Charles University

Faculty of Science

Study program: Animal Physiology

Mgr. Barbora Melkes

Studies on molecular interactions of the -opioid and TRPV1

receptors

PhD thesis

Supervisor: doc. RNDr. Jiří Novotný, DSc.

Prague 2020

Declaration

I hereby declare that this PhD thesis is exclusively my work and that it has not been

submitted (or any of its part) in order to obtain any academic degree earlier or at another

institution. All publications and other sources used in the thesis have been appropriately

cited.

Prague, 9.6.2020

………………………………………………

Mgr. Barbora Melkes

Acknowledgements

I would like to thank my supervisor, doc. RNDr. Jiří Novotný, DSc. for his guidance,

support and encouragement during my PhD studies.

I would like to thank all past and present members of our laboratory for creating a

pleasant working environment and especially a place where I like to go despite all the

trouble. I would like to thank to RNDr. Lucie Hejnová, Ph.D. for all her advice and

willingness to think about many of my questions at any time. Thanks to RNDr. Jitka

Škrabalová, Ph.D. and RNDr. Klara Hahnova, Ph.D, for starting with me here and creating

a place where friendship and help come first. I miss you girls so much. It was a great ride

here with you. I also want to thank my successor, helper and great friend Mgr. Vendula

Marková, for helping me get my science started and showing me that it works better in two,

and most importantly it's more fun. I would like to thank to Mgr. Onřej Honc for his tireless

help with the protocols, especially with point 16, and for his willingness to stop at any time

and discuss a few ordinary things. Thanks to Mgr. Radka Moravcová, for her willingness to

help at any time and for showing that hope dies last and for delicious cakes and to Mgr.

Simona Moravcová for her pleasant cooperation and also delicious cakes. I would also like

to thank to Mgr. Dmitri Manakov, Ph.D., Mgr. Zuzana Čočková and all past and present

students in our laboratory.

Special warm thanks to my husband Tomáš, my son Olin, my mom Ivča and the rest of

the family for their support and inspiration.

Abstract

In this work, we investigated the behavior of the -opioid receptor (MOR) and the

transient receptor potential vanilloid 1 (TRPV1) ion channel in the plasma membrane and

their mutual communication. Both these receptors are implicated in pain perception and

analgesia.

We observed that the lateral mobility of MOR was strongly affected by different biased

opioid agonists. DAMGO and endomorphin-2 display opposite bias towards MOR.

According to our results, they also have the opposite effects on the mobility of MOR.

Morphine induced only small changes in the mobility of MOR. Moreover, cholesterol

depletion and blockage of G protein signaling by pertussis toxin (PTX) affected the ability

of different MOR agonists to alter MOR mobility in a unique manner. The effects of

DAMGO and endomorphin-2 were compromised under these conditions. On the other hand,

we observed increased movement of MOR after the addition of morphine. PTX alone did

not affect receptor movement, but it completely disrupted the effect of cholesterol depletion

on morphine induced changes the mobility of MOR.

Next we studied the mobility of TRPV1. The TRPV1 agonist capsaicin changed the

lateral mobility of TRPV1. Surprisingly, after adding the MOR antagonist naloxone, the

apparent diffusion coefficient of TRPV1 but to a lower extent than capsaicin. MOR agonist

DAMGO and antagonist levallorphan did not affect the mobility of TRPV1. We found that

naloxone was able to increase intracellular calcium. However, naloxone was less effective

than capsaicin in the same concentration. Our radioligand binding assay confirmed the

ability naloxone binding sites of [3H]Naloxone to bind directly to TRPV1.

In the last part of this work, we observed that there is mutual communication between

MOR and TRPV1 signaling pathways. We found significant changes in the lateral mobility

of MOR after adding the agonist of TRPV1 and vice versa.

In sum, our results indicate that there is a close cooperation between MOR and TRPV1

within the plasma membrane and that the mobility of both these receptors is strongly affected

by their cognate as well as non-cognate agonists.

Keywords: Biased agonists; calcium; cholesterol; FRAP; μ-opioid receptor naloxone;

receptor lateral mobility; TRPV1

Abstrakt

V této práci jsme zkoumali chování -opioidního receptoru (MOR) a iontového kanálu

TRPV1 (transient receptor potential vanilloid 1) v plazmatické membráně buněk a jejich

vzájemnou komunikaci. Oba tyto receptory se podílejí na vnímání bolesti a analgezii.

Zjistili jsme, že laterální pohyblivost MOR byla silně ovlivněna různými usměrňujícími

opioidními agonisty. DAMGO a endomorfin-2 vykazují opačný usměrňovací agonismus

vůči MOR. Podle našich výsledků mají také opačné účinky na mobilitu MOR. Morfin

vyvolal pouze malé změny v mobilitě MOR. Kromě toho, deplece cholesterolu a blokování

G proteinové signalizace za pomoci pertusového toxinu (PTX) ovlivňovaly schopnost

agonistů MOR měnit jeho mobilitu. Účinky DAMGO a endomorfinu-2 byly za těchto

podmínek sníženy. Na druhé straně jsme pozorovali morfinem zvýšený pohyb MOR po

depleci cholesterolu. Samotný PTX neovlivnil pohyb receptoru, ale zcela narušil účinek

deplece cholesterolu na morfinem vyvolanou změnu mobility MOR.

Dále jsme se zabývali mobilitou TRPV1. Agonista TRPV1 kapsaicin změnil laterální

mobilitu TRPV1. Překvapivě, po přidání MOR antagonisty naloxonu se také zvýšil difúzní

koeficient TRPV1, ale v menší míře než po kapsaicinu. Agonista MOR DAMGO a

antagonista levallorfan neovlivnily mobilitu TRPV1. Zjistili jsme, že kapsaicin i naloxon

byly schopné zvýšit hladinu intracelulárního vápníku. Naloxon však byl ve stejné

koncentraci méně účinný než kapsaicin. Následně jsme pomocí vazebné studie za použití

radioligandu [3H]naloxonu prokázali přímou vazbu naloxonu na TRPV1.

V poslední části této práce jsme zjistili, že existuje vzájemná komunikace mezi

signalizačními drahami MOR a TRPV1. Po přidání agonisty TRPV1 jsme zaznamenali

významné změny v laterální mobilitě MOR a naopak.

Souhrnně lze říci, že naše výsledky naznačují, že existuje úzká spolupráce mezi MOR a

TRPV1 v plazmatické membráně a že mobilita obou těchto receptorů může být silně

ovlivněna jejich příbuznými i nepříbuznými agonisty.

Klíčová slova: Usměrňovací agonismus; Cholesterol; FRAP; laterální pohyblivost

receptorů; µ-Opioidní receptor; TRPV1; vápník

Table of Contents

List of Abbreviations ......................................................................................................... 10

1. Introduction ................................................................................................................ 14

2. Literature review ........................................................................................................ 15

2.1 Fighting the pain ................................................................................................... 15

2.2 Mu opioid receptor ................................................................................................ 17

2.2.1 Basic characteristics of MOR ........................................................................ 17

2.2.2 Structure ........................................................................................................ 17

2.2.3 Agonists and antagonists ............................................................................... 19

2.2.4 Signaling pathways ........................................................................................ 20

2.2.5 Biassed agonism ............................................................................................ 24

2.2.6 Membrane compartmentalization .................................................................. 27

2.3 TRPV1 .................................................................................................................. 28

2.3.1 Characteristics of TRPV1 .............................................................................. 28

2.3.2 Agonists and antagonists ............................................................................... 29

2.3.3 Regulation of TRPV1 and its signaling pathways ......................................... 30

2.3.4 Spatiotemporal organization of TRPV1 in the plasma membrane ................ 31

2.4 Mu opioid receptor and TRPV1 cooperation in cell ............................................. 32

3. Aims ............................................................................................................................. 34

4. List of publications ..................................................................................................... 35

4.1 List of publications connected with this work ...................................................... 35

4.2 List of other publications ...................................................................................... 35

4.3 Author´s contribution on the publications ............................................................ 36

5. Methods ....................................................................................................................... 37

5.1 Materials ............................................................................................................... 37

5.2 Plasmid construction ............................................................................................. 37

5.2.1 Sources .......................................................................................................... 37

5.2.2 Polymerase Chain Reaction (PCR) ............................................................... 37

5.2.3 In-FusionR HD cloning (Clontech) ................................................................ 38

5.2.4 Agarose gel electrophoresis .......................................................................... 38

5.2.5 Transformation and Sequencing .................................................................... 38

5.3 Cell culture ........................................................................................................... 39

5.3.1 Ligands .......................................................................................................... 39

5.3.2 Cholesterol depletion and replenishment ...................................................... 39

5.3.3 Pertussis toxin ............................................................................................... 40

5.4 Creating stable cell line expressing YFP-tagged MOR ........................................ 40

5.4.1 Transfection ................................................................................................... 40

5.4.2 FACS Sorting ................................................................................................ 40

5.5 Radioligand binding assay .................................................................................... 40

5.5.1 MOR binding assay ....................................................................................... 40

5.5.2 TRPV1 binding assay .................................................................................... 41

5.6 RT-PCR ................................................................................................................ 41

5.6.1 Isolation of RNA ........................................................................................... 41

5.6.2 Reverse transcription (RT) ............................................................................ 42

5.6.3 Real-time PCR ............................................................................................... 42

5.7 Transient transfection ........................................................................................... 42

5.8 Total internal reflection (TIRF) ............................................................................ 43

5.9 Fluorescent recovery after photobleaching (FRAP) ............................................. 43

5.10 Plasma membrane isolation .................................................................................. 44

5.11 Endpoint calcium assay ........................................................................................ 45

5.12 Statistics ................................................................................................................ 45

6. Results .......................................................................................................................... 46

6.1 Characterization of HMY-1 Cell line ................................................................... 46

6.1.1 Real-time RT PCR ......................................................................................... 46

6.1.2 MOR binding assay ....................................................................................... 47

6.1.3 Confocal fluorescence microscopy visualization .......................................... 47

6.2 Measurement of lateral mobility of MOR in the plasma membrane of HMY-1

cells 50

6.2.1 Modulation of the mobility of MOR by different biased agonists ................ 50

6.2.2 Impact of cholesterol depletion on the ability of MOR agonists to alter MOR-

YFP mobility ................................................................................................................ 53

6.2.3 Compromising effect of pertussis toxin on the ability of MOR agonists to

alter MOR-YFP mobility ............................................................................................. 56

6.3 Expression of TRPV1-CFP in HEK293 cells ....................................................... 58

6.4 Effect of different ligands of the lateral mobility of TRPV1 ................................ 59

6.5 Changes in intracellular calcium levels after treatment of HEK293 cells with

different ligands ............................................................................................................... 61

6.6 Naloxone binding to TRPV1 ................................................................................ 62

6.7 Coexpression of MOR-YFP and TRPV1-CFP in HMY-1 cells ........................... 63

6.8 Activation of TRPV1 changes the lateral mobility of MOR and the ratio between

mobile and immobile MOR in the plasma membrane ..................................................... 64

6.9 Activation of MOR changes the lateral mobility of TRPV1 and the ratio between

mobile and immobile TRPV1 in the plasma membrane .................................................. 66

7. Discussion .................................................................................................................... 68

7.1 MOR ..................................................................................................................... 68

7.2 TRPV1 .................................................................................................................. 73

7.3 MOR and TRPV1 ................................................................................................. 75

8. Summary ..................................................................................................................... 78

9. Bibliography ............................................................................................................... 80

10

List of Abbreviations

A

AAS antibiotic antimycotic solution

AC adenylate cyclase

AKAP150 A kinase anchoring protein

Akt kinase, also named as protein kinase B

B

BRET bioluminescence resonance energy transfer

β2AR β2-adrenergic receptor

βCDX β-cyclodextrin

C

CaMKII calmodulin kinase II

cAMP cyclic adenosine monophosphate

CFA complete Freunds adjuvant

CFP cyan fluorescent protein

CHO Chinese hamster ovary cells

CRE cAMP response element

CREB cAMP response element binding protein

D

D apparent diffusion coefficient

11

DADLE [D-Ala2, D-Leu5]-enkephalin

DAMGO [D-Ala2, N-MePhe4, Gly-ol]-enkephalin

DMEM Dulbecco’s modified Eagle’s medium

DOR δ-opioid receptor

DRG dorsal root ganglion

E

ERK extracellular signal-regulated kinase

F

FACS fluorescence-activated cell sorting

FBS fetal bovine serum

FCS fluorescent correlation spectroscopy

FRAP fluorescent recovery after photobleaching

FRET fluorescent resonance energy transfer

G

GDP guanosine diphosphate

GIRK G protein-coupled inwardly-rectifying potassium channel

GPCR G protein-coupled receptor

GRK G protein-coupled receptor kinase

GST Glutathione S-transferase

GTP guanosine triphosphate

12

H

HEK293 human embryonic kidney 293 cells

J

JNK c-Jun N-terminal kinase

K

KO knock out

KOR κ-opioid receptor

M

MAPK mitogen-activated protein kinase

Mf mobile fraction

MOR µ-opioid receptor

P

PCR polymerase chain reaction

PDE phosphodiesterase

PI3K phosphatidyl inositol-3 kinase

PKA proteinkinase A

PKC proteinkinase C

PLC phospholipase C

PNS post nuclear supernatant

PTX pertussis toxin

13

R

RGS regulator of G protein signaling

RT reverse transcription

T

TIRF total internal reflection

TM transmembrane

TRP transient receptor potential

TRPV1 transient receptor potential vanilloid 1

Y

YFP yellow fluorescent protein

14

1. Introduction

The perception of pain is one of the essential mechanisms of human survival. However,

acute pain may become chronic under certain pathological conditions and unbearable pain

sensations require proper medical treatment. A lot of efforts have been paid to better

understanding of the neural and molecular mechanisms of pain and looking for more

effective painkillers. There are different ways how the mechanisms of pain can be studied.

Obviously, we cannot use human beings in these studies, so we often use animal models,

mostly mice, and rats. But the problem is that the physiology of rodents is somewhat

different from the physiology of humans. Another approach to study the molecular

mechanisms of pain is based on using human cell lines. Nevertheless, in vitro models also

bring many problems. Anyway, the molecular mechanisms and cellular pathways involved

in pain perception and analgesic effects of some drugs have successfully been studied for a

long time. However, many issues still remain unresolved.

In our work, we were interested in studying the -opioid receptor (MOR) and the

transient receptor potential vanilloid 1 (TRPV1) ion channel and their signaling upon

treatment with agonists. These two receptors are both essential players in pain perception

and analgesia. The problem is the lack of methodological instruments for studying the

signaling mechanisms and behavior of plasma membrane receptors. One of the possible

approaches is to stain the receptors with fluorescent dyes to visualize them using fluorescent

microscopy techniques.

It was observed that different receptor ligands may distinctly affect the receptor behavior

and can initiate different signaling pathways in the cell. Here, we aimed to explore the impact

of different ligands on the mobility of MOR and TRPV1 in the plasma membrane. The

mobility can be affected by the change of receptor conformation, changes of the plasma

membrane composition, or by the molecular interactions of the receptor with the effectors

or other accessory molecules. Hence, these investigations can tell us a lot about the molecular

mechanisms of the signaling of the receptors.

15

2. Literature review

2.1 Fighting the pain

The opioid substances are known and used to treat the pain since the 19. century but

their clinical use is limited by tolerance and fear of addiction. It took a long time to reveal

the main principles of opioid effects. Opioid drugs have been used from ancient times to the

present, but the most explosive era of studying the drugs and their consequences happened

in the 1970s. It was found that opioid drugs bind to specific sites in the brain and that several

endogenous substances exhibit the same physiological properties.

In the following years, molecular cloning strategies were instrumental in helping to

identify three distinct opioid receptors for both endogenous and exogenous opioid

substances. They were named µ, δ, and κ opioid receptors (MOR, DOR, and KOR) (Chen et

al. 1993, Kieffer et al. 1992, Minami et al. 1993). Each of these receptor subtypes has its

specific characteristics, but they all are contributors to the regulation of pain, stress, and

reward system (Darcq and Kieffer 2018). Their different roles are depicted in Fig 1.

In the physiology of pain, all opioid receptors have important roles, but MOR is really

crucial for mediating the analgesic effects of most opioids. To date, lots of different analgesic

drugs have been synthesized. However, morphine is still the most effective analgesic opiate.

Of all the opioid receptors, morphine has the strongest affinity for MOR, and all its

physiologic actions, including analgesia and tolerance, are absent in MOR knockout mice

(Matthes et al. 1996). Many other MOR agonists are also potent analgesics but they are

highly addictive as well.

16

Fig. 1. Opioid receptors are the main regulators of the reward/aversion system. All three

opioid receptor subtypes have specific agonists that produce different mood responses and

are crucial to cope with pain and stress. MOR and KOR oppositely regulate hedonic

homeostasis with MOR agonists having a euphoric effect and KOR agonists having a

dysphoric effect. KOR agonists are also associated with stress and negative effects. DOR is

on the opposite end of the mood axis, and DOR agonists have an anxiolytic and positive

effects on mood (Valentino and Volkow 2018).

The lack of functional analgesics without side effects and enormous increase in opioid

prescriptions resulted in the current opioid epidemic in the USA. According to preliminary

data from the Centers for Disease Control and Prevention, more than 72 000 people in the

United States died due to drug overdose in 2017 and even more worldwide; over two-thirds

of them used opioids either from prescription or illegal markets (Vranken, Schutjens and

Mantel-Teeuwisse 2019). The rise of the opioid epidemic has evoked efforts to develop

opioid analgesics without adverse effects. However, there is still lack of essential knowledge

about the molecular mechanisms of opioid drug functioning, which hampers the possibility

of synthesizing the drugs without adverse effects that still poses a strong analgesic activity.

It was found that some other receptors may have modulatory effects on MOR and vice

versa. Such interactions can possibly offer new opportunities to fight painful states. It was

reported that heterooligomerization of MOR with other opioid receptors modulate not only

the binding but also the signaling and trafficking properties of individual receptors. Opioid

receptor heteromerization has been extensively investigated to identify novel therapeutic

targets that are as potent as morphine but without the side effects associated with chronic

17

morphine use (Fujita et al. 2014). However, the existence of functional opioid receptor

heteromers remains controversial because these are difficult to study. Most evidence relies

on the use of heterologous cells and on antibodies that have certain limitations concerning

their specificity (Valentino and Volkow 2018). Interestingly, there are some indications

about potential connection between the TRPV1 and MOR. TRPV1 is essential for the

induction of thermal nociception and is mainly expressed in sensory neurons. Recent reports

indicate that opioid and TRPV1 receptor agonists have contrasting consequences for anti-

nociception, tolerance, and dependence. Moreover, chronic morphine exposure modulates

TRPV1 activation and induces the anti-nociception effects of morphine (Bao et al.

2015). Given their potential as therapeutic targets, the systematic investigation of both the

opioid and TRPV1 receptors and their mutual interactions appears highly important.

2.2 Mu opioid receptor

2.2.1 Basic characteristics of MOR

MOR belongs the large family of G-protein coupled receptors (GPCR). It is a member

of the pertussis toxin-sensitive group, and its classic action is mostly mediated by the

inhibitory G proteins (Gi). These receptors are widely distributed through the nervous

system. Using an in situ hybridization histochemistry method with 33P-labelled RNA probes,

MOR were found in the prefrontal cortex, hippocampus, striatum, ventral pallidum,

hypothalamus, thalamus, cerebellum and also in the spinal cord (Peckys and Landwehrmeyer

1999).

2.2.2 Structure

MOR is a membrane-bound receptor with seven transmembrane helices, the N-terminal

on the outer part of membrane and the C-terminal inside the cell. This receptor derived from

a single gene OPRM1 that consists of 4 exons that clone the seven transmembrane structure.

Exon 1 encodes the N-terminus and first transmembrane domain (TM1), exon 2 encodes

TM2/3/4, exon 3 encodes TM5/6/7, and a fourth exon encodes 12 amino acids of the

intracellular C-terminus (Pasternak 2010).

18

A great progress has been made in studying the structure of MOR binding pocket and

effector binding sites. The model of MOR constructed by Filizola and colleagues suggested

that the MOR1 binding cavity is located in the inner inter-helical region constituted by the

transmembrane helices TM3, TM4, TM5, TM6 and TM7, and is partially covered by

dynamic extracellular loops (Filizola et al. 1999, Filizola, Carteni-Farina and Perez 1999).

Molecular dynamics simulations showed a ligand-dependent increase in the conformational

flexibility of the third intracellular loop that couples with the G-protein complex. It was

found that the flexibility of the third intracellular loop i3 dramatically changes when

morphine is bound to the receptor, consistent with the critical role of i3 as the docking site

of G protein binding. The increased flexibility of the i3 morphine-bound state could serve as

a structural activator or a “mechanical signal” coupling the receptor and G protein

(Serohijos et al. 2011). Furthermore, morphine-dependent flexible modulation of the C-

terminus (Serohijos et al. 2011) is also in agreement with the critical role of the C-terminus

in GPCRs signaling as a structural site for phosphorylation and a binding site for scaffolding

proteins (Milligan and White 2001).

It is commonly accepted that GPCRs including MOR, interact with each other to form

homo- and heterodimers. There is evidence indicating that MOR form homodimers. Firstly,

it was observed in the HEK293 cell model as well as in hippocampal neuron cultures that

MOR exist in molecular complexes with significant trafficking properties (He et al. 2002).

The structural analysis of MOR bound to the antagonist morphinan showed that they form a

two-fold symmetrical dimer bound to each other through the transmembrane helices 5 and 6

(Manglik et al. 2012).

In the case of dimerization of MOR with other opioid receptors, it was observed that

they can dimerize with all of them. Furthermore, it was demonstrated that the hetero-

oligomerization of MOR and DOR receptors changes their ligand binding properties due to

the allosteric modulations of the ligand binding of the second monomer after the activation

of the first monomer (Gomes et al. 2011). Many studies have pointed to the possible

pharmacological effect of heterooligomers of different opioid receptors (Wang et al. 2005b,

Wang et al. 2005a, Evans et al. 2010, George et al. 2000). It was also shown that MOR

heteromerized with other GPCRs. For example cannabinoid CB1 receptor (Hojo et al. 2008),

α2A-adrenoreceptor (Jordan et al. 2003, Vilardaga et al. 2008), chemokine receptor CCR5

(Suzuki et al. 2002), metabotropic glutamate mGlu5 receptors (Schröder et al. 2009), 5-HT1A

receptors (Cussac et al. 2012) and substance P NK1 receptors (Pfeiffer et al. 2003) can form

19

heterodiomes with MOR. All these heterodimers were proven by co-immunoprecipitation or

proximity-based studies FRET (fluorescence resonance energy transfer) or BRET

(bioluminescence resonance energy transfer) or both these methods.

2.2.3 Agonists and antagonists

Morphine, the most known MOR agonist, is a naturally occurring alkaloid obtained from

immature poppies (Papaver somniferum L.). It began to be used as a common analgesic in

the 1930s. Morphine is composed of 5 condensed cycles and has a morphinan chemical

structure derived from phenanthrene (Fig. 2).

The most experimentally used MOR agonist besides morphine is DAMGO ([D-Ala2, N-

MePhe4, Gly-ol]-enkephalin), a hydrolysis-resistant derivative of enkephalin (Fig. 2), which

has an affinity for the MOR similar to morphine (Raynor et al. 1994).

Fig. 2. Chemical structure of morphine (A) and DAMGO (B)

Morphine and DAMGO have similar intrinsic efficacy and are both known as agonists

of MOR that able to inhibit adenylyl cyclase similarly. However, DAMGO has slightly

higher potency in stimulating the binding of [35S]GTPS (Traynor and Nahorski 1995).

Epitope-tagged MORs in the plasma membrane of HEK293 cells internalized rapidly

following activation by the enkephalin analog DAMGO. However, no internalization of

MORs was observed under the same conditions in morphine-treated cells. Different

concentrations (up to 100 μM) of morphine failed to cause detectable rapid internalization

of MOR at (Keith et al. 1996). These data indicate that agonists, which have similar effects

on receptor-mediated signaling, can have dramatically different effects on the intracellular

trafficking of the receptor (Keith et al. 1996, Borgland et al. 2003).

20

Because morphine and other compounds that are clinically useful and open to abuse act

primarily at MOR, it was essential to identify endogenous peptides specific for this binding

site. Two peptides isolated from brain, endomorphin-1 (Tyr-Pro-Trp-Phe-NH2), and

endomorphin-2 (Tyr-Pro-Phe-Phe-NH2), were found to have a high affinity and selectivity

for MOR. These peptides are more effective than DAMGO in vitro, and they produce potent

and prolonged analgesia in mice (Zadina et al. 1997). Both endomorphin-1 and

endomorphin-2 trigger rapid internalization of MOR (Mc et al. 1999).

Naloxone is an opioid antagonist that has a relatively high binding affinity for all opioid

receptors. It has a similar morphinan structure as morphine (Fig. 3).

Fig. 3. Chemical structure of naloxone

2.2.4 Signaling pathways

Cellular communication through MOR requires the coordination of processes governing

receptor activation, signaling, phosphorylation, desensitization, and internalization. In figure

4, there is a scheme of basic signaling processes of MOR with a time scale. Desensitization

is a rapid process preceding endocytosis (approximately 2–5 minutes). Short-term tolerance

includes endocytosis and other mechanisms (up to 1 day), and long-term tolerance (longer

than one day) presumably involves multiple regulatory processes (Williams et al. 2013).

21

Fig. 4. General scheme of the time scale (log scale) of MOR signaling following binding

of an efficacious agonist such as [Met]5enkephalin. The fastest processes being G protein

signaling, followed by the phosphorylation by G protein receptor kinase (GRK) ( saturating

in less than 20 seconds). Following the phosphorylation, β-Arrestin binding saturates in

several minutes. This triggers the desensitization that reaches a steady state in

approximately 5 minutes. Endocytosis of MOR comes to a steady state in around 30 minutes

and recycling over about 1 hour, although this may vary for different splice variants

(Williams et al. 2013).

2.2.4.1 G protein signaling

G protein-regulated signaling after activation of MOR is a long-time known mechanism

which does not require a detailed description here. MOR binds preferentially to the pertussis

toxin-sensitive Gi/Go group of G proteins although some coupling to the pertussis toxin-

insensitive G protein Gz has also been recognized (Connor and Christie 1999). Briefly,

following the activation of MOR by agonist, the heterotrimeric G protein via its Gα subunit

binds to the C terminus of MOR. GDP (guanosine diphosphate) bound to the Gα is

exchanged for GTP (guanosine triphosphate), and the β and γ subunit complex dissociates

from Gα subunit. The Gα subunit subsequently inhibits the activity of adenylyl cyclase

22

resulting in a lower production of cAMP (cyclic adenosine monophosphate), which, in turn,

results in decreased activity of cAMP-dependent protein kinases, for example, protein kinase

A (PKA). In the case of PKA, this leads to a decrease of phosphorylation of cAMP response

element binding protein (CREB), which binds to the cAMP response elements (CRE) in the

nucleus. This factors regulate the transcription of many essential genes coding the proteins

involved in metabolism, signaling, homeostasis, cell cycle, and transcription, but also the

synthesis of neurotransmitters and neuroregulators (Mayr and Montminy 2001).

The Gβγ complex effectors include G protein-gated inwardly rectifying K+ channel

(GIRK), N-type voltage-dependent calcium channel, G protein-coupled receptor kinase

(GRK) 2/3, phospholipase Cb (PLCβ), phosphatidylinositol-3-kinase (PI3K), AC, etc. (Bian

et al. 2012). Moreover, βγ subunit activation of phosphatidylinositol 3-kinase promotes

MAPK (mitogen-activated protein kinase) activity through a series of phosphorylation steps,

including the activation of c-Src (Polakiewicz et al. 1998). Activated ERK/MAPK can

phosphorylate multiple targets in the cytoplasm and nucleus (i.e., transcription factors such

as CREB) (Williams et al. 2001).

2.2.4.2 Desensitization and β-arrestin 2 signaling

The desensitization of GPCRs is one of the most important regulatory mechanisms

driven by the specific protein kinases (GRKs, G protein receptor kinases). Following the G

protein signaling after activation of the receptor, GRKs phosphorylate the relevant GPCR.

This phosphorylation leads to the internalization of the receptor and blocks G protein

signalization. In 1990, following the studies of desensitization of β-adrenergic receptors

driven by GRKs, it was found that there is yet another protein playing an important role in

desensitization mechanisms. This protein was named β-arrestin (Lohse et al. 1990).

Nowadays, it is widely accepted that phosphorylation of GPCR by GRKs and subsequent

binding of β-arrestins plays a key role in the desensitization of receptors. β-Arrestins also

act as scaffolding proteins that promote the internalization of GPCRs. During internalization,

the receptor is transported into an endosome in the cytoplasm. Subsequently, the receptor

will either be degraded by lysosomes or recycled to the cell membrane (Cahill et al. 2016).

It has long been known that the complex of GPCR and β-arrestin 2 has a signaling

function as well. β-Arrestin may act as a scaffolding protein and promote the stable

association of signaling proteins with MOR. It may head to the activation of the MAPK

23

pathways, for example, Jun N terminal kinase (JNK) (McDonald et al. 2000) and ERK1/2

(Luttrell et al. 2001). Mice lacking β-arrestin 2 exhibit prolonged opioid analgesic effects

and reduced tolerance to morphine (Bohn et al. 1999), suggesting that β-arrestin/MAPK

signaling contributes to the development of opioid tolerance.

Lately, it was shown that the mechanism of desensitization and internalization strongly

depends on the type of agonists. There are differences between various agonists. There are

agonists with a relatively high efficacy for endocytosis (e.g., DAMGO), and agonists with a

relatively low efficacy for endocytosis (e.g., morphine). It was found that DAMGO-driven

phosphorylation of Thr(370) and Ser(375) of the receptor was preferentially catalyzed by

GRK2 and GRK3. In contrast, morphine-driven Ser(375) phosphorylation of the receptor

was preferentially catalyzed by GRK5 (Doll et al. 2012). On the other hand, Johnson and

colleagues showed that DAMGO and morphine each induce desensitization of MOR

signaling in HEK293 cells but by different molecular mechanisms; DAMGO-induced

desensitization is GRK2-dependent, whereas morphine-induced desensitization is in part

PKC (protein kinase C)-dependent. MOR desensitized after activation by DAMGO are

readily internalized by an arrestin-dependent mechanism, whereas those activated by

morphine are not (Johnson et al. 2006).

Moreover, it was shown that different kinases can drive phosphorylation of the C-

terminal tail of MOR. Using N-terminal glutathione S transferase (GST) fusion proteins of

the cytoplasmic, C-terminal tail of MOR and point mutations of the same, in vitro, that

purified GRK phosphorylates Ser(375), PKC phosphorylates Ser(363) (Chen et al. 2013) of

the receptor. On the other hand, Ca2+/calmodulin-dependent protein kinase II (CaMKII)

phosphorylates Thr(370). Phosphorylation of the GST fusion protein of the C-terminal tail

of MOR enhanced its ability to bind β-arrestin (Chen et al. 2013). The recruitment of β-

arrestin is then dependent on the phosphorylation pattern of specific residues in the

intracellular domains of MOR. For example, using electron microscopy two-dimensional

averages and three-dimensional reconstructions revealed bimodal binding of β-arrestin 1 to

the β2-adrenergic receptor, involving two separate sets of interactions, one with the

phosphorylated carboxy-terminus of the receptor and the other with its seven-

transmembrane core (Shukla et al. 2014). Whether this is also the case of MOR is not yet

known.

24

2.2.5 Biassed agonism

Biased agonism of GPCRs is a widely accepted phenomenon that describes the

possibility of switching between two classical signaling pathways upon activation of a

receptor by different ligands. Recently, biased agonism or regulation of GPCRs dependent

on the specific properties of specific agonists has been extensively explored. Studies on this

topic published so far suggest that MOR agonists mostly direct signaling either through the

respective G protein or through β-arrestin 2 (Fig. 5) (Williams et al., 2013). However, there

are likely to be other variations, such as bias in GPCR coupling to different G protein

subtypes.

Fig. 5. A scheme of signaling of non-biased and biased GPCR agonists. Non-biased

agonists stimulate both G protein and β-arrestin signaling pathways equally. Biased

agonists display preferences towards the G protein-mediated signaling pathway or the β-

arrestin signaling pathway (Conibear and Kelly 2019).

The importance of biased agonism at MOR emerged after the finding of remarkable

potentiation and prolongation of the analgesic effect of morphine after the functional

deletion of the β-arrestin 2 gene in mice. This observation suggests that MOR desensitization

was impaired (Bohn et al. 1999). Moreover, the subsequent studies of β-arrestin 2 knockout

mice revealed that acute desensitization and tolerance to morphine was attenuated in the

knockout animals (Bohn et al., 2000). These animals displayed dramatically attenuated

respiratory suppression and acute constipation caused by morphine (Raehal, Walker and

25

Bohn 2005) suggesting possible therapeutic benefits of G protein-biased MOR ligands for

maintaining analgesic efficacy in chronic pain states.

It was found that GPCRs activate complex signaling networks and can adopt multiple

active conformations upon agonist binding. As a consequence, the "efficacy" of receptors,

which was classically considered linear, is now recognized as pluridimensional, which

means that ligands can have many different efficacies for the many behaviors that the

receptor can exhibit. It leads to a breakdown in the standard classifications of agonist and

antagonist (Reiter et al. 2012, Kenakin 2011).

In the case of MOR, the ability of 22 opioid agonists to activate G proteins and to recruit

β-arrestin 2 in HEK293 cells stably expressing MOR was investigated (Fig. 6). It was shown

that there is a strong correlation between the two signaling outputs for most of those agonists;

however, there seems to be the bias towards β-arrestin 2 recruitment for a few agonists,

particularly the endomorphin-1 and -2 (McPherson et al. 2010).

To verify whether the endomorphin-2 is biased toward β-arrestin recruitment over G

protein activation, authors performed experiments to show that there truly is a significant

bias towards the β-arrestin 2. The likely source for the β-arrestin bias is the ability of

endomorphin-2 to induce greater phosphorylation of MOR than would be predicted from the

ability of this peptide to activate G protein-coupled responses (Rivero et al. 2012). However,

in the study of the other group using different cell line (Chinese hamster ovary, CHO),

endomorphin-2 bias towards β-arrestin 2 recruitment over [35S]GTPγS binding was not

significant (Thompson et al. 2015). Potential reasons for these differences include the

method used to quantify bias in vitro, the time points used to measure β-arrestin 2

recruitment, the choice of reference ligand, the different cell backgrounds as well as

differences in the statistical test used to assess significance (Thompson et al. 2015, Conibear

and Kelly 2019).

26

Fig. 6. The bias factor of MOR agonists. The bias factor for 16 MOR ligands was

calculated using data of ligand-induced [35S]GTPγS binding and β-arrestin 2 recruitment

previously obtained in HEK293 cells stably expressing MOR (Rajagopal et al. 2011),

(McPherson et al. 2010). Leu-enkephalin was selected as the reference (unbiased) ligand. A

one-sample, two-tailed t test was used to determine the statistical difference of the degree of

bias from 0 (Rivero et al. 2012).

Recent data show that bias should be examined across multiple pathways. There seems

to be another level of complexity of bias that extends beyond the activation of G protein

versus β-arrestin 2 recruitment. It was shown that endomorphin-2 preferentially activate

cAMP signaling over [35S]GTPγS signaling in different cell lines (Thompson et al. 2015,

LaVigne et al. 2020). Experiments carried out with an isoform-selective RGS-4 (regulator

of G protein signaling) inhibitor, and siRNA knockdown of AC6 in N2a cells indicated that

these manipulations did not significantly affect the bias properties of endomorphin-2,

suggesting that these proteins may not play a role in endomorphin-2 bias (LaVigne et al.

2020).

At present, there is a worrying lack of correlation between studies in the bias factors

calculated for the MOR. Even the nature of the bias for a given agonist has been shown to

27

change depending on the signaling output used for bias calculation (e.g., G protein versus

cAMP) (Conibear and Kelly 2019).

Moreover, the results of recent studies using β-arrestin 2 knockout mice do not support

the original suggestion that β-arrestin 2 signaling plays a crucial role in opioid-

induced respiratory depression (Raehal et al. 2005). There was a consortium formed

consisting of three different laboratories located in different countries to evaluate

independently opioid-induced respiratory depression. It was demonstrated that the

prototypical μ-opioid agonist morphine, as well as the potent opioid fentanyl, do indeed

induce respiratory depression and constipation in β-arrestin 2 knockout mice in a dose-

dependent manner indistinguishable from that observed in wild-type mice (Kliewer et al.

2020).

2.2.6 Membrane compartmentalization

There is little consistency in data of many groups trying to identify the distribution of

MOR in the plasma membrane. Some studies claimed that MOR is localized mainly in lipid

rafts (Zheng et al. 2008, Zhao, Loh and Law 2006, Qiu et al. 2011). However, there are also

studies trying to deny it (Gaibelet et al. 2008). In all these studies, authors worked with

isolated fractions of cell membranes. Therefore the diversity could be ascribed to various

compositions of rafts dependent on cell type, to the nature of starting material, or can be

affected by different protocols used for isolation of membrane fractions (Cezanne, Navarro

and Tocanne 1992).

There is also lack of consistency regarding the effect of different agonists on the

association of MOR with lipid rafts. It was found that there are changes of MOR

conformation following agonist treatment, which may result in lipid/protein hydrophobic

mismatches possibly able to generate new rafts or to drive activated MOR towards existing

raft zones (Gaibelet et al. 2008). This was confirmed by FRAP experiments revealing that

MOR diffusion is restricted to different sub-micrometer domains after agonist binding

(Sauliere et al. 2006). Results of some FRAP studies indicated that MOR can be modulated

upon agonist binding, suggesting that a selective pharmacological response could be

associated with a specific dynamic organization of the receptors in the membrane (Sauliere

et al. 2006, Sauliere-Nzeh et al. 2010). There are also some indications that the mobility

parameters of MOR can also be influenced by changes in membrane cholesterol content

28

(Vukojevic et al. 2008), which suggests the importance of cholesterol enriched domains for

MOR-mediated signaling.

2.3 TRPV1

TRPV1 is a non-selective cation channel that plays a key role in the generation and

maintenance of nociceptor sensitization and desensitization. It is known for its involvement

in pain sensation and neurogenic inflammation (Planells-Cases et al. 2005). It plays an

essential role in pain hypersensitivity, which is associated with chronic pain conditions.

TRPV1 is highly expressed in the plasma membrane of nociceptive dorsal root ganglia

(DRG) neurons (Caterina and Julius 2001).

2.3.1 Characteristics of TRPV1

TRPV1 is a nonselective ion channel belonging to the subfamily TRPV of the TRP

family of channels. It was the first channel of the TRPV subfamily discovered, and all the

group is named according to it. The TRPV subfamily consists of 6 members TRPV1-TRPV6,

and all of them share amino acid sequence homology. They are nonselective cation channels,

but TRPV5 and 6 show high preferences to Ca2+ cations (Vennekens et al. 2008). TRPV1 is

the best characterized member of the TRPV subfamily and is still most extensively studied.

The roles of TRPV1 in pain are already clearly known, but we still lack the knowledge of

the precise mechanisms of its functioning.

Besides its sensitivity to a variety of exogenous and endogenous compounds, it is also a

heat sensor sensitive to ≈ 42°C. TRPV1 was firstly cloned in 1997 from the cDNA library

from sensory neurons using calcium influx (Caterina et al. 1997). Later on, physiological

functions of TRPV1 were studied on animal models. Mice lacking this channel (TRPV1-/-)

displayed impaired behavior to heat noxious stimuli and vanilloid-evoked pain but no

changes in reaction to noxious thermal injury were observed in these animals. They also

showed little thermal hypersensitivity in the setting of inflammation (Caterina et al. 2000).

TRPV1 are tetrameric cation-selective channels. Each of the four structurally similar

subunits have six transmembrane (TM) domains with intracellular N- (containing six

ankyrin-like repeats) and C-termini and a pore region between TM5 and TM6 containing

sites that are important for channel activation and ion selectivity. The N- and C- termini have

29

residues and regions that are sites for phosphorylation/dephosphorylation and PI(4,5)P2

binding, which regulate TRPV1 sensitivity and membrane insertion (Bevan et al. 2014).

2.3.2 Agonists and antagonists

The main exogenous ligands of this channel are vanilloid compounds, the most known

of which is capsaicin, the substance from chili peppers that elicits burning pain (Caterina et

al. 1997) (Fig. 7).

Fig. 7: Chemical structure of vanilloid compound named capsaicin

Other ways of activation of TRPV1 are either by changes in pH (≤ 5.9), noxious heat

(>42°C) or by bioactive lipids (e.g., N-arachidonylethanolamine (anandamide), N-

arachidonoyldopamine, N-oleoyldopamine, and leukotriene B4 (Vriens et al 2009)) which

contribute to pain hypersensitivity. Moreover, TRPV1 channels in the mammalian pain

pathway are activated or potentiated when phosphatidylinositol 4,5-bisphosphate (PIP2) is

hydrolyzed (Chuang et al. 2001).

In addition to plant-derived TRPV1 agonists, several animal-derived toxins such as

vanillotoxins VaTx1, VaTx2, and VaTx3 found in the venom of the tarantula Psalmopoeus

cambridgei have been shown to act on TRPV1 (Siemens et al. 2006).

30

2.3.3 Regulation of TRPV1 and its signaling pathways

The typical properties of TRPV1 as an ion channel, calcium influx and membrane

depolarization, are inseparable. Stimulation of TRPV1 channels induces influx of Ca2+ into

the cells. It is known that changes in cytosolic free Ca2+ concentration are crucial in the

regulation of a large variety of cellular functions, ranging from short-term processes, such

as muscle contraction, exocytosis, or platelet aggregation, to long-term events, including cell

proliferation or apoptosis (Berridge et al. 2000). Activation of nociceptive TRPV1 ion

channel in sensitive (i.e., DRG) neurons leads to an influx of Ca2+ across the plasma

membrane resulting in membrane depolarization that, in turn, might trigger voltage-gated

ion channel-dependent action potentials that transmit the information to the spinal cord and

the higher nerve centers (Jardín et al. 2017). At a cellular level, the rise in intracellular Ca2+ is

essential for activating transcription mediated by the transcription factor AP-1 in capsaicin

or resiniferatoxin-stimulated cells. The signal transduction of capsaicin, leading to enhanced

AP-1-mediated transcription, requires extracellular signal-regulated protein kinase ERK1/2

as a signal transducer (Backes et al. 2018).

The regulation of TRPV1 is driven via desensitization, internalization, and degradation.

The prolonged exposure of TRPV1 to capsaicin leads to agonists-induced receptor

internalization and lysosomal degradation. The down-regulation requires channel activation

and calcium influx (Sanz-Salvador et al. 2012). TRPV1 phosphorylation is suggested to lead

to an increased probability of receptor activation in response to a specific agonist by inducing

a conformational change favoring agonist binding (Studer and McNaughton 2010). This

process is modulated by cAMP-dependent protein kinase A (PKA)- and protein kinase C

(PKC)-mediated phosphorylation (Sanz-Salvador et al. 2012, Studer and McNaughton

2010). PKA decreases the desensitization of TRPV1 by directly phosphorylating the

channel presumably at sites Ser116 and Thr370 (Mohapatra and Nau 2003, Bhave et al.

2002). The phosphorylation of TRPV1 by PKA and PKC is mediated by the scaffolding

protein PKA-anchoring protein 150 (AKAP150). The siRNA-mediated knock-down of

AKAP150 expression led to a significant reduction in PKA phosphorylation of TRPV1 in

cultured TG neurons (Jeske et al. 2008) and also PKC-mediated phosphorylation of TRPV1

and sensitization to a capsaicin response is dependent upon functional expression of the

AKAP150 scaffolding protein (Jeske et al. 2009).

31

Towards the degradation, the phosphorylation of TRPV1 and β-arrestin 2 by PKA and

PKC triggers the association of TRPV1 with scaffolding protein β-arrestin 2 (Por et al.

2013). It was shown that both siRNA-mediated knockdown and genetic ablation of β-arrestin

2 significantly reduce TRPV1 desensitization (Por et al. 2012). Moreover, it was

demonstrated that β-arrestin 2 expression is required to localize the phosphodiesterase

PDE4D5 within close spatial proximity to TRPV1 at the plasma membrane. The

phosphodiesterase PDE4D5 modulates PKA-driven phosphorylation of TRPV1 and thus

contributes to the effective regulation of receptor desensitization (Por et al. 2012). The

contribution of β-arrestin 2 to the modulation of TRPV1 activity is further supported by

reducing the agonist affinity for TRPV1 after β-arrestin 2 co-expression (Por et al. 2012).

Surprisingly, TRPV1 receptor does not rely entirely upon calcium signaling to affect

cellular biology. It also has a close relationship with the mechanistic target of rapamycin

(mTOR), AMP-activated protein kinase (AMPK), and protein kinase B (Akt) that have

important roles in pain sensitivity, stem cell development, cellular survival, and cellular

metabolism (Maiese 2017).

2.3.4 Spatiotemporal organization of TRPV1 in the plasma membrane

A growing body of evidence accumulated in recent years shows that the surface

membrane dynamics of ion channels is not just noise but constructive variable (Heine et al.

2016). Only a few studies are revealing the spatiotemporal organization of TRPV1 in the

plasma membrane. It was shown that there are three populations of TRPV1 with somewhat

different dynamics and properties: one binding to caveolin-1 and confined to caveolar

structures, another one actively guided by microtubules, and yet another one which diffuses

freely and is not directly implicated in regulating receptor functionality (Storti et al. 2015).

Moreover, Senning and Gordon showed that there is highly variable mobility from

channel-to-channel and, to a smaller extent, from cell to cell and that the mobility of TRPV

rapidly decreases upon channel activation by capsaicin (the mobility of open TRPV1), but

only in the presence of extracellular calcium ions (Senning and Gordon 2015).

32

2.4 Mu opioid receptor and TRPV1 cooperation in cell

Some studies have demonstrated natural co-expression of MOR and TRPV1 receptors

in different regions of the central nervous system and have pointed to possible functional

interactions of these receptors (Endres-Becker et al. 2007, Maione et al. 2009). It was shown

that opioids can inhibit the activity of TRPV1, and this inhibition is MOR-specific, mediated

via Gi/o proteins and the cAMP/PKA pathway (Endres-Becker et al. 2007). Besides that, the

opioid or TRPV1 receptor agonist exposure has contrasting consequences for anti-

nociception, tolerance, and dependence. Some evidence shows that chronic morphine

exposure modulates TRPV1 activation and induces the anti-nociception effects of morphine

(Bao et al. 2015).

The destruction of TRPV1 receptor-expressing sensory neurons by resiniferatoxin, an

ultrapotent capsaicin analog, blocked morphine tolerance (Chen and Pan 2006), and

sustained morphine treatment resulted in tolerance and tolerance-associated thermal

hyperalgesia, by regulating TRPV1 expression, in a MAPK-dependent manner (Chen et al.

2008). Moreover, unlike wild-type mice, TRPV1 KO (knock out) mice did not develop

thermal and tactile hypersensitivity induced by sustained morphine administration and

TRPV1 antagonist reversed morphine-induced thermal and tactile hypersensitivity in mice

and rats. These observations suggest that TRPV1 is an essential part of the neuroadaptive

changes that lead to enhanced pain states (i.e., hyperalgesia) after sustained morphine

treatment (Vardanyan et al. 2009). Together, these data indicate that continuous exposure to

opioids enhances the TRPV1 function in the periphery and plays an essential role in

sustained morphine-induced hypersensitivity.

The question about the possible mechanisms of MOR-TRPV1 crosstalk and signaling

pathways is not fully understood yet; however, there are some clues.

It was shown that opioid withdrawal significantly increased cAMP levels and capsaicin-

induced TRPV1 activity in both transfected human embryonic kidney 293 cells and

dissociated DRG neurons. Inhibition of AC and PKA, as well as mutations of the PKA

phosphorylation sites threonine 144 and serine 774, prevented the enhanced TRPV1 activity

(Spahn et al. 2013).

Using an in vitro culture system of primary sensory neurons, Rowan and colleagues

found that activation of MOR by DAMGO or morphine leads to recruitment of β-arrestin 2

33

to MOR, away from TRPV1. Additionally, they demonstrated that the recruitment of β-

arrestin 2 away from TRPV1 results in sensitization of TRPV1 responses through a β-arrestin

2- and PKA-dependent manner (Rowan et al. 2014).

Lately, an interaction between TRPV1, MOR, and GRK5 was demonstrated. It was

shown that calcium influx through TRPV1 leads to the nuclear translocation of GRK5 which

blocks its ability to phosphorylate MOR. This interaction leaves the G protein-mediated

analgesic signaling of MOR intact but inhibits β-arrestin–mediated internalization and

desensitization of MOR. Thus, TRPV1 activation has the potential to mitigate opioid side

effects by inhibiting MOR phosphorylation while leaving intact the analgesic mechanism

mediated by G protein signaling (Scherer et al. 2017).

Activation of TRPV1 stimulated the MAPK signaling pathway and subsequently was

accompanied by the shuttling of the scaffold protein β-arrestin 2 to the nucleus. The nuclear

translocation of β-arrestin 2, in turn, prevented its recruitment to MOR, subsequent

internalization of agonist-bound MOR, and the suppression of MOR activity that occurs

upon receptor desensitization (Basso et al. 2019).

Recent evidence suggests that functional communication between MOR and TRPV1

receptors is reciprocal and highly dependent on specific conditions, particularly on the mode

and duration of activation of these receptors. However, many questions concerning MOR-

TRPV1 receptor interactions are still unresolved, including cross-communication between

their signaling pathways and respective feedback loops.

34

3. Aims

Preparation of stably expressing MOR-YFP cell line.

Optimization of microscopic methods to study fluorescently stained MOR and

TRPV1.

To explore the effect on the receptor mobility of three biased MOR agonists and the

impact of membrane cholesterol levels and pertussis toxin treament.

To investigate whether treatment with selected MOR ligands of HEK293 cells

expressing TRPV1 could influence the channel mobility and function.

To measure the mobility of MOR and TRPV1 after the addition of their ligands and to

investigate the possible receptor cross-activation.

35

4. List of publications

4.1 List of publications connected with this work

1. Melkes, B., Hejnova, L., Novotny, J. (2016) Biased μ-opioid receptor agonists

diversely regulate lateral mobility and functional coupling of the receptor to its

cognate G proteins. Naunyn-Schmiedeberg's Arch. Pharmacol. 389: 1289.

2. Melkes, B., Markova, V., Hejnova, L., Marek, A., Novotny, J. (2020) Naloxone is a

potential binding ligand and activator of the capsaicin receptor TRPV1. Biol. Pharm.

Bull. 43, 1–6

4.2 List of other publications

1. Bezouska, K., Kubinkova, Z., Stribny, J., Volfova, B., Pompach, P., Kuzma, M., Sirova,

M., Ríhova, B. (2012) Dimerization of an immunoactivating peptide derived from

mycobacterial hsp65 using N-hydroxysuccinimide based bifunctional reagents is critical

for its antitumor properties. Bioconjug. Chem. 23, 2032-2041.

2. Pacesova, D., Volfova, B., Cervena, K., Hejnova, L., Novotny, J., Bendova, Z. (2015)

Acute morphine affects the rat circadian clock via rhythms of phosphorylated

ERK1/2 and GSK3 kinases and Per1 expression in the rat suprachiasmatic nucleus.

Br. J. Pharmacol. 172, 3638-3649.

3. Hahnova, K., Pacesova, D., Volfova, B., Cervena, K., Kasparova, D., Zurmanova, J.,

Bendova, Z. (2016) Circadian Dexras 1 in rats: Development, location, and

responsiveness to light. Chronobiol. Int. 33, 141-150.

4. Moravcova, R., Melkes, B., Novotny, J. (2018) TRH receptor mobility in the plasma

membrane is strongly affected by agonist binding and by interaction with some

cognate signaling proteins. J. Recept. Signal Transduct. Res. 38, 20-26.

5. Moravcova, S., Pacesova, D., Melkes, B., Kyclerova, H., Spisska, V., Novotny, J.,

Bendova, Z. (2018). The day/night difference in the circadian clock's response to

acute lipopolysaccharide and the rhythmic Stat3 expression in the rat suprachiasmatic

nucleus, PLoS One 13(9):e0199405.

36

4.3 Author´s contribution on the publications

1. Melkes, B., Hejnova, L., Novotny, J. (2016) Biased μ-opioid receptor agonists

diversely regulate lateral mobility and functional coupling of the receptor to its

cognate G proteins. Naunyn-Schmiedeberg's Arch. Pharmacol. 389: 1289.

Author prepared the stable HMY-1 cell line, performed all the experiments

except the GTPγS assay, did all the analysis, prepared all the graphs and images and

participated in writing of the manuscript.

2. Melkes, B., Markova, V., Hejnova, L., Marek, A., Novotny, J. (2020) Naloxone is a

potential binding ligand and activator of the capsaicin receptor TRPV1. Biol. Pharm.

Bull. 43, 1–6

Author did most of the work with cells and most of the experiments excluding

the synthesis of [3H]DAMGO, did the analysis and prepared most of the graphs and

participated in the writing of the manuscript.

37

5. Methods

5.1 Materials

Lipofectamine 2000 and 3000, and Opti-MEM medium were purchased from Invitrogen

(Carlsbad, CA, USA), and fetal bovine serum (FBS) was from Thermo Fisher Scientific

(Waltham, MA, USA). The tritiated agonist [3H]DAMGO and [35S]GTPγS were purchased

from Hartmann Analytic (Braunschweig, Germany), and scintillation cocktail CytoScint was

from ICN Biomedicals (Irvine, CA, USA). Cell MeterTM No Wash and Probenecid-Free

Endpoint Calcium Assay Kit was from AAT Bioquest (Sunnyvale, CA, USA). All ligands

and other chemicals were from Sigma-Aldrich (St. Louis, MI, USA), and they were of the

highest purity available.

5.2 Plasmid construction

5.2.1 Sources

A plasmid containing MOR-YFP was cloned using vector pcDNA3-YFP (Addgene

plasmid no. 13033, a gift from Doug Golenbock, University of Massachusettes Medical

school, USA) with geneticin resistance and insert containing human MOR (Source

BioScience). A plasmid containing TRPV1-CFP was a kind gift from Dr. Leon Islas (De-la-

Rosa et al. 2013).

5.2.2 Polymerase Chain Reaction (PCR)

PCR was carried out using Q5R High-Fidelity 2x master mix (New England Biolabs),

adding DNA overlaps corresponding with the YFP vector on both ends of MOR. Primers:

Forward primer: CAGTGTGCTGGAATTCGCCACCATGGGTCTCCTG

Reverse primer: TGCTCACCATCTCGAGGGGCAACGGAGCAGTTTC

The PCR reaction was condused as follows. Template DNA (1 ng) was mixed with 12.5

µl of Q5R High-Fidelity 2x master mix, 1.25 µl of 10 µM forward primer, 1.25 µl of 10 µM

38

reverse primer and nuclease-free water was added to the volume of 25 µl. All reaction

components were assembled on ice and quickly transferred to thermocycler preheated to the

denaturation temperature (98°C). Thermocycling conditions were set as follows:

Initial denaturation 98°C 30 sec

30 cycles 98°C 10 sec

68 °C 20 sec

72°C 50 sec

Final extension 72°C 2 min

Hold 4°C ∞

After the thermocycling, the reaction was purified using DNA Clean & Concentrator

spin columns (Zymo Research) according to the manufacturer’s instructions.

5.2.3 In-FusionR HD cloning (Clontech)

The reaction was mixed according to the manufacturer’s instructions. Briefly, 100 ng of

purified PCR fragment was mixed with 80 ng of linearized vector, 2 µl of 5x In-FusionR HD

Enzyme Premix, and H2O added to the volume of 10 µl. The reaction was incubated for 15

min at 50°C and then placed on ice before continuing with transformation procedure.

5.2.4 Agarose gel electrophoresis

Agarose gel electrophoresis was performed on 1% agarose gel with TBE buffer (89 mM

Tris, 89 mM boric acid, and 2 mM EDTA) and ethidium bromide (2%) staining in Hoefer

HE33 submarine electrophoresis unit set on 100V voltage for 30 min.

5.2.5 Transformation and Sequencing

Plasmid transformation into XL-1 Blue E. Coli was carried out as follows. One

nanogram of plasmid DNA was mixed with 100 µl of chemically competent XL-1 Blue cells

and left on ice for 30 minutes. The mixture was heat shocked for 45 seconds at 42°C and left

on ice for 2 minutes to cool down. Two hundred µl of Luria Bertoni’s media was added, and

39

the mixture was left shaking for 1 hour at 37°C. After the incubation, the mixture was plated

on previously prepared LB plates with ampicillin as a resistance marker. Plates were

incubated overnight at 37°C. Single colonies were inoculated into 5 ml of LB medium

containing 5µg/µl of Ampicillin and incubated roughly mixing overnight at 37°C. The DNA

isolation was carried out with the ZR plasmid Miniprep kit (ZymoResearch) according to

the manufacturer’s instructions. The sequence of the final construct was verified by DNA

sequencing at the DNA Sequencing Facility of the Faculty of Science of Charles University.

5.3 Cell culture

Human Embryonic Kidney (HEK293) cells were cultured in Dulbecco's modified

Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), and 1%

antibiotic antimycotic solution (AAS, Sigma-Aldrich) at 37°C in 5% CO2 humidified

atmosphere.

5.3.1 Ligands

For MOR, we used the following agonists: morphine, DAMGO, and endomorphin-2, all

at 1 µM concentration if not stated otherwise. The experiments were started after 5-10

minutes (acute administration). The opioid antagonist naloxone was used at a concentration

10 µM. The experiments were started after 5-10 minutes (when studying the direct effects

of naloxone). In some cases, cells were cultivated in the presence of naloxone for 1 hour

before adding other agonists.

For TRPV1, we used agonist capsaicin at a concentration of 0.5 µM or 1 µM and

antagonist capsazepine at a concentration 10 times higher (5 µM or 10 µM). Cells were

treated with these ligands for the same time periods as in the case of MOR ligands.

5.3.2 Cholesterol depletion and replenishment

Cholesterol was depleted from membranes using 10 mM β-cyclodextrin in serum-free

DMEM for 30 min at 37°C (Ostasov et al. 2007). Before the beginning of the experiments,

βCDX/DMEM was replaced by serum-free DMEM. Replenishment of cholesterol was

40

carried out by adding water-soluble cholesterol in serum-free DMEM at the final

concentration of 0.25mM for 2 hours at 37°C.

5.3.3 Pertussis toxin

Treatment of cells by pertussis toxin to achieve the discontinuance of Gαi protein

signaling was carried out as follows: cells were incubated with pertussis toxin in DMEM at

a final concentration 25ng/ml for 24 hours before the start of the experiments.

5.4 Creating stable cell line expressing YFP-tagged MOR

5.4.1 Transfection

Cells were plated in 24 wells plate in DMEM media and at a confluence of 50-60% were

transfected using Lipofectamine 2000 (Invitrogen) according to manufacturer’s instructions.

Cells were then roughly selected using G418 sulfate at the concentration of 800 µg/ml for

three weeks.

5.4.2 FACS Sorting

Cells were sorted using BD Influx TM cell sorter (BD Biosciences, Franklin Lakes, NJ,

USA). Cells were gated on scatter and pulse width to identify and sort single cells. After a

few weeks of culture, we identified 17 cell clones. We used several methods (RT-PCR,

MOR-binding assay, microscopic analysis) to identify the best clone for the subsequent

experiments.

5.5 Radioligand binding assay

5.5.1 MOR binding assay

To determine the expression levels of MOR, a fraction of crude membranes of HMY-1

cells and rat cerebral cortex were used to perform a single-point radioligand binding assay

with the [3H]DAMGO. Crude membranes (100 µg) in 0.5 ml of buffer B (50 mM Tris-HCL,

41

1mM MgCl2, pH 7.4) were incubated with 3 nM [3H]DAMGO at 25°C for 120 min.

Naloxone (10 µM) was used to determine non-specific binding. After incubation, reactions

were filtrated on a Brandel cell harvester through Whatman GF/C filters presoaked with 0.3

% polyethyleneimine. The radioactivity trapped was determined by liquid scintillation

spectrometry using Tri-carb 2910TR counter (Perkin Elmer).

5.5.2 TRPV1 binding assay

To determine the binding ability of Naloxone to TRPV1, we performed a single-point

radioligand binding assay with [3H] Naloxone. HEK293 cells were seeded in 12 well plate

and in 24 hours transfected with a plasmid containing TRPV1-CFP construct. Both

transfected and untransfected cells as control were incubated in serum-free DMEM medium

in the presence of 100 nM [3H] Naloxone for 60 min at 37°C. Naloxone (100 µM) was used

to define non-specific binding. Cells were detached by pipetting and immediately filtrated

on a Brandel cell harvester through Whatman GF/C filter presoaked with 0.3 %

polyethyleneimine and then washed three times with 3 ml of ice-cold buffer B (50mM Tris-

HCl and 1 mM MgCl2; pH 7.4). The radioactivity trapped was determined by liquid

scintillation spectrometry using Tri-Carb 2910TR counter (Perkin Elmer, Waltham, MA,

USA).

5.6 RT-PCR

5.6.1 Isolation of RNA

Cells were grown in 6 well plates and harvested using RNAzolRRT (MRC). Culture

media was removed, and 1 ml of RNAzolRRT was added to lyse the cells. The lysate was

roughly mixed with 400 µl of H2O and incubated for 10 min at room temperature. The

centrifugation for removing the rest of lysed cells and debris was performed at room

temperature for 2 min at 12 000g. The supernatant (1 ml) was transferred into the new tube

and mixed with 1 ml of isopropanol. The mixture was incubated at room temperature for 10

min. Then, it was centrifuged at 12 000 g for 10 min. The resulting pellet was resuspended

in 500 µl of 75% ethanol and centrifuged at 8000 g for 3 min. The ethanol cleanup was

repeated two times. The resting pellet was resuspended in 30 µl of H2O and heated for 10

42

min at 55-60°C. The purity and integrity of the RNA preparations were checked by the

spectroscopy and agarose gel electrophoresis.

5.6.2 Reverse transcription (RT)

Reverse transcription was performed using a High capacity RNA-to-cDNA kit (Applied

Biosystems) according to the manufacturer’s instructions. Briefly, 2 µg of RNA was mixed

with 10 µl of 2x RT Buffer and 1 µl of 20x Enzyme mix. The final volume of the reaction

was adjusted to 20 µl with H2O. The reaction was incubated at 37°C for 60 minutes and then

heated to 95°C for 5 min to stop the reaction. In the end, the resulting cDNA was chilled to

4°C and used in real-time PCR.

5.6.3 Real-time PCR

Real-time PCR was performed as follows. Samples of cDNA were amplified using

TaqMan Gene Expression Assay (Invitrogen) containing a specific probe for detection MOR

(Invitrogen) according to the manufacturer’s instructions. PCR was performed on a

LightCycler® 480 Instrument (Roche Ltd.). The temperature profile: initial denaturation at

95 °C for 15 min, followed by 50 cycles consisting of denaturation at 95 °C for 18 sec and

amplification at 60 °C for 1 min. Non-template and non-RT reactions were performed as

controls. Standard curves were generated for a specific probe using a threefold serial dilution

of cDNA. The efficiency of the PCR amplification for the probe was then calculated from

the standard curve to state precisely the relative expression.

5.7 Transient transfection

Cells were plated in the appropriate format in DMEM media and after 24 hours (at a

confluence approximately 60-70%) were transfected using Lipofectamine 3000 (Invitrogen)

according to manufacturer’s instructions. Briefly, Lipofectamine 3000 diluted in Opti-MEM

medium was mixed with DNA diluted in Opti-MEM medium and P3000 Reagent. The final

mixture was incubated for 15 min at room temperature and then added directly to the cell

culture. After 24 hours of incubation, cells were used for the next experiments.

43

5.8 Total internal reflection (TIRF)

Cells were plated on a 35 mm glass-bottom dish in phenol red-free DMEM

supplemented with 10% FBS, and 1% AAS. After 24 h, cells were transfected as written

above with TRPV1-CFP construct, and after 24 h, cells were visualized using Zeiss Elyra

SP.1 nanoscope equipped with TIRF technology.

5.9 Fluorescent recovery after photobleaching (FRAP)

HMY-1 cells were seeded on glass-bottom dishes and maintained in phenol red-free

DMEM supplemented with 10 % FBS, 1 % AAS, and 0.8 mg/ml geneticin. Photobleaching

experiments on living cells were performed on an inverted Zeiss LSM 880 confocal laser

scanning microscope (Carl Zeiss AG) equipped with 40×/1.2 WDICIII C Apochromat

objective lens and a back-thinned CCD camera (Zeiss Axio Cam). For the excitation of

fluorophores, we used the 514-nm laser for visualizing YFP (yellow fluorescent protein) and

405-nm laser for visualizing CFP (cyan fluorescent protein). Images were acquired using

Zen Black software (Carl Zeiss AG). During all FRAP experiments, the cells were placed in

a chamber for live-cell visualization with a temperature of 37 °C and 5 % CO2. All the

diffusion data was always assessed by measurements in plasma membrane areas adjacent to

the glass support. Bleaching was accomplished with a circular spot using the 488- and 514-

nm for YFP and 458- and 488-nm for CFP laser pulse from a 40-mW Argon laser operating

at 100 % power. The radius of the circular bleaching area was 2 μm. Six iterations were used

for each bleach pulse. Subsequent fluorescence recovery was monitored at low laser intensity

(2 % of a 40-mW laser) and 512 × 512 pixel resolution with a sampling rate of 2 ms. As a

rule, 15 pre bleach images were collected and, immediately after photobleaching, 400

successive post bleach images were recorded to monitor the fluorescence redistribution.

Background noise and total fluorescence in the area of interest were also observed during

the time course and used for normalization. The data were analyzed using easyFRAP, a

MATLAB platform-based tool (Rapsomaniki et al. 2012). FRAP curve was fitted with a

two-phase association non-linear function using the least square fit.

44

In each FRAP experiment, at least 50 cells were screened in 3 individual runs. The

obtained data were averaged to generate a single FRAP curve. Recovery curves were

calculated according to the following equation:

recovery (%) = (I bleach − I bckg)/(I ref − I bckg) × 100,

where I bleach is the fluorescence intensity of the bleached spot, I bckg is the fluorescence

intensity of the background, and I ref is the fluorescence intensity of the control regions in

other cells or regions far remote from the target cell. The values of the apparent diffusion

coefficients (D) for both receptors were obtained from the following equation:

D = 0.224 ω2/t1/2,

where ω is the diameter of the selected bleached spot, and t ½ is the half-life of the

fluorescence recovery (Soumpasis 1983).

The potential effects of agonists on the lateral mobility of MOR-YFP or TRPC1-CFP

were investigated using DAMGO, morphine, endomorphin-2, and capsaicin.

5.10 Plasma membrane isolation

Fifteen 80cm2 flasks were harvested for one sample as follows. Cells were detached

from the flasks by scraping and harvested using centrifugation at 1800 rpm for 10 min at

4°C. The pellet was washed by PBS and then homogenized in TMES (50 mM Tris-HCL, 3

mM MgCl2, 1 mM EDTA, 250 mM sucrose, pH 7.5) buffer enriched with complete protease

inhibitor cocktail (Roche Diagnostics) in Teflon-glass homogenizer for 5 min at 1800RPM

on ice. Centrifugation of the homogenate to remove the non-homogenized cells and nuclear

fraction was performed for 1000 g, 3 min at 4°C. The resulted post-nuclear supernatant

(PNS) was used for isolation of plasma membrane enriched fraction on the PercollR density

gradient. PNS was applied to the top of 30 % w/v PercollR in TMES buffer in 26 ml thick-

wall polycarbonate tubes and centrifugated in rotor Beckman Ti50 for 20 min at 27 000 RPM

at 4°C. After centrifugation, 2 visible layers were formed. The upper layer, which is enriched

in the plasma membrane, was diluted 1:4 in TE buffer (50 mM Tris-HCl, pH 7.4, 1mM

EDTA) and centrifuged in rotor Beckman Ti50 for 90 min, at 50 000 RPM. Membrane

sediment was collected from the top of a stiff PercollR pellet, homogenized in a small volume

45

of TME buffer (150 mM NaCl, 20 mM Tris–HCl, 3 mM MgCl2, 1 mM EDTA, pH 7.4),

snap-frozen in liquid nitrogen and stored at −80 °C.

5.11 Endpoint calcium assay

HEK293 cells were plated in 384 well plates (8000 cells per well). After 24 h the cells

were transfected with TRPV1-CFP plasmid as written above. After 24 hours, cells were

ready for the assay. We used Cell MeterTM no wash and probenecid-free endpoint calcium

assay kit (AAT Bioquest). Fluo-8ETM AM dye solution was prepared according to the

manufacturer’s instructions and mixed with a 1x assay buffer. Then 25 µl per well of the

mixture was added to the plate and incubated for 45 min in a cell incubator. After the

incubation, agonist resuspended in HHBS buffer was added, and the calcium flux assay was

run immediately by monitoring the fluorescence intensity at Ex/Em=490/525 nm with

bottom read mode on a microplate reader.

5.12 Statistics

Data are presented as mean values ± standard error of the mean (S.E.M.) of at least three

independent experiments. Statistical analysis was performed using GraphPad Prism (version

6.0). Statistical significance of differences between the means of relevant groups was

assessed either by student T-test or by one-way ANOVA with the Bonferroni test.

Corresponding p values were *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001, ****p ≤ 0.0001.

46

6. Results

6.1 Characterization of HMY-1 Cell line

Using the FACS (fluorescence-activated cell sorting) sorter procedure, we obtained 17

monoclonal cell lines expressing the human µ opioid receptor tagged on its C terminus with

YFP. We used multiple methods to choose the right one for our next experiments. After

consideration of growth speed and cellular shape, we chose six cell lines for the following

procedures.

6.1.1 Real-time RT PCR

We decided to measure the amount of mRNA of MOR in the obtained cell lines. Using a

real-time RT PCR method with a specific probe against MOR, we screened all selected cell

lines (Fig. 8). The results showed a relatively high expression of µ-opioid receptor. As a positive

control, we used SH-SY5Y cells, the human neuroblastoma cell line naturally expressing the

low amount of MOR. As a negative control, we used the PC-12 cell line which does not express

any MOR.

Fig. 8. Real-time PCR graph showing amplification curves of transfected cells, positive

control SH-SY5Y cells naturally expressing µ-opioid receptor and PC-12 cells as a negative

control. For subsequent experiments, we chose only one transfected cell line – HMY-1.

PC-12 SH-SY5Y Transfected cells

47

For the subsequent experiments, we chose the cell line that expressed the least amount of

MOR among all the other tested cell lines. This line was denoted HMY-1.

6.1.2 MOR binding assay

We used the HMY-1 cell line to check the binding capacity of [3H]DAMGO to MOR and

to examine the expression level of MOR-YFP in this cell line. As a control, we used SH-SY5Y

cells that express MOR endogenously and a sample of the rat brain cortex (Fig. 9). Radioligand

binding was measured using a single-point saturation analysis, which may provide a reasonable

estimate of receptor density. Cell membranes prepared from HMY-1 cells and rat cerebral

cortex bound about 100 and 50 fmol [3H]DAMGO/mg protein, respectively.

co

r tex

HM

Y-1

SH

-SY

5Y

0

5 0

1 0 0

1 5 0

Sp

ec

ific

[3

H]D

AM

GO

bin

din

g

(fm

ol.

mg

-1 p

ro

tein

)

*** ***

Fig. 9. The expression levels of µ-opioid receptors in crude membranes of the rat brain

cortex, HMY-1 cells, and SH-SY5Y cells naturally expressing MOR were assessed using

[3H]DAMGO single point binding analysis. Results are expressed as means ± S.E.M. (***p <

0.001 versus the HMY-1 cell line).

6.1.3 Confocal fluorescence microscopy visualization

The expression and localization of MOR-YFP in HMY-1 cells were visualized by confocal

fluorescence microscopy. Localization of the fluorescence signal corresponding to MOR-YFP

48

suggested that the receptor is appropriately folded and targeted to the plasma membrane (Fig.

10).

Fig. 10. Characterization of the HMY-1 cell line by fluorescence microscopy. HEK293 cells

stably expressing YFP (yellow fluorescent protein)-tagged MOR (i.e., HMY-1 cells) were

inspected using Zeiss LSM 880 confocal microscope. The confocal fluorescence image shows

the cellular distribution of MOR on the plasma membrane.

Moreover, the treatment of HMY-1 cells with the MOR agonist DAMGO or endomorphin-

2 led to the internalization of MOR-YFP, which was reflected by a considerable loss of yellow

fluorescence from the cell surface and its appearance in the cell interior after a few minutes

(Fig. 11).

49

Fig. 11. DAMGO and endomorphin-2 induced internalization of MOR. HMY-1 cells were

treated with either 1 µM DAMGO or 1 µM endomorphin-2 for 5 min (A) or 20 min (B) and

then inspected using Zeiss LSM 880 confocal microscope.

Contrarily, the addition of morphine did not cause such a noticeable internalization of the

receptor (data not shown). Agonist-induced subcellular redistribution of MOR-YFP was

prevented by pretreatment of the cells with the MOR antagonist naloxone.

A

5 min

B

20 min

DAMGO endomorphin-2

50

6.2 Measurement of lateral mobility of MOR in the plasma

membrane of HMY-1 cells

6.2.1 Modulation of the mobility of MOR by different biased agonists

We used a high-resolution FRAP method for measuring the mobility of MOR in the plasma

membrane of HMY-1 cells in the basal state and after the addition of specific agonists DAMGO,

morphine, endomorphin-2, and antagonist naloxone. Representative images of basal membrane

photobleaching and recovery are shown in Fig. 12A. The representative recovery curves are

shown in Fig. 12B.

A

51

0 1 0 2 0 3 0

0 .0

0 .5

1 .0

t [s ]

No

rm

ali

ze

d f

luo

re

sc

en

ce

in

ten

sit

y

C o n tro l

D A M G O

M o rp h in e

E n d -2

b le a c h

Fig. 12. Fluorescence recovery after photobleaching of MOR-YFP in the HMY-1 cell line.

A. Photographs of bleaching spot with 2 µm radius at the bottom plasma membrane of HMY-1

cells at different time intervals after the addition of MOR. B Examples of normalized recovery

curves of MOR in control cells and after treatment with DAMGO, morphine or endomorphin-

2 (at 1 µM concentration).

B

52

Co

ntr

ol

DA

MG

O

Mo

rph

ine

En

d-2

Nalo

xo

ne

0 .0

0 .2

0 .4

0 .6

0 .8

D [

m2

/s]

***

***

Fig. 13. Effect of various biased agonists on the lateral mobility of MOR-YFP in HMY-1

cells. FRAP measurements of MOR-YFP movement in the cells that were incubated without

(Control) or with DAMGO (1 μM), morphine (1 μM), endomorphin-2 (1 μM), or naloxone (10

μM). Apparent diffusion coefficients (D) were calculated from confocal FRAP data obtained

using a circular bleach region with a 2-μm radius. The data were collected from at least 60

cells from at least three independent experiments. Results are expressed as means ± S.E.M.

(***p < 0.001 versus control).

More specifically, we observed that the movement of the receptors increased by

approximately one half in the presence of DAMGO (D = 0.58 ± 0.03 μm2/s) and decreased by

38 % in the presence of endomorphin-2 (D = 0.24 ± 0.03 μm2/s), compared to control

(D = 0.39 ± 0.02 μm2/s). Morphine did not significantly increased the value of the diffusion

coefficient (D = 0.45 ± 0.03 μm2/s). The MOR antagonist naloxone alone also did not affect the

MOR-YFP diffusion coefficient (D = 0.43 ± 0.03 μm2/s), and the presence of this compound in

the culture medium compromised the ability of MOR agonists to induce changes in the receptor

mobility (Fig. 14).

53

Co

ntr

ol

Nalo

xo

ne+D

AM

GO

Nalo

xo

ne+M

orp

hin

e

Nalo

xo

ne+E

nd

-2

0 .0

0 .2

0 .4

0 .6

0 .8

D [

m2

/s]

Fig. 14. Pretreatment with naloxone blocks the effect of various biased agonists on the

lateral mobility of MOR-YFP movement in HMY-1 cells. FRAP measurements were performed

on cells pretreated with naloxone for 60 minutes before incubation without (Control) or with

DAMGO (1 μM), morphine (1 μM), or endomorphin-2 (1 μM). Apparent diffusion coefficients

(D) were calculated from confocal FRAP data obtained using a circular bleach region with a

2-μm radius. The data were collected from at least 60 cells from at least three independent

experiments.

6.2.2 Impact of cholesterol depletion on the ability of MOR agonists to alter

MOR-YFP mobility

To lower cholesterol in the plasma membranes of HMY-1 cells, we incubated the cells with

10 mM β-cyclodextrin (30 min at 37°C). This treatment removed about 60 % of cholesterol

from HMY-1 plasma membranes (the average cholesterol level fell from 203.6 to 79.7 nmol/mg

protein). Immediately after cholesterol depletion, cells were used for FRAP measurements.

Neither the mobile fraction (Mf = 82.0 ± 2.5 %) nor the apparent diffusion coefficient (D = 0.40

± 0.02 μm2/s) of MOR-YFP were changed by cholesterol depletion, compared to control cells.

However, cholesterol depletion affected the ability of different MOR agonists to alter MOR-

YFP mobility in a unique manner (Fig. 15). Whereas cholesterol depletion significantly reduced

the ability of DAMGO to increase MOR-YFP mobility (D = 0.48 ± 0.03 μm2/s) and completely

54

blocked the negative effect of endomorphin-2 (D = 0.39 ± 0.03 μm2/s), the ability of morphine

to increase receptor mobility was markedly enhanced (D = 0.66 ± 0.03 μm2/s). The null effect

of naloxone on the lateral mobility of MOR-YFP was not changed by cholesterol depletion (D

= 0.43 ± 0.03 μm2/s). In the next set of experiments, cells depleted of cholesterol were

subsequently treated with water-soluble cholesterol to replenish the cholesterol levels in the

plasma membrane.

Co

ntr

ol

C

DX

DA

MG

O

C

DX

+D

AM

GO

Mo

rph

ine

C

DX

+M

orp

hin

e

En

d-2

C

DX

+E

nd

-2

Nalo

xo

ne

C

DX

+N

alo

xo

ne

0 .0

0 .2

0 .4

0 .6

0 .8

D [

m2

/s]

# # #

# # #

#

***

***

Fig. 15. Effect of cholesterol depletion on the lateral mobility of MOR-YFP in HMY-1 cells

upon activation by different MOR ligands. Cells were treated with the cholesterol-depleting

agent β-cyclodextrin (βCDX, 10 mM) for 30 min before FRAP experiments. FRAP

measurements were performed on untreated or βCDX-pretreated cells that were incubated

without (Control) or with DAMGO (1 μM), morphine (1 μM), endomorphin-2 (1 μM), or

naloxone (10 μM). Apparent diffusion coefficients (D) were calculated from confocal FRAP

data obtained using a circular bleach region with a 2-μm radius. The data were collected from

at least 60 cells from at least 3 independent experiments. Results are expressed as means ±

S.E.M. (***p < 0.001 versus control; #p < 0.05; ###p < 0.001 versus relevant agonist).

55

The replenishment of cholesterol in HMY-1 cells blocked the effect of morphine in

cholesterol-depleted cells and returned the lateral mobility of MOR-YFP to the control (naïve)

state (D = 0.43 ± 0.03 μm2/s) (Fig. 16). This indicates that the marked increase in MOR-YFP

mobility induced by morphine in cholesterol-depleted cells was a consequence of the altered

cholesterol content.

Co

ntr

ol

C

DX

+M

orp

hin

e

C

DX

+C

ho

l+M

orp

hin

e

C

DX

+N

alo

xo

ne+

Mo

rph

ine

0 .0

0 .2

0 .4

0 .6

0 .8

D [

m2

/s]

***

Fig. 16. Effect of naloxone or cholesterol replenishment on morphine-induced changes in

the lateral mobility of MOR-YFP in HMY-1 cells pretreated with β-cyclodextrin. FRAP

measurements were performed on cholesterol-depleted (βCDX pretreated) cells that were

incubated for 1 h with naloxone (10 μM) or for 2 h with 0.25 mM water-soluble cholesterol

(Chol) before the addition of morphine (1 μM). Apparent diffusion coefficients (D) were

calculated from confocal FRAP data obtained using a circular bleach region with a 2-μm

radius. The data were collected from at least 60 cells from at least three independent

experiments. Results are expressed as means ± S.E.M. (***p < 0.001 versus control).

56

6.2.3 Compromising effect of pertussis toxin on the ability of MOR agonists

to alter MOR-YFP mobility

To assess the role of interaction of MOR-YFP with its cognate Gi/o proteins on agonist-

induced changes in receptor mobility, pertussis toxin (PTX) was used. HMY-1 cells were

pretreatment with PTX (25 ng/ml, 24 h) alone or in combination with βCDX before the FRAP

experiments. These manipulations did not affect the lateral mobility of MOR-YFP (Fig. 17A).

However, the ability of DAMGO to change receptor mobility was decreased by PTX treatment

(Fig. 17B). PTX also attenuated to some extent the ability of endomorphin-2 to reduce receptor

mobility (Fig. 17D), but this effect was weaker than in the case of DAMGO. In the case of

morphine, the situation was more complex (Fig. 17C). Interestingly, PTX did not significantly

change the morphine-induced increase in MOR-YFP mobility (D = 0.49 ± 0.03 μm2/s) but

compromised the enhancing effect of cholesterol depletion (D= 0.43 ± 0.04 μm2/s).

57

Co

ntr

ol

C

DX

PT

X

PT

X+

CD

X

0 .0

0 .2

0 .4

0 .6

0 .8

D [

m2

/s]

C o n tro lA

Co

ntr

ol

DA

MG

O

C

DX

+D

AM

GO

PT

X+D

AM

GO

PT

X+

CD

X+D

AM

GO

0 .0

0 .2

0 .4

0 .6

0 .8

D A M G O

D [

m2

/s]

# # #

***

#

B

Co

ntr

ol

Mo

rph

ine

C

DX

+M

orp

hin

e

PT

X+M

orp

hin

e

PT

X+

CD

X+M

orp

hin

e

0 .0

0 .2

0 .4

0 .6

0 .8

M o r p h in e

D [

m2

/s]

# # ## # #

**

C

Co

ntr

ol

En

do

-2

C

DX

+E

nd

-2

PT

X+E

nd

-2

PT

X+

CD

X+E

nd

-2

0 .0

0 .2

0 .4

0 .6

0 .8

D [

m2

/s]

***

**

E n d o m o rp h in -2

#

D

# #

Fig. 17. Effect of pertussis toxin on MOR agonist-induced changes in the lateral mobility

of MOR-YFP in HMY-1 cells. Cells were incubated for 24 h without or with pertussis toxin (25

ng/ml) before FRAP measurements. In some experiments, cholesterol was depleted by a 30-min

treatment of cells with β-cyclodextrin before the addition of DAMGO (1 μM), morphine (1 μM),

or endomorphin-2 (1 μM). The individual graphs show the effect of βCDX, PTX, and their

combination on the MOR-YFP movement in control cells (A) and the impact of pretreatment

with these agents on the ability of DAMGO (B), morphine (C), and End-2 (d) to change receptor

mobility. Apparent diffusion coefficients (D) were calculated from confocal FRAP data

obtained using a circular bleach region with a 2-μm radius. The data were collected from at

least 60 cells from at least three independent experiments. Results are expressed as means ±

58

S.E.M. (*p < 0.05; **p < 0.01; ***p < 0.001 versus control; #p < 0.05; ##p < 0.01; ###p <

0.001 versus relevant column).

6.3 Expression of TRPV1-CFP in HEK293 cells

We used HEK293 cells transiently transfected with the pcDNA3.1-TRPV1-CFP construct

as our experimental model. Twenty-four hours after transfection, cells were visualized using

two different microscopic techniques. Plasma membrane localization of TRPV1-CFP was

visualized by confocal fluorescence microscopy (Fig. 18A) and total internal reflection

fluorescence (TIRF) microscopy of the bottom plasma membrane (Fig. 18B). These

investigations confirmed that TRPV1-CFP was predominantly localized to the plasma

membrane.

Fig. 18. TRPV1-CFP expression in HEK293 cells. A. Confocal fluorescence image is

showing the cellular distribution of TRPV1-CFP. B. TIRF image of the bottom membrane of

HEK293 cell expressing TRPV1-CFP.

A B

10 µm 10 µm

59

6.4 Effect of different ligands of the lateral mobility of TRPV1

To assess the possible effect of different ligands on TRPV1, we proceeded to conduct

measurements of the mobility of TRPV1-CFP in the plasma membrane after adding naloxone,

capsaicin, and DAMGO (Fig. 19). Capsaicin, a potent agonist of TRPV1, changed the lateral

mobility of TRPV1-CFP in the plasma membrane of HMY-1 cells. We found a threefold

increase of the apparent diffusion coefficient compared to control untreated cells. After adding

naloxone, we could also see an increase of the apparent diffusion coefficient of TRPV-CFP but

it was changed to a lesser extent than in the presence of capsaicin. The movement of TRPV1-

CFP was two times faster after adding naloxone, compared to control cells. The MOR agonist

DAMGO and antagonist levallorphan did not affect the lateral mobility of TRPV1-CFP. The

mobile fraction of TRPV1 was significantly lowered after the treatment of cells with capsaicin

but not after the addition of DAMGO or levallorphan. Naloxone affected the mobile fraction of

TRPV1 only slightly with a tendency to decrease the proportion of mobile receptors. TRPV1

antagonist capsazepine did not affect the mobility of TRPV1, and it blocked the effects of both

capsaicin and naloxone.

60

0 5 1 0 1 5

0 .0

0 .5

1 .0

1 .5

t [s ]

No

rma

liz

ed

flu

ore

sc

en

ce

in

ten

sit

y

C a p s a ic in

b le a c h

N a loxone

D A M G O

A

Co

ntr

ol

Cap

saic

in

DA

MG

O

Nalo

xo

ne

Levallo

rph

an

CP

Z

CP

Z-c

ap

saic

in

CP

Z-n

alo

xo

ne

0 .0

0 .2

0 .4

0 .6

0 .8

Mo

bil

e f

ra

cti

on

*

B

Co

ntr

ol

Cap

saic

in

DA

MG

O

Nalo

xo

ne

Levallo

rph

an

CP

Z

CP

Z-c

ap

saic

in

CP

Z-n

alo

xo

ne

0 .0

0 .5

1 .0

1 .5

2 .0

D [

m2

/s]

***

****

C

Fig. 19. Effect of different ligands on lateral mobility of TRPV1-CFP in HMY-1 cells. FRAP

experiments were performed on cells incubated without (control) or with naloxone (10 µM),

capsaicin (0.5 µM) or DAMGO (1 µM). Examples of normalized recovery curves (first 15

seconds) (A), apparent diffusion coefficients (D) (B) and mobile fraction (C) for HMY-1 cells

treated with selected agonists are shown. The data were calculated from confocal FRAP data

obtained using a circular bleach region with a 2-µm radius from a bottom cell membrane

attached to the glass support. Results are expressed as means ± S.E.M. (**p≤ 0.01;

***p ≤ 0.001; ****p ≤ 0.0001 versus control).

61

6.5 Changes in intracellular calcium levels after treatment of HEK293

cells with different ligands

Capsaicin is known to mediate calcium influx in the cell via TRPV1. Here, we observed an

increase in intracellular calcium after treatment with capsaicin of HEK293 cells transiently

transfected with TRPV1. In the case of naloxone, we could also see a rise in intracellular

calcium. However, naloxone was less effective than capsaicin at the same concentration. After

adding capsaicin, we observed a 100 times increase and after adding naloxone a 30 times

increase. Both the MOR agonist DAMGO and antagonist levallorphan had no effect on

intracellular calcium when compared to the control untreated cells (Fig. 20).

0 .0 1 0 .1 1 1 0

0

5 0

1 0 0

C o n c e n tra t io n o f l ig a n d ( M )

% o

f m

ax

imu

m r

es

po

ns

e

H E K 2 9 3 + c a p s a ic in

H E K 2 9 3 /T R P V 1 + c a p s a ic in

H E K 2 9 3 /T R P V 1 + n a lo x o n e

**** ****

*** ***

H E K 2 9 3 /T R P V 1 + le v a llo rp h a n

H E K 2 9 3 /T R P V 1 + D A M G O

H E K 2 9 3 /T R P V 1 + c a p s a z e p in e

Fig. 20. Effect of different ligands on intracellular calcium levels in HEK293 cells

transiently transfected with TRPV1-CFP. Control and transfected cells were treated with

capsaicin, capsazepine, naloxone levallorphan, and DAMGO. For measuring the calcium

influx, we used the Cell MeterTM Endpoint Calcium Assay Kit (AAT Bioquest). Data were

obtained from three independent experiments and are expressed as means ± S.E.M.

(***p ≤ 0.001; ****p ≤ 0.0001 versus control).

62

6.6 Naloxone binding to TRPV1

To assess the binding of naloxone to TRPV1, we used radioligand binding assay with

[3H]naloxone. Radioligand binding was measured using a single-point saturation analysis. We

found a 1.5 fold increase in [3H]naloxone binding to the cells transiently transfected with

TRPV1 when compared to the untransfected cells (Fig. 21). The DOR agonist DADLE ([D-

Ala2, D-Leu5]-enkephalin) was used to block the binding of [3H]naloxone to DOR, which are

endogenously expressed in HEK293 cells.

- D

CP

Z

CP

Z +

D-

D

CP

Z

CP

Z +

D

0

5 0 0 0

1 0 0 0 0

1 5 0 0 0

Sp

ec

ific

bin

din

g o

f [3

H]-

na

lox

on

e

[nu

mb

er o

f b

ind

ing

sit

es

/ce

ll]

**

*** ***

##

H E K 2 9 3 H E K 2 9 3 /T R P V 1

§§§

Fig. 21. To determine the binding ability of naloxone to TRPV1, we used a single-point

radioligand binding assay with [3H]-naloxone (100 nM) in HEK293 cells (control) and

HEK293 cells transfected with TRPV1-CFP (HEK293/TRPV1). Data are means ± S.E.M. from

three independent experiments performed in triplicates (**p ≤ 0.01, ***p ≤ 0.001 vs. control

HEK293 cells; ××p ≤ 0.01 vs. untreated HEK293/TRPV1 cells; ##p ≤ 0.001 vs. CPZ; §§§p ≤

0.001 vs. D)

63

6.7 Coexpression of MOR-YFP and TRPV1-CFP in HMY-1 cells

For these experiments, we transiently transfected with TRPV1-CFP construct the HMY-1

cell line expressing MOR-YFP. In figure 22, there is a TIRF image of the bottom membrane

showing the distribution of TRPV1 (Fig. 22A) and MOR (Fig. 22B). These observations

indicated a massive plasma membrane localization of both TRPV1-CFP and MOR-YFP.

Fig. 22. The expression of TRPV1 and MOR in HMY-1 cells. A. Image of TRPV1-CFP

localization at the bottom membrane of HMY-1 cells transiently transfected with TRPV1-CFP

construct. B. Image of MOR-YFP localization at the bottom membrane of HMY-1 transiently

transfected with TRPV1-CFP construct. Both these photographs were taken using the TIRF

mode of Superresolution microscope Zeiss Elyra.

64

6.8 Activation of TRPV1 changes the lateral mobility of MOR and the

ratio between mobile and immobile MOR in the plasma

membrane

In this set of experiments, we focused on measuring the diffusion coefficients of MOR.

Cells were seeded in the glass-bottom chamber, transiently transfected with TRPV1-CFP

construct, and after 24 hours, different ligands were added 5 minutes before measurements. In

the case of all MOR agonists, we observed similar changes in receptor mobility as for HMY-1

cells without TRPV1-CFP. In the case of the TRPV1 agonist capsaicin we found a more than

twofold increase in the diffusion coefficient of MOR (control, D = 0.358 ± 0.036 μm2/s;

capsaicin, D = 0.978 ± 0.077 μm2/s) (Fig. 23A). Cells treated with antagonists of both these

receptors before adding the agonists were used as controls. In the case of pretreatment of the

cells with naloxone or capsazepine before adding endomorphin-2 or capsaicin, the effects of

both agonists were completely blocked.

Next, we measured the amount of mobile and immobile receptors in the plasma membrane

after the activation with agonists of both MOR and TRPV1. The mobile fraction of MOR was

significantly decreased after the treatment of HMY-1/TRPV1 cells with capsaicin. This effect

was blocked by preincubation of cells with the TRPV1 antagonist capsazepine. Both DAMGO

and endomorphin-2 increased the mobile fraction of MOR, but the effect of DAMGO was

weaker. The pretreatment of cells with receptor antagonists before adding the agonists blocked

the effects of both agonists (Fig. 23B).

65

Fig. 23. Changes of properties of MOR in the plasma membrane of HMY-1 cells transiently

transfected with TRPV1-CFP. A. The diffusion coefficients of MOR in HMY-1/TRPV1 cells B.

Mobile fractions of MOR (the ratio between mobile and immobile receptors) in the plasma

membrane of HMY-1-TRPV1. The cells were seeded in a glass-bottom chamber in DMEM

without phenol red and treated with the MOR agonist endomorphin-2 (1 µM), the TRPV1

agonist capsaicin (0.5 µM) for 5 min, and antagonists of both receptors naloxone and

capsazepine (both at 10 µM concentration) for 10 min before adding agonists. The

measurements were performed at a membrane attached on glass support on a confocal

microscope Zeiss LSM880. The data were collected from 50 cells from 3 independent

experiments. Results are expressed as means ± S.E.M. (*p ˂ 0.05; **p ˂ 0.01; ***p ˂ 0.001

versus control).

Ctr

l

Cap

saic

in

Mo

rph

ine

DA

MG

O

En

d-2

Nal + E

nd

-2

Cp

z +

Cap

saic

in

0 .0

0 .5

1 .0

1 .5

D [

m2

/s]

***

***

**

A

Ctr

l

Cap

saic

in

Mo

rph

ine

DA

MG

O

En

d-2

Nal + E

nd

-2

Cp

z +

Cap

saic

in

0 .0

0 .5

1 .0

Mo

bil

e F

ra

cti

on

**

**

B

*

66

6.9 Activation of MOR changes the lateral mobility of TRPV1 and the

ratio between mobile and immobile TRPV1 in the plasma

membrane

The diffusion of inactive TRPV1 was higher than the diffusion of inactive MOR in cells

expressing both of these receptors. After activation of TRPV1 with capsaicin, the diffusion

coefficient of this receptor changed more than two times (control, D = 0.73 ± 0.09 μm2/s;

capsaicin, D = 1.59 ± 0.13 μm2/s) when compared to control cells only with vehicle. Moreover,

the activation of MOR by morphine changed the mobility of TRPV1 to the similar manner as

the TRPV1 agonist capsaicin. Endomorphin-2 also changed the diffusion coefficient of TRPV1

(D = 1.15 ± 0.12 μm2/s), but to a lower extent than capsaicin and morphine (Fig. 24A).

Pretreatment of the cells with antagonists of both these receptors blocked the changes induced

by the addition of receptor agonists.

The measurements of mobile fraction in the plasma membrane after the addition of the

agonists of both MOR and TRPV1 provided the following results. The mobile fraction of

TRPV1 was significantly decreased after the treatment of HMY-1/TRPV1 cells with capsaicin.

Endomorphin-2 also affected the mobile fraction of TRPV1; the proportion of mobile receptors

increased and the number of immobile receptors decreased. Preincubation of the cells with

capsazepine or naloxone before adding the agonists blocked the effect of both agonists (Fig.

24B).

67

Fig. 23. Changes of properties of TRPV1 in the plasma membrane of HMY-1 cells

transiently transfected with TRPV1-CFP. A. The diffusion coefficient of TRPV1 in HMY-1-

TRPV1. B. Mobile fractions of TRPV1 (the ratio between mobile and immobile receptors) in

the plasma membrane of HMY-1-TRPV1. The cells were seeded in a glass-bottom chamber in

DMEM without phenol red and treated with the MOR agonist endomorphin-2 (1 µM), the

TRPV1 agonist capsaicin (0.5 µM), and antagonists of both receptors naloxone and

capsazepine (both at 10 µM concentration) for 10 min before adding agonists. The

measurements were performed at a membrane attached on glass support on a confocal

microscope Zeiss LSM880. The data were collected from 50 cells from 3 independent

experiments. Results are expressed as means ± S.E.M. (*p ˂ 0.05; ***p ˂ 0.001 versus control).

Ctr

l

Cap

saic

in

Mo

rph

ine

DA

MG

O

En

d-2

Cp

z +

Cap

saic

in

Nal + E

nd

-2

0 .0

0 .5

1 .0

1 .5

2 .0

D [

m2

/s]

*** ***

*

A

Ctr

l

Cap

saic

in

Mo

rph

ine

DA

MG

O

En

d-2

Cp

z +

Cap

saic

in

Nal + E

nd

-2

0 .0

0 .5

1 .0

Mo

bil

e F

ra

cti

on

***

*

B

68

7. Discussion

7.1 MOR

For this study, we prepared the HMY-1 cell line (HEK293 cells stably expressing MOR

tagged with yellow fluorescent protein on its intracellular C-terminal end). It is known that the

attachment of fluorescent proteins to a receptor may change its properties. Many studies have

shown the proper expression of fluorescently tagged GPCRs on their C-terminus and verified

their full functionality (Böhme and Beck-Sickinger 2009). We performed structural and

functional studies to confirm that our YFP-tagged MOR is localized to the plasma membrane

and is fully functional. Moreover, we chose HMY-1 cells that express the least amount of MOR

out of all 17 different cell lines created. There is no doubt that the rate of the expression of

GPCRs may change their signaling properties (Böhme and Beck-Sickinger 2009). According

to the binding analysis with [3H]DAMGO, HMY-1 cells express roughly double number of

MOR than naturally occur in the rat brain cortex. Therefore, we believe that the HMY-1 cell

line is suitable for studying the physical and functional properties of MOR.

For studying the mobility and signaling properties of MOR, we chose three different MOR

agonists with distinct biased signaling profiles. Whereas DAMGO mostly stimulates G protein

dependent signaling, endomorphin-2 stimulates β-arrestin 2-dependent signaling and morphine

does not display any significant bias towards these two pathways (McPherson et al., 2010;

Rivero et al., 2012). However, since then, the opinion about the bias properties of our opioids

ligands slightly changed. It was shown that whereas DAMGO is G protein-biased ligand (using

[35S]-GTPγS binding), endomorphin-2 is cAMP-biased ligand (LaVigne et al. 2020). Anyway,

both these agonists have distinct signaling profiles (Conibear and Kelly 2019).

It is evident that the lateral mobility of MOR in the plasma membrane can be affected by

different factors. The mobility of GPCRs may vary upon the activation by different ligands.

The mobility of a receptor can also be affected by structural changes in the receptor after ligand

binding or by the interactions of the receptor with its effectors (Carayon et al. 2014). It may

also be influenced by the interactions with other membrane receptors (Carayon et al. 2014) or

by properties of membrane lipids and their compartmentalization (Sauliere-Nzeh et al. 2010,

Leitenberger, Reister-Gottfried and Seifert 2008).

69

Vukojevic and colleagues hypothesized that the enhanced MOR mobility observed in their

study after the stimulation with DAMGO suggests that processes other than pure random

diffusion are involved under such conditions. For example, MOR may undergo directed motion,

or its mobility may be accelerated through curvature coupling with plasma membrane lipids

and/or surface fluctuations of the plasma membrane (Vukojevic et al. 2008). Another possibility

is that MOR is in an inactive state bound to some membrane skeleton proteins or other proteins

inside the cell (cytoskeleton proteins, etc.). In this case, the diffusion coefficient determined by

FRAP is not altered after cholesterol depletion but is differently changed after activation of the

receptor by different biased agonists.

In our experiments, we could see changes in the lateral mobility of MOR-YFP after the

stimulation by both DAMGO and endomorphin-2; the latter agonists triggers rapid

internalization of MOR. Interestingly, the observed changes in receptor movement were

antagonistic. Whereas DAMGO increased the mobility of MOR, endomorphin-2 decreased it.

It is imaginable that different effects of DAMGO and endomorphin-2 reflect different signaling

bias of these two ligands. Morphine is known as a prototypical opioid receptor agonist. Our

experiments revealed that the activation of MOR by morphine has only a small impact on the

mobility of MOR and that the MOR antagonist naloxone does not change the receptor mobility

at all. To this date, there are only a couple of studies concerned with the diffusion of MOR in

the plasma membrane, but the results of these studies are partially discordant. The problem is

that there are differences between cells used for experiments or differences between staining of

MOR; MOR either tagged with fluorescent proteins or linked with some other tags that were

fluorescently stained after expression. There were also differences in the length of activation of

receptors before measurements and in the concentration of ligands. Therefore it is rather

difficult to compare the results of different studies. However, I would like to summarize the

most important points here. First of all, I would like to discuss the results with DAMGO as it is

the only ligand used in all relevant studies (Tab. 1).

There are differences in results, but overall, the consensus is that the mobility of MOR is

altered after activation by DAMGO. Vukojevic and colleagues found that the mobility of MOR

increased after treatment with DAMGO and they hypothesized that this was the consequence

of receptor endocytosis (Vukojevic et al. 2008).

70

Table 1. Different conditions used in studies investigating the effect of DAMGO

on the lateral mobility of MOR

Author Cell line MOR Method Time Ligand,

concentration Notes

Vukojevic et al. 2008

PC-12 MOR-GFP stable

transfection FCS 30 min DAMGO, 1 μM

apical membrane, endocytosis

Sauliere-Nzeh et al.

2010

SH-SY5Y

MOR-GFP stable transfection

FRAP 10 min DAMGO, 1 μM 14°C

Melkes et al. 2016

HEK293 MOR-YFP stable

transfection FRAP 10 min DAMGO, 1 μM

basal membrane

Gondin et al. 2019

HEK293 MOR-SNAP +

surface 488 dye FCS+FRAP

10 min + 20 min

DAMGO, 10 μM

stained only surface

receptors

Metz et al. 2019

AtT20 MOR-FLAG + antiFLAg Ab +

QDOTS SMT 10 min

DAMGO, 10 μM

labeling can reduce

mobility and alter

molecular interactions

Sauliere-Nzeh and colleagues found the stimulation of MOR by DAMGO resulted in a

decrease in domain size of MOR but there was no change in receptor diffusion. These authors

used SH-SY5Y cells that endogenously express MOR, which could affect the results. Besides

that, the experiments were performed at low temperature (14°C), which means that the mobility

of MOR was examined under the conditions of little internalization of the receptors (Sauliere-

Nzeh et al. 2010).

A study by Gondin et al. (2019) found that the mobility of MOR decreased after the

activation by DAMGO. The rate of MOR diffusion slowed down in a manner independent of

internalization but dependent on GRK2/3. However, these authors obtained these results using

FCS (fluorescence correlation spectroscopy) but not FRAP measurements. Because of the way

they stained MOR, they could detect only the receptors present on the cell surface at the moment

of staining. Therefore, the results could be influenced by the portion of the unstained receptors

(Gondin et al. 2019).

A more recent study demonstrated that the mobility of MOR can decrease after prolonged

DAMGO administration due to the increased receptor colocalization with clathrin. The authors

hypothesized that the results may be affected by the staining procedure as the labeling with

71

QDOTS can reduce the mobility and alter molecular interactions (Metz et al. 2019). The latter

two studies used high concentrations of DAMGO, which could also affect the results. In our

research, we observed a significant increase in the mobility of MOR. We assume that our results

reflect MOR movement in the plasma membrane shortly before receptor internalization.

As insinuated above, the differences between the results of our study and other studies can

be explained by different experimental conditions. Other investigators stained only cell surface

receptors using antibodies and used high concentrations of DAMGO and longer treatment

periods. Thus, different populations of MOR could be detected at the plasma membrane in these

circumstances. However, it will take a lot of work to prove or disprove this conception and to

find consensus. A particularly interesting avenue for future research would be to measure the

time curve of the mobility of activated MOR populations because internalization of MOR

elicited by DAMGO is a relatively rapid process which can change in the course of time and

depends on experimental conditions.

More consistent data have been obtained in the case of antagonists or morphine, a low-

internalizing opioid receptor agonist. Most authors did not observe any changes or little impact

of ligands on MOR mobility (Vukojevic et al. 2008, Sauliere-Nzeh et al. 2010, Gondin et al.

2019, Metz et al. 2019).

It was found that the changes of MOR conformation following agonist treatment may result

in lipid/protein hydrophobic mismatches that are possibly able to generate new membrane

compartments or to drive activated MOR towards existing microdomain zones (Gaibelet et al.

2008). This was confirmed by FRAP experiments revealing that MOR diffusion is restricted to

different submicrometer domains after agonist binding (Sauliere et al. 2006).

In the case of depletion of cholesterol, which is a method widely using for disruption of

membrane cholesterol enriched domains in studying GPCR (Qiu et al. 2011), we observed a

similar pattern between MOR internalizing ligands and morphine. Whereas cholesterol

depletion blocked the effects of DAMGO and endomorphin-2, it enhanced (approximately 1.5

times) the mobility of MOR after morphine. It was shown before that agonist-induced

redistribution of MOR to membrane domains depends on the cholesterol level (Gaibelet et al.

2008). It is not known the exact membrane compartmentalization and properties after the

depletion of cholesterol yet. Therefore, based on our data, we cannot assume whether MOR is

localized in or out of membrane microdomains. Anyway, it seems that the distribution of MOR

between different plasma membrane compartments is different after activation by different

72

agonists. It was shown that lowering cholesterol levels in the plasma membrane did not visibly

alter the distribution of a crosslinked or uncrosslinked glycosylphosphatidylinositol-anchored

folate receptor (Hao et al. 2001). We showed here that there is no difference between the

diffusion coefficient of MOR in control cells and the diffusion coefficient of MOR in cells after

cholesterol depletion (containing approximately 50% of cholesterol). It is not known whether

cholesterol is depleted from the whole membrane evenly or preferntially from cholesterol rich

microdomains and only then from the rest of the membrane or the other way round. The

formation of visible micrometer-scale domains was found to be triggered by lowering

cholesterol in the plasma membrane of several mammalian cell types (Hao et al. 2001).

In membrane preparations from cholesterol-depleted HMY-1 cells, DAMGO exhibited

increased efficacy and somewhat reduced potency to promote [35S]GTPγS binding, compared

to control cells. The ability of morphine and endomorphin-2 to stimulate [35S]GTPγS binding

was diminished and their efficacy was not changed (Melkes et al. 2016). The differentially

altered binding characteristics of individual agonists suggest that the plasma membrane

cholesterol content plays an essential role in defining the efficiency of MOR/Gi/o protein

coupling and that different ligands exhibit specific behaviors toward their typical receptors

under diverse conditions. We think that the discordant data regarding the impact of cholesterol

depletion on DAMGO-stimulated [35S]GTPγS binding can be at least partly attributed to

different models and experimental conditions. It is essential to mention here that Bmax values of

[3H]DAMGO binding in transfected cells used in the studies mentioned earlier were in the range

of 2–9 pmol/mg protein. This imply that MOR expression was at least ten times greater than

usual for neural tissues (about 50–200 fmol/mg protein) (Vigano et al. 2003; Chen and

Pan 2006). On the other hand, the expression level of MOR-YFP in HMY-1 cells corresponds

well to MOR expression in natural tissues. It is imaginable that the massive overexpression of

MOR in different cell lines used for characterization of these receptors can lead to divergent

outcomes.

Pretreatment of HMY-1 cells with PTX, which is known to inactivate Gi/o proteins and

thus block their interaction with cognate receptors, completely suppressed the ability of

DAMGO but not morphine to enhance the lateral mobility of MOR-YFP. After treatment with

pertussis toxin, we observed different effects of individual agonists on the diffusion coefficient

of MOR. Interestingly, Sauliere-Nzeh and coleagues did not find any significant impact of PTX

on DAMGO-induced changes in the mobility parameters of MOR in SH-SY5Y cells. Besides

that, they observed that the ability of morphine to increase the proportion of the mobile

73

receptors was reduced after PTX treatment (Sauliere-Nzeh et al. 2010). In agreement with these

authors, we did not see any effect of PTX on the receptor mobility in the basal (unstimulated)

state. However, these findings seem to contradict some data obtained for other GPCRs, where

PTX was able to increase receptor mobility already in the basal state (Kilander et al. 2014).

Consistent with our results, the latter study reported that the changes caused by DAMGO were

pertussis toxin sensitive (Gondin et al. 2019). These results correspond to previous findings that

the early events of signaling cascade, which is dependent on the association of various proteins

with receptors, strongly modulate the diffusion behavior of these constituents (Sauliere-Nzeh

et al. 2010). Our results indicate that the changes in MOR-YFP mobility induced by DAMGO

but not by morphine are strongly dependent on receptor interaction with Gi/o proteins. On the

other hand, the ability of endomorphin-2 to decrease the lateral mobility of MOR-YFP was only

slightly attenuated by PTX, which is indicative of a minor role of Gi/o proteins in regulation of

receptor mobility by this biased agonist.

In agreement with other studies, we believe that protein-protein interactions are the leading

cause of changes in the diffusion rate of MOR in plasma membranes (Destainville et al. 2008,

Sauliere-Nzeh et al. 2010). Our data indicate that signaling cascades may strongly affect the

mobility of MOR in the plasma membrane. Therefore, the next step would be to investigate the

composition of MOR signaling complexes after activation of the receptor by different agonists.

7.2 TRPV1

The next part of this thesis has been devoted to the signaling of TRPV1, another notable

player in the field of molecular mechanisms of pain. Here, we were interested in examining the

possible impact of selected opioid ligands on the movement of TRPV1 in the plasma membrane

and its function. Recent evidence suggests that there is functional communication between

MOR and TRPV1 receptors, which is reciprocal and highly dependent on specific conditions,

particularly on the mode and duration of activation of these receptors (Bao et al. 2015).

However, many issues regarding MOR-TRPV1 interactions, including cross-communication

between their signaling pathways and respective feedback loops, have not yet been fully

explored.

To date, there are not many studies dealing with the mobility of TRPV1. As mentioned

above, the mobility of receptors in the plasma membrane can be influenced by many different

factors. Receptor interactions with ligands, cytoskeletal proteins or other interacting partners

74

appear to be especially important. The membrane viscosity and thermal energy stored in the

plasma membrane are also essential as they are necessary for the flexibility of molecular

machinery to be as functional as we know it, e.g., from the orchestrated action of ion channels

during an action potential (Heine et al. 2016). It was shown before that the distribution of most

ion channels in the membrane is not spatially uniform: they undergo activity-driven changes in

the range of minutes to days. Even in the range of milliseconds, the composition and topology

of ion channels are not static but engage in highly dynamic processes, including a stochastic or

activity-dependent transient association of the pore-forming and auxiliary subunits, lateral

diffusion, as well as clustering of different channels (Heine et al. 2016).

It was reported previously that the mobility of TRPV1 immediately (seconds) after its

activation by capsaicin markedly decreased but only in the presence of extracellular Ca2+

(Senning and Gordon 2015). There are different populations of TRPV1 in the plasma membrane

dependent on receptor state of activity. Measurements of membrane time and spatial

organization of TRPV1 revealed specific binding of TRPV1 to the cytoskeletal proteins,

microtubules and caveolin-1 (Storti et al. 2012, Storti et al. 2015). It is known that there are

usually two or three different pools of membrane receptors that behave differently. For

example, there two major neurikinin-1 receptor populations were found described; one showing

high mobility and low lateral restriction and the other showing low mobility and high lateral

restriction (Veya et al. 2015).

Here, we aimed to determine what happens with TRPV1 within minutes after its activation

with capsaicin. We could see that besides the previously described large pool of immobile

fraction of TRPV1 (most likely the one with bound Ca2+) (Senning and Gordon 2015), there is

another fraction of the receptors that has not yet been described in the literature and that display

different behavior and diffuse very fast in the plasma membrane. It was shown before that

prolonged exposure of TRPV1 to agonists induces rapid receptor endocytosis and lysosomal

degradation in both sensory neurons and recombinant systems. Agonist-induced

receptor internalization followed clathrin- and dynamin-independent endocytic route. This

process was triggered by TRPV1 channel activation and Ca2+ influx through the receptor.

TRPV1 internalization appears to be strongly modulated by PKA-dependent phosphorylation

(Sanz-Salvador et al. 2012). Thus, we hypothesize that the fraction of TRPV1 observed in our

study is the one connected to internalization of the receptor.

Interestingly, we also observed similar changes in the mobility of TRPV1 after adding

naloxone, but to a lesser extent. In the case of the MOR agonist DAMGO, we did not see any

75

changes in TRPV1 diffusion nor in the mobile fraction of the receptor. These data indicate that

the changes in TRPV1 behavior are triggered by ligand binding to this receptor.

We also monitored intracellular calcium levels after adding different ligands. It is well

known that capsaicin causes the opening of the TRPV1 channel and massive calcium influx

(Caterina et al. 1997). There are some indications that different compounds interacting with

TRPV1 may cause calcium influx via TRPV1 to a different extent (Tóth et al. 2005).We found

that not DAMGO but capsaicin and naloxone both increase intracellular calcium. Nevertheless,

capsaicin was less effective than naloxone in eliciting calcium influx.

In conclusion, we observed that the selective MOR agonist DAMGO influenced neither

TRPV1 mobility nor intracellular Ca2+ levels. By contrast, the opioid antagonist naloxone

markedly increased the rate of TRPV1 diffusion in the plasma membrane and promoted Ca2+

influx through these channels, but not to the same extent as the TRPV1 agonist capsaicin. These

findings imply that naloxone may function as a potential TRPV1 agonist. The ability of a ligand

to bind to a receptors can be confirmed by using a radioaligand binding. In this study, we used

[3H]-naloxone to confirm its presumed ability to directly interact with the TRPV1 channel.

The possible interaction of naloxone with TRPV1 was recently reported. Using the

complete Freund's adjuvant (CFA) inflammatory pain model to examine the role of TRPV1 in

regulating endogenous opioid analgesia in mice, it was found that naloxone methiodide (Nal-

M) slowed the recovery from CFA-induced hypersensitivity in wild-type but not in TRPV1-

deficient mice (Basso et al. 2019).

This study is the first to show that naloxone may directly affect the function of TRPV1.

The potential of naloxone to interfere with TRPV1 signaling should be taken into consideration

when using this drug in future experiments, as well as when evaluating the molecular

mechanism of its therapeutic effects.

7.3 MOR and TRPV1

In the last part of this thesis, we have been interested in investigating the connection

between MOR and TRPV1 in the plasma membrane. Delineating the relationship between these

two receptors might be of great importance for better understanding the molecular mechanisms

of pain. A couple of recent studies have reported information about the connection between the

signaling pathways of MOR and TRPV1 but none of these studies explored behavior of these

76

receptors in the plasma membrane. Therefore, we decided to study the changes in the lateral

mobility of both these receptors in the plasma membrane after activation by different agonists

and antagonists. For this study, we chose the same three MOR agonists with distinct biased

signaling profiles as before (DAMGO, morphine, and endomorphin-2) and antagonist

naloxone. In the case of TRPV1, we used agonist capsaicin and antagonist capsazepine.

We wondered whether the expression of TRPV1 in the HMY-1 cell line could change the

lateral mobility of MOR. Our results indicated that TRPV1 did not alter the mobility of MOR,

but interestingly it changed the mobile fraction of these receptors. After activation of MOR

with DAMGO and endomorphin-2, the mobile fraction was significantly higher than in control

and morphine activated cells. It is known that the mobile fraction of membrane proteins is

affected by membrane microdomains. We know from our previous study that the mobility of

MOR-YFP is affected by the disruption of cholesterol-enriched membrane domains. Here, we

focused on the presumed differences between DAMGO and endomorphin-2 on the one side and

morphine on the other side. We know that the ability of DAMGO and endomorphin-2 to

modulate the mobility of MOR-YFP was diminished after cholesterol depletion. There are some

indications that TRPV1-mediated signaling is also dependent on the cholesterol content in the

plasma membrane (Szoke et al. 2010). Therefore, it can be hypothesized that the expression of

TRPV1 somehow modified the properties of the plasma membrane, which was reflected by the

changes in mobile fractions of MOR after activation by DAMGO and endomorphin-2. The

activation of TRPV1 with capsaicin markedly increased the mobility of MOR-YFP and

decreased the number of mobile receptors in the plasma membrane.

In the case of TRPV1, we observed interesting changes in the diffusion coefficients of

TRPV1-CFP after activation of TRPV1 with capsaicin but also after activation of MOR with

morphine and endomorphin-2. The changes in the mobility of TRPV1 were similar in all cases.

There were no changes in the movement of TRPV1 after activation of MOR with DAMGO,

which is G protein biased ligand. These data point to the possibility of involvement of β-arrestin

2 signaling in mediating the observed changes in the mobility of TRPV1. β-Arrestin 2 is

essential both in MOR and TRPV1 signaling. After activation of MOR, it is a crucial component

of the desensitization mechanism, and it triggers the pathway of MAP kinases. In TRPV1-

mediated signaling, β-arrestin 2 functions as a scaffold protein for phosphodiesterase 4D

(PDE4D5) to TRPV1 to regulate receptor PKA driven phosphorylation and subsequent

desensitization (Por et al. 2012).

77

It was recently revealed that the activation of TRPV1 leads to the nuclear translocation of

GRK5. The lack of GRK5 in the cytoplasm leads to the lower phosphorylation level of MOR.

This inhibits β-arrestin 2-mediated internalization and desensitization of MOR while leaving G

protein-mediated analgesic signaling of MOR intact (Scherer et al. 2017). These data suggest

that the connection between signaling pathways of MOR and TRPV1 is mediated via GRKs

and β-arrestin 2.

Our data suggest that endomorphin-2 is a unique ligand in the connection between MOR

and TRPV1 as it was the only one that changed the number of mobile TRPV1 in the plasma

membrane. Scherer and colleagues (Scherer et al. 2017) hypothesized that MOR and TRPV1

compete for GRK5 and β-arrestin 2, which could help to explain our results. It may be

concluded that after activation of MOR with endomorphin-2, the receptor is phosphorylated by

GRK5 and β-arrestin 2 is subsequently bound to it. Therefore, there is lower amount of β-

arrestin 2 in the cytoplasm, which leaves more of TRPV1 mobile without scaffolding them.

Most of the studies of connections between MOR and TRPV1 are more about crosstalk

between their signaling pathways. There is no information about a close relationship and

cooperation between MOR and TRPV1 in the plasma membrane. Our present study is the first

to show that activation of both receptors changes the physical properties of these receptors in

the plasma membrane.

78

8. Summary

In this work, we focused on studying the properties of two of the key receptors involved in

the molecular mechanism of pain, MOR and TRPV1.

We showed that the lateral mobility of MOR is strongly affected by different biased

agonists, namely morphine, DAMGO, and endomorphin-2. DAMGO and endomorphin-2

display opposite bias towards MOR, and according to our results, they also have opposite

effects on the mobility of MOR. Morphine alone induced only small changes in the mobility of

MOR.

Membrane properties may affect the mobility of membrane-bound receptors. Therefore, in

some experiments, we depleted cholesterol to disrupt cholesterol-rich membrane microdomains

and assessed the changes in the mobility of MOR. Cholesterol depletion affected the ability of

different MOR agonists to alter the movement of MOR in a specific manner. The effects of

DAMGO and endomorphin-2 were blocked. On the other hand, we observed increased mobility

of MOR after the addition of morphine to the cells with depleted cholesterol from plasma

membranes. The replenishment of cholesterol blocked the effect of morphine observed in

cholesterol-depleted cells.

In the case of blockage of G protein signaling using pertussis toxin (PTX), the ability of

DAMGO and endomorphin-2 to change the mobility of MOR was abolished. In the case of

morphine, PTX alone did not affect MOR mobility. On the other hand, G protein signaling

blockage by PTX completely prevented the effect of cholesterol depletion on morphine-induced

change in the receptor mobility.

The next investigations were focused on the mobility of TRPV1. Capsaicin, a potent agonist

of TRPV1, changed the lateral movement of TRPV1 in the plasma membrane of HMY-1 cells.

After adding the MOR antagonist naloxone, the apparent diffusion coefficient of TRPV1

increased but to a lower extent than after the addition of capsaicin. Whereas the mobile fraction

of TRPV1 was significantly lowered after capsaicin treatment, only a slight change was

detected after naloxone treatment. The MOR agonist DAMGO and antagonist levallorphan did

not affect the mobility of TRPV1.

In the functional study, we observed an increase in intracellular calcium after the treatment

of cells with capsaicin. We could also see the rise of intracellular calcium after treatment of the

79

cells with naloxone. However, naloxone was less effective than capsaicin at the same

concentration. After adding capsaicin, we observed a 100 times increase and after adding

naloxone a 30 times increase. Both the MOR agonist DAMGO and antagonist levallorphan had

no effect on TRPV1 compared to control untreated cells.

Using radioligand binding assay with [3H]-naloxone we showed that there is a specific

binding of naloxone directly to TRPV1. We observed 1.5 times increased binding of [3H]-

naloxone to cells expressing TRPV1 than to cells lacking this receptor.

Finally, we showed that there is mutual communication between MOR and TRPV1

receptors and their signaling pathways. We observed significant changes in the mobility of

MOR after adding agonist of TRPV1 and vice versa. Specifically, in the case of the TRPV1

agonist capsaicin, we found a twofold increase in the diffusion coefficient of MOR. In the case

of pretreatment of the cells with capsazepine before adding TRPV1 agonist, agonist effects

were completely nlocked. Moreover, the activation of MOR by morphine induced similar

changes in the mobility of TRPV1 as those observed in the presence of the TRPV1 agonist

capsaicin. Endomorphin-2 also affected the mobility of TRPV1, but to a lesser extent than

capsaicin or morphine. Pretreatment of the cells with naloxone blocked the changes induced by

agonists.

In sum, our results show that there is a close cooperation between MOR and TRPV1 within

the plasma membrane and that the mobility of both these receptors is strongly affected by

agonists.

80

9. Bibliography

Backes, T. M., O. G. Rössler, X. Hui, C. Grötzinger, P. Lipp & G. Thiel (2018) Stimulation of

TRPV1 channels activates the AP-1 transcription factor. Biochem Pharmacol, 150,

160-169.

Bao, Y., Y. Gao, L. Yang, X. Kong, J. Yu, W. Hou & B. Hua (2015) The mechanism of μ-

opioid receptor (MOR)-TRPV1 crosstalk in TRPV1 activation involves morphine anti-

nociception, tolerance and dependence. Channels (Austin), 9, 235-43.

Basso, L., R. Aboushousha, C. Y. Fan, M. Iftinca, H. Melo, R. Flynn, F. Agosti, M. D.

Hollenberg, R. Thompson, E. Bourinet, T. Trang & C. Altier (2019) TRPV1 promotes

opioid analgesia during inflammation. Sci Signal, 12.

Berridge, M. J., P. Lipp & M. D. Bootman (2000) The versatility and universality of calcium

signalling. Nat Rev Mol Cell Biol, 1, 11-21.

Bevan, S., T. Quallo & D. A. Andersson (2014) TRPV1. Handb Exp Pharmacol, 222, 207-45.

Bhave, G., W. Zhu, H. Wang, D. J. Brasier, G. S. Oxford & R. W. t. Gereau (2002) cAMP-

dependent protein kinase regulates desensitization of the capsaicin receptor (VR1) by

direct phosphorylation. Neuron, 35, 721-31.

Bian, J. M., N. Wu, R. B. Su & J. Li (2012) Opioid receptor trafficking and signaling: what

happens after opioid receptor activation? Cell Mol Neurobiol, 32, 167-84.

Bohn, L. M., R. J. Lefkowitz, R. R. Gainetdinov, K. Peppel, M. G. Caron & F. T. Lin (1999)

Enhanced morphine analgesia in mice lacking beta-arrestin 2. Science, 286, 2495-8.

Borgland, S. L., M. Connor, P. B. Osborne, J. B. Furness & M. J. Christie (2003) Opioid

agonists have different efficacy profiles for G protein activation, rapid desensitization,

and endocytosis of mu-opioid receptors. J Biol Chem, 278, 18776-84.

Böhme, I. & A. G. Beck-Sickinger. 2009. Illuminating the life of GPCRs. In Cell Commun

Signal, 16.

Cahill, C. M., W. Walwyn, A. M. W. Taylor, A. A. A. Pradhan & C. J. Evans (2016)

Allostatic Mechanisms of Opioid Tolerance Beyond Desensitization and

Downregulation. Trends Pharmacol Sci, 37, 963-976.

Carayon, K., L. Moulédous, A. Combedazou, S. Mazères, E. Haanappel, L. Salomé & C.

Mollereau (2014) Heterologous regulation of Mu-opioid (MOP) receptor mobility in

the membrane of SH-SY5Y cells. J Biol Chem, 289, 28697-706.

81

Caterina, M. J. & D. Julius (2001) The vanilloid receptor: a molecular gateway to the pain

pathway. Annu Rev Neurosci, 24, 487-517.

Caterina, M. J., A. Leffler, A. B. Malmberg, W. J. Martin, J. Trafton, K. R. Petersen-Zeitz, M.

Koltzenburg, A. I. Basbaum & D. Julius (2000) Impaired nociception and pain

sensation in mice lacking the capsaicin receptor. Science, 288, 306-13.

Caterina, M. J., M. A. Schumacher, M. Tominaga, T. A. Rosen, J. D. Levine & D. Julius

(1997) The capsaicin receptor: a heat-activated ion channel in the pain pathway.

Nature, 389, 816-24.

Cezanne, L., L. Navarro & J. F. Tocanne (1992) Isolation of the plasma-membrane and

organelles from chinese-hamster ovary cells. Biochimica Et Biophysica Acta, 1112,

205-214.

Chen, S. R. & H. L. Pan (2006) Loss of TRPV1-expressing sensory neurons reduces spinal

mu opioid receptors but paradoxically potentiates opioid analgesia. Journal of

Neurophysiology, 95, 3086-3096.

Chen, Y., C. Geis & C. Sommer (2008) Activation of TRPV1 contributes to morphine

tolerance: involvement of the mitogen-activated protein kinase signaling pathway. J

Neurosci, 28, 5836-45.

Chen, Y., A. Mestek, J. Liu, J. A. Hurley & L. Yu (1993) Molecular-cloning and functional

expression of a mu-opioid receptor from rat-brain. Molecular Pharmacology, 44, 8-12.

Chen, Y. J., S. Oldfield, A. J. Butcher, A. B. Tobin, K. Saxena, V. V. Gurevich, J. L. Benovic,

G. Henderson & E. Kelly (2013) Identification of phosphorylation sites in the COOH-

terminal tail of the mu-opioid receptor. J Neurochem, 124, 189-99.

Chuang , H. H., E. D. Prescott, H. Kong, S. Shields, S. E. Jordt, A. I. Basbaum, M. V. Chao

& D. Julius (2001) Bradykinin and nerve growth factor release the capsaicin receptor

from PtdIns(4,5)P2-mediated inhibition. Nature, 411, 957-62.

Conibear, A. E. & E. Kelly (2019) A Biased View of mu-Opioid Receptors? Mol Pharmacol,

96, 542-549.

Connor, M. & M. D. Christie (1999) Opioid receptor signalling mechanisms. Clin Exp

Pharmacol Physiol, 26, 493-9.

Cussac, D., I. Rauly-Lestienne, P. Heusler, F. Finana, C. Cathala, S. Bernois & L. De Vries

(2012) μ-Opioid and 5-HT1A receptors heterodimerize and show signalling crosstalk

via G protein and MAP-kinase pathways. Cell Signal, 24, 1648-57.

Darcq, E. & B. L. Kieffer (2018) Opioid receptors: drivers to addiction? Nat Rev Neurosci,

19, 499-514.

82

De-la-Rosa, V., G. E. Rangel-Yescas, E. Ladrón-de-Guevara, T. Rosenbaum & L. D. Islas

(2013) Coarse architecture of the transient receptor potential vanilloid 1 (TRPV1) ion

channel determined by fluorescence resonance energy transfer. J Biol Chem, 288,

29506-17.

Destainville, N., F. Dumas & L. Salomé (2008) What do diffusion measurements tell us about

membrane compartmentalisation? Emergence of the role of interprotein interactions. J

Chem Biol, 1, 37-48.

Doll, C., F. Poll, K. Peuker, A. Loktev, L. Gluck & S. Schulz (2012) Deciphering micro-

opioid receptor phosphorylation and dephosphorylation in HEK293 cells. Br J

Pharmacol, 167, 1259-70.

Endres-Becker, J., P. A. Heppenstall, S. A. Mousa, D. Labuz, A. Oksche, M. Schäfer, C. Stein

& C. Zöllner (2007) Mu-opioid receptor activation modulates transient receptor

potential vanilloid 1 (TRPV1) currents in sensory neurons in a model of inflammatory

pain. Mol Pharmacol, 71, 12-8.

Evans, R. M., H. You, S. Hameed, C. Altier, A. Mezghrani, E. Bourinet & G. W. Zamponi

(2010) Heterodimerization of ORL1 and opioid receptors and its consequences for N-

type calcium channel regulation. J Biol Chem, 285, 1032-40.

Filizola, M., M. Carteni-Farina & J. J. Perez (1999) Molecular modeling study of the

differential ligand-receptor interaction at the mu, delta and kappa opioid receptors. J

Comput Aided Mol Des, 13, 397-407.

Filizola, M., L. Laakkonen & G. H. Loew (1999) 3D modeling, ligand binding and activation

studies of the cloned mouse delta, mu; and kappa opioid receptors. Protein Eng, 12,

927-42.

Fujita, W., I. Gomes & L. A. Devi (2014) Revolution in GPCR signalling: opioid receptor

heteromers as novel therapeutic targets: IUPHAR review 10. Br J Pharmacol, 171,

4155-76.

Gaibelet, G., C. Millot, C. Lebrun, S. Ravault, A. Sauliere, A. Andre, B. Lagane & A. Lopez

(2008) Cholesterol content drives distinct pharmacological behaviours of mu-opioid

receptor in different microdomains of the CHO plasma membrane. Molecular

Membrane Biology, 25, 423-435.

George, S. R., T. Fan, Z. Xie, R. Tse, V. Tam, G. Varghese & B. F. O'Dowd (2000)

Oligomerization of mu- and delta-opioid receptors. Generation of novel functional

properties. J Biol Chem, 275, 26128-35.

83

Gomes, I., A. P. Ijzerman, K. Ye, E. L. Maillet & L. A. Devi (2011) G protein-coupled

receptor heteromerization: a role in allosteric modulation of ligand binding. Mol

Pharmacol, 79, 1044-52.

Gondin, A. B., M. L. Halls, M. Canals & S. J. Briddon (2019) GRK Mediates μ-Opioid

Receptor Plasma Membrane Reorganization. Front Mol Neurosci, 12.

Hao, M., S. Mukherjee & F. R. Maxfield (2001) Cholesterol depletion induces large scale

domain segregation in living cell membranes. Proc Natl Acad Sci U S A, 98, 13072-7.

He, L., J. Fong, M. von Zastrow & J. L. Whistler (2002) Regulation of opioid receptor

trafficking and morphine tolerance by receptor oligomerization. Cell, 108, 271-82.

Heine, M., A. Ciuraszkiewicz, A. Voigt, J. Heck & A. Bikbaev. 2016. Surface dynamics of

voltage-gated ion channels. In Channels (Austin), 267-81.

Hojo, M., Y. Sudo, Y. Ando, K. Minami, M. Takada, T. Matsubara, M. Kanaide, K.

Taniyama, K. Sumikawa & Y. Uezono (2008) mu-Opioid receptor forms a functional

heterodimer with cannabinoid CB1 receptor: electrophysiological and FRET assay

analysis. J Pharmacol Sci, 108, 308-19.

Jardín, I., J. J. López, R. Diez, J. Sánchez-Collado, C. Cantonero, L. Albarrán, G. E.

Woodard, P. C. Redondo, G. M. Salido, T. Smani & J. A. Rosado (2017) TRPs in Pain

Sensation. Front Physiol, 8.

Jeske, N. A., A. Diogenes, N. B. Ruparel, J. C. Fehrenbacher, M. Henry, A. N. Akopian & K.

M. Hargreaves (2008) A-kinase anchoring protein mediates TRPV1 thermal

hyperalgesia through PKA phosphorylation of TRPV1. Pain, 138, 604-16.

Jeske, N. A., A. M. Patwardhan, N. B. Ruparel, A. N. Akopian, M. S. Shapiro & M. A. Henry

(2009) A-kinase anchoring protein 150 controls protein kinase C-mediated

phosphorylation and sensitization of TRPV1. Pain, 146, 301-7.

Johnson, E. A., S. Oldfield, E. Braksator, A. Gonzalez-Cuello, D. Couch, K. J. Hall, S. J.

Mundell, C. P. Bailey, E. Kelly & G. Henderson (2006) Agonist-selective mechanisms

of mu-opioid receptor desensitization in human embryonic kidney 293 cells. Mol

Pharmacol, 70, 676-85.

Jordan, B. A., I. Gomes, C. Rios, J. Filipovska & L. A. Devi (2003) Functional interactions

between mu opioid and alpha 2A-adrenergic receptors. Mol Pharmacol, 64, 1317-24.

Keith, D. E., S. R. Murray, P. A. Zaki, P. C. Chu, D. V. Lissin, L. Kang, C. J. Evans & M.

von Zastrow (1996) Morphine activates opioid receptors without causing their rapid

internalization. J Biol Chem, 271, 19021-4.

84

Kenakin, T. (2011) Functional selectivity and biased receptor signaling. J Pharmacol Exp

Ther, 336, 296-302.

Kieffer, B. L., K. Befort, C. Gaveriaux-Ruff & C. G. Hirth (1992) The delta-opioid receptor:

isolation of a cDNA by expression cloning and pharmacological characterization. Proc

Natl Acad Sci U S A, 89, 12048-52.

Kilander, M. B. C., J. Dahlstrom & G. Schulte (2014) Assessment of Frizzled 6 membrane

mobility by FRAP supports G protein coupling and reveals WNT-Frizzled selectivity.

Cellular Signalling, 26, 1943-1949.

Kliewer, A., A. Gillis, R. Hill, F. Schmidel, C. Bailey, E. Kelly, G. Henderson, M. J. Christie

& S. Schulz (2020) Morphine-induced respiratory depression is independent of β-

arrestin2 signalling. Br J Pharmacol.

LaVigne, J., A. Keresztes, D. Chiem & J. M. Streicher (2020) The endomorphin-1/2 and

dynorphin-B peptides display biased agonism at the mu opioid receptor. Pharmacol

Rep.

Leitenberger, S. M., E. Reister-Gottfried & U. Seifert (2008) Curvature coupling dependence

of membrane protein diffusion coefficients. Langmuir, 24, 1254-61.

Lohse, M. J., J. L. Benovic, J. Codina, M. G. Caron & R. J. Lefkowitz (1990) beta-Arrestin: a

protein that regulates beta-adrenergic receptor function. Science, 248, 1547-50.

Luttrell, L. M., F. L. Roudabush, E. W. Choy, W. E. Miller, M. E. Field, K. L. Pierce & R. J.

Lefkowitz (2001) Activation and targeting of extracellular signal-regulated kinases by

beta-arrestin scaffolds. Proc Natl Acad Sci U S A, 98, 2449-54.

Maiese, K. (2017) Warming Up to New Possibilities with the Capsaicin Receptor TRPV1:

mTOR, AMPK, and Erythropoietin. Curr Neurovasc Res, 14, 184-189.

Maione, S., K. Starowicz, L. Cristino, F. Guida, E. Palazzo, L. Luongo, F. Rossi, I. Marabese,

V. de Novellis & V. Di Marzo (2009) Functional interaction between TRPV1 and mu-

opioid receptors in the descending antinociceptive pathway activates glutamate

transmission and induces analgesia. J Neurophysiol, 101, 2411-22.

Manglik, A., A. C. Kruse, T. S. Kobilka, F. S. Thian, J. M. Mathiesen, R. K. Sunahara, L.

Pardo, W. I. Weis, B. K. Kobilka & S. Granier (2012) Crystal structure of the µ-opioid

receptor bound to a morphinan antagonist. Nature, 485, 321-6.

Matthes, H. W., R. Maldonado, F. Simonin, O. Valverde, S. Slowe, I. Kitchen, K. Befort, A.

Dierich, M. Le Meur, P. Dollé, E. Tzavara, J. Hanoune, B. P. Roques & B. L. Kieffer

(1996) Loss of morphine-induced analgesia, reward effect and withdrawal symptoms

in mice lacking the mu-opioid-receptor gene. Nature, 383, 819-23.

85

Mayr, B. & M. Montminy (2001) Transcriptional regulation by the phosphorylation-

dependent factor CREB. Nat Rev Mol Cell Biol, 2, 599-609.

Mc, C. K., E. F. Grady, J. Minnis, B. Balestra, M. Tonini, N. C. Brecha, N. W. Bunnett & C.

Sternini (1999) Activation and internaliyation of the μ-opioid receptor bz the newly

discovered endogenous agonists endomorphin-1 and endomorphin-2. Neuroscience,

90, 1051-9.

McDonald, P. H., C. W. Chow, W. E. Miller, S. A. Laporte, M. E. Field, F. T. Lin, R. J. Davis

& R. J. Lefkowitz (2000) Beta-arrestin 2: a receptor-regulated MAPK scaffold for the

activation of JNK3. Science, 290, 1574-7.

McPherson, J., G. Rivero, M. Baptist, J. Llorente, S. Al-Sabah, C. Krasel, W. L. Dewey, C. P.

Bailey, E. M. Rosethorne, S. J. Charlton, G. Henderson & E. Kelly (2010) mu-Opioid

Receptors: Correlation of Agonist Efficacy for Signalling with Ability to Activate

Internalization. Molecular Pharmacology, 78, 756-766.

Melkes, B., L. Hejnova & J. Novotny (2016) Biased μ-opioid receptor agonists diversely

regulate lateral mobility and functional coupling of the receptor to its cognate G

proteins. Naunyn Schmiedebergs Arch Pharmacol. 389: 1289.

Metz, M. J., R. L. Pennock, D. Krapf & S. T. Hentges (2019) Temporal dependence of shifts

in mu opioid receptor mobility at the cell surface after agonist binding observed by

single-particle tracking. Sci Rep, 9, 7297.

Milligan, G. & J. H. White (2001) Protein-protein interactions at G-protein-coupled receptors.

Trends Pharmacol Sci, 22, 513-8.

Minami, M., T. Toya, Y. Katao, K. Maekawa, S. Nakamura, T. Onogi, S. Kaneko & M. Satoh

(1993) Cloning and expression of a cDNA for the rat kappa-opioid receptor. FEBS

Lett, 329, 291-5.

Mohapatra, D. P. & C. Nau (2003) Desensitization of capsaicin-activated currents in the

vanilloid receptor TRPV1 is decreased by the cyclic AMP-dependent protein kinase

pathway. J Biol Chem, 278, 50080-90.

Ostasov, P., L. Bourova, L. Hejnova, J. Novotny & P. Svoboda (2007) Disruption of the

plasma membrane integrity by cholesterol depletion impairs effectiveness of TRH

receptor-mediated signal transduction via G(q)/G(11)alpha proteinse. Journal of

Receptors and Signal Transduction, 27, 335-352.

Pasternak, G. W. (2010) Molecular insights into mu opioid pharmacology: From the clinic to

the bench. Clin J Pain, 26 Suppl 10, S3-9.

86

Peckys, D. & G. B. Landwehrmeyer (1999) Expression of mu, kappa, and delta opioid

receptor messenger RNA in the human CNS: a 33P in situ hybridization study.

Neuroscience, 88, 1093-135.

Pfeiffer, M., S. Kirscht, R. Stumm, T. Koch, D. Wu, M. Laugsch, H. Schröder, V. Höllt & S.

Schulz (2003) Heterodimerization of substance P and mu-opioid receptors regulates

receptor trafficking and resensitization. J Biol Chem, 278, 51630-7.

Planells-Cases, R., N. Garcia-Sanz, C. Morenilla-Palao & A. Ferrer-Montiel (2005)

Functional aspects and mechanisms of TRPV1 involvement in neurogenic

inflammation that leads to thermal hyperalgesia. Pflugers Arch, 451, 151-9.

Polakiewicz, R. D., S. M. Schieferl, A. C. Gingras, N. Sonenberg & M. J. Comb (1998) mu-

Opioid receptor activates signaling pathways implicated in cell survival and

translational control. J Biol Chem, 273, 23534-41.

Por, E. D., S. M. Bierbower, K. A. Berg, R. Gomez, A. N. Akopian, W. C. Wetsel & N. A.

Jeske (2012) β-Arrestin-2 desensitizes the transient receptor potential vanilloid 1

(TRPV1) channel. J Biol Chem, 287, 37552-63.

Por, E. D., R. Gomez, A. N. Akopian & N. A. Jeske (2013) Phosphorylation regulates TRPV1

association with β-arrestin-2. Biochem J, 451, 101-9.

Qiu, Y., Y. Wang, P.-Y. Law, H.-Z. Chen & H. H. Loh (2011) Cholesterol Regulates mu-

Opioid Receptor-Induced beta-Arrestin 2 Translocation to Membrane Lipid Rafts.

Molecular Pharmacology, 80, 210-218.

Raehal, K. M., J. K. Walker & L. M. Bohn (2005) Morphine side effects in beta-arrestin 2

knockout mice. J Pharmacol Exp Ther, 314, 1195-201.

Rajagopal, S., S. Ahn, D. H. Rominger, W. Gowen-MacDonald, C. M. Lam, S. M. Dewire, J.

D. Violin & R. J. Lefkowitz (2011) Quantifying ligand bias at seven-transmembrane

receptors. Mol Pharmacol, 80, 367-77.

Rapsomaniki, M. A., P. Kotsantis, I.-E. Symeonidou, N.-N. Giakoumakis, S. Taraviras & Z.

Lygerou (2012) easyFRAP: an interactive, easy-to-use tool for qualitative and

quantitative analysis of FRAP data. Bioinformatics, 28, 1800-1801.

Raynor, K., H. Kong, Y. Chen, K. Yasuda, L. Yu, G. I. Bell & T. Reisine (1994)

Pharmacological characterization of the cloned kappa-, delta-, and mu-opioid

receptors. Mol Pharmacol, 45, 330-4.

Reiter, E., S. Ahn, A. K. Shukla & R. J. Lefkowitz (2012) Molecular mechanism of beta-

arrestin-biased agonism at seven-transmembrane receptors. Annu Rev Pharmacol

Toxicol, 52, 179-97.

87

Rivero, G., J. Llorente, J. McPherson, A. Cooke, S. J. Mundell, C. A. McArdle, E. M.

Rosethorne, S. J. Charlton, C. Krasel, C. P. Bailey, G. Henderson & E. Kelly (2012)

Endomorphin-2: A Biased Agonist at the mu-Opioid Receptor. Molecular

Pharmacology, 82, 178-188.

Rowan, M. P., S. M. Bierbower, M. A. Eskander, K. Szteyn, E. D. Por, R. Gomez, N.

Veldhuis, N. W. Bunnett & N. A. Jeske (2014) Activation of mu opioid receptors

sensitizes transient receptor potential vanilloid type 1 (TRPV1) via β-arrestin-2-

mediated cross-talk. PLoS One, 9, e93688.

Sanz-Salvador, L., A. Andres-Borderia, A. Ferrer-Montiel & R. Planells-Cases (2012)

Agonist- and Ca2+-dependent desensitization of TRPV1 channel targets the receptor

to lysosomes for degradation. J Biol Chem, 287, 19462-71.

Sauliere, A., G. Gaibelet, C. Millot, S. Mazeres, A. Lopez & L. Salome (2006) Diffusion of

the mu opioid receptor at the surface of human neuroblastoma SH-SY5Y cells is

restricted to permeable domains. Febs Letters, 580, 5227-5231.

Sauliere-Nzeh, A. N., C. Millot, M. Corbani, S. Mazeres, A. Lopez & L. Salome (2010)

Agonist-selective Dynamic Compartmentalization of Human Mu Opioid Receptor as

Revealed by Resolutive FRAP Analysis. Journal of Biological Chemistry, 285, 14514-

14520.

Scherer, P. C., N. W. Zaccor, N. M. Neumann, C. Vasavda, R. Barrow, A. J. Ewald, F. Rao,

C. J. Sumner & S. H. Snyder (2017) TRPV1 is a physiological regulator of μ-opioid

receptors. Proc Natl Acad Sci U S A, 114, 13561-13566.

Schröder, H., D. F. Wu, A. Seifert, M. Rankovic, S. Schulz, V. Höllt & T. Koch (2009)

Allosteric modulation of metabotropic glutamate receptor 5 affects phosphorylation,

internalization, and desensitization of the micro-opioid receptor. Neuropharmacology,

56, 768-78.

Senning, E. N. & S. E. Gordon (2015) Activity and Ca²⁺ regulate the mobility of TRPV1

channels in the plasma membrane of sensory neurons. Elife, 4, e03819.

Serohijos, A. W. R., S. Yin, F. Ding, J. Gauthier, D. G. Gibson, W. Maixner, N. V.

Dokholyan & L. Diatchenko (2011) Structural basis for mu-opioid receptor binding

and activation. Structure, 19, 1683-90.

Shukla, A. K., G. H. Westfield, K. Xiao, R. I. Reis, L. Y. Huang, P. Tripathi-Shukla, J. Qian,

S. Li, A. Blanc, A. N. Oleskie, A. M. Dosey, M. Su, C. R. Liang, L. L. Gu, J. M. Shan,

X. Chen, R. Hanna, M. Choi, X. J. Yao, B. U. Klink, A. W. Kahsai, S. S. Sidhu, S.

Koide, P. A. Penczek, A. A. Kossiakoff, V. L. Woods, Jr., B. K. Kobilka, G. Skiniotis

88

& R. J. Lefkowitz (2014) Visualization of arrestin recruitment by a G-protein-coupled

receptor. Nature, 512, 218-222.

Siemens, J., S. Zhou, R. Piskorowski, T. Nikai, E. A. Lumpkin, A. I. Basbaum, D. King & D.

Julius (2006) Spider toxins activate the capsaicin receptor to produce inflammatory

pain. Nature, 444, 208-12.

Soumpasis, D. M. (1983) Theoretical-analysis of fluorescence photobleaching recovery

experiments. Biophysical Journal, 41, 95-97.

Spahn, V., O. Fischer, J. Endres-Becker, M. Schäfer, C. Stein & C. Zöllner (2013) Opioid

withdrawal increases transient receptor potential vanilloid 1 activity in a protein kinase

A-dependent manner. Pain, 154, 598-608.

Storti, B., R. Bizzarri, F. Cardarelli & F. Beltram (2012) Intact microtubules preserve

transient receptor potential vanilloid 1 (TRPV1) functionality through receptor

binding. J Biol Chem, 287, 7803-11.

Storti, B., C. Di Rienzo, F. Cardarelli, R. Bizzarri & F. Beltram (2015) Unveiling TRPV1

spatio-temporal organization in live cell membranes. PLoS One, 10, e0116900.

Studer, M. & P. A. McNaughton (2010) Modulation of single-channel properties of TRPV1

by phosphorylation. J Physiol, 588, 3743-56.

Suzuki, S., L. F. Chuang, P. Yau, R. H. Doi & R. Y. Chuang (2002) Interactions of opioid and

chemokine receptors: oligomerization of mu, kappa, and delta with CCR5 on immune

cells. Exp Cell Res, 280, 192-200.

Szoke, E., R. Börzsei, D. M. Tóth, O. Lengl, Z. Helyes, Z. Sándor & J. Szolcsányi (2010)

Effect of lipid raft disruption on TRPV1 receptor activation of trigeminal sensory

neurons and transfected cell line. Eur J Pharmacol, 628, 67-74.

Thompson, G. L., J. R. Lane, T. Coudrat, P. M. Sexton, A. Christopoulos & M. Canals (2015)

Biased Agonism of Endogenous Opioid Peptides at the mu-Opioid Receptor. Mol

Pharmacol, 88, 335-46.

Traynor, J. R. & S. R. Nahorski (1995) Modulation by mu-opioid agonists of guanosine-5'-O-

(3-[35S]thio)triphosphate binding to membranes from human neuroblastoma SH-

SY5Y cells. Mol Pharmacol, 47, 848-54.

Tóth, A., Y. Wang, N. Kedei, R. Tran, L. V. Pearce, S. U. Kang, M. K. Jin, H. K. Choi, J. Lee

& P. M. Blumberg (2005) Different vanilloid agonists cause different patterns of

calcium response in CHO cells heterologously expressing rat TRPV1. Life Sci, 76,

2921-32.

89

Valentino, R. J. & N. D. Volkow (2018) Untangling the complexity of opioid receptor

function. Neuropsychopharmacology, 43, 2514-2520.

Vardanyan, A., R. Wang, T. W. Vanderah, M. H. Ossipov, J. Lai, F. Porreca & T. King

(2009) TRPV1 receptor in expression of opioid-induced hyperalgesia. J Pain, 10, 243-

52.

Vennekens, R., G. Owsianik & B. Nilius (2008) Vanilloid transient receptor potential cation

channels: an overview. Curr Pharm Des, 14, 18-31.

Veya, L., J. Piguet & H. Vogel (2015) Single Molecule Imaging Deciphers the Relation

between Mobility and Signaling of a Prototypical G Protein-coupled Receptor in

Living Cells. J Biol Chem, 290, 27723-35.

Vilardaga, J. P., V. O. Nikolaev, K. Lorenz, S. Ferrandon, Z. Zhuang & M. J. Lohse (2008)

Conformational cross-talk between alpha2A-adrenergic and mu-opioid receptors

controls cell signaling. Nat Chem Biol, 4, 126-31.

Vranken, M. J. M., M. D. B. Schutjens & A. K. Mantel-Teeuwisse (2019) The double opioid

crisis: A call for balance. Pharmacoepidemiol Drug Saf, 28, 1-3.

Vriens, J., G. Appendino & B. Nilius (2009) Pharmacology of vanilloid transient receptor

potential cation channels. Mol Pharmacol, 75, 1262-79.

Vukojevic, V., Y. Ming, C. D'Addario, M. Hansen, U. Langel, R. Schulz, B. Johansson, R.

Rigler & L. Terenius (2008) mu-opioid receptor activation in live cells. Faseb

Journal, 22, 3537-3548.

Wang, D., X. Sun, L. M. Bohn & W. Sadée (2005a) Opioid receptor homo- and

heterodimerization in living cells by quantitative bioluminescence resonance energy

transfer. Mol Pharmacol, 67, 2173-84.

Wang, H. L., C. Y. Hsu, P. C. Huang, Y. L. Kuo, A. H. Li, T. H. Yeh, A. S. Tso & Y. L. Chen

(2005b) Heterodimerization of opioid receptor-like 1 and mu-opioid receptors impairs

the potency of micro receptor agonist. J Neurochem, 92, 1285-94.

Williams, J. T., M. J. Christie & O. Manzoni (2001) Cellular and synaptic adaptations

mediating opioid dependence. Physiol Rev, 81, 299-343.

Williams, J. T., S. L. Ingram, G. Henderson, C. Chavkin, M. von Zastrow, S. Schulz, T.

Koch, C. J. Evans & M. J. Christie (2013) Regulation of mu-Opioid Receptors:

Desensitization, Phosphorylation, Internalization, and Tolerance. Pharmacological

Reviews, 65, 223-254.

Zadina, J. E., L. Hackler, L. J. Ge & A. J. Kastin (1997) A potent and selective endogenous

agonist for the mu-opiate receptor. Nature, 386, 499-502.

90

Zhao, H., H. H. Loh & P. Y. Law (2006) Adenylyl cyclase superactivation induced by long-

term treatment with opioid agonist is dependent on receptor localized within lipid rafts

and is independent of receptor internalization. Molecular Pharmacology, 69, 1421-

1432.

Zheng, H., J. Chu, Y. Qiu, H. H. Loh & P.-Y. Law (2008) Agonist-selective signaling is

determined by the receptor location within the membrane domains. Proceedings of the

National Academy of Sciences of the United States of America, 105, 9421-9426.