lable at ScienceDirect

Biochemical and Biophysical Research Communications 467 (2015) 223e228

Contents lists avai

Biochemical and Biophysical Research Communications

journal homepage: www.elsevier .com/locate/ybbrc

Long non-coding RNA ANRIL is up-regulated in bladder cancer andregulates bladder cancer cell proliferation and apoptosis through theintrinsic pathway

Hongxue Zhu a, b, 1, Xuechao Li a, 1, Yarong Song a, Peng Zhang a, Yajun Xiao a, Yifei Xing a, *

a Department of Urology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, PR Chinab Department of Urology, Hospital of Xinjiang Production and Construction Corps, Urumqi 830002, PR China

a r t i c l e i n f o

Article history:Received 23 September 2015Accepted 1 October 2015Available online 9 October 2015

Keywords:ANRILBladder cancerProliferationApoptosisThe intrinsic pathway

* Corresponding author. Department of Urology, UnCollege, Huazhong University of Science and Technolo430022, PR China.

E-mail address: yifei_xing@163.com (Y. Xing).1 These authors contributed equally to this work.

http://dx.doi.org/10.1016/j.bbrc.2015.10.0020006-291X/© 2015 Elsevier Inc. All rights reserved.

a b s t r a c t

Antisense non-coding RNA in the INK4 locus (ANRIL) is a member of long non-coding RNAs and has beenreported to be dysregulated in several human cancers. However, the role of ANRIL in bladder cancerremains unclear. This present study aimed to investigate whether and how ANRIL involved in bladdercancer. Our results showed up-regulation of ANRIL in bladder cancer tissues versus the correspondingadjacent non-tumor tissues. To explore the specific mechanisms, ANRIL was silenced by small interferingRNA or short hairpin RNA transfection in human bladder cancer T24 and EJ cells. Knockdown of ANRILrepressed cell proliferation and increased cell apoptosis, along with decreased expression of Bcl-2 andincreased expressions of Bax, cytoplasmic cytochrome c and Smac and cleaved caspase-9, caspase-3 andPARP. However, no change of cleaved caspase-8 level was observed. Furthermore, in vivo experimentconfirmed that knockdown of ANRIL inhibited tumorigenic ability of EJ cells in nude mice. Meanwhile, inaccordance with in vitro study, knockdown of ANRIL inhibited expression of Bcl-2 and up-regulatedexpressions of Bax and cleaved caspase-9, but did not affect cleaved caspase-8 level. In conclusion, wefirst report that ANRIL possibly serves as an oncogene in bladder cancer and regulates bladder cancer cellproliferation and apoptosis through the intrinsic apoptosis pathway.

© 2015 Elsevier Inc. All rights reserved.

1. Introduction

Bladder cancer is a common genitourinary malignancy with anestimated 429,800 new cases and 165,100 deaths in 2012 world-wide [1]. The incidence of bladder cancer rises with age, and theprognosis of locally muscle-invasive bladder cancer remains poordespite the therapeutic improvement in bladder cancer manage-ment [2]. Therefore, it remains a great challenge to uncover thespecific molecular mechanisms of bladder cancer and identify newbiomarkers and therapeutic targets for clinical management ofbladder cancer patients.

Long non-coding RNAs (LncRNAs) refer to non-protein codingtranscripts with more than 200 nucleotides in length, which havegained extensive attention for their wide range of biological regu-latory functions [3]. Increasing evidences have confirmed that

ion Hospital, Tongji Medicalgy, 1277 Jiefang Ave., Wuhan

lncRNAs are closely related to development and progression ofhuman cancers [4,5]. Several lncRNAs act as tumor suppressors, forexample, GAS5 [6], MEG3 [7], while others serve as oncogenes, suchas MALAT1 [8] and HOTAIR [9].

LncRNA antisense non-coding RNA in the INK4 locus (ANRIL)was first identified from familial melanoma patients with neuralsystem tumors and a germ-line deletion of the entire INK4B-ARF-INK4A gene cluster [10]. ANRIL encodes a 3834-nt RNA that con-tains 19 exons at the antisense orientation of the INK4B-ARF-INK4Agene cluster, where three important tumor suppressors, p14ARF,p15INK4b and p16INK4a, were transcribed [11]. The locus whereANRIL locates is homozygously deleted or transcriptionally silencedin approximately 40% of human cancers [12]. Accumulated datareveal that up-regulation of ANRIL is regarded as a risk factor inseveral types of human cancers, including hepatocellular carci-noma [13,14], lung cancer [15e17], ovarian cancer [18], gastriccancer [19], breast cancer, esophageal squamous cell carcinoma[20], etc. However, the function of ANRIL in bladder cancer has notbeen described. Herein, our work aimed to investigate the rela-tionship between ANRIL and bladder cancer. Our data showed that

H. Zhu et al. / Biochemical and Biophysical Research Communications 467 (2015) 223e228224

ANRIL was up-regulated in bladder cancer tissues versus the cor-responding adjacent non-tumor tissues. Furthermore, we foundthat ANRIL could regulate bladder cancer cell proliferation andapoptosis in vitro and in vivo through the intrinsic apoptosispathway. Our findings imply that ANRIL may be harnessed as anovel biomarker and therapeutic target for bladder cancer.

2. Materials and methods

2.1. Patients and specimens

From January 2013 to October 2013, 51 pairs of bladder cancerspecimens and the corresponding adjacent non-tumor tissues werecollected from bladder cancer patients, who had undergone radicalcystectomy at Department of Urology, Union Hospital, TongjiMedical College, Huazhong University of Science and Technology,Wuhan, P. R. China. All the patients were diagnosed as bladdertransitional cell cancer by histopathological examination. Theresearch was approved by the Institutional Review Board, TongjiMedical College, Huazhong University of Science and Technology,Wuhan, P. R. China, and written informed consents had been ob-tained from each patient before surgery.

2.2. Quantitative reverse transcription polymerase chain reaction(qRT-PCR)

Total RNA was extracted from cells or tissues by Trizol (Invi-trogen, Carlsbad, CA, USA). RNA samples were reverse transcribedusing Transcriptor First Strand cDNA Synthesis Kit (Invitrogen). RT-qPCR was performed using the SYBR Green PCR kit (Toyobo, Osaka,Japan). GAPDH was used as the endogenous control. The primerpairs were listed as follows: ANRIL, 50- TGCTCTATCCGCCAATCAGG-30 (sense) and 50- GGGCCTCAGTGGCACATACC-30 (antisense) [21];GAPDH, 50- AGAAGGCTGGGGCTCATTTG-30 (sense) and 50-AGGGGCCATCCACAGTCTTC-30 (antisense) [22].

2.3. Cell culture

Human bladder cancer T24 cells were obtained from AmericanType Culture Collection and human bladder cancer EJ cells weregifted by Prof. Fuqing Zeng (Union Hospital, Tongji Medical College,Huazhong University of Science and Technology, Wuhan, P. R.China). Both the cells were cultured in RPMI-1640 medium (Gibco,

Fig. 1. ANRIL was significantly up-regulated in bladder cancer tissues. ANRIL expression was(n ¼ 51) by qRT-PCR and normalized to GAPDH expression. Results were presented as the enon-coding RNA in the INK4 locus. qRT-PCR, quantitative reverse transcription polymerase

Grand Island, NY, USA) with 10% fetal bovine serum (HyClone,Logan, UT, USA) at 37 �C with 5% CO2.

2.4. Down-regulation of ANRIL

ANRIL was silenced in T24 and EJ cells with small interfering RNA(siRNA) for ANRIL (si-ANRIL) or short hairpin RNA (shRNA) for ANRIL(sh-ANRIL), which were synthesized by RiboBio (Guangzhou, P. R.China) and Genechem (Shanghai, P. R. China), respectively. Cells wereseeded in 6-well plates at 60% confluency. Next day, appropriateamount of si-ANRIL (or sh-ANRIL) or negative control siRNA (si-NC)[or negative control shRNA (sh-NC)] and Lipofectamine 2000 trans-fection reagent (Invitrogen) were diluted in Opti-MEM Reduced-Serum Medium (Gibco), respectively, co-incubated for 20 min atroom temperature and added into each well. Stably transfected cellswere selected by G418 (EMD Chemicals, Inc., San Diego, CA). Thesequences of si-ANRIL and sh-ANRIL were GGUCAUCUCAUUGCU-CUAU and GGTCATCTCATTGCTCTATCC, respectively [21].

2.5. Cell proliferation assay

Cells transfected with si-NC or si-ANRIL (5 � 103 cells per well)were seeded in 96-well plates for 0 h, 24 h, 48 h, and 72 h. Then, 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenylthtrazolium bromide(MTT) solution (20 ml per well; Sigma, St. Louis, MO) was added intoeach well for 4 h. DMSO (150 ml per well; Sigma) was added intoeach well for 10 min. Absorbance at 570 nm was measured on amicroplate reader.

2.6. Colony formation assay

Cells transfected with si-NC or si-ANRIL (500 cells per well)were seeded into 6-well plates for 14 days. Colonies were fixedwithmethanol and stained with 0.1% crystal violet (SigmaeAldrich, St.Louis, MO, USA). Colonies with more than 50 cells were counted.

2.7. Flow cytometry

Cells transfected with si-NC or si-ANRIL (5 � 105 cells per well)were seeded in 6-well plated for 48 h and then harvested. Cellswere stained with FITC-Annexin V and PI (BD, San Diego, CA, USA)according to the manufacturer's instructions. Apoptosis rate wasdetected by flow cytometry (FACScan; Becton Dickinson, Mountain

examined in bladder cancer tissues (n ¼ 51) and the corresponding non-tumor tissuesxpression level in tumor tissues relative to that in non-tumor tissues. ANRIL, antisensechain reaction.

Fig. 2. Knockdown of ANRIL inhibited bladder cancer cell proliferation and induced cell apoptosis in vitro. (A) The ANRIL expression levels in T24 and EJ cells transfected with si-NCor si-ANRIL were detected by qRT-PCR. (B)The cell proliferation of T24 and EJ cells transfected with si-NC or si-ANRIL was determined at the appointed time points by MTT. (C)Colony formation assay was performed to detect the proliferation of T24 and EJ cells transfected with si-NC or si-ANRIL for 14 days. (D) Flow cytometry was used to analyze the cellapoptosis of T24 and EJ cells transfected with si-NC or si-ANRIL for 48 h si-ANRIL, small interfering RNA for ANRIL; si-NC, negative control small interfering RNA for ANRIL. *p ＜0.05.

H. Zhu et al. / Biochemical and Biophysical Research Communications 467 (2015) 223e228 225

View, CA, USA).

2.8. Western blot analysis

For Smac and cytochrome c (cyt c), cytoplasmic protein was

isolated using Mitochondria/Cytosol Fractionation kit (BioVision,Inc., Milpitas, CA, USA). Total protein was isolated from cells withcell lysis buffer (Beyotime, Jiangsu, China) or from tumor tissueswith RIPA lysis buffer (Beyotime). Proteins were separated by SDS-PAGE and transferred onto PVDF membranes. Membranes were

Fig. 3. ANRIL regulated bladder cancer cells apoptosis through the intrinsic pathwayin vitro. (A and B) The expression levels of cleaved PARP, caspase-3, caspase-8 andcaspase-9, Bcl-2, Bax and cytoplasmic cyt c and Smac were detected in T24 and EJ cellstransfected with si-NC or si-ANRIL by western blot. cyt c, cytochrome c.

Fig. 4. ANRIL regulated bladder cancer cell growth and apoptosis through the intrinsicpathway in vivo. (A) Tumors from EJ cells stably transfected with sh-NC or sh-ANRIL.(B) Tumor weights were compared between sh-NC and sh-ANRIL groups. (C) qRT-PCR was performed to detect ANRIL expression levels in tumors from EJ cells stablytransfected with sh-NC or sh-ANRIL. (D) The expression levels of cleaved caspase-8 andcaspase-9, Bcl-2 and Bax proteins were determined in tumors from EJ cells stablytransfected with sh-NC or sh-ANRIL by western blot. sh-ANRIL, short hairpin RNA forANRIL; sh-NC, negative control short hairpin RNA for ANRIL. *p ＜ 0.05.

H. Zhu et al. / Biochemical and Biophysical Research Communications 467 (2015) 223e228226

blocked with 5% non-fat milk, incubated with primary antibodiescleaved caspase-8 [Cell Signaling Technology (CST), Danvers, MA,USA], Bcl-2 (Santa Cruz, CA, USA), Bax (Santa Cruz), Smac (CST), cytc (CST), cleaved caspase-9 (CST), cleaved caspase-3 (CST), cleavedPARP (CST), and GAPDH (CST) at 4 �C overnight and then incubatedwith secondary antibodies. Bands were visualized with ECL reagent(Amersham Biosciences, Piscataway, NJ, USA). GAPDH was used asthe loading control.

2.9. In vivo experiments

All the experimental protocols were approved by the Institu-tional Animal Care and Use Committee of Huazhong University ofScience and Technology, Wuhan, P. R. China. Four-week old BALB/cnude mice were randomly divided into two groups, with 4 mice ineach group. EJ cells stably transfected with sh-NC or sh-ANRIL(5 � 106 cells per mouse) were injected subcutaneously on theright flanks of mice for 21 days. Then, the mice were sacrificed bycervical dislocation, and the tumors were removed and weighed.

2.10. Statistical analysis

All data were expressed as Mean ± standard deviation. All sta-tistical analyses were done with Statistical Package for the SocialSciences (SPSS), version 17.0 (SPSS Inc., Chicago, IL, USA). P < 0.05

was considered statistically significant.

3. Results

3.1. ANRIL was significantly up-regulated in bladder cancer tissues

The qRT-PCR analysis showed that ANRIL was up-regulated in78.43% (40 of 51) of bladder cancer tissues, compared with thecorresponding adjacent non-tumor tissues (Fig. 1), which impliedthat ANRIL might play an oncogenic role in bladder cancer.

3.2. Knockdown of ANRIL inhibited bladder cancer cell proliferationand induced cell apoptosis in vitro

To investigate the potential role of ANRIL in bladder cancer cellproliferation and cell apoptosis, si-ANRIL was transfected intobladder cancer T24 and EJ cells, respectively. The qRT-PCR analysisconfirmed that expression of ANRIL was effectively reduced in bothcell lines (Fig. 2A), using an interference target sequence of ANRILreported by Kotake [21]. Further, MTT and colony formation assaysshowed that Cell proliferation and colony-forming efficiencies of

H. Zhu et al. / Biochemical and Biophysical Research Communications 467 (2015) 223e228 227

T24 and EJ cells were both significantly suppressed with ANRILdown-regulation, compared with si-NC group (Fig. 2B and C).Moreover, flow cytometry analysis revealed that ANRIL knockdownremarkably promoted cell apoptosis of T24 and EJ cells (Fig. 2D).

3.3. ANRIL regulated bladder cancer cells apoptosis through theintrinsic pathway in vitro

Cell apoptosis are regulated through two major pathways: theintrinsic apoptosis pathway, alternatively named mitochondria-associated pathway, and the extrinsic apoptosis pathway, alsoknown as death receptor signaling pathway [23]. Caspases, a familyof cysteine proteases, are the central regulators of apoptosis.Capase-3, one effector caspase, is activated either by initiatorcaspase-9 in intrinsic pathway or by initiator caspase-8 in extrinsicpathway [24]. Western blot analysis was performed to explore thepotential role of ANRIL in bladder cancer cell apoptosis. With ANRILknockdown, cleaved caspse-9, caspase-3 and PARP were evidentlyincreased, while the level of cleaved capase-8 was not changed(Fig. 3A), which implied that the intrinsic pathway was activated.Our further data revealed that Bcl-2 and Bax, the key proteins of theintrinsic pathway, were down-regulated and up-regulated,respectively, accompanied with increased cytoplasmic cyt c andSmac (Fig. 3B).

3.4. ANRIL regulated bladder cancer cell growth and apoptosisthrough the intrinsic pathway in vivo

To explore whether ANRIL affected tumorigenesis of bladdercancer cells, EJ cells stably transfected with sh-NC or sh-ANRIL wereinjected into nude mice for 21 days. The results showed tumorweights of the sh-ANRIL group were remarkably lower than that inthe sh-NC group (Fig. 4B). Meanwhile, qRT-PCR demonstrated thatANRIL expressions in the sh-ANRIL group were lower than those inthe si-NC group (Fig. 4C). Consistently with in vitro experiment,tumors in the sh-ANRIL group showed up-regulated expressions ofBax and cleaved caspase-9, reduced expression of Bcl-2 and nochange of cleaved caspase-8 level, compared to those in the sh-NCgroup (Fig. 4D). The above data further confirmed the function ofANRIL on bladder cancer cell proliferation and apoptosis.

4. Discussion

LncRNAs are regard as potential therapeutic targets for humancancers, and previous studies reveal that several lncRNAs playcrucial role in regulating cancer cell proliferation, migration andinvasion. For example, lncRNA H19 is highly expressed in humanembryos and fetal tissues and nearly completely shut off in adults,while it re-expresses in multiple tumors, including bladder cancer[25]. H19 promotes bladder cancer metastasis in vitro and in vivo byup-regulating EZH2 expression and down-regulating E-cadherinexpression [26]. Therefore, H19 is supposed as a prognostic tumormarker for the early recurrence of bladder cancer [27].

Recent evidences reveal that another lncRNA, ANRIL, regulatescancer cell proliferation, apoptosis and metastasis, and is positivelycorrelated with poor prognosis of several human cancers, such ashepatocellular carcinoma, lung cancer, ovarian cancer, gastric can-cer [13e19]. However, the role of ANRIL in bladder cancer remainsunclear. Here, we first clarify the correlation of ANRIL with bladdercancer. Our data showed that ANRIL was significantly up-regulatedin bladder cancer tissues versus the corresponding non-tumortissues, which indicates that ANRIL possibly plays an importantrole in development and progression of bladder cancer. Moreover,knockdown of ANRIL could lead to the obvious inhibition of bladdercancer cell proliferation both in vitro and in vivo. In addition, flow

cytometric analysis indicated that down-regulation of ANRILrepressed bladder cancer cell proliferation by inducing apoptosis.The above findings suggest that ANRIL might function as an onco-gene and contribute to bladder cancer development and progres-sion via regulating cell proliferation and apoptosis.

Apoptosis is a programmed cellular suicide mechanism andmaintains cellular homeostasis. However, cancer cells can overrideapoptosis via amplifying anti-apoptotic machinery and/or down-regulating pro-apoptotic program [28]. In this study, followingdown-regulation of ANRIL, cleaved caspse-9, caspase-3 and PARPwere obviously increased, while the level of cleaved capase-8 wasnot altered, which implied activation of the intrinsic pathwayrather than the extrinsic pathway. The intrinsic pathway is regu-lated by Bcl-2 family proteins, which control the stability of mito-chondrial membrane. Anti-apoptotic protein Bcl-2, located in theouter mitochondrial membrane, inhibits the activity of Bax and therelease of cyt c and Smac from mitochondria into cytoplasm, whileactivated Bax participates in formation of pores in the outer mito-chondrial membrane and leads to the release of cyt c and Smac,which activate caspase-9 and thus caspase-3 [29,30]. Our furtherdata revealed that knockdown of ANRIL reduced the expression ofBcl-2 and increased the level of Bax and cytoplasmic cyt c and Smac.These results demonstrated that ANRIL regulated bladder cancercell apoptosis through the intrinsic pathway, which was also sup-ported by in vivo experiment.

To our knowledge, this is the first report that showed lncRNAANRIL could regulate bladder cancer cell proliferation andapoptosis. Collectively, we showed that ANRIL was significantlyover-expressed in bladder cancer tissues and regulated bladdercancer cell proliferation and apoptosis both in vitro and in vivothrough the intrinsic pathway. Our study may provide a promisingbiomarker and therapeutic target for clinical management ofbladder cancer.

Acknowledgments

This work was supported by grants from National Natural Sci-ence Foundation of China (No. 81272847 and No. 30973008). Wethank Prof. Fuqing Zeng (Union Hospital, Tongji Medical College,Huazhong University of Science and Technology, Wuhan, P. R.China) for gifting the human bladder cancer EJ cell line.

Transparency document

Transparency document related to this article can be foundonline at http://dx.doi.org/10.1016/j.bbrc.2015.10.002.

References

[1] L.A. Torre, F. Bray, R.L. Siegel, J. Ferlay, J. Lortet-Tieulent, A. Jemal, Globalcancer statistics, 2012, CA, Cancer J. Clin. 65 (2015) 87e108.

[2] D.S. Kaufman, W.U. Shipley, A.S. Feldman, Bladder cancer, Lancet 374 (2009)239e249.

[3] V.A. Moran, R.J. Perera, A.M. Khalil, Emerging functional and mechanisticparadigms of mammalian long non-coding RNAs, Nucleic Acids Res. 40 (2012)6391e6400.

[4] J. Okamoto, T. Hirata, Z. Chen, H.M. Zhou, I. Mikami, H. Li, A. Yagui-Beltran,M. Johansson, L.M. Coussens, G. Clement, Y. Shi, F. Zhang, K. Koizumi,K. Shimizu, D. Jablons, B. He, EMX2 is epigenetically silenced and suppressesgrowth in human lung cancer, Oncogene 29 (2010) 5969e5975.

[5] J.C. Scheuermann, L.A. Boyer, Getting to the heart of the matter: long non-coding RNAs in cardiac development and disease, EMBO J. 32 (2013)1805e1816.

[6] M. Mourtada-Maarabouni, M.R. Pickard, V.L. Hedge, F. Farzaneh, G.T. Williams,GAS5, a non-protein-coding RNA, controls apoptosis and is downregulated inbreast cancer, Oncogene 28 (2009) 195e208.

[7] C. Braconi, T. Kogure, N. Valeri, N. Huang, G. Nuovo, S. Costinean, M. Negrini,E. Miotto, C.M. Croce, T. Patel, microRNA-29 can regulate expression of thelong non-coding RNA gene MEG3 in hepatocellular cancer, Oncogene 30(2011) 4750e4756.

H. Zhu et al. / Biochemical and Biophysical Research Communications 467 (2015) 223e228228

[8] T. Gutschner, M. Hammerle, M. Eissmann, J. Hsu, Y. Kim, G. Hung, A. Revenko,G. Arun, M. Stentrup, M. Gross, M. Zornig, A.R. MacLeod, D.L. Spector,S. Diederichs, The noncoding RNA MALAT1 is a critical regulator of themetastasis phenotype of lung cancer cells, Cancer Res. 73 (2013) 1180e1189.

[9] M. Svoboda, J. Slyskova, M. Schneiderova, P. Makovicky, L. Bielik, M. Levy,L. Lipska, B. Hemmelova, Z. Kala, M. Protivankova, O. Vycital, V. Liska,L. Schwarzova, L. Vodickova, P. Vodicka, HOTAIR long non-coding RNA is anegative prognostic factor not only in primary tumors, but also in the blood ofcolorectal cancer patients, Carcinogenesis 35 (2014) 1510e1515.

[10] E. Pasmant, I. Laurendeau, D. Heron, M. Vidaud, D. Vidaud, I. Bieche, Charac-terization of a germ-line deletion, including the entire INK4/ARF locus, in amelanoma-neural system tumor family: identification of ANRIL, an antisensenoncoding RNA whose expression coclusters with ARF, Cancer Res. 67 (2007)3963e3969.

[11] C.H. Li, Y. Chen, Targeting long non-coding RNAs in cancers: progress andprospects, Int. J. Biochem. Cell Biol. 45 (2013) 1895e1910.

[12] K. Tano, N. Akimitsu, Long non-coding RNAs in cancer progression, Front.Genet. 3 (2012) 219.

[13] L. Hua, C.Y. Wang, K.H. Yao, J.T. Chen, J.J. Zhang, W.L. Ma, High expression oflong non-coding RNA ANRIL is associated with poor prognosis in hepatocel-lular carcinoma, Int. J. Clin. Exp. Pathol. 8 (2015) 3076e3082.

[14] M.D. Huang, W.M. Chen, F.Z. Qi, R. Xia, M. Sun, T.P. Xu, L. Yin, E.B. Zhang,W. De, Y.Q. Shu, Long non-coding RNA ANRIL is upregulated in hepatocellularcarcinoma and regulates cell apoptosis by epigenetic silencing of KLF2,J. Hematol. Oncol. 8 (2015) 50.

[15] Y.H. Kang, D. Kim, E.J. Jin, Down-regulation of phospholipase D stimulatesdeath of lung cancer cells involving up-regulation of the long ncRNA ANRIL,Anticancer Res. 35 (2015) 2795e2803.

[16] L. Lin, Z.T. Gu, W.H. Chen, K.J. Cao, Increased expression of the long non-coding RNA ANRIL promotes lung cancer cell metastasis and correlates withpoor prognosis, Diagn. Pathol. 10 (2015) 14.

[17] F.Q. Nie, M. Sun, J.S. Yang, M. Xie, T.P. Xu, R. Xia, Y.W. Liu, X.H. Liu, E.B. Zhang,K.H. Lu, Y.Q. Shu, Long noncoding RNA ANRIL promotes non-small cell lungcancer cell proliferation and inhibits apoptosis by silencing KLF2 and P21expression, Mol. Cancer Ther. 14 (2015) 268e277.

[18] J.J. Qiu, Y.Y. Lin, J.X. Ding, W.W. Feng, H.Y. Jin, K.Q. Hua, Long non-coding RNA

ANRIL predicts poor prognosis and promotes invasion/metastasis in serousovarian cancer, Int. J. Oncol. 46 (2015) 2497e2505.

[19] E.B. Zhang, R. Kong, D.D. Yin, L.H. You, M. Sun, L. Han, T.P. Xu, R. Xia, J.S. Yang,W. De, J. Chen, Long noncoding RNA ANRIL indicates a poor prognosis ofgastric cancer and promotes tumor growth by epigenetically silencing of miR-99a/miR-449a, Oncotarget 5 (2014) 2276e2292.

[20] D. Chen, Z. Zhang, C. Mao, Y. Zhou, L. Yu, Y. Yin, S. Wu, X. Mou, Y. Zhu, ANRILinhibits p15(INK4b) through the TGFbeta1 signaling pathway in humanesophageal squamous cell carcinoma, Cell. Immunol. 289 (2014) 91e96.

[21] Y. Kotake, T. Nakagawa, K. Kitagawa, S. Suzuki, N. Liu, M. Kitagawa, Y. Xiong,Long non-coding RNA ANRIL is required for the PRC2 recruitment to andsilencing of p15(INK4B) tumor suppressor gene, Oncogene 30 (2011)1956e1962.

[22] G. Wan, R. Mathur, X. Hu, Y. Liu, X. Zhang, G. Peng, X. Lu, Long non-coding RNAANRIL (CDKN2B-AS) is induced by the ATM-E2F1 signaling pathway, Cell.Signal 25 (2013) 1086e1095.

[23] G.S. Salvesen, C.S. Duckett, IAP proteins: blocking the road to death's door,Nat. Rev. Mol. Cell Biol. 3 (2002) 401e410.

[24] E. Varfolomeev, D. Vucic, Inhibitor of apoptosis proteins: fascinating biologyleads to attractive tumor therapeutic targets, Future Oncol. 7 (2011) 633e648.

[25] M. Elkin, A. Shevelev, E. Schulze, M. Tykocinsky, M. Cooper, I. Ariel, D. Pode,E. Kopf, N. de Groot, A. Hochberg, The expression of the imprinted H19 andIGF-2 genes in human bladder carcinoma, FEBS Lett. 374 (1995) 57e61.

[26] M. Luo, Z. Li, W. Wang, Y. Zeng, Z. Liu, J. Qiu, Long non-coding RNA H19 in-creases bladder cancer metastasis by associating with EZH2 and inhibiting E-cadherin expression, Cancer Lett. 333 (2013) 213e221.

[27] I. Ariel, M. Sughayer, Y. Fellig, G. Pizov, S. Ayesh, D. Podeh, B.A. Libdeh, C. Levy,T. Birman, M.L. Tykocinski, N. de Groot, A. Hochberg, The imprinted H19 geneis a marker of early recurrence in human bladder carcinoma, Mol. Pathol. 53(2000) 320e323.

[28] K. Fernald, M. Kurokawa, Evading apoptosis in cancer, Trends Cell Biol. 23(2013) 620e633.

[29] A. Gross, J.M. McDonnell, S.J. Korsmeyer, BCL-2 family members and themitochondria in apoptosis, Genes Dev. 13 (1999) 1899e1911.

[30] J.C. Martinou, R.J. Youle, Mitochondria in apoptosis: Bcl-2 family members andmitochondrial dynamics, Dev. Cell 21 (2011) 92e101.

本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP

图书馆。

图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页 文献云下载 图书馆入口 外文数据库大全 疑难文献辅助工具