CHAPTER 6

POLYMERASE CHAIN REACTION- INTRODUCTION

- PROCESSES INVOLVED- APPLICATIONS

- DNA FINGERPRINTING- R-T PCR

MISS NUR SHALENA SOFIAN

INTRODUCTION TO PCR• PCR was invented in 1984 by ( Kary Mullis ) & he received the

Nobel Prize in chemistry in 1993, for his invention• It revolutionized biological methods specially in molecular

cloning in a way that it has became an inseparable & irreplaceable part of molecular investigations.

PCR: What is it?

• Polymerase chain reaction: a means of amplifying relatively short pieces of DNA

• Advantages: - very small amounts of DNA- Wide array of sample- Ease of extraction- specifically target particular DNA sequences of varying length

The PCR Process: Components of the Reaction

• Template DNA• Primers• dNTPs – building blocks of DNA• Thermostable DNA polymerase (Taq

polymerase)• Buffer and salts (KCl, MgCl2)• Optional: BSA, DMSO, formamide

Thermus aquaticus from hot springs

• There are three basic steps which are in common with all type of PCR

1. Thermal denaturation :• In this step DNAs are denatured mostly by temperature about

94˚C & single stranded DNAs are made • ( in some cases It’s done by helicase )2. Primer annealing :• In this step primers are attached to ssDNA by their

complementary regions.3. Extension or polymerization :• This is done by a temperature resistance polymerase named

Taq polymerase which is extracted from Thermus aquaticus.

PROCESSES INVOLVE

Breaks the hydrogen bonds between the

two strands

Alleviates supercoiling

Keep the parental strands apart

Synthesizes an RNA primer

Synthesizes daughter DNA strands

III

Covalently links DNA fragments together

DNA REPLICATION PROCESS

PCR carries out in thermocycler

PCR phases

Exponential◦ If 100% efficiency – exact

doubling of products. Specific and precise

Linear◦ High variability. Reaction

components are being consumed and PCR products are starting to degrade.

Plateau◦ End-point analysis. The

reaction has stopped and if left for long – degradation of PCR products.

PCR phases in linear view

Cycle #

[DNA]

Contaminations like RNAs must be removed by RNase.

Advantages & Disadvantages

• The most accurate & feasible technique to determine the amount & concentration of products.

• Rapid cycling (30 minutes to 2 hours).• Specific & sensitive.• Not much more expensive.

* * * * *• Pollution.• Poor precision.• Hard to get quantitative data.

How are the primers made?

Example

• Target sequence (priming sites are underlined)

5’TATAAGCCATAACGATATTGCTGAGTCAAGTCCACATATCATATGGATGAGAAATGCTTGTGGAGCTGATGTTGATTTGGAGAGACTCTCTCTCTCTCTCTCTCTCTCTAAACCAGTTAAAGAGTGTGCCAGTAGAG3’

Forward primer: 5’ ATG GAT GAG AAA TGC TTG TG 3’Reverse primer: 5’ACT GGC ACA CTC TTT AAC TGG 3’

APPLICATIONS

• Amplify a sample of chromosomal DNA – used in DNA fingerprinting analysis

• Nonspecific PCR is used to increase total amount of DNA in very small samples e.g. blood stains found at crime scene

• To detect and quantitate amount of specific RNAs in living cells – used in RT-PCR

• Other applications such as fluorescent labeling, mutation detection

DNA FINGERPRINTING IN PCR

• Automated DNA fingerprinting whereby a sample DNA is amplified utilizing primers that recognizes end of microsatellites

• Microsatellite fragments are fluorescently labeled and separated by gel electrophoresis

• The fluorescent molecules excited with laser and measured via fluorescent detector

Reverse Transcriptase PCR

• One of the most useful applied molecular genetics method

• RNA needs to be purified and stored at low temperature to prevent degradation

• Two steps:1. Biochemical separation of total RNA from DNA and protein using protein denaturant2. Isolation of poly-A and mRNA using oligo dT affinity matrix

Reverse Transcriptase PCR

First strand cDNA synthesis• mRNa copied into cDNA by reverse

transcriptase using oligo dT primersSecond strand cDNA synthesis• Requires artificial primer to initiate synthesis• Addition of small amounts of RNaseH resulted

in production of short RNA primers – promoting DNA synthesis at multiple sites along cDNA template

The reaction• PCR mix – Taq polymerase, specific primers, dNTPs

and buffers• cDNA is denatured >900C; temperature lowers to 50-

600C to allow annealing of primers (600 bp apart)• Temperature rises to 720C and Taq polymerase

extends the DNA from the primers• The cycle is repeated• The reaction products of cDNA are anaylzed by

agarose gel electrophoresis• EtBr is insensitive and does not allow accurate

quantitation of cDNA. Alternative is to use SYBR green dye (more fluorescent)

• SYBR green binds to ds DNA (reverse transcriptase PCR) and ss DNA (real-time PCR)

RT-PCR can be used for cloning

• Restriction enzyme sites can be added to the cDNA of interest

• Able to generate sticky ends for ligation into vector of choice

• 2 sticky ends permits directional cloning

SYBR GREEN

Real-Time PCR• The reverse transcriptase has an endo H activity which

removes the mRNA allowing second strand of DNA to be formed

• Real time PCR is developed to:- quantitate differences in mRNA expression- availability of small amounts of mRNA e.g. cells obtained by laser capture micro-dissection, small amounts of tissue, primary cells, precious reagents

• To quantitate mRNA:- Northern blotting- Ribonuclease protection assays (RPA)- in situ hybridization- PCR

Real-Time chemistries allow for the detection of PCR amplification duringthe early phases of the reaction. Measuring the kinetics of the reaction inthe early phases of PCR provides a distinct advantage over traditionalPCR detection.

Real Time PCR - Diagnosis• Quantitatively measurement of Human Immunodeficiency Virus

(HIV).• Detection of Thalassemia, hemophilia, sickle cell anemia &

fauvism by real time PCR.• Cystic fibrosis.• Phenyl ketonuria.• Use in forensic medicine.• Non-invasive Prenatal Diagnosis by Analysis of Fetal DNA in

Maternal Plasma.• Detection and Quantitation of Circulating Plasmodium falciparum

DNA.• Effect of antimicrobial peptides on host cells

Conclusion

• PCR has proved to be a useful tool in research and diagnosis.

• Its use has also brought new challenges to research in terms of interpreting the results due to sensitivity and quantitative measurement

• In medicine, PCR-based diagnostics are just becoming widely used and because of the increased cost-effectiveness of the newer assays, knowledge for their interpretation will soon become available