Cernunnos deficiency reduces thymocyte lifespan and alters the T ...

Cernunnos deficiency reduces thymocyte lifespan and 1

alters the T cell repertoire in mice and humans 2

3

Gabriella Vera, MSc1,2,*, Paola Rivera-Munoz, PhD,1,2,*, Vincent Abramowski, MSc1,*, 4

Laurent Malivert, PhD1,2, Annick Lim, PhD4, Christine Bole-Feysot, PhD2, Christelle 5

Martin, PhD5, Benoit Florkin, MD6, Sylvain Latour, PhD1,2, Patrick Revy, PhD1,2 , and Jean-6

Pierre de Villartay,PhD1,2,3# 7

8

1 Laboratory “Genome Dynamics in the Immune System”, INSERM U768, 75015 Paris, 9

France; 10

2 Université Paris Descartes-Sorbonne Paris Cité, Institut Imagine, Site Necker, IFR94, 11

75015 Paris , France; 12

3 Assistance Publique-Hôpitaux de Paris, Service d’Immunologie et d’Hématologie 13

Pédiatrique, Hôpital Necker Enfants Malades, 75015 Paris, France; 14

4 Département d'Immunologie, Institut Pasteur, 75724 Paris, France; 15

5 SEAT, CNRS UPS44, 94800 Villejuif, France; 16

6 Service de Pédiatrie, Centre Hospitalier Universitaire (CHU) de la Citadelle, Liège, 17

Belgium. 18

19

*: These authors contributed equally to this work 20

#: Correspondence to: Dr. Jean-Pierre de Villartay 21

INSERM U768, Hôpital Necker 22

149 rue de Sèvres, 75015 Paris 23

tel: +33 1 44 49 50 81 24

fax: +33 1 42 73 06 40 25

[email protected] 26

27

28

Running Title: Cernunnos and T cell repertoire 29

30

31

Word count M&M: 644 words 32

Character count Intro/Res/Disc/Fig leg: 26153 char 33

34

Copyright © 2012, American Society for Microbiology. All Rights Reserved.Mol. Cell. Biol. doi:10.1128/MCB.01057-12 MCB Accepts, published online ahead of print on 3 December 2012

on April 9, 2018 by guest

http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

2

Abstract 35

Cernunnos is a DNA repair factor of the Non Homologous End Joining machinery. Its 36

deficiency in humans causes radiosensitive SCID with microcephaly, characterized in part 37

by a profound lymphopenia. In contrast to the human condition, the immune system of 38

Cernunnos KO mice is not overwhelmingly affected. In particular, Cernunnos is dispensable 39

during V(D)J recombination in lymphoid cells. Nevertheless, the viability of thymocytes is 40

reduced in Cernu KO mice, owing to the chronic activation of a P53-dependent DNA 41

damage response. This translates into the qualitative alteration of the T cell repertoire, in 42

which the most distal Vα and Jα segments are missing. This results in the contraction of 43

discrete T cell populations such as iNKT and MAIT in both humans and mice. 44

45


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

3

Introduction 46

The immune system is the site of intense genome dynamics, in particular during the 47

development and maturation of B and T lymphocytes in bone marrow and thymus when 48

antigen receptor genes are rearranged through V(D)J recombination prior to their 49

expression. DNA damages are also likely to occur during the several phases of intense 50

proliferation, which accompany the development of B and T cells . 51

V(D)J recombination is the prototypical example for the generation of programmed DNA 52

double strand break (DNA-dsb) during lymphoid development through the activity of 53

Recombination activating genes 1 and 2 (Rag1/2) on immunoglobulin (Ig) and T cell 54

receptor (TCR) genes of (see Helmink et al.(15) for a recent review). The resulting DNA-55

dsb is resolved by the Non Homologous End Joining (NHEJ) DNA repair pathway, 56

composed of seven core components (see Lieber et al.(24) for a recent review). The 57

Cernunnos/Xrcc4/DNA-Ligase IV complex ultimately reseals the DNA-dsb. Cernunnos, 58

also known as Xrcc4 like factor (XLF), is the last NHEJ factor that was independently 59

identified through the survey of RS-SCID patients(7) and a yeast two-hybrid screen with 60

Xrcc4 as a bait(1). Cernunnos and Xrcc4 adopt the same overall three-dimensional crystal 61

structure(2, 22), and together with DNA-Ligase IV are parts of the same complex(1, 8). 62

Cernunnos stimulates the DNA joining activity of the Xrcc4/DNA-ligaseIV complex(25, 63

30). 64

V(D)J recombination constitutes a central checkpoint in the development of the immune 65

system, as its defect leads to abortive B and T cell maturation in vivo, resulting in severe 66

combined immune deficiency (SCID) (9), but its first recognized function is the generation 67

of a diverse antigenic repertoire through the combinatorial association of Variable, 68

Diversity, and Joining segments that encode the Variable domains of both Ig and TCRs(5). 69

Numerous examples show that a reduced V(D)J recombinase activity affects the extent of 70


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

4

antigenic diversity of immune receptors in mice and humans. The resulting immune 71

deregulation may then lead to autoimmunity, increased susceptibility to infections, or to the 72

development of various forms of cancer(35). 73

A Cernunnos KO mouse in which deletion of exons 4-5 caused in-frame alternative splicing 74

of exon 3 to 6 and residual (less than 1% of wt.) protein expression was previously 75

reported(21). In the present study we used a different gene targeting approach to develop a 76

complete Cernunnos null mouse model to explore the role of Cernunnos in the development 77

and maturation of the murine immune system in comparison to what is known in Cernunnos 78

deficient human patients. 79

80

Materials and Methods 81

Generation of Cernu-/- mice 82

Cernu-/- mice were developed at the Institut Clinique de la Souris (ICS, Illkirch, France) by 83

flanking exon 4 with loxP sites (Figure 1). Mice were genotyped by standard PCR on tail 84

DNA using the following primers: Cernu4R (5’-GTCCCCAGCTGTTAAGAGTTTC-3’) for 85

KO and Flox ; CernuExo4F (5’-GGATGAAGGACCTTGAGATCC-3’) for flox ; Cernu3F 86

(5’-CTATGGAAGCCAGGAGAGAATG-3’) for KO. All animals were maintained in a 87

specific pathogen-free environment. Analyses were performed on Cernu KO and littermate 88

control animals with a mix B6/129 background. P53 KO mice were on a mix B6/129 89

background as well. All experiments and procedures were performed in compliance with the 90

French Ministry of Agriculture’s Regulations for Animal Experiments (Act no. 87847, 19 91

October 1987, as modified in May 2001). 92

93 Analysis of lymphocyte populations 94

Cell phenotyping was performed on blood, thymus, bone marrow, lymph nodes, and splenic 95

lymphoid populations by four-color fluorescence analysis as previously described(33). 96


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

5

iNKT cell determination was performed on splenocytes from 4-8 weeks old mice by staining 97

with APC mouse-CD1d tetramer loaded, or not, with αGal-cer (kindly provided NIH 98

Tetramer Core Facility), and 2.4G2 anti-Fc antibody and FITC anti-mouse TCRβ (BD 99

bioscience) and PE anti-mouse CD3ε or anti-mouse NK1.1 (Becton Dickson). Human 100

iNKT(29) and MAIT(26) cells were determined using anti-Va24 and anti-Va7.2 antibodies 101

on PBLs. 102

103

V(D)J recombination assay in thymocytes 104

CD4-CD8- thymocytes were negatively purified by magnetic sorting and infected with the 105

MX-RSS12/23 supernatant(23). The level of V(D)J recombination was determined 48h after 106

transduction by scoring the GFP+ (rearranged) cells among the huCD4+ transduced cells. 107

Thymocytes from Artemis -/- mice were used as negative control. 108

109

Thymocyte proliferation assay in vivo 110

Cernu KO mice were bred into the Rag1-/- background and 6-8 wks. old double KO mice 111

were injected i.p. with 100µg of anti-CD3 antibody to mimic the TCR-β selection induced 112

thymocyte proliferative burst as previously described(38). 113

114

Thymocyte survival assay in vitro 115

Single cell suspensions were obtained from thymus and cultured at 1x106 cells/ml in 116

DMEM supplemented with glutamine and 10% decomplemented fetal bovine serum. Viable 117

cells were determined after 24h by trypan blue staining and apoptosis was analyzed by 118

FACS after labeling with Annexin-V and 7AAD (Apoptosis detection kit, BD Pharmingen). 119

120


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

6

RT-PCR analysis of TCR-Jα usage 121

For mTRAV3.1, mTRAV5.1, and mTRAV3.4 combined determination, thymocyte and 122

splenocyte derived cDNAs were PCR-amplified using mTRAV3 (5’-123

TCATCTGCACCTACACAGACAGTGC-3’) and mTCR-EX4R (5’-124

GATGGAGCTTGGGAGTCAG-3’) primers, cloned into TOPO-TA vector (Invitrogen), 125

and sequenced with T7 or M13 primers. Immunoscope was determined as previously 126

described(28). 127

128

Analysis of global TCR-α usage by deep sequencing 129

RNA from human PBLs was reverse transcribed using SMARTER 5’RACE cDNA kit 130

(Clontech laboratories) according to manufacturer’s recommendations. 5’RACE PCR was 131

achieved using a mix of long: 5'-132

CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT–3' and short: 5'–133

CTAATACGACTCACTATAGGGC –3' Universal Primer Mix (UPM) and the Cα reverse primer 134

CAR3: 5’-GTCTCTCAGCTGGTACACG-3’. 500bp PCR products were gel purified and 135

processed for single molecule sequencing using the Ion Personal Genome Machine (PGM, 136

Ion Torrent, Life Technologies) according to manufacturer’s recommendations. hTRAV and 137

hTRAJ gene segments were identified using IMGT database and software 138

(http://www.imgt.org/HighV-QUEST)(6). The genomic location of each hTRAV and 139

hTRAJ element was obtained from UCSC Genome Browser (http://genome.ucsc.edu/). 140

141

Quantitative real-time RT-PCR analysis 142

TaqMan PCR were performed in triplicates on 20 ng of reverse transcribed RNA using 143

Predesigned primers and probe sets from Applied Biosystems (mouse cernunnos exons1-2: 144

Mm 01259071_m1; mouse Bid exons5-6: m00432073_m1 ; mouse Cdkn1a or P21 exons1-145


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

7

2: Mm 01303209 _m1 ; mouse Bax exons4-5: Mm 00432050 _m1; mouse Bbc3 or PUMA 146

exons3-4: Mm 00519268 _m1; and GAPDH: Mm99999915_g1). mRNA content was 147

calculated with the sequence detector SDS2.1 software (Applied Biosystems). GAPDH was 148

used for normalization of expression and RNA from Cernu+/- mice as the calibrator. The 149

relative amount of mRNA in samples was determined using the 2-ΔΔCT methods where ΔΔCT 150

is the difference between ΔCT(Cttarget-CTGAPDH)sample and ΔCT(Cttarget 151

CTGAPDH)calibrator. Final results were expressed as the n-fold differences in target gene 152

expression in tested samples when compared with the mean expression value of a control. 153

154

Results 155

Generation of Cernunnos KO mice. 156

Based on previous structure/function studies, we designed our Cernunnos KO model by 157

deleting exon 4 (Figure 1A). Cernu KO was bred to homozygosity by crossing Cernu+/- 158

mice. All genotype combinations were born at the expected Mendelian frequency (Figure 1B 159

and 1C). Quantitative RT-PCR analysis covering exons 1-2 demonstrated the absence of 160

detectable Cernunnos transcript in both thymus and spleen from Cernu-/- mice as a probable 161

consequence of non-sense mediated RNA decay resulting from the out of frame splicing of 162

exon 3 to 5 (Figure 1D). Accordingly, Cernunnos protein was not detected in Cernu-/- MEFs 163

by western blot (Figure 1E). MEFs from Cernu-/- demonstrated an increased sensitivity to 164

the radiomimetic drug phleomycin in vitro (Figure 1F) as expected for a NHEJ defect. 165

166

The immune system is not overwhelmingly affected in Cernunnos KO mice 167

The lymphocyte counts of Cernu-/- mice were slightly, yet significantly, diminished (Figure 168

2A) compared to those of their wt. littermates in thymus (31.6x106 vs. 108.7x106, 169

p=0.0009), spleen (27.4x106 vs. 72.8x106, p<0.0001), and lymph nodes (6.7x106 vs. 170


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

8

4.7x106, p=0.25), which contrasted with the known severe lymphopenia of human 171

Cernunnos patients(7). This was independent of the age of the animals (data not shown) and 172

homogeneous between all the T and B cell populations analyzed in thymus, spleen, and 173

lymph nodes (data not shown). The lark-shaped image of CD4/CD8 dual staining of 174

thymocytes attests for the normal development of thymocytes through all maturation stages 175

and thus indicates a proficient V(D)J recombination process. To confirm this, we analyzed 176

the V(D)J recombination activity ex vivo in purified DN thymocytes using the retroviral 177

V(D)J recombination substrate MX-RSS12/23(23) (Figure 2B). About 26% of thymocytes 178

from wt. mice transduced with the reporter (identified by the expression of HuCD4) have 179

rearranged the substrate and express GFP. No recombination could be identified in Artemis 180

deficient thymocytes as expected. DN thymocytes from Cernu-/- mice showed a two fold 181

reduction in the V(D)J recombination activity in this setting. Moreover, sequence of coding 182

joints recovered from Cernu-/- thymocytes were only marginally affected with a slight, yet 183

not statistically significant, increase in coding ends erosion as compared with wt. 184

thymocytes (Figure 3). This is in accord with the relatively normal V(D)J recombination 185

activity noted in A-MuLV transformed pro-B cell lines derived from a distinct Cernu-/- 186

mouse model(21). Cernunnos is also dispensable for V(D)J recombination in humans as 187

shown by the normal B cell differentiation in the bone marrow of Cernunnos patients as 188

opposed to Rag1/2, Artemis, or DNA LigaseIV patients (36). 189

We then asked if the reduction in thymocyte counts could be a consequence of an impaired 190

proliferative capacity during TCR-β selection. We introduced the Cernu KO mutation on the 191

Rag1-/- background and mimicked the TCR-β selection driven thymocyte proliferative burst 192

by treating mice i.p. with 100µg anti-CD3 as previously described(38). There was no 193

difference in anti-CD3 driven thymocytes expansion after 9 days between Rag1-/-xCernu-/- 194


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

9

and Rag1-/- mice, with about 100x106 recovered cells, a 2-log increase as compared to the 195

thymocyte cellularity of untreated mice in both cases (Figure 2C). 196

197

The T cell repertoire is biased in Cernunnos KO mice 198

We analyze T cell repertoire diversity in Cernu-/- mice by Immunoscope (28). Both TCR-β 199

(Figure 4A) and TCR-α (Figure 4B) repertoires were diversified with the representation of 200

all Vβ and Vα families in accord with the proficient V(D)J recombination activity. 201

Nevertheless, a close examination of most 5’ (“distal”) and 3’ (“proximal”) Vα segments 202

revealed a striking difference in their usage among Cernu-/- and Cernu+/- mice (Figure 4B, 203

C). Whereas the distal mTRAV1 and mTRAV2 account for 2.2% of all Vα in Cernu+/- T 204

cells, they only represent 0.4% of Vα in Cernu-/- mice (Figure 4C). Conversely, the most 205

proximal mTRAV17 to mTRAV21 segments represent 2.7% and 8.8% of Vα segments in 206

Cernu+/- and Cernu-/- T lymphocytes respectively. In other words, while the frequency of 207

distal Vα is reduced by 80% in Cernu-/- T cells, the usage of proximal Vα segments is 208

increased 3.2 fold in the same mice. To consolidate this observation we designed a PCR 209

assay whereby TCR-α transcripts expressing either distal mTRAV3.1 and mTRAV5.1 or 210

proximal mTRAV3.4 genes (Figure 5A) are co-amplified with a single pair of primers and 211

the frequency of the three Vαs is then determined by cloning and sequencing. As shown in 212

Figure 5B, the use of distal Vα segments is significantly reduced in Cernu-/- mice as 213

compared to Cernu+/- mice, both in thymus (32% vs. 81%, p<0.0001) and spleen (61% vs. 214

81%, p<0.0001). We next determined Jα usage in each set of Vα dist. and Vα prox. 215

containing TCR-α transcripts (Figure 5C). In accord with the theory of sequential waves of 216

TCR-α rearrangements in the thymus (see discussion)(27), the Vα prox. (Vα3’) containing 217

transcripts tend to use the most 5’ (proximal to Vαs) Jα segments with a median at 218


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

10

mTRAJ51 in thymus and mTRAJ46 in spleen for both Cernu+/- and Cernu-/- T cells. The 219

Vα dist. (Vα5’) containing transcripts from Cernu+/- T cells follow the same rule by using 220

more 3’ (distal to Vαs) Jα segments, centered around mTRAJ16 and mTRAJ25 for thymus 221

and spleen respectively. In sharp contrast, Vα dist. containing transcripts from Cernu-/- T 222

cells contain Jα segments centered on mTRAJ40 and mTRAJ46 in thymus and spleen 223

respectively, close to the beginning of the TCR-Jα cluster. In summary, the molecular 224

analysis of TCR-α rearrangements in Cernu-/- mice revealed two main differences when 225

compared to Cernu+/- mice: 1) a strong tendency to use the most 3’ (proximal to Jαs) Vα 226

segments and 2) a considerable shift in Jα usage toward the most 5’ (proximal to Vαs) 227

segments even when TCR-α rearrangements involved distal Vαs. 228

229

The TCRα repertoire is skewed in human Cernunnos patients 230

We then wished to appreciate to what extent the variation of Vα and Jα utilization identified 231

in Cernu-/- mice could be generalized to human Cernunnos deficiency condition. We 232

evaluated TCR-α repertoire in PBLs by means of 5’ RACE PCR and Next Generation 233

Sequencing. Vα and Jα were plotted according to their relative positions on the genome 234

(Figure 6A, B). Whereas the median positions of Vα from the control was located around 235

hTRAV9.2 (pos. 3.2 105 bp), the Vα median position in TCR-α transcripts from the 236

Cernunnos patient was significantly displaced downstream of the Vα locus around 237

hTRAV26-1 (pos. 5.2 105 bp), in proximity to the TCR-Jα cluster. Conversely, the median 238

Jαs were centered around hTRAJ28 and hTRAJ39 (pos. 4.0 and 2.6 104 bp) for the control 239

and the Cernunnos patient respectively, a statistically significant shift toward the 5’ side of 240

the TCR-Jα cluster, more proximal to the Vα segments, in TCR-α from the patient. The 241

contour plot representation of the TCR-α transcripts according to the position of Vα and Jα 242


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

11

segments (Figure 6B) illustrates the shift of the TCR-α point cloud towards the most 243

downstream Vα and most upstream Jα in PBLs from Cernunnos patient as compared to 244

control. Indeed, the barycenter (Vα; Jα) moves from (3.2 105 bp; 4.0 104 bp) in control to 245

(5.2 105 bp; 2.6 104 bp) in Cernunnos patient. 246

Mucosal-associated invariant T cells (MAIT) and invariant Natural killer T cells (iNKT) are 247

two innate-like populations of T lymphocytes that express highly conserved and semi 248

invariant T cell receptors (4, 18). iNKT cells are bona fide T lymphocytes that also express 249

NK lineage receptors. They recognize microbial ligands, suggesting their probable innate-250

like antimicrobial functions. MAIT cells also react to bacterially infected cells in MHC class 251

I-like molecule (MR1)-dependent manner. Vitamin B metabolites were recently identified as 252

ligands for MAIT cells (16). In humans, iNKTs use hTRAV10 (pos. 2.0 105 bp)) and 253

hTRAJ18 (pos. 5.0 104 bp) and MAITs express hTRAV1.2 (pos. 0.2 105 bp) and hTRAJ33 254

(pos. 3.3 104 bp). Figure 6C represents the position of invariant TCR-α transcripts from 255

iNKT and MAIT T cells together with the 75% cloud point of TCR-α transcripts from a 256

Cernunnos patient and a control individual. It appears that MAIT and iNKT specific TCR-α 257

transcripts are well outside the TCR-α 75% cloud point in Cernunnos patient arguing that 258

these two minor T cell populations should be largely underrepresented in the context of 259

Cernunnos deficiency. In mice, the invariant TCRα expressed by iNKT cells is composed of 260

Vα14 (mTRAV11) rearranged to mTRAJ18. The frequency of iNKT cells identified by dual 261

staining using anti-TCRβ and CD1-d tetramer significantly decreased from 1.06% to 0.28% 262

in the spleen of Cernu-/- mice (Figure 7B) as expected given the reduced usage of distal 263

TCR-Jα segments. Determination of iNKT and MAIT cells in PBLs from one Cernunnos 264

patient showed the same tendency with a 10-fold decrease in both populations in comparison 265

with the control of the day (data not shown). Nevertheless, frequency of iNKT and MAIT 266

cells being highly variable among individuals, this sole observation in humans awaits other 267


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

12

cases for statistical support. 268

Collectively, the shift in TCRα usage towards the most proximal Vα and Jα segments and 269

the resulting disappearance of iNKT cells represent the signature of reduced thymocyte 270

viability as detailed in the discussion. This series of analyses thus suggested that the lack of 271

Cernunnos decreases thymocyte lifespan both in humans and mice. 272

273

Decreased viability of Cernu-/- thymocytes 274

To confirm this hypothesis we analyzed thymocyte lifespan upon Cernunnos inactivation by 275

surveying thymocyte viability after 24h in culture in vitro (Figure 8A). The cell recovery 276

decreased from 50.22% to 24.84% in Cernu+/- and Cernu-/- cultures respectively. This 277

statistically significant 50% reduction was imputable to an increase in thymocytes apoptosis 278

as measured by dual staining with 7AAD and Annexin-V (Figure 8B). 279

To evaluate the possible implication of the DNA repair/tumor suppressor factor P53 in this 280

phenomenon, we determined the level of expression of several P53 target genes by real time 281

quantitative PCR (Figure 8C). The expression of four P53-dependent genes involved in 282

apoptosis, PUMA, P21, Bid, and BAX was significantly increased in thymocytes from 283

Cernu-/- mice (Figure 8C). The almost complete return of expression levels to baseline for 284

these four genes in the Cernu-/-xP53-/- double KO (DKO) animals further attested for the 285

implication of P53 in thymocyte apoptosis caused by the loss of Cernunnos. 286

287

P53 KO partly complements the reduced Cernunnos KO thymocyte viability 288

To further ascertain the role of P53 in the decreased thymocyte fitness observed in Cernu-/- 289

mice, we generated Cernu-/-xP53-/- DKO animals and surveyed the various parameters 290

associated with thymocytes viability. The first striking consequence of introducing the P53 291

KO background was a complete normalization of the thymocyte counts (243.2x106 in DKO 292


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

13

vs. 92.78x106 in Cernu-/- mice, p=0.0074) in DKO mice (Figure 9A), together with the 293

statistically significant increase in thymocytes recovery in 24h cultures in vitro (Figure 9B). 294

Introduction of the P53 KO background had also a significant impact on the frequency of 295

TCR-Vα and Jα usage (Figure 9C). Indeed, the proportion of upstream Vα usage increased 296

from 32% to 58% in splenic T cells from Cernu-/- and DKO mice respectively, a statistically 297

significant shift towards the values obtained in T cells from wt. (93%) and P53-/- (82%) 298

mice. This partial normalization of TCR-Vα usage was accompanied by a concomitant 299

correction of Jα usage in 5’Vα containing transcripts with median Jα at mTRAJ38 and 300

mTRAJ29 in Cernu-/- and DKO T cells respectively, a mTRAJ position in the later 301

approaching the median values of mTRAJ23 seen in wt. and P53-/- mice (Figure 9C). Lastly, 302

the increased thymocytes viability in DKO as revealed by TCR Vα and Jα usage translated 303

into the partial recovery of the iNKT T cell population in DKO spleens (Figure 9D). 304

305

We conclude that Cernunnos deficiency results in the chronic activation of the DNA damage 306

response (DDR), and the subsequent P53 driven upregulation of pro-apoptotic factors 307

leading to thymocytes decreased viability and the qualitative alteration of the T cell 308

repertoire both in humans and mice. 309

310

Discussion 311

The Cernunnos loss of function is not embryonic lethal in mice. likewise, we identified a 312

human Cernunnos patient harboring a homozygous genomic deletion spanning exons 2 to 5, 313

resulting in a null allele (unpublished observation). Cernunnos is therefore not essential both 314

in humans and mice in contrast to Xrcc4 and DNA-Ligase IV. 315

Surprisingly, the immune system is not overwhelmingly affected in Cernu-/- mice in contrast 316

to the human Cernunnos deficiency condition(7). Indeed, while Cernunnos patients harbor a 317


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

14

remarkable lymphopenia, the number of T and B lymphocytes is only slightly reduced in 318

Cernu-/- mice when compared to heterozygous or wt. littermates. Indeed, Cernunnos is 319

largely dispensable during V(D)J recombination as first noted by Li et al.(21). Accordingly, 320

Cernu-/- mice crossed onto the P53 KO background did not develop B cell lymphoma as 321

opposed to other NHEJ deficiency situations(10). We would like to propose a speculative 322

yet plausible explanation for this intriguing observation based on our recent report on the 323

Cernunnos/XRCC4 complex structure(31). Crystal of Cernunnos-Xrcc4 complexes revealed 324

that both homodimers associate with each other in long filaments through their head 325

domains, helping tether the broken DNA ends by creating a “DNA ligation synapse” (3, 14, 326

31, 39). The absence of Cernunnos would then result in this DNA ligation synapse 327

destabilization rather than a catalytic malfunction of the X4/Cernu/L4 complex per se. 328

During V(D)J recombination, the Rag1 and Rag2 proteins persist on DNA ends in the so 329

called Post Cleavage Complex (PCC) (see Schatz et al.(32) for a recent review), to shepherd 330

the Rag1/2 induced DNA breaks toward the NHEJ pathway (20). The DNA-ends tethering 331

function of Xrcc4-Cernunnos filaments would then become partially redundant to the 332

Rag1/2 PCC, arguing for the almost normal V(D)J recombination in the absence of 333

Cernunnos. Interestingly, V(D)J recombination is severely altered in mice carrying both 334

ATM and Cernunnos KO alleles(40), which is in accord with the known role of ATM in 335

stabilizing the PCC complex. 336

We noted a significant alteration in TCR Vα and Jα usage in both murine and human 337

Cernunnos deficient T cells. The TCR-α locus is unique compared to the other TCR and Ig 338

loci in the sense that multiple waves of TCR-α rearrangements can occur until the resulting 339

TCR expressing thymocytes are positively selected (see Krangel et al.(17) for review). The 340

initial waves of TCR-α rearrangement involve the most 5’ Jα segments(37). Subsequent 341

waves of VαJα rearrangements involve upstream Vα to downstream Jα segments (Figure 342


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

15

10). Thymocyte viability directly impacts on the numbers of successive VαJα 343

rearrangements(13, 34). The shift in TCRα usage toward the most 3’Vα and the most 5’Jα 344

in Cernunnos deficient T cells in both humans and mice is therefore an indication of reduced 345

thymocyte viability in these settings. 346

This is a consequence of a chronic P53 activation likely caused by a lasting-DNA damage 347

response. Indeed, introduction of the P53 KO background partially reverted the 348

characteristics associated with thymocyte fragility. This is reminiscent of the situation of 349

DNA-Ligase IV and Xrcc4 KO mice(11, 12), in which, the backcrossing onto the P53 KO 350

background circumvent the embryonic lethality caused by the apoptosis of post-mitotic 351

neurons. 352

In conclusion, we found that although Cernunnos is dispensable for V(D)J recombination, 353

its absence results in a skewing of TCR Vα and Jα usage resulting in the quantitative and 354

qualitative alteration of the T cell repertoire. This is in particular highlighted by the deficit in 355

iNKT and MAIT cells, two populations of lymphocytes expressing invariant TCRs 356

composed of upstream Vα rearranged to downstream Jα and therefore relying on extended 357

thymocyte lifespan. Given the possible anti-microbial activity of these two discrete T cell 358

population (4,19), their deficit could impact the immunocompetence of Cernunnos defective 359

hosts. Likewise, one cannot exclude that some other yet undefined T cell populations 360

bearing particular TCR specificities could be compromised (or over-represented) in the 361

absence of Cernunnos. Analysis of TCR-α rearrangement in peripheral mature T cells as an 362

indirect mean to evaluate thymocyte viability could help understand some immune 363

deregulation situations leading to autoimmunity or susceptibility to develop cancer. 364

365

Acknowledgments 366

We thank P. Ferrier and M. Krangel for critical reading of the manuscript, Kamel Abdoun 367


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

16

for animal care and anti-CD3 injections, and Christelle Lenoir for assistance in iNKT 368

determination in humans. We thank The Institut Clinique de la Souris (ICS, Illkirch, France) 369

for development of the Cernu KO mouse, the NIH Tetramer Facility for CD1d tetramers, 370

and O. Lantz for the anti-hVα7.2 antibody. This work was supported by institutional grants 371

from INSERM, ERC (249816 PIDIMMUN), Ligue Nationale contre le Cancer (Equipe 372

Labellisée LA LIGUE), and GIS-Maladies Rares. GV was supported by the Ministère de la 373

Recherche et de la Technologie (MRT), P R-M by Institut National du Cancer (INCa) and 374

Association de Recherche sur le Cancer (ARC), and L M by MRT and ARC. P R and S L 375

are scientists from CNRS. 376

377

References 378

1. Ahnesorg, P., P. Smith, and S. P. Jackson. 2006. XLF interacts with the XRCC4-379

DNA ligase IV complex to promote DNA nonhomologous end-joining. Cell 380

124:301-313. 381

2. Andres, S. N., M. Modesti, C. J. Tsai, G. Chu, and M. S. Junop. 2007. Crystal 382

structure of human XLF: a twist in nonhomologous DNA end-joining. Molecular cell 383

28:1093-1101. 384

3. Andres, S. N., A. Vergnes, D. Ristic, C. Wyman, M. Modesti, and M. Junop. 385

2012. A human XRCC4-XLF complex bridges DNA. Nucleic acids research 386

40:1868-1878. 387

4. Bendelac, A., P. B. Savage, and L. Teyton. 2007. The biology of NKT cells. 388

Annual review of immunology 25:297-336. 389

5. Brack, C., M. Hirama, R. Lenhard-Schuller, and S. Tonegawa. 1978. A complete 390

immunoglobulin gene is created by somatic recombination. Cell 15:1-14. 391


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

17

6. Brochet, X., M. P. Lefranc, and V. Giudicelli. 2008. IMGT/V-QUEST: the highly 392

customized and integrated system for IG and TR standardized V-J and V-D-J 393

sequence analysis. Nucleic acids research 36:W503-508. 394

7. Buck, D., L. Malivert, R. de Chasseval, A. Barraud, M. C. Fondaneche, O. 395

Sanal, A. Plebani, J. L. Stephan, M. Hufnagel, F. le Deist, A. Fischer, A. 396

Durandy, J. P. de Villartay, and P. Revy. 2006. Cernunnos, a novel 397

nonhomologous end-joining factor, is mutated in human immunodeficiency with 398

microcephaly. Cell 124:287-299. 399

8. Callebaut, I., L. Malivert, A. Fischer, J. P. Mornon, P. Revy, and J. P. de 400

Villartay. 2006. Cernunnos interacts with the XRCC4 x DNA-ligase IV complex 401

and is homologous to the yeast nonhomologous end-joining factor Nej1. The Journal 402

of biological chemistry 281:13857-13860. 403

9. de Villartay, J. P. 2009. V(D)J recombination deficiencies. Advances in 404

experimental medicine and biology 650:46-58. 405

10. Ferguson, D. O., and F. W. Alt. 2001. DNA double strand break repair and 406

chromosomal translocation: lessons from animal models. Oncogene 20:5572-5579. 407

11. Frank, K. M., N. E. Sharpless, Y. Gao, J. M. Sekiguchi, D. O. Ferguson, C. Zhu, 408

J. P. Manis, J. Horner, R. A. DePinho, and F. W. Alt. 2000. DNA ligase IV 409

deficiency in mice leads to defective neurogenesis and embryonic lethality via the 410

p53 pathway. Molecular cell 5:993-1002. 411

12. Gao, Y., D. O. Ferguson, W. Xie, J. P. Manis, J. Sekiguchi, K. M. Frank, J. 412

Chaudhuri, J. Horner, R. A. DePinho, and F. W. Alt. 2000. Interplay of p53 and 413

DNA-repair protein XRCC4 in tumorigenesis, genomic stability and development. 414

Nature 404:897-900. 415


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

18

13. Guo, J., A. Hawwari, H. Li, Z. Sun, S. K. Mahanta, D. R. Littman, M. S. 416

Krangel, and Y. W. He. 2002. Regulation of the TCRalpha repertoire by the 417

survival window of CD4(+)CD8(+) thymocytes. Nature immunology 3:469-476. 418

14. Hammel, M., M. Rey, Y. Yu, R. S. Mani, S. Classen, M. Liu, M. E. Pique, S. 419

Fang, B. L. Mahaney, M. Weinfeld, D. C. Schriemer, S. P. Lees-Miller, and J. A. 420

Tainer. 2011. XRCC4 protein interactions with XRCC4-like factor (XLF) create an 421

extended grooved scaffold for DNA ligation and double strand break repair. The 422

Journal of biological chemistry 286:32638-32650. 423

15. Helmink, B. A., and B. P. Sleckman. 2011. The Response to and Repair of RAG-424

Mediated DNA Double-Strand Breaks. Annual review of immunology. 425

16. Kjer-Nielsen, L., O. Patel, A. J. Corbett, J. Le Nours, B. Meehan, L. Liu, M. 426

Bhati, Z. Chen, L. Kostenko, R. Reantragoon, N. A. Williamson, A. W. Purcell, 427

N. L. Dudek, M. J. McConville, R. A. O'Hair, G. N. Khairallah, D. I. Godfrey, 428

D. P. Fairlie, J. Rossjohn, and J. McCluskey. 2012. MR1 presents microbial 429

vitamin B metabolites to MAIT cells. Nature. 430

17. Krangel, M. S., J. Carabana, I. Abbarategui, R. Schlimgen, and A. Hawwari. 431

2004. Enforcing order within a complex locus: current perspectives on the control of 432

V(D)J recombination at the murine T-cell receptor alpha/delta locus. Immunological 433

reviews 200:224-232. 434

18. Le Bourhis, L., L. Guerri, M. Dusseaux, E. Martin, C. Soudais, and O. Lantz. 435

2011. Mucosal-associated invariant T cells: unconventional development and 436

function. Trends in immunology 32:212-218. 437

19. Le Bourhis, L., E. Martin, I. Peguillet, A. Guihot, N. Froux, M. Core, E. Levy, 438

M. Dusseaux, V. Meyssonnier, V. Premel, C. Ngo, B. Riteau, L. Duban, D. 439


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

19

Robert, S. Huang, M. Rottman, C. Soudais, and O. Lantz. 2010. Antimicrobial 440

activity of mucosal-associated invariant T cells. Nature immunology 11:701-708. 441

20. Lee, G. S., M. B. Neiditch, S. S. Salus, and D. B. Roth. 2004. RAG proteins 442

shepherd double-strand breaks to a specific pathway, suppressing error-prone repair, 443

but RAG nicking initiates homologous recombination. Cell 117:171-184. 444

21. Li, G., F. W. Alt, H. L. Cheng, J. W. Brush, P. H. Goff, M. M. Murphy, S. 445

Franco, Y. Zhang, and S. Zha. 2008. Lymphocyte-specific compensation for 446

XLF/cernunnos end-joining functions in V(D)J recombination. Molecular cell 447

31:631-640. 448

22. Li, Y., D. Y. Chirgadze, V. M. Bolanos-Garcia, B. L. Sibanda, O. R. Davies, P. 449

Ahnesorg, S. P. Jackson, and T. L. Blundell. 2008. Crystal structure of human 450

XLF/Cernunnos reveals unexpected differences from XRCC4 with implications for 451

NHEJ. The EMBO journal 27:290-300. 452

23. Liang, H. E., L. Y. Hsu, D. Cado, L. G. Cowell, G. Kelsoe, and M. S. Schlissel. 453

2002. The "dispensable" portion of RAG2 is necessary for efficient V-to-DJ 454

rearrangement during B and T cell development. Immunity 17:639-651. 455

24. Lieber, M. R. 2010. The mechanism of double-strand DNA break repair by the 456

nonhomologous DNA end-joining pathway. Annual review of biochemistry 79:181-457

211. 458

25. Lu, H., U. Pannicke, K. Schwarz, and M. R. Lieber. 2007. Length-dependent 459

binding of human XLF to DNA and stimulation of XRCC4.DNA ligase IV activity. 460

The Journal of biological chemistry 282:11155-11162. 461

26. Martin, E., E. Treiner, L. Duban, L. Guerri, H. Laude, C. Toly, V. Premel, A. 462

Devys, I. C. Moura, F. Tilloy, S. Cherif, G. Vera, S. Latour, C. Soudais, and O. 463


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

20

Lantz. 2009. Stepwise development of MAIT cells in mouse and human. PLoS 464

biology 7:e54. 465

27. Mauvieux, L., I. Villey, and J. P. de Villartay. 2001. T early alpha (TEA) regulates 466

initial TCRVAJA rearrangements and leads to TCRJA coincidence. European 467

journal of immunology 31:2080-2086. 468

28. Pannetier, C., M. Cochet, S. Darche, A. Casrouge, M. Zoller, and P. Kourilsky. 469

1993. The sizes of the CDR3 hypervariable regions of the murine T-cell receptor 470

beta chains vary as a function of the recombined germ-line segments. Proceedings of 471

the National Academy of Sciences of the United States of America 90:4319-4323. 472

29. Pasquier, B., L. Yin, M. C. Fondaneche, F. Relouzat, C. Bloch-Queyrat, N. 473

Lambert, A. Fischer, G. de Saint-Basile, and S. Latour. 2005. Defective NKT cell 474

development in mice and humans lacking the adapter SAP, the X-linked 475

lymphoproliferative syndrome gene product. The Journal of experimental medicine 476

201:695-701. 477

30. Riballo, E., L. Woodbine, T. Stiff, S. A. Walker, A. A. Goodarzi, and P. A. 478

Jeggo. 2009. XLF-Cernunnos promotes DNA ligase IV-XRCC4 re-adenylation 479

following ligation. Nucleic acids research 37:482-492. 480

31. Ropars, V., P. Drevet, P. Legrand, S. Baconnais, J. Amram, G. Faure, J. A. 481

Marquez, O. Pietrement, R. Guerois, I. Callebaut, E. Le Cam, P. Revy, J. P. de 482

Villartay, and J. B. Charbonnier. 2011. Structural characterization of filaments 483

formed by human Xrcc4-Cernunnos/XLF complex involved in nonhomologous 484

DNA end-joining. Proceedings of the National Academy of Sciences of the United 485

States of America 108:12663-12668. 486

32. Schatz, D. G., and P. C. Swanson. 2011. V(D)J recombination: mechanisms of 487

initiation. Annual review of genetics 45:167-202. 488


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

21

33. Soulas-Sprauel, P., G. Le Guyader, P. Rivera-Munoz, V. Abramowski, C. 489

Olivier-Martin, C. Goujet-Zalc, P. Charneau, and J. P. de Villartay. 2007. Role 490

for DNA repair factor XRCC4 in immunoglobulin class switch recombination. The 491

Journal of experimental medicine 204:1717-1727. 492

34. Sun, Z., D. Unutmaz, Y. R. Zou, M. J. Sunshine, A. Pierani, S. Brenner-Morton, 493

R. E. Mebius, and D. R. Littman. 2000. Requirement for RORgamma in thymocyte 494

survival and lymphoid organ development. Science 288:2369-2373. 495

35. Vajdic, C. M., L. Mao, M. T. van Leeuwen, P. Kirkpatrick, A. E. Grulich, and 496

S. Riminton. 2010. Are antibody deficiency disorders associated with a narrower 497

range of cancers than other forms of immunodeficiency? Blood 116:1228-1234. 498

36. van der Burg, M., and A. R. Gennery. 2011. Educational paper. The expanding 499

clinical and immunological spectrum of severe combined immunodeficiency. 500

European journal of pediatrics 170:561-571. 501

37. Villey, I., D. Caillol, F. Selz, P. Ferrier, and J. P. de Villartay. 1996. Defect in 502

rearrangement of the most 5' TCR-J alpha following targeted deletion of T early 503

alpha (TEA): implications for TCR alpha locus accessibility. Immunity 5:331-342. 504

38. Villey, I., P. Quartier, F. Selz, and J. P. de Villartay. 1997. Germ-line 505

transcription and methylation status of the TCR-J alpha locus in its accessible 506

configuration. European journal of immunology 27:1619-1625. 507

39. Wu, Q., T. Ochi, D. Matak-Vinkovic, C. V. Robinson, D. Y. Chirgadze, and T. 508

L. Blundell. 2011. Non-homologous end-joining partners in a helical dance: 509

structural studies of XLF-XRCC4 interactions. Biochemical Society transactions 510

39:1387-1392, suppl 1382 p following 1392. 511

40. Zha, S., C. Guo, C. Boboila, V. Oksenych, H. L. Cheng, Y. Zhang, D. R. 512

Wesemann, G. Yuen, H. Patel, P. H. Goff, R. L. Dubois, and F. W. Alt. 2011. 513


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

22

ATM damage response and XLF repair factor are functionally redundant in joining 514

DNA breaks. Nature 469:250-254. 515

516


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

23

Figure legends 517

Figure 1. Generation of Cernu-/- mice. (A) Schematic representation of the KO strategy and 518

location of the external 5’probe. Exon 4 was flanked by LoxP sites. (B) Southern blot 519

analysis of tail DNA showing the 6.3Kb wt. band and 4.9Kb KO allele on BclI digest using 520

the 5’probe. (C) Mendelian distribution in offspring of Cernu+/-xCernu+/- and Cernu+/-521

xCernu-/- intercrosses. (D) Quantitative RT-PCR evaluation of Cernunnos transcript levels in 522

thymus and spleen of +/+, +/-, and -/- littermates. (E) WB analysis showing the absence of 523

35kDa Cernunnos protein in MEFs. Anti-Ku-70 ab was used as loading control. **: non-524

specific band (F) Phleomycin sensitivity of Cernu-/- (green circles), Xrcc4-/- (grey circles), 525

DNA-Lig4-/- (black circles), and wt. (orange circles) MEFs. Represented is one of two 526

separate experiments, with values representing the mean of two independent determinations 527

for each point. 528

529

Figure 2. (A) lymphocyte cellularity in thymus, spleen, and lymph nodes (LN) of Cernu+/- 530

and Cernu-/- mice. (B) V(D)J recombination activity in purified CD4-CD8- thymocytes. 531

Transduced cells are identified through the expression of the huCD4 gene from the reporter. 532

The % of recombination represents the fraction of GFP positive cells among the huCD4 533

positive cells. The relative V(D)J activity is calculated par comparison to the level attained 534

in thymocytes from Cernu+/- mice used as 100% activity control. (C) Proliferative capacity 535

of thymocytes. Cernu-/-Rag1-/- and Rag1-/- mice were injected i.p. with anti-CD3. 536

537

Figure 3. (A) Nucleotide sequence analysis of Coding Joins recovered from pMX-RSS-538

12/23 transduced thymocytes from 2 Cernu+/- and 2 Cernu-/- mice. (B) Similar frequency of 539

nucleotide loss at Coding Joins recovered from pMX-RSS-12/23 transduced thymocytes 540

from Cernu+/- and Cernu-/- mice. 541


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

24

542

Figure 4. Immunoscope of TCRβ (A) and TCRα (B) from 2 Cernu-/- (R6 and R8) and 2 543

Cernu+/- (R7 and R9) mice. (C) Differential representation of distal (5’) and proximal (3’) 544

Vα in Cernu-/- and Cernu+/- T cells. 545

546

Figure 5. (A) Schematic representation of the murine TCR Vα and Jα clusters and position 547

of the three Vα genes co-amplified in PCR conditions using a unique set of primers. (B) 548

Differential representation of distal Vαs (mTRAV3.1 and mTRAV5.1) versus proximal Vαs 549

(mTRAV3.4) after cloning and sequencing of RT-PCR products from thymus and spleen. 550

(C) TCR-Jα representation in dist. and prox. Vαs containing transcripts from thymus and 551

spleen of Cernu-/- and Cernu+/- mice. Vertical red lines correspond to the median for Jα 552

usage. 553

554

Figure 6. TCRα repertoire in human Cernunnos patient. (A) Box and whiskers 555

representation of Vα and Jα usage in TCRα transcripts from one Cernunnos patient and one 556

control individual as determined by 5’RACE PCR and Next Generation Sequencing (NGS). 557

Each VαJα transcript (black and grey dots for Cernunnos patients and control respectively) 558

is positioned according to the relative location (in bp) of its Vα and Jα element in the 559

genome. (B) Contour plots representation of TCRα transcripts from Cernunnos patient (431 560

sequences) and control (1423 sequences). Blue and red bullets represent the VαJα 561

barycenter in each case. (C) Boxes representing 75% of TCRα transcript sequences for a 562

Cernunnos patient (orange square) and a control (blue square). The two green bullets 563

represent the theoretical position of TCRα chains from iNKT (hTRAV10, pos. 2.0 105 bp; 564


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

25

hTRAJ18 pos. 5.0 104) and MAIT (hTRAV1.2, pos. 0.2 105 bp; hTRAJ33, pos. 3.3 104 bp) 565

cells respectively. 566

567

Figure 7. (A) Determination of iNKT cells in spleen by dual staining with anti-TCRβ and 568

CD1-d tetramer. (B) Schematic representation of the human and murine TCR Vα and Jα 569

clusters with the location of TRAV and TRAJ used by iNKT cells. Two Jα can be used by 570

murine NKT cells, TRAV11D or the most downstream TRAV11 because of the duplication 571

of the central TCR-Jα segments in mice. 572

573

Figure 8. Thymocyte survival (A) and apoptosis (B) in 24h culture in vitro. (C) Quantitative 574

RT-PCR analysis of P53 target genes in Cernu-/- thymocytes. 575

576

Figure 9. Partial normalization of Cernu-/- thymocyte viability upon P53 inactivation. (A) 577

Total thymocyte counts. (B) Thymocyte relative survival in 24h culture. (C) Differential 578

TCR-Vα usage in splenic T cells using PCR co-amplification of two 5’Vα (Va3.1 and 579

Va5.1) and one 3’Vα(Va3.4). The vertical red lines represent the medians for Jα usage. (D) 580

iNKT cell recovery in spleen. 581

582

Figure 10. Multiple waves of TCRα rearrangements during thymocyte development. DNA 583

accessibility in the TCRJα cluster is regulated such that the first VαJα rearrangements are 584

targeted to the 5’ side of the TCR-Jα cluster. If the thymocytes expressing the resulting TCR 585

are not positively selected, Rag1 and Rag2 expression continues and a second wave of 586

rearrangement involving upstream Vα and downstream Jα occurs. In the absence of 587

positive selection of this newly expressed TCR, a third wave of VαJα recombination occurs 588

and so on. The possibility of thymocytes to undergo several waves of TCRα rearrangement 589


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Vera et al.

26

depends on their lifespan. In RORγT-/- mice the thymocyte viability is decreased resulting in 590

a bias of Jα usage towards the most 5’ elements (first wave). In contrary, the thymocyte 591

lifespan is increased in BclXL Tg mice allowing several waves of recombination and the 592

resulting skewing of Jα usage toward the most downstream elements. 593


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Cernunnos deficiency reduces thymocyte lifespan and alters the T ...

Documents

Transcript of Cernunnos deficiency reduces thymocyte lifespan and alters the T ...