Rabies glycoprotein fused with B subunit of cholera toxin expressed in tobacco plants folds into...

8/10/2019 Rabies glycoprotein fused with B subunit of cholera toxin expressed in tobacco plants folds into biologically active …

http://slidepdf.com/reader/full/rabies-glycoprotein-fused-with-b-subunit-of-cholera-toxin-expressed-in-tobacco 1/8

This article appeared in a journal published by Elsevier. The attached

copy is furnished to the author for internal non-commercial research

and education use, including for instruction at the authors institution

and sharing with colleagues.

Other uses, including reproduction and distribution, or selling or

licensing copies, or posting to personal, institutional or third partywebsites are prohibited.

In most cases authors are permitted to post their version of the

article (e.g. in Word or Tex form) to their personal website or

institutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies are

encouraged to visit:

http://www.elsevier.com/copyright





Author's personal copy

Rabies glycoprotein fused with B subunit of cholera toxin expressed

in tobacco plants folds into biologically active pentameric protein

Sribash Roy, Antariksh Tyagi, Siddharth Tiwari, Ankit Singh, Samir V. Sawant,Pradhyumna K. Singh, Rakesh Tuli *

National Botanical Research Institute, Council for Scientific and Industrial Research, Rana Pratap Marg, UP, Lucknow 226001, India

a r t i c l e i n f o

Article history:

Received 26 August 2009

and in revised form 2 October 2009

Available online 8 October 2009

Keywords:

Cholera toxin

Edible vaccine

Mucosal carrier

Rabies glycoprotein

a b s t r a c t

The pentameric B subunit of cholera toxin (CtxB) is an efficient mucosal adjuvant for vaccines. We report

the expression of a chimeric protein comprising the synthetic cholera toxin B subunit fused at its C-ter-

minal with rabies surface glycoprotein (G protein) in tobacco plants. The 80.3 kDa fusion polypeptide

expressed at 0.4% of the total soluble protein in leaves of the selected transgenic lines. The fusion protein

formed a 403 kDa pentameric protein which was functionally active in binding to GM1 receptor. The

plant-made protein had a higher affinity for GM1 receptor than the native bacterial CtxB. The pentameric

fusion protein was recognized by the anti-cholera toxin as well as anti-rabies antibodies. Its immuno-

protective ability against rabies remains to be examined.

2009 Elsevier Inc. All rights reserved.

Introduction

Transgenic plants expressing foreign proteins of industrial and

pharmaceutical value are suggested to be economically viable alter-

natives to fermentation-based production systems. However, there

is a need to evaluate plants for the expression of a variety of func-

tionally active eukaryotic proteins that undergo complex folding

and post translational modifications. One such group of pharma-

ceutically important proteins is the subunit vaccine antigens. When

expressed in edible plant parts, these have been reported to be

effective as oral and mucosal antigens [1–3]. The expression level

of these antigens expressed in plants, as nuclear genes is often

low, ranging from 0.001% to 0.3% of total soluble protein (TSP)1

[4]. The low level expression limits the extent of immune response

and the development of an effective plant-based oral vaccine. Strate-gies like co-administration with an adjuvant [5] and fusion of anti-

gens with an effective carrier molecule, either chemically or

genetically, can increase the immunogenicity of antigens [6,7].

In several studies, cholera toxin B subunit (CtxB) has been used

as a carrier for antigens [8–11]. CtxB is a homopentameric

(Mr 58,000) protein comprising the polypeptides (Mr 11,600)

arranged in a ring-like configuration. The native pentameric struc-

ture of CtxB and its binding to GM1 receptors are crucial for its

function as mucosal carrier and the resultant immunological re-

sponse. Conjugation of antigens with CtxB can reduce the dose re-

quired for T-cell activation by more than 10,000-fold as compared

to the free antigen [12]. Rabies virus genome encodes five major

proteins- nucleoprotein (N), phosphoprotein (P), matrix protein

(M), glycoprotein (G) and RNA-dependent RNA polymerase (L)

[13,14]. The surface glycoprotein (G) plays an important role in vir-

al pathogenesis and functions as a protective antigen [15]. One of

the strategies to control rabies in wild animals is to develop oral

vaccine that can be given as bait in the wild. This requires enhanc-

ing immunogenicity and expression of the G protein at high level

in plant tissue. With an aim to enhance immune response and

achieve high level expression of the G protein, plant codon opti-

mized synthetic ctxB and G protein (rgp) genes were fused and

transformed into tobacco plants. The plants expressed the chimeric

CtxB-G protein which was purified from leaves of the transgenictobacco plants and analyzed for functional integrity.

Materials and methods

Construction of ctxB and rgp fusion and cloning into plant expression

cassette

We have earlier reported designing and cloning of plant codon

optimized synthetic ctxB gene of Vibrio cholerae O139 strain 1854

[16] and rgp gene of rabies virus glycoprotein [17] and their

expression in tobacco leaves. In this study, a glycine–proline hinge

was used at the point of fusion of translational frames of the CtxB

and G proteins. The signal sequence PR-S, of the pathogenesis

induced tobacco protein PR-1a was used to facilitate transport of

1046-5928/$ - see front matter 2009 Elsevier Inc. All rights reserved.

doi:10.1016/j.pep.2009.10.002

* Corresponding author. Fax: +91 0522 2205836/2205839.

E-mail address: [email protected] (R. Tuli).1

Abbreviations used: TSP, total soluble protein; PVDF, polyvinylidene fluoride; HRP,

horseradish peroxidase; ALP, alkaline-phosphatase.

Protein Expression and Purification 70 (2010) 184–190

Contents lists available at ScienceDirect

Protein Expression and Purification

j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / y p r e p




the fusion protein to endoplasmic reticulum [18]. The pr-s-ctxB

was PCR amplified using a forward primer (50ACTCTAGAA

TGAACTTCCTCAAGTCCTTC30) with XbaI and a reverse primer

(50AGGCC CGGGACCGTTAGCCATGGAGATAG30) with SmaI site

using pSM31 [16] as the template DNA. The reverse primer was de-

signed to include codons for the glycine-proline hinge at the 30

endof ctxB. The synthetic G protein gene was PCR amplified using pSA5

[17] as template DNA and a forward primer (50GGTCCCG

GGCCTAAGTTCCC TATCTACAC30) with SmaI site including codons

for the glycine–proline of the hinge region. The reverse primer

(50ACGAGCTCTCATCACAACTCATCCTTCTC30) carried a SacI site.

Amplified PCR fragments were digested with the respective

enzymes and triply ligated in the vector, pBI101 containing the

enhanced CaMV35S promoter to obtain pSR1241 with two gly-

cine-proline repeats as hinge at the 3‘end of ctxB (Fig. 1).

Plant transformation and analysis

Agrobacterium tumefaciens LBA4404 was transformed with

pSR1241 by electroporation and used for tobacco (Nicotiana tabac-

cum cv. Petit Havana) transformation using the leaf disc method

[19]. The kanamycin resistant T0 plantlets were transferred to soil

in the green house and grown to maturity. Transgenic plants were

screened for the presence of the ctxB-rgp gene by PCR, using for-

ward 50ATCGATGTCGACTAACAACTTCCTCAAGTCTT30 and reverse

50AGATCGTCGACTCATCACAACTCATCCCTCTCGGAC30 primers. Sta-

ble integration and copy number of the transgene were established

by Southern hybridization as described in [17]. Hybridization was

performed at 65 C for 16 h, using [aP32] dCTP labeled probe, com-

prising 570 bp XhoI– AgeI fragment at 30 end of the gene. The mem-

brane was exposed to Fuji screen for 24 h and scanned on phosphor

imager (Molecular Imager FX, Bio-Rad, and Hercules, USA).

Quantitative analysis of ctxB-rgp transcript by real-time PCR

Total RNA was prepared from the leaves of T 0 transgenic plants

in TRIZOL LS reagent (Invitrogen Life Technologies, USA) according

to manufacturer’s instructions. One lg RNA was used for the first-

strand cDNA synthesis using c-DNA synthesis kit (PE BiosystemsInc., USA). PCR on cDNA was performed using the forward

50CCAAGCTTTCTAGATAAACAATGAACTTCCTCAAGTCATT 30 and re-

verse 50GGATATAATCTTTCCGGACTGTGGAGT AACGGAGTCCACCC-

TACCGGT 30 primers. Expression of the ctxB-rgp transcript in

different transgenic lines was quantified by real-time PCR using

TaqMan probe (50FAM TCCCAGA GATGCAGTCC-NFQ30) on ABI

Prism 7700 sequence detection system (TaqMan, PE Biosystems

Inc., USA). The ctxB-rgp transcript was normalized with respect to

ubiquitin transcript as internal control in the same sample. The rel-

ative fold expression of the ctxB-rgp gene was estimated in terms of

2DDC T [20]. The DCT was determined by subtracting ubiquitin C Tvalue from ctxB-rgp C T value in a given sample. The DDC T value

was determined by subtracting the lowest expressing plant (cali-

brator)D

C T from the D

C T of each plant.

Polyacrylamide gel electrophoresis and immunoblot analysis

Transgenic tobacco leaves were analyzed for the presence of

CtxB-G protein by immunoblot analysis. Leaf material (1 g) was

ground in liquid nitrogen and homogenized in 2 ml extraction buf-

fer (50 mM sodium phosphate pH 7.5, 150 mM NaCl, 150 mM sor-

bitol, 2 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride,

2 mM plant protease inhibitors cocktail from Sigma, USA and

0.08% Triton-X 100. Total soluble protein content was determined

by Bradford assay [21]. Thirty lg TSP of transgenic and non-trans-

genic plants was electrophoresed on 10% denaturing SDS gel and

transferred to polyvinylidene fluoride (PVDF) membrane. The

Hinge of GPGP SEKDEL

XbaI BglII SacI ApaI

2040bp

Hind III

SEKDEL

XbaI BglII SacIRB LB

TnosnptII PECaMV35S Pnos pr-s ctxB Tnos

Hind IIIRB

TnosnptII PECaMV35S PnospSA5

pSM31

Tnosrgp pr-s

SacI XhoI Apa1 Hind III

SEKDEL

Hind IIIRB

TnosnptII PECaMV35S PnospSR1241

LB

Tnosrgp pr-s

XhoI

ctxB

LB

AgeI

Fig. 1. Gene constructs showing cloning of the fusion gene ctxB-rgp in pBI101. The pr-s-ctxB and rgp fragments were PCR amplified from pSM31 and pSA5, respectively.

Amplified PCR fragments were digested with respective enzymes and triple ligated in pBI101 to obtain pSR1241 with two glycine-proline repeats as hinge at the 30 end of

ctxB.

S. Roy et al. / Protein Expression and Purification 70 (2010) 184–190 185




membranes were incubated with anti-cholera antibody (Sigma,

USA) and equine anti-rabies serum (Haffkine Bio-pharmaceutical

Corporation Ltd, India) for 2 h. After three washes with TBST, the

membranes were further incubated with horseradish peroxidase

(HRP) conjugated anti-rabbit IgG and alkaline-phosphatase (ALP)

conjugated anti-horse IgG (Sigma, USA) for 2 h at room tempera-ture for CtxB and G proteins, respectively, and developed by HRP

(Promega life science, USA) or ALP (Bio-Rad, USA) color develop-

ment kit. For detection of the pentameric form of CtxB-G protein,

6% SDS–PAGE gel was used and the un-boiled samples were loaded

without adding DTT in sample-loading buffer [22]. The gel was run

at constant 30 V, blotted into PVDF membrane for at least 5 h and

developed as described above.

Quantification of CtxB-G protein in plant and assay of immunological

activity

GM1-ELISA was performed to quantify the expression level of

pentameric form of the CtxB-G protein in tobacco leaves as re-

ported in Mishra et al. [16] with minor modifications. The 96-wellmicrotiter plates (Greiner, Germany) were coated with 3.0 lg/ml

GM1 made in sodium bicarbonate coating buffer pH 9.6 (15 mM

Na2CO3, 35 mM NaHCO3) and incubated over night at 4 C. As con-

trol, BSA (3.0 lg/ml) in bicarbonate buffer was coated in some

wells. The wells were blocked with 300 ll of 1% BSA in phosphate

buffered saline Tween 20 (PBST; 0.01 M Na2HPO4, 0.003 M

KH2PO4, 0.1 M NaCl, pH 7.4, 0.05% Tween 20, v/v) for 1 h. Total sol-

uble leaf protein and bacterial CtxB (Sigma, USA) were diluted seri-

ally, added into the wells in triplicate and incubated for 1 h,

followed by 2 h incubation with rabbit anti-cholera toxin antibody

at 1:4000 dilution in PBST containing 0.25% BSA followed by 2 h

incubation with mouse anti-rabbit IgG alkaline-phosphatase con-

jugate at 1:30,000 dilution in PBST containing 0.25% BSA. The

plates were developed with p-nitrophenyl phosphate substrate.

The reaction was terminated by the addition of 3 M NaOH. The

plates were read at 405 nm and the CtxB expression level was

quantified on a linear standard curve. All estimates were made

on the basis of three independent experiments.

Assay of the immunological activity of CtxB-G protein against

rabies was performed as described above except that the antibody

against a custom synthesized G peptide was used as the primary

antibody in 1:4000 dilution. Indirect ELISA was performed to check

immunological activity against rabies antibody. Microtiter plates

were coated with plant-CtxB–G protein crude extract and incu-

bated at 4 C overnight. The plates were blocked with 1% BSA in

PBST for 1 h at 37 C. After washing three times with PBST, the pep-

tide antibody against G protein and equine anti-rabies antibody

were added at 1:4000 dilution and incubated for 2 h at 37 C.

The plates were further incubated with ALP conjugated anti-rabbitand anti-horse IgG in 1:8000 dilution for 2 h at 37 C and devel-

oped as described above.

In order to assess relative binding affinity of CtxB-G protein for

GM1 receptors, microtiter plates were coated with various concen-

trations of GM1 and incubated at 4 C overnight. The plant derived

CtxB, CtxB-G leaf extract, bacterial CtxB (Sigma, USA) or BSA (neg-

ative control) were added to the wells at 3lg/ml and incubated

overnight at 4 or 37 C. The plates were developed following Mish-

ra et al. [16].

Purification of CtxB-G protein and pentamerization

Purification of CtxB-G protein was carried out as described in

Mishra et al. [16]. Briefly, Rabbit anti-CtxB IgG was coupled toCNBr-activated Sepharose 4B following manufacturer’s instruc-

tions (Amersham Biosciences, Sweden). The rabibit anti-CtxB IgG

(20 mg) was dissolved in coupling buffer (0.1 M NaHCO3 pH 8.3

containing 0.5 M NaCl). Two grams of CNBr- activated Sepharose

4B was suspended in 1 mM HCl and washed for 15 min on a sin-

tered glass filter. Approximately 200 ml of 1 mM HCl was added

in several aliquots per g of dried powder. The coupling solution

containing the rabbit anti-CtxB IgG was mixed with the medium

in a stoppered vessel and rotated over night at 4 C. Excess ligandwas washed away with five volumes (w/v) of the coupling buffer.

The slurry was transferred to 0.1 M Tris–Cl buffer, pH 8.0, allowed

to stand for 2 h and then, washed with at least three cycles of five

volumes of each buffers with alternating pH (0.1 M acetate buffer,

pH 4.0 containing 0.5 M NaCl followed by a wash with 0.1 M Tris–

Cl, pH 8.0 containing 0.5 M NaCl). The Sepharose coupled with the

anti-CtxB IgG was loaded onto a column and pre-equilibrated with

buffer (50 mM sodium phosphate pH 7.5, 150 mM NaCl, 2 mM

dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 0.08% Triton-

X 100). Tobacco leaf (10 g) was grounded in liquid nitrogen and

homogenized in 20 ml extraction buffer as described above. The

extract was centrifuged for 10 min at 5000 g . The supernatant

was again centrifuged for 15 min at 13,000 g. The clarified tobacco

leaf extract (22 ml) was loaded onto the column. The wash throughwas re-loaded for maximum binding of the CtxB-G protein. The

column was washed with six volumes of wash buffer (50 mM so-

dium phosphate pH 7.5, 150 mM NaCl, and 2 mM dithiothreitol).

The CtxB-G protein was eluted with glycine–Cl buffer pH 2.8 and

neutralized to pH 7.4 by collection of the drops in 1/10th volume

of 1 M tris–Cl pH 9.5. The eluted CtxB-G protein fraction (20 ml)

was dialyzed against buffer (0.1 M tris–Cl pH 7.5, 0.4 M NaCl and

2 mM EDTA). The dialysis bag containing the protein was kept on

sucrose bed for concentrating the protein, with intermittent

changes of sucrose. The concentrated CtxB-G protein (1lg/ll)

was incubated overnight at 37 C to allow pentamerization.

Results

Insertion events and the expression of CtxB-G in transgenic tobacco

Six independently transformed kanamycin resistant tobacco

plants were verified for the presence of ctxB-rgp gene by PCR

amplification of the genomic DNA (Fig. 2A). The expected DNA

fragment of 1.9 kb was observed in all the six plants (lanes 1–

6) whereas genomic DNA of the non-transgenic plant gave no

amplification (lane NT). The quantitative analysis of ctxB-rgp tran-

script carried out by real-time PCR showed the highest transcript

level (1600-fold) in plant #1 as compare to that in the least

expressing transgenic plant #6 (Fig. 3). The transgenic plant #1

showing the highest expression of ctxB-rgp was further analyzed

by Southern hybridization for determining the copy number of

the transgene insertion. The transgenic plant #1 contained singlecopy of the transgene inserted into its genome (Fig. 2B).

Expression of functional CtxB-G protein in plant leaves

The level of pentameric form of CtxB-G protein expressed in

transgenic tobacco lines was determined by monosialoganglio-

side-dependent enzyme linked immunosorbent assay (GM1-ELISA)

of total leaf protein. The highest expression level was observed in

plant #1 where the CtxB-G expressed at 0.4% of TSP in leaves. This

was followed by expression at 0.21% in the plant #3 (Fig. 4A).

Immunological activity of the fusion protein CtxB-G was checked

by performing both GM1-ELISA and indirect ELISA (Fig. 4B). Pep-

tide antibodies against the G protein as well as equine anti-rabies

antibodies were used as primary antibodies in both the assays. Thebinding of the CtxB-G protein to GM1 receptors in GM1-ELISA

established that the chimeric protein expressed in tobacco leaves

was in pentameric form. That the chimeric protein was immuno-

186 S. Roy et al. / Protein Expression and Purification 70 (2010) 184–190




logically active against both CtxB and the rabies antibodies was

established by indirect ELISA using both the antibodies.

The transgenic plants (#1, 2 and 3) showing high expression of

the CtxB-G protein were selected for analysis on immunoblot. As

expected, a 403 kDa (66 kDa glycosylated G + 14.6 kDa glycos-ylated CtxB polypeptide pentamer) protein was observed in the

non-reduced and un-boiled sample when detected by both CtxB

(Fig. 5A) and G protein antibodies (Fig. 5B). No band was detected

in the non-transgenic plants. The highest expression of CtxB-G pro-

tein was noticed in plant #1 (Fig. 6A, lane1 and Fig. 6B, lane 1).This

is consistent with the results of real-time PCR and ELISA. Under the

denaturing conditions, a band of 80.6 kDa, representing the

monomeric fusion polypeptide was detected using equine anti-ra-

bies antibodies (Fig. 5C).

Binding affinity of the tobacco-expressed proteins to GM1 receptors

Functionality of CtxB and its fusion derivatives was correlated

with the ability to bind to GM1 ganglioside.The binding affinityof the plant derived CtxB, CtxB-G and bacterial CtxB to GM1 was

determined by GM1-ELISA carried out at 4 or 37 C (Fig. 6). Within

the linear range of binding at variable molar concentrations of

GM1, the order of binding affinity was: plant-CtxB > CtxB-G > bac-

terial CtxB at both the temperatures. Thus, the plant-expressedCtxB showed higher affinity towards GM1 as compared to the bac-

terial CtxB and CtxB-G. The CtxB-G showed higher affinity towards

GM1 as compared to bacterial CtxB but lower affinity than plant-

expressed CtxB at both the temperatures.

Purification of CtxB-G protein and pentamerization

The CtxB-G protein expressed in transgenic tobacco lines was

purified using immunoaffinity column. The summary of recovery

at different steps of purification of CtxB-G is shown in Table 1.

Quantification of the eluted protein by ELISA showed that about

31% of CtxB-G was recovered using single step affinity purification.

The recovery suggested 93% purity (Table 1), which is also evident

on the denaturing gel electrophoresis (Fig. 7A). The pentamericnature of CtxB-G was evident from its receptor binding in GM1-

ELISA, as explained earlier. It was further substantiated by non-

denaturing SDS–PAGE analysis. The protein was suspended in buf-

fer without DTT and loaded onto a 6% denaturing SDS gel. In the

non-reduced and un-boiled samples, one major protein band was

formed at position corresponding to molecular mass of 403 kDa

(Fig. 7B). This agreed with the predicted size of the pentameric

form of CtxB-G protein. No major bands corresponding to lower

multimeric forms were noticed even when the gel was run for

2 h instead of 5 h (data not shown).

Discussion

Rabies virus surface glycoprotein (G protein) is immuno-protec-tive against rabies [15]. In an earlier study from our group, a syn-

thetic gene coding the G protein was expressed in tobacco plants.

The plant derived G protein, given by intra-peritoneal route, in-

duced protective immunity in mice against intracerebral lethal

challenge with live rabies virus [17]. The non-glycosylated G pro-

tein prepared from bacterial cells does not give protective immu-

nity [23,24]. The G protein expressed in yeast is glycosylated but

gives protection only against intra-muscular and not intracerebral

virus challenge [25]. This may be due to difference in glycosylation

of G protein expressed in Saccharomyces cerevisiae from those

required for effective protection against the viral challenge. In an-

other study, a chimeric peptide containing antigenic determinants

from the rabies virus G protein (amino acids 253–275) and the

nucleoprotein (amino acids 404–418) was expressed in tobaccoplants as translational fusions with alfalfa mosaic virus (AlMV)

coat protein. The recombinant A1MV virus particles purified from

the transiently infected plants gave protective immunity in mice

M 1 2 3 4 5 6 NT

bp

2027

1584

1375

A B

Fig. 2. Detection of synthetic ctxB-rgp gene in T0 transgenic tobacco plants by PCR (A) and Southern hybridization analysis of the transgenic (lane 1) and non-transgenic (lane

2) plants (B). Genomic DNA was isolated from transgenic and wild-type plant leaf. PCR was performed using gene specific primers. The PCR products were separated on 1.0%

agarose gel. M, EcoR1/HindIII digested k DNA markers, PCR products with DNA template from six independent T0 transgenic (lanes 1–6) and non-transgenic (NT) plants. For

Southern hybridization, genomic DNA from T0 transgenic plant #1 was digested with XhoI, electrophoresed in 0.8% agarose gel and blotted onto Hybond N+ membrane. Since

the fragment between T-borders has one XhoI site, the number of fragments hybridizing with 570 bp rgp probe from 30 region of the gene represents copy number of the

insert. A single band (lane 1) indicates the presence of single copy in the genome.

Fig. 3. Quantitative analysis of ctxB-G transcript in transgenic lines by real-time

PCR. The relative levels of the transcript (Y -axis) with respect to the least expressing

plant (#6) in ( X -axis) are shown. Error bar represents SD values based on the three

replicates.





after intra-muscular challenge with the rabies virus [26]. The fu-

sion of CtxB with G protein studied here is expected to provide

CtxB as a receptor specific carrier. This may reduce the dose re-

quired for oral mucosal uptake of CtxB-G. The approach may en-

C t x B - G ( % T S P )

0

0.05

0.1

0.15

0.2

0.25

0.3

0.35

0.4

0.45

#1 # 3

T0 plants

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

C t x B - G ( A b s o r b a n c e )

Plant # 1NT plants

Ab1 Ab2 Ab1 Ab2

Indirect ELISA GM1-ELISA

A B

Fig. 4. CtxB-G protein expression in leaf in T0 transgenic tobacco plants #1 and #3 by GM1-ELISA (A) and assay of immunological activity of CtxB-G protein against rabies

antibodies by indirect and GM1-ELISA (B). The expression level of CtxB-G protein is given as %TSP. In indirect ELISA and GM1-ELISA for plant # 1, the plates were developed

using peptide anti-G (Ab1) and equine anti-rabies (Ab2) antibody. NT, non-transgenic plants.

A B

1 2 3 NT

403

250

kDa M 1 2 3 NT M 1 2 3 NT

7295

55

kDa205130

36

28

C

80.6 kDa

Fig. 5. Western blot analysis of transgenic plants under non-denaturing conditions using anti-cholera antibody (A), anti-rabies antibody (B) and under denaturing condition

using anti-rabies antibody (C). Crude protein (30 lg) prepared from the leaves of non-transgenic (NT) and transgenic T 0 plants #1, 2 and 3 was loaded along with molecular

weight markers (M).

at 370C

at 40C

GM1 concentration (µM)

A 4 0 5 n m

0

0.05

0.1

0.15

0.2

0.25

0.3

0.35

0.4

0.45

0.5

0 2 4 6 8 10

Bacterial CtxB

plant CtxB

CtxB-G

BSACtxB-G

plant CtxB

bacterial CtxB

BSA

Fig. 6. GM1 binding analysis of the plant-CtxB, CtxB-G and the bacterial CtxB. Binding affinity of the proteins to GM1 was determined by GM1-ELISA at 4 or 37 C. Microtiter

plates, precoated with different concentrations of GM1, were treated with different proteins at 3 lg/ml concentration. BSA was taken as negative control. To detect the

amount of the bound proteins, the wells were incubated with anti-CtxB antibody and ALP conjugated secondary antibody, followed by the addition of substrate. The

absorbance at 405 nm plotted on Y -axis shows the amount of CtxB bound at increasing concentrations of GM1 receptor.





hance the immuno-protective ability of G protein given through

oral/mucosal epithelium or in the form of an edible vaccine.

In our study, the native signal peptide of CtxB was replaced by

the tobacco PR-S signal peptide [18], which efficiently transports

proteins into the endoplasmic reticulum of plant cells. The addition

of the ER retention signal at the C-terminus has been suggested to

enhance the accumulation of recombinant proteins in transgenic

plants [27,28]. The glycine–proline hinge provides flexibility to

independently folding domains of the chimeric protein and allows

their folding with little steric hindrance. The fusion proteins carry-

ing CtxB either at the N-terminus [29–31] or the C-terminus

[32,33] or even internally within the CtxB sequence [34,35] have

been produced and characterized earlier. Gonzalez et al. [31] re-

ported that a CtxB fusion protein carrying 18 amino acid N-termi-

nal extension retained activity with respect to pentamerization

and GM1 binding. In another study [29], it was shown that the

affinity of the chimeras for GM1 was inversely proportional to

the size of the peptide fused to the N-terminus of CtxB. Our resultsshow that the G- protein, in spite of being about five fold larger

than the CtxB, allowed the latter to pentemerize in the fusion

and bind to the GM1 receptors. The fusion protein retained antige-

nicity of both the component proteins.

The expression of CtxB-G protein in different transgenic plants

showed wide variation, i.e. 0.002–0.4% of TSP in leaf. This is consis-

tent with the transcript level noticed by real-time PCR. The varia-

tion in expression is understandably due to integration of the

transgene at different positions in the genome of independent

transgenic lines [36]. We have earlier reported a high level expres-

sion of synthetic G protein in the selected tobacco lines, i.e. at

0.38% of TSP [17]. In another study, the chimeric rabies virus pep-

tide fused to the N-terminus of AlMV CP was reported to accumu-

late at levels reaching 0.4 ± 0.07 mg/g of fresh spinach leaf tissue[26].

GM1-ELISA using the peptide antibody against the G protein

and the equine anti-rabies antibody established that the pentamer-

ic fusion protein maintained immunologically active G protein do-

mains. However, the absorbance values of CtxB-G protein in GM1-

ELISA were lower than the absorbance values in indirect ELISA for

the two antibodies. This is be due to higher binding of CtxB to GM1

receptors coated on the ELISA plates as compared to its binding to

the plates in indirect ELISA.The binding assay showed that a pentameric CtxB was formed

with functionally correct folding and assembly of the chimeric

CtxB-G expressed in tobacco leaves. These results suggest that

the folding of the fusion protein was driven by CtxB though this

is the smaller (14.6 kDa) partner in the 80.6 kDa chimeric protein.

Earlier, we reported that the plant-synthesized CtxB shows a high-

er affinity for binding to GM1 as compared to the bacterial CtxB

[16]. The glycosylation of the plant-expressed CtxB was predicted

to facilitate functionally more favorable folding of the CtxB in to-

bacco cells. Here we show that the binding affinity of CtxB-G pro-

tein to GM1 was lower than that of CtxB expressed in tobacco

leaves. This may be due to the bulky nature of the G protein in

CtxB-G protein pentamer (403 kDa) which may cause steric hin-

drance to the binding of CtxB to GM1 receptor as compared tothe binding of CtxB pentamer (73 kDa). The G protein has three po-

tential N-linked glycosylation sites at Asn37, Asn247 and Asn319

positions [37]. The chaperones, other folding enzymes [38,39]

and the glycosylation in plant cells may lead to an increase in affin-

ity of the CtxB for GM1 receptors as compared to the non-glycos-

ylated bacterial CtxB. The binding affinity of the three proteins to

GM1 was higher at 37 C than at 4 C. Maximum binding of the

cholera toxin to GM1 is reported to occur within 1 h at 370C

[40]. Though the binding assay was carried out using crude extract

of the proteins, binding curves, nevertheless, demonstrate that the

three pentemeric proteins bound GM1 with different affinities.

This study describes the expression and assembly of the CtxB-G

protein fusion in transgenic tobacco plants. The assembly of CtxB-

G protein monomers into biologically active pentamers in trans-

formed tobacco leaf tissue suggests that CtxB-G protein antigen ex-

pressed in plants may show efficient internalization through the

mucosal receptors. This may enhance immunogenic ability of the

CtxB-G protein fusion against rabies following oral and mucosal

immunization. Differences in binding constants of the CtxB ex-

pressed in different cellular systems suggest the need to examine

the folding and functional behavior of proteins obtained from het-

erologous expression systems.

Acknowledgments

We greatly acknowledge the financial support provided by

Council for Scientific and Industrial Research and to the Depart-

ment of Science and Technology for J.C. Bose Fellowship to RakeshTuli. We thank Shadma Ashraf for the construct of the rgp and S.

Mishra for the ctxB genes, reported earlier.

References

[1] C.J. Arntzen, High-tech herbal medicine: plant-based vaccines, Nat. Biotechnol.15 (1997) 221–222.

[2] X.L. Jiang, Z.M. He, Z.Q. Peng, Y. Qi, Q. Chen, S.Y. Yu, Cholera toxin B protein intransgenic tomato fruit induces systemic immune response in mice, Trans. Res.16 (2007) 169–175.

[3] N. Tomonori, T. Hidenori, Y. Yoshikazu, Y. Lijun, M. Takehiro, M. Mio, M. Ushio,N. Akiko, U. Akihiro, H. Takachika, M. Shigeto, T. Kunisuke, T. Fumio, K. Hiroshi,Rice-based mucosal vaccine as a global strategy for cold chain and needle freevaccination, Proc. Natl. Acad. Sci. USA 104 (2007) 10986–10991.

[4] J. Yu, W.H. Langridge, Novel approaches to oral vaccines: delivery of antigensby edible plants, Curr. Infect. Dis. Rep. 2 (2000) 73–77.

[5] W. Tao, C. Jian-Ping, L. Hong, Z. Ke-Qian, Z. Lei, Y. Chun-Lei, T. Da-Chang, Co-expression and immunity of Legionella pneumophila mip gene andimmunoadjuvant ctxB gene, Acta Biochim. Biophys. Sin. 37 (2005) 199–204.

[6] K. Jin, H. So-Chon, Y. Moon-Sik, J. Yong-Suk, Expression of syntheticneutralizing epitope of porcine epidemic diarrhea virus fused with synthetic

Table 1

Purification of recombinant CtxB-G from tobacco leaves.

Fraction Total

protein

(lg)

CtxB-

G

(lg)

Recovery

(%)

Purity

(%)

Supernatant after centrifugation 45,100 180 100 0.4Antibody affinity column 60 56 31 93

The above values are based on the purification initiated with 10 g fresh leaves. Total

protein was calculated by Bradford assay, CtxB-G was determined by ELISA.

97

66

45

205

kDa

205

A B

M S M S

403

97

Fig. 7. SDS–PAGE analysis of the affinity purified CtxB-G protein. Purified protein

(200 ng) was loaded for silver staining (A). The purified protein was pentamerized

in vitro and checked on silver stained gel following non-denaturing SDS–PAGE (B).

M, molecular weight markers and S, purified protein sample.





B subunit of Escherichia coli heat-labile enterotoxin in tobacco plants, ProteinExpr. Purif. 46 (2006) 16–22.

[7] S. Hamid, B. Soren, W. Dale, P.S. Jacob, H.S. Jan, L. Machel, Genetic fusion of human insulin B-chain to the B-subunit of cholera toxin enhances in vitroantigen presentation and induction of bystander suppression in vivo,Immunology 106 (2002) 237–245.

[8] M.T. Dertzbaugh, C.O. Elson, Comparative effectiveness of the cholera toxin B

subunit and alkaline phosphatase as carriers for oral vaccines, Infect. Immun.61 (1993) 48–55.

[9] M.T. Dertzbaugh, D.L. Peterson, F.L. Macrina, Cholera toxin B-subunit genefusion: structural and functional analysis of the chimeric protein, Infect.Immun. 58 (1990) 70–79.

[10] H. Song, L. Zhou, W. Fang, Y. Li, X.H. Fang, X. Li, M. Wu, B. Qiu, High-levelexpression of codon optimized foot-and mouth disease virus complex epitopesand cholera toxin B subunit chimera in Hansenula polymorpha, Biochem.Biophys. Res. Commun. 315 (2004) 235–239.

[11] N. Lycke, J. Holmgren, Strong adjuvant properties of cholera toxin on gutmucosal immune responses to orally presented antigens, Immunology 59(1986) 301–308.

[12] A.G. Chandy, K. Eriksson, M. Lebens, I. Nordstrom, E. Schon, J. Holmgren,Cholera toxin B subunit as a carrier molecule promotes antigen presentationand increases CD40 and CD86 expression on antigen-presenting cells, Infect.Immun. 69 (2001) 5716–5725.

[13] D.G. Coslett, B.P. Hollow, J.K. Obijeski, The structural proteins of rabies virusand evidence for their synthesis from separate monocistronic RNA species, J.

Gen. Virol. 49 (1980) 161–180.[14] K. Conzelmann, J.H. Cox, L.G. Schneider, H. Thiel, Molecular cloning andcomplete nucleotide sequence of the attenuated rabies virus SAD19, Virology175 (1990) 485–499.

[15] T.J. Wiktor, E. Gyorgy, D. Schlumberger, F. Sokol, H. Koprowski, Antigenicproperties of rabies virus components, J. Immunol. 110 (1973) 269–276.

[16] S. Mishra, D.K. Yadav, R. Tuli, Ubiquitin fusion enhances cholera toxin Bsubunit expression in transgenic plants and the plant-expressed protein bindsGM1 receptors more efficiently, J. Biotechnol. 127 (2006) 95–108.

[17] S. Ashraf, P.K. Singh, D.K. Yadav, Md. Shahnawaz, S. Mishra, S.V. Sawant, R. Tuli,High level expression of surface glycoprotein of rabies virus in tobacco leavesand its immunoprotective activity in mice, J. Biotechnol. 119 (2005) 1–14.

[18] P.C. Sijmons, B.M. Dekker, B. Schrammeijer, T.C. Verwoerd, P.J. Van Den Elzen,A. Hoekema, Production of correctly processed human serum albumin intransgenic plants, Biotechnology 8 (1990) 217–221.

[19] R.B. Horsch, J.E. Fry, N.L. Hoffmann, D. Eicholtz, S.G. Rogers, R.T. Fraley, Asimple and general method for transferring genes into plants, Science 227(1985) 1229–1231.

[20] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-

time quantitative PCR & the 2-DDCT method, Methods 25 (2001) 402–408.[21] M.M. Bradford, A rapid and sensitive method for quantitation of microgram

quantities of protein utilizing the principles of protein dye binding, Anal.Biochem. 72 (1976) 248–254.

[22] A.P.M. Areas, M.L.S. Oliveira, E.N. Miyaji, L.C. C Leite, K.A. Aires, W.O. Dias, P.L.Ho, Expression and characterization of cholera toxin B- pneumococcal surfaceadhesion A fusion protein in Escherichia coli: ability of CTB-psaA to induceimmune response in mice, Biochem. Biophy. Res. Commun. 321 (2004) 192–196.

[23] R.F. Lathe, M.P. Kieny, D. Schmitt, P. Curtis, J.P. Lecocq, M13 bacteriophagevectors for the expression of foreign proteins in Escherichia coli: the rabiesglycoprotein, J. Mol. Appl .Genet. 2 (1984) 331–342.

[24] E.S. Norton, J.F. Obijeski, D.V. Goeddel, Rabies virus glycoprotein analogs:biosynthesis in Escherichia coli, Science 219 (1983) 614–620.

[25] S.R. Klepfer, C. Debouck, J. Uffelman, P. Jacobs, A. Bollen, E.V. Jones,Characterization of rabies glycoprotein expressed in yeast, Arch. Virol. 128

(1993) 269–286.[26] V. Yusibov, D.C. Hooper, S.V. Spitsin, N. Fleysh, R.B. Kean, T. Mikheeva, D. Deka,

A. Karasev, S. Cox, J. Randall, H. Koprowski, Expression in plants andimmunogenicity of plant virus-based experimental rabies vaccine, Vaccine20 (2002) 3155–3164.

[27] H.S. Masson, D.M.K. Lam, C.J. Arntzen, Expression of hepatitis B surface antigenin transgenic plants, Proc. Natl. Acad. Sci. USA 89 (1998) 11745–11749.

[28] J.A. Napier, G. Richard, P.R. Sherwry, Trafficking and stability of heterologousproteins in transgenic plants, Meth. Biotechnol. 3 (1998) 189–202.

[29] M.T. Dertzbaugh, C.O. Elson, Reduction in oral immunogenicity of choleratoxin B subunit by N-terminal peptide addition, Infect. Immun. 61 (1993) 384–390.

[30] J. Sanchez, S. Johansson, B. Lowenadler, A. Svennerholm, J.M. Holmgren,Recombinant cholera toxin B subunit and gene fusion proteins for oralvaccination, Res. Microbiol. 141 (1990) 971–979.

[31] R.A. Gonzalez, J. Sanchez, J. Holmgren, S. Lopez, C.F. Arias, Immunologicalcharacterization of a rotavirus-neutralizing epitope fused to the cholera toxin

B subunit, Gene 133 (1993) 227–232.[32] C.H. Shi, C. Cao, J.S. Xhing, J. Li, Q.J. Ma, Gene fusion of cholera toxin B subunitand HBV PreS2 epitope and the antigenicity of fusion protein, Vaccine 13(1995) 933.

[33] T. Zhang, E. Li, S.L. Stanley Jr., Oral immunization with the dodecapeptiderepeat of the serine-rich Entamoeba histolytica protein (SREHP) fused to thecholera toxin B subunit induces a mucosal and systemic anti-SREHP antibodyresponse, Infect. Immun. 63 (1995) 1349–1355.

[34] M. Backstrom, J. Holmgren, F. Schodel, M. Lebens, Characterization of aninternal permissive site in the cholera toxin B-subunit and insertion of epitopes from human immunodeficiency virus-1, hepatitis B virus andenterotoxigenic Escherichia coli, Gene 165 (1995) 163–168.

[35] M. Backstrom, M. Lebens, F. Schrodel, J. Holmgren, Insertion of a HIV-1-neutralizing epitope in a surface-exposed internal region of the cholera toxin Bsubunit, Gene 149 (1994) 211–217.

[36] C. Peach, J. Velten, Expression variability (position effect) of CAT and GUSreporter genes driven by linked divergent T-DNA promoters, Plant Mol. Biol.17 (1991) 49–60.

[37] A. Anilionis, W.H. Wunner, P.J. Curtis, Structure of the glycoprotein gene in

rabies virus, Nature 294 (1981) 275–278.[38] A.J. Parodi, Role of N-oligosaccharide endoplasmic reticulum processing

reactions in glycoprotein folding and degradation, Biochem. J. 348 (2000) 1–13.

[39] E.S. Trombetta, A. Helenius, Lectins as chaperones in glycoprotein folding, Curr.Opin. Struct. Biol. 8 (1998) 587–592.

[40] J. Holmgren, V. Elwing, P. Fredman, L. Svennerholm, Polystyrene adsorbedgangliosides for investigation of the structure of the tetanus toxin receptor,Eur. J. Biochem. 106 (1980) 371–379.


Rabies glycoprotein fused with B subunit of cholera toxin expressed in tobacco plants folds into...

Documents

Transcript of Rabies glycoprotein fused with B subunit of cholera toxin expressed in tobacco plants folds into...