS was transformed
with the recombinant expression vector, pET-
28a/CTB, and induced with IPTG and
accumulated large amounts of a protein
migrating in SDS-PAGE with an apparent
molecular weight of approximately 20 kDa (Fig.
3,lane 5 and 6).
To detect antigenicity of expressed protein
Western blot analysis was performed. The major
band observed in SDS-PAGE (20 kDa) was
confirmed as CTB protein by western blot
analysis with rabbit serum antinative CTB which
indicates apparent molecular mass of 20 kDa and
its immune-reactivity.
Discussion
375
PROCEEDINGS OF THE 3RD INTERNATIONAL CONFERENCE ON ENERGY AND DEVELOPMENT - ENVIRONMENT - BIOMEDICINE
ISBN: 978-960-474-148-9 21 ISSN: 1790-5095
The expression of recombinant proteins is a
promising and relatively inexpensive method by
which vaccines could be produced directly ‘‘on
site’’ [22-24]. On the other hand, mucosally
administered conjugates of CTB and various
antigens have been shown to suppress the
development of progress of a number of
autoimmune diseases in animal models. The oral
administration of CTB-based autoantigens has
been shown to have a protective effect against
autoimmune diabetes in animal models [1-10
and 24].
It has been assumed that among nonliving
immunogens, only those with mucosa-binding
and possibly also immunostimulatory properties
can induce local and systemic immune responses
without inducing systemic immunological
tolerance, when administered by a mucosal
route. A notable example is CT, one of the most
potent mucosal immunogens, which, when
administered orally with an unrelated antigen,
can also prevent induction of systemic tolerance
to that antigen. These unusual features can be
partly explained by the ability of CTB to bind
avidly to GM1 on cell surfaces, and to the ADP-
ribosylating action of the toxic A subunit of CT.
Based on these observations, mucosal
administration of antigen coupled to mucosa-
binding molecules such as CT or CTB has been
proposed as a strategy to induce local and
systemic immune responses rather than systemic
tolerance [25].
In these study we able to cloned and expressed
CTB in Escherichia coli. Our study showed that
Escherichia coli is a suitable host to cloned and
expressed the CTB. Because the growing rate
and expression yield of Escherichia coli is high,
this bacterium is useful for this reason. Although
we can use of Escherichia coli for large scale
production of CTB.
Fig2. SDS-PAGE(12% w/v) electrophoresis of expression product.
1, 2 and 3 non induct samples. 4: Pr marker, 5 and 6: induction
samples with IPTG.
References
1. Zhao-Hui Gong, Hui-Qing Jin, Yong-Feng Jin,
and Yao-Zhou Zhang. Expression of Cholera
Toxin B Subunit and Assembly as Functional
Oligomers in Silkworm. Journal of Biochemistry
and Molecular Biology, Vol. 38, No. 6 November
2005, pp. 717-724,
2. Cuatrecasas, P. Gangliosides and membrane
receptors for cholera toxin. Biochemistry. 1973;
12:3558-3566.
3. Pierre, P., Denis, O., Bazin, H., Mbongolo, E. M.
and Vaerman, J. P. Modulation of oral tolerance
to ovalbumin by cholera toxin and its B subunit.
Eur. J. Immunol. 1992; 22: 3179-3182.
PROCEEDINGS OF THE 3RD INTERNATIONAL CONFERENCE ON ENERGY AND DEVELOPMENT - ENVIRONMENT - BIOMEDICINE
ISBN: 978-960-474-148-9 22 ISSN: 1790-5095
4. Sun, J. B., Holmgren, J. and Czerkinsky, C.
Cholera toxin B subunit: An efficient
transmucosal carrier-delivery system for
induction of peripheral tolerance. Proc. Natl.
Acad. Sci. USA.1994; 91: 10795-10799.
5. Sun, J. B., Li, B. L., Czerkinsky, C. and
Holmgren, J. Enhanced immunological tolerance
against allograft rejection by oral administration
of allogenic antigen linked to cholera toxin B
subunit. Clin. Immunol. 2000; 97: 30-139.
6. Sun, J. B., Rask, C., Olson, T., Holmgren, J. and
Czerkinsky, C. Treatment of experimental
autoimmune encephalomyelitis by feeding myelin
basic protein conjugated to cholera toxin B
subunit. Proc. Natl. Acad. Sci. USA. 1996;
93:7196-7201.
7. Bregenholt, S., Wang, M., Wolfe, T., Hughes, A.,
Baerentzen, L., Dyrberg, T., von Herrath, M. G.
and Petersen, J. S. The cholera toxin B subunit is
a mucosal adjuvant for oral tolerance induction in
type 1 diabetes. Scand. J. Immunol. 2003;57:
432-438.
8. Li, T. K. and Fox, B. S. Cholera toxin B subunit
binding to an antigen presenting cell directly co-
stimulates cytokine production from a T cell
clone. Int. Immunol. 1996; 8: 1849-1856.
9. Holmgren, J., Adamsson, J., Anjuere, F.,
Clemens, J., Czerkinsky, C., Eriksson, K., Flach,
C. F., George-Chandy, A., Harandi, A. M.,
Lebens, M., Lehner, T., Lindblad, M., Nygren, E.,
Raghavan, S., Sanchez, J., Stanford, M., Sun, J.
B., Svennerholm, A. M. and Tengvall, S. Mucosal
adjuvants and anti-infection and anti-
immunopathology vaccines based on cholera
toxin, cholera toxin B subunit and CpG DNA.
Immunol. Lett. 2005; 97: 181-188.
10. Zhang, P., Yang, Q. B., Balkovetz, D. F., Lewis,
J. P., Clements, J. D., Michalek, S. M. and Katz,
J. Effectiveness of the B subunit of cholera toxin
in potentiating immune responses to the
recombinant hemagglutinin/adhesin domain of
the gingipain Kgp from Porphyromonas
gingivalis. Vaccine. 2005; 23: 4734-4744.
11. Ana Paula de Mattos Areas, Maria Leonor
Sarno de Oliveira Celso Raul Romero Ramos,
Maria Elisabete Sbrogio-Almeida, Isa Raw, and
Paulo Lee Hoa. Synthesis of cholera toxin B
subunit gene: cloning and expression of a
functional 6XHis-tagged protein in Escherichia
coli. Protein Expression and Purification. 2002;
25: 481–487.
12. A. Rudin, G.C. Riise, J. Holmgren, Antibody
responses in the lower respiratory tract and male
urogenital tract in humans after nasal and oral
vaccination with cholera toxin B subunit, Infect.
Immun. 1999; 67: 2884–2890.
13. C. Bergquist, E.V. Johansson, T. Lagergard, J.
Holmgren, A. Rudin, Intranasal vaccination of
humans with recombinant cholera toxin B subunit
induces systemic and local antibody responses in
the upper respiratory tract and the vagina, Infect.
Immun. 1997; 65: 2676–2684.
14. S. Tamura, Y. Samegai, H. Kurata, T. Nagamine,
C. Aizawa, T. Kurata, Protection against
influenza virus infection by vaccine inoculated
intranasally with cholera toxin B subunit,
Vaccine.1998; 6: 409–413.
15. C. Czerkinsky, M.W. Russell, N. Lycke, M.
Landblad, J. Holmgren, Oral administration of a
streptococcal antigen coupled to cholera toxin B
subunit evokes strong antibody responses in
salivary glands and extramucosal tissues, Infect.
Immun.1989; 57: 1072–1077.
16. U. Wiedermann, B. Jahn-Schmid, M. Lindblad,
C. Rask, J. Holmgren, D. Kraft, C. Ebner,
Suppressive versus stimulatory effects of
allergen/cholera toxoid (CTB) conjugates
depending on the nature of the allergen in a
murine model of type I allergy, Int.
Immunol.1999; 11: 1717–1724.
17. I. Bergerot, C. Ploix, J. Petersen, V. Moulin, C.
Rask, N. Fabien, M. Lindblad, A. Mayer, C.
Czerkinsky, J. Holmgren, C. Thivolet, A cholera
toxoid-insulin conjugate as an oral vaccine
against spontaneous autoimmune diabetes, Proc.
Natl. Acad. Sci. USA 1997; 94: 4610–4614.
18. J.B. Sun, C. Rask, T. Olsson, J. Holmgren, C.
Czerkinsky, Treatment of experimental
autoimmune encephalomyelitis by feeding myelin
basic protein conjugated to cholera toxin B
subunit, Proc. Natl. Acad. Sci. USA 1996; 93:
7196–7201.
19. C. Czerkinsky, J.B. Sun, M. Lebens, B.L. Li, C.
Rask, M. Lindblad, J. Holmgren, Cholera toxin B
subunit as transmucosal carrier-delivery and
immunomodulating system for induction of
antiinfectious and antipathological immunity,
Ann. N. Y. Acad. Sci. 1996; 778: 185–193.
20. J.B. Sun, J. Holmgren, C. Czerkinsky, Cholera
toxin B subunit: an efficient transmucosal carrier-
delivery system for induction of peripheral
immunological tolerance, Proc. Natl. Acad. Sci.
USA. 1994; 91: 10795–10799.
21. Zhaohui Gong, Xiang Long, Lin Pan, Yanping
Le, Qiong Liu, Shaomin Wang , Junming Guo,
Bingxiu Xiao, Mi Zhou, Disen Mei. Cloning,
expression, purification and characterization of
the cholera toxin B subunit and triple glutamic
acid decarboxylase epitopes fusion protein in
PROCEEDINGS OF THE 3RD INTERNATIONAL CONFERENCE ON ENERGY AND DEVELOPMENT - ENVIRONMENT - BIOMEDICINE
ISBN: 978-960-474-148-9 23 ISSN: 1790-5095
Escherichia coli. Protein Expression and
Purification .2009; 66: 191–197.
22. C. Rask, J. Holmgren, M. Frederiksson, M.
Lindblad, I. Nordström, J.B. Sun, C. Czerkinsky,
Prolonged oral treatment with low doses of
allergen conjugated to cholera toxin B subunit
suppresses immunoglobulin E antibody responses
in sensitized mice, Clin. Exp. Allergy.2000; 30:
1024–1032.
23. Gholamreza Goudarzi, Morteza Sattari, Mehryar
Habibi Roudkenar Mehran, Montajabi-Niyat,
Ahmad Zavaran-Hosseini, Kamran Mosavi-
Hosseini. Cloning, expression, purification, and
characterization of recombinant flagellin isolated
from Pseudomonas aeruginosa. Biotechnol Lett.
2009; 31:1353–1360.
24. Young-Sook Kim, Bang-Geul Kim, Tae-Geum
Kim, Tae-Jin Kang, Moon-Sik Yang. Expression
of a cholera toxin B subunit in transgenic lettuce
(Lactuca sativa L.) using Agrobacterium-
mediated transformation system. Plant Cell Tiss
Organ Cult.2006; 87:203–210.
25. Jia-Bin Sun, Janholmgren and Cecil Czerkinsky.
Cholera toxin B subunit: An efficient
transmucosal carrier-delivery system for
induction of peripheral immunological tolerance.
Proc. Nadl. Acad. Sci. USA. 1994; 91: 10795-
10799.
PROCEEDINGS OF THE 3RD INTERNATIONAL CONFERENCE ON ENERGY AND DEVELOPMENT - ENVIRONMENT - BIOMEDICINE
ISBN: 978-960-474-148-9 24 ISSN: 1790-5095