AC

Ja

b

a

ARA

KCAR

1

pbrt0eBtitae

Co

H4

0h

International Journal of Antimicrobial Agents 40 (2012) 24– 29

Contents lists available at SciVerse ScienceDirect

International Journal of Antimicrobial Agents

j our na l ho me p age: ht tp : / /www.e lsev ier .com/ locate / i jant imicag

ssociation between PCR ribotypes and antimicrobial susceptibility amonglostridium difficile isolates from healthcare-associated infections in South Korea

ieun Kima, Jung Oak Kangb,∗, Hyunjoo Paia, Tae Yeal Choib

Department of Internal Medicine, Hanyang University College of Medicine, Seoul, South KoreaDepartment of Laboratory Medicine, Hanyang University College of Medicine, Seoul, South Korea

r t i c l e i n f o

rticle history:eceived 2 March 2012ccepted 22 March 2012

eywords:lostridium difficilentimicrobial susceptibilityibotyping

a b s t r a c t

In this study, the association between antimicrobial susceptibility, PCR ribotype and presence of theermB gene in clinical isolates of Clostridium difficile was investigated. PCR ribotyping and ermB gene PCRwere performed on 131 C. difficile isolates. The susceptibility of these isolates to metronidazole, van-comycin, piperacillin/tazobactam (TZP), clindamycin, moxifloxacin and rifaximin was also determined.Use of antibiotics within the previous 2 months was documented. Resistance rates to clindamycin, mox-ifloxacin and rifaximin were 67.9%, 62.6% and 19.1%, respectively. No metronidazole, vancomycin or TZPresistance was detected. Previous exposure to moxifloxacin was significantly correlated with resistanceto this antibiotic, but prior use of clindamycin was not significantly correlated with clindamycin resis-tance. Sixty-four strains (48.9%) carried the ermB gene, of which all but one (98.5%) were resistant to

clindamycin. The clindamycin resistance rates of the common PCR ribotypes (018, 017 and 001) were91.4%, 100% and 84.2%, respectively, and their moxifloxacin resistance rates were 91.4%, 95.0% and 78.9%,respectively. Resistance rates to rifaximin were 5.7% and 95.0% in ribotype 018 and 017 strains, whilstnone of the 001 strains were resistant to rifaximin. In conclusion, the common ribotypes 018, 017 and001 of C. difficile have high rates of resistance to clindamycin and moxifloxacin, but differ greatly in thefrequency of rifaximin resistance.

lsevie

© 2012 E

. Introduction

Clostridium difficile has been known for more than 30 years as therimary cause of antibiotic-associated diarrhoea and pseudomem-ranous colitis. Currently, a new strain known as type BI fromestriction endonuclease analysis, North American pulsed-fieldype 1 (NAP1) from pulsed-field gel electrophoresis and ribotype27 from PCR ribotyping has become the single most importantpidemic strain causing C. difficile infection (CDI) worldwide [1].ecause of the ribotype 027 strain epidemic, the incidence of CDI,he proportion of complicated cases and fatality rates have allncreased in North America and Europe [2]. However, the ribo-ype 027 strain was rarely reported in South Korea until recently,nd molecular epidemiology has instead revealed a nationwidepidemic of A−B+ strains of C. difficile starting in 2003 [3].

There are several explanations for the changing epidemiology ofDI, including alterations of antimicrobial use and the emergencef a new strain with increased virulence, antimicrobial resistance or

∗ Corresponding author. Present address: Department of Laboratory Medicine,anyang University, Guri Hospital, Gyeongchun-ro 153, Guri City, Gyeonggi-do,71-701, South Korea. Tel.: +82 31 560 2572; fax: +82 31 560 2585.

E-mail address: jokang@hanyang.ac.kr (J.O. Kang).

924-8579/$ – see front matter © 2012 Elsevier B.V. and the International Society of Chemttp://dx.doi.org/10.1016/j.ijantimicag.2012.03.015

r B.V. and the International Society of Chemotherapy. All rights reserved.

both [4]. The most commonly used antimicrobial in the 1970s wasclindamycin, and in the 1980s it was cephalosporins, but recentepidemic cases in Canada suggest that fluoroquinolones may nowplay an important role [5]. Therefore, surveillance of prior antimi-crobial use, antimicrobial resistance patterns in the communityand hospitals, and characterisation of the corresponding molecu-lar mechanisms are very important for avoiding treatment failureor complications as well as preventing nosocomial or communityspread of epidemic strains.

In this study, the association between recent antimicrobial useand antimicrobial resistance of clinical isolates of toxigenic C. dif-ficile in a tertiary care hospital in South Korea was investigated.Antimicrobial resistance in relation to epidemic PCR ribotype pat-terns and resistance genes was also analysed.

2. Materials and methods

2.1. Setting and study design

This study was conducted at Hanyang University Hospital, a

900-bed tertiary care facility located in Seoul, South Korea. FromSeptember 2008 through January 2010, all C. difficile isolates frompatients older than 18 years of age with healthcare-associated C. dif-ficile infections (HA-CDIs) were enrolled. The study was approved

otherapy. All rights reserved.

of Ant

b(

2

tmuS≥pvumom�at

2

cmsI

2

etsuBat(

2

HodCddrds

TA

v

J. Kim et al. / International Journal

y the institutional review board of Hanyang University HospitalHYUH IRB 2010-R-12). Informed consent was waived by the board.

.2. Definitions

HA-CDI was defined when the C. difficile isolates from stool cul-ures were positive for toxin genes (tcdA, tcdB, cdtA or cdtB) by

ultiplex PCR or gave positive results in toxin antigen assay A&Bsing a commercial kit (VIDAS® C. difficile Toxins A & B; bioMérieuxA, Marcy l’Étoile, France) in patients with diarrhoea that developed72 h after hospitalisation or within 2 months of the last discharge,rovided the patient had not resided in a healthcare facility. Pre-ious use of antimicrobial agents was defined when a patient hadsed the same class of antibiotics for ≥3 days within the last 2onths. Use of clindamycin, fluoroquinolones (moxifloxacin, lev-

floxacin and ciprofloxacin), rifamycins (rifampicin and rifaximin),etronidazole, glycopeptides (vancomycin and teicoplanin) and-lactam/�-lactamase inhibitors [piperacillin/tazobactam (TZP),mpicillin/sulbactam and amoxicillin/clavulanic acid] was inves-igated.

.3. Isolation of Clostridium difficile

Stool specimens were cultured anaerobically on cycloserine–efoxitin–taurocholate agar (Oxoid Ltd., Cambridge, UK) supple-ented with 7% horse blood after alcohol shock treatment of stool

pecimens. Colonies of C. difficile were identified with an API® RapidD 32A system (bioMérieux SA, Lyon, France).

.4. PCR ribotyping of Clostridium difficile

PCR ribotyping was performed using template DNA as describedlsewhere [6]. Amplification products were fractionated by elec-rophoresis through 8% acrylamide gels (30% acrylamide/bisolution, 29:1; Bio-Rad, Richmond, CA) and were visualised underltraviolet by staining gels for 30 min with ethidium bromide.anding patterns were checked visually. Each unique pattern wasssigned its own ribotype code and was matched with the PCR ribo-ypes of the reference strains ribotype 027 and ATCC 43598 strainribotype 017) [7].

.5. Antimicrobial susceptibility tests

Susceptibility tests were conducted on 143 isolates from 188A-CDI patients, and minimum inhibitory concentrations (MICs)f six antimicrobial agents (metronidazole, vancomycin, TZP, clin-amycin, moxifloxacin and rifaximin) were determined for 131. difficile isolates from 131 HA-CDI patients. The MICs of clin-amycin, moxifloxacin, metronidazole, vancomycin and TZP were

etermined by Etest (AB-BIODISK, Solna, Sweden) and those ofifaximin were determined by the agar dilution test. Clostridiumifficile ATCC 700057 was used as a quality control strain for theusceptibility tests.

able 1ntimicrobial resistance rates of 131 isolates from healthcare-associated Clostridium diffi

Antibiotic Breakpoint (mg/L)a Resistance rate [n

Clindamycin ≥8 89 (67.9)

Moxifloxacin ≥8 82 (62.6)

Rifaximin ≥4 25 (19.1)

Metronidazole ≥32 0 (0.0)

Vancomycin ≥32 0 (0.0)

Piperacillin/tazobactam ≥128/4 0 (0.0)

a The breakpoints for most antimicrobial agents were considered according to Clinicancomycin was considered according to a previous report by Huang et al. [9].

imicrobial Agents 40 (2012) 24– 29 25

Resistance breakpoints were as defined by the Clinical andLaboratory Standards Institute (CLSI) [8] (Table 1). For those antimi-crobial agents with no defined breakpoint, resistance was definedaccording to a previous report by Huang et al. [9] (Table 1). High-level resistance was defined as MICs for clindamycin of ≥256 mg/Land for moxifloxacin of ≥32 mg/L [9].

2.6. Detection of the ermB gene

ermB gene-specific PCR was performed with template DNA,as described previously, with primers 2980 (5′AATTAAGTAAAC-AGGTAACGTT3′) and 2981 (5′GCTCCTTGGAAGCTGTCAGTAG3′)[10]. A PCR product of 688 bp on electrophoresis was considereda positive result for ermB.

2.7. Statistical methods

SPSS v.13.0 for Windows (SPSS Inc., Chicago, IL) was used for sta-tistical analysis. Categorical variables were analysed by Pearson’s�2 test or Fisher’s exact test. A P-value of <0.05 by two-tailed testwas considered statistically significant.

3. Results

Among 131 isolates, 20 toxin B-only, 100 toxin A and B, and11 binary toxin as well as toxin A and B-producing isolates wereincluded.

3.1. Minimum inhibitory concentration distribution ofClostridium difficile for various antimicrobial agents

The MIC distribution patterns of the 131 C. difficile isolatesdiffered depending on the antimicrobial agent (Fig. 1). The MICsof clindamycin (Fig. 1A), moxifloxacin (Fig. 1B) and rifaximin(Fig. 1C) each formed bimodal distributions clearly separated bytheir breakpoints. The distributions of the MICs for TZP (Fig. 1D),metronidazole (Fig. 1E) and vancomycin (Fig. 1F) were unimodalwith narrow ranges of MICs.

None of the isolates were resistant to metronidazole, van-comycin or TZP (Table 1). The rates of resistance to clindamycinand moxifloxacin were 67.9% and 62.6%, respectively, and 80(61.1%) of the isolates were resistant to both drugs. The rates ofhigh-level resistance to clindamycin (≥256 mg/L) and moxifloxacin(≥32 mg/L) were 56.5% and 29.0%, respectively. Twenty-five iso-lates (19.1%) were resistant to rifaximin, of which 22 (88.0%) werealso resistant to clindamycin and 23 (92.0%) to moxifloxacin, withclose correlations between the resistances (P = 0.017 and P < 0.0001,respectively).

3.2. Correlation between antibiotic resistance and previous

antibiotic exposure

Previous use of clindamycin had a marginal effect on the pro-portion of strains resistant to clindamycin (P = 0.053). On the other

cile infection and previous antibiotic history.

(%)] Exposure to same class of antibiotics [n (%)] P-value

29 (22.1) 0.05359 (45.0) 0.019

2 (1.5)35 (26.7)27 (20.6)41 (31.3)

al and Laboratory Standards Institute guidelines [8]. Resistance to rifaximin and

26 J. Kim et al. / International Journal of Antimicrobial Agents 40 (2012) 24– 29

F idium

( agenM

hfrara

3C

ibfs(iAm

daac

cwr

ig. 1. Minimum inhibitory concentration (MIC) distribution of 131 isolates of ClostrB) and rifaximin (C), separated by vertical grey line indicating the breakpoint of each

ICs with a unimodal distribution.

and, previous use of fluoroquinolones was highly related to therequency of resistance to moxifloxacin (P = 0.019). In the case ofifaximin, none of the patients had previous exposure to rifaximinnd only two had been exposed to rifampicin, and these latter wereesistant to rifaximin. Previous use of metronidazole, vancomycinnd TZP was not associated with resistance.

.3. Antibiotic resistance according to PCR ribotypes oflostridium difficile

A total of 35 distinct PCR ribotypes was observed among the 131solates, the most common being ribotype 018 (35; 26.7%), followedy ribotype 017 (20; 15.3%) and ribotype 001 (19; 14.5%). MICsor clindamycin, moxifloxacin and rifaximin among the isolates ofeven ribotypes are shown in Table 2. The most common ribotype018) had high rates of resistance to clindamycin (91.4%) and mox-floxacin (91.4%), but a low rate of resistance to rifaximin (5.7%).ll of the clindamycin-resistant 018 isolates were also resistant tooxifloxacin.Ribotypes 001 and 112 also had high rates of resistance to clin-

amycin (84.2% and 100%) and moxifloxacin (78.9% and 75.0%),nd none of the isolates was resistant to rifaximin. All of the 001nd 112 isolates resistant to moxifloxacin were also resistant tolindamycin.

Ribotype 017 had a quite different pattern of resistance. Forlindamycin and moxifloxacin, the resistance rate of ribotype 017as 100% and 95.0%, respectively, and 95.0% were also resistant to

ifaximin.

difficile to various antimicrobial agents. (A–C) MICs of clindamycin (A), moxifloxacint. (D–F) Piperacillin/tazobactam (D), metronidazole (E) and vancomycin (F) showed

Eleven binary toxin-producing strains were identified, includingthree of ribotype 027. Ribotype 027 was not resistant to any of thesix antimicrobial agents. None of the other binary toxin-producingisolates was resistant to any of the six antimicrobial agents, exceptfor one with a MIC of 8 mg/L for rifaximin.

3.4. Presence of the ermB gene

Sixty-four isolates (48.9%) were positive for ermB. The frequencyof ermB positivity was related to resistance to clindamycin (63/89;70.8%) and high-level resistance to clindamycin (52/74; 70.3%)(P < 0.0001 and P < 0.0001, respectively). Frequencies of ermB posi-tivity varied among the PCR ribotypes. Clindamycin resistance ratesof ribotypes 018 and 017 were 91.4% and 100%, respectively. Amongthe clindamycin-resistant ribotype 018 and 017 strains, the ermBgene was detected in 100% and 85.0%, respectively. Ribotypes 001and 112 had high rates of resistance to clindamycin (84.2% and100%), but few of the clindamycin-resistant isolates were ermB-positive (5.3% and 25.0%, respectively).

4. Discussion

Rates of resistance to clindamycin in C. difficile isolates of 22–88%have been reported, depending on the study setting [11,12]. In

the present study, the rate of resistance to clindamycin was high(67.9%) and was similar to Kim et al.’s figure of 60% for SouthKorea [7]. Previous use of clindamycin had a 4.2-fold higher preva-lence odds ratio for acquisition of clindamycin resistance than

J. Kim et al. / International Journal of Antimicrobial Agents 40 (2012) 24– 29 27

Table 2Results of susceptibility testing to clindamycin, moxifloxacin and rifaximin according to PCR ribotype.

PCR ribotype Total no. Clindamycin Moxifloxacin Rifaximin

MIC (mg/L) %R MIC (mg/L) %R MIC (mg/L) %R

Range MIC50 MIC90 Range MIC50 MIC90 Range MIC50 MIC90

018 35 2 to >256 >256 >256 91.4 2–32 16 16 91.4 <0.003 to >8 0.007 0.015 5.7017 20 16 to >256 >256 >256 100.0 2–64 32 64 95.0 0.007 to >8 >8 >8 95.0001 19 1.5 to >256 >256 >256 84.2 <0.25–128 32 128 78.9 <0.003–2 0.007 2 0.0014 7 2–12 4 12 28.6 0.5–2 2 2 0.0 0.007–0.015 0.007 0.015 0.0002 6 2 to >256 3 >256 16.7 2–16 2 16 33.3 0.003–0.015 0.007 0.015 0.0112 4 12 to >256 >256 >256 100.0 2–128 64 128 75.0 <0.003–0.007 0.007 0.007 0.0

1–2

P MIC f

frwear4riBrott13

htwrt2tnfOhpbfttp

crATbc(rrp0rpmwc

027 3 3–6 6 6 0.0

CR, polymerase chain reaction; MIC, minimum inhibitory concentration; MIC50/90,

or the other antimicrobial agents [13]. However, Solomon et al.eported that exposure to macrolide–lincosamide–streptogramin Bas not associated with acquisition of resistance or presence of the

rmB gene [11]. Previous exposure to clindamycin was marginallyssociated with resistance to clindamycin (P = 0.053). The rate ofesistance to moxifloxacin in this study was 62.6%, higher than the2% reported by Kim et al. for South Korea [7], but similar to thateported by Huang et al. for China (61.8%) [12]. Resistance to mox-floxacin has received attention because of the outbreak involvingI/NAP1 C. difficile isolates [4]. Historically BI/NAP1 strains were notesistant to moxifloxacin; however, with the increasing use of flu-roquinolones, all isolates of the epidemic strain are now resistanto moxifloxacin. Since the introduction of new fluoroquinolones,he rate of resistance to moxifloxacin has increased [14,15]; it was0% in 1985–2001 and 56% in 2002–2008, and the overall rate was8.4–87.1% [11,16].

Estimates of the frequency of resistance of C. difficile to rifamycinave varied between 3% and 53.5% in different geographic loca-ions. As there is no recommended breakpoint for rifaximin, manyorkers have used the breakpoint for rifampicin, and the rate of

esistance to rifaximin is seen as like that to rifampicin [12]. Inhe case of rifaximin, the frequency of resistance was reported as.7–4.7% in the USA and 29.1% in China [17,18]. In the current study,he 19.1% resistance rate to rifaximin was similar to that in the Chi-ese study [12]. Previous use of rifamycin had a relative risk of 2.4

or developing infection due to rifampicin-resistant C. difficile [19].nly 2 (1.5%) of the 131 HA-CDI patients in the current study hadistories of prior exposure to rifamycin, and the isolates from theseatients were resistant to rifaximin, with MICs of >8 mg/L. The num-er of patients who had been exposed to rifamycin was too smallor statistical analysis, therefore more cases are needed to elucidatehe risk factors for rifaximin resistance. To compare resistance rateso rifaximin in Asia and the USA, nationwide patterns of rifamycinrescription should be surveyed.

One unusual strain resistant to metronidazole and van-omycin was encountered. Recent studies have reported decreasedates of susceptibility to metronidazole and vancomycin [20].ccording to European Committee on Antimicrobial Susceptibilityesting (EUCAST) guidelines (v.2.0; http://www.eucast.org), MICreakpoints of 2 mg/L define resistance to metronidazole and van-omycin. By these criteria, seven metronidazole-resistant strains5.3%) were isolated, comprising three ribotype 017 strains, twoibotype 018, one ribotype 001 and one strain of undeterminedibotype, as well as four vancomycin-resistant strains (3.1%), com-rising two ribotype 018 strains, 1 ribotype 017 and 1 ribotype02 (Fig. 1). None of the patients harbouring the metronidazole-esistant strains had been exposed to metronidazole within the

revious 2 months. Among them, three cases were treated withetronidazole without recurrence. One case did not improve CDIith metronidazole on treatment day 3 and after change to van-

omycin resolved diarrhoea without recurrence.

2 2 0.0 0.015 0.015 0.015 0.0

or 50% and 90% of the isolates respectively; %R, percent resistant.

The remaining three cases did not receive medication because ofself-resolved diarrhoea. Of the four patients yielding vancomycin-resistant strains, two had been exposed to vancomycin within theprevious 2 months. The treatment choice of the four cases wasmetronidazole. There was neither treatment failure nor recurrenceamong them. There are no available data for comparing the resis-tance rates for metronidazole and vancomycin according to theEUCAST criteria. Rates of resistance to these antimicrobial agentscould be increased by adjusting the EUCAST criteria.

The pattern of resistance of C. difficile to antimicrobial agentsdiffered depending on PCR ribotype. Ribotype 018 was the mostcommon type in this study and is reported to be emerging in Europe,especially in Italy [21]. There is little published information aboutthe antibiotic susceptibility of this ribotype. In the study by Spi-gaglia et al., its rate of resistance to fluoroquinolones was 56%, andthese workers suggested that the increased rate of resistance tofluoroquinolones of this ribotype was responsible for its increasedprevalence [15]. The rate of resistance of 018 strains to moxifloxacin(91.4%) was higher than the average rate of the 131 isolates inthe current study (62.6%). On the basis of the EUCAST breakpoints,the rates of resistance of ribotype 018 to metronidazole and van-comycin were both 5.7% (2/35).

Ribotype 001 was the second most common type in Europe in2008 [21] and the third most common type in the current study. Therates of resistance of ribotype 001 to clindamycin varied from 0%to 85.4% [11,22] and the rates of resistance to moxifloxacin werereported to vary from 50% to 98.9%. Of the ribotype 001 isolatesfrom Scotland, 24.4% showed reduced susceptibility to metronida-zole (MICs ≥ 6 mg/L) [20]. In the current study, rates of resistance ofribotype 001 to clindamycin and moxifloxacin were as high as 84.2%and 78.9%, respectively. There has been no previous report aboutthe rifaximin resistance of ribotype 001, and none of the strains inthis study were resistant to rifaximin. The metronidazole resistancerate based on EUCAST criteria was 5.3% (1/19).

Ribotype 014 was the fourth most common type in this study. Itsreported resistance rates to clindamycin were 0–27.6% [11,22,23].One study reported a resistance rate to clindamycin as 100% [14].The rate of resistance to moxifloxacin was <10% [14,23]. In thecurrent sample, ribotype 014 also had a low rate of resistance toclindamycin (28.6%) and there were no resistance to moxifloxacinor rifaximin.

Ribotype 002 was the fifth most common type in this study.Its resistance rate to clindamycin has been reported variously as2.4–92% [14,22] and a previous study reported no isolate resistantto moxifloxacin [23]. The MICs of vancomycin for all three ribotype002 isolates exceeded 4 mg/L [24]. In the current study, the resis-tance rates of ribotype 002 to clindamycin and moxifloxacin were

low (16.7% and 33.3%) and only one isolate had a vancomycin MICof 4 mg/L (data not shown).

The historic BI/NAP1 strain (ribotype 027) was not resis-tant to moxifloxacin; however, with the increasing use of

2 f Anti

flBotM2ribSrs

iadshr7trap(Om

cwr8odertditor

tst(eot

ralwNvlo

A

bW

[

[

[

[

[

[

[

[

[

[

[

[

[

8 J. Kim et al. / International Journal o

uoroquinolones, all healthcare-associated isolates of the epidemicI/NAP1 strain are now resistant to moxifloxacin [4]. Their ratef resistance to clindamycin was relatively low (0–20%) evenhough resistance to ciprofloxacin approached 100% [11,23,25].

oxifloxacin was introduced in Hanyang University Hospital in004. The resistance rate to moxifloxacin (62.6%) and the exposureate to the same class of antibiotics (45.0%) showed a signif-cant correlation in this study (P = 0.019). However, there haseen no reported outbreak caused by the BI/NAP1/027 strain inouth Korea [26] and there were no moxifloxacin- or clindamycin-esistant strains among the ribotype 027 isolates in the currenttudy.

Some ribotype 017 strains were found to be multidrug-resistantn other studies [25]. Some had high-level resistance to clindamycinnd harboured the ermB gene [27]. The rate of resistance to clin-amycin of ribotype 017 was reported to be 90–100% and theame was true for clindamycin in the current study [23,25]. Thereas been one study on the rate of resistance of ribotype 017 toifamycins, and the reported rates for rifaximin and rifampicin were5.6% and 96.9%, respectively [12]. In the present study, the resis-ance rate to rifaximin of ribotype 017 was also 95.0%, and all theesistant isolates in this study harboured the rpoB mutations H502Nnd R505K as the basis of their resistance. Using the EUCAST break-oint, the metronidazole resistance rate of ribotype 017 was 15%3/20) and that of vancomycin was 5% (1/20) (data not shown).ne of the isolates resistant to vancomycin was also resistant toetronidazole.Good concordance between possession of the ermB gene and

ombined clindamycin resistance has been reported [28]. Thereas a high frequency of the ermB gene among clindamycin-

esistant strains of ribotypes 001 and 017 (85.8–88% and9.9–94.4%, respectively) [29,30]. In the current study, possessionf the ermB gene was highly correlated with resistance to clin-amycin (P < 0.0001). Among the clindamycin-resistant strains, thermB gene was 100% positive in ribotype 018 and 85.0% positive inibotype 017.There was only one ermB gene-positive strain amonghe ribotype 001 isolates. A significant association between clin-amycin resistance and possession of the ermB gene was found only

n ribotype 018 isolates (P < 0.0001) (data not shown). Other resis-ance mechanisms should be considered to account for the high ratef resistance to clindamycin among C. difficile isolates, especially foribotypes 001 and 112.

Although there was no association between previous exposureo clindamycin and possession of the ermB gene (P = 0.944) (data nothown), previous use of clindamycin was correlated with resistanceo clindamycin among the ermB gene-negative C. difficile isolatesP = 0.012) (data not shown). This finding suggests that previousxposure to clindamycin does not influence the presence/absencef the ermB gene but could be an important factor underlying resis-ance in ermB gene-negative C. difficile isolates.

In conclusion, resistance rates to clindamycin, moxifloxacin andifaximin differ depending on the PCR ribotype. Ribotype 018 has

high rate of resistance to clindamycin and moxifloxacin but aow rate of resistance to rifaximin. Many ribotype 017 isolates

ere multiply resistant to clindamycin, moxifloxacin and rifaximin.one of the strains encountered were resistant to metronidazole,ancomycin or TZP. Previous use of moxifloxacin influenced theikelihood of acquisition of resistance to that drug, and possessionf the ermB gene was related to resistance to clindamycin.

cknowledgments

The moxifloxacin Etest strips were kindly supplied byioMérieux SA (Lyon, France) and rifaximin was donated by Alfaassermann (Pescara, Italy).

[

microbial Agents 40 (2012) 24– 29

Funding: This work was supported by the research fund ofHanyang University (Seoul, South Korea) (HY-2010-MC).

Competing interests: None declared.Ethical approval: This study was approved by the institutional

review board of Hanyang University Hospital (Seoul, South Korea)(HYUH IRB 2010-R-12). Informed consent was waived by the board.

References

[1] Pepin J, Valiquette L, Alary ME, Villemure P, Pelletier A, Forget K, et al. Clostrid-ium difficile-associated diarrhea in a region of Quebec from 1991 to 2003: achanging pattern of disease severity. CMAJ 2004;171:466–72.

[2] Kelly CP, LaMont JT. Clostridium difficile—more difficult than ever. N Engl J Med2008;359:1932–40.

[3] Shin BM, Kuak EY, Yoo HM, Kim EC, Lee K, Kang JO, et al. Multicentre study of theprevalence of toxigenic Clostridium difficile in Korea: results of a retrospectivestudy 2000–2005. J Med Microbiol 2008;57:697–701.

[4] McDonald LC, Killgore GE, Thompson A, Owens Jr RC, Kazakova SV, Sambol SP,et al. An epidemic, toxin gene-variant strain of Clostridium difficile. N Engl J Med2005;353:2433–41.

[5] Razavi B, Apisarnthanarak A, Mundy LM. Clostridium difficile: emergence ofhypervirulence and fluoroquinolone resistance. Infection 2007;35:300–7.

[6] Bidet P, Barbut F, Lalande V, Burghoffer B, Petit JC. Development of a newPCR-ribotyping method for Clostridium difficile based on ribosomal RNA genesequencing. FEMS Microbiol Lett 1999;175:261–6.

[7] Kim H, Jeong SH, Roh KH, Hong SG, Kim JW, Shin MG, et al. Investigation oftoxin gene diversity, molecular epidemiology, and antimicrobial resistance ofClostridium difficile isolated from 12 hospitals in South Korea. Korean J Lab Med2010;30:491–7.

[8] Clinical and Laboratory Standards Institute. Methods for antimicrobial suscep-tibility testing of anaerobic bacteria; approved standard. 7th ed. DocumentM11-A7. Wayne, PA: CLSI; 2007.

[9] Huang H, Wu S, Wang M, Zhang Y, Fang H, Palmgren AC, et al. Clostridium difficileinfections in a Shanghai hospital: antimicrobial resistance, toxin profiles andribotypes. Int J Antimicrob Agents 2009;33:339–42.

10] Johnson S, Samore MH, Farrow KA, Killgore GE, Tenover FC, Lyras D, et al.Epidemics of diarrhea caused by a clindamycin-resistant strain of Clostridiumdifficile in four hospitals. N Engl J Med 1999;341:1645–51.

11] Solomon K, Fanning S, McDermott S, Murray S, Scott L, Martin A, et al. PCR ribo-type prevalence and molecular basis of macrolide–lincosamide–streptograminB (MLSB) and fluoroquinolone resistance in Irish clinical Clostridium difficileisolates. J Antimicrob Chemother 2011;66:1976–82.

12] Huang H, Weintraub A, Fang H, Wu S, Zhang Y, Nord CE. Antimicrobial suscep-tibility and heteroresistance in Chinese Clostridium difficile strains. Anaerobe2010;16:633–5.

13] Samore MH, Venkataraman L, DeGirolami PC, Merrigan MM, Johnson S, GerdingDN, et al. Genotypic and phenotypic analysis of Clostridium difficile correlatedwith previous antibiotic exposure. Microb Drug Resist 2006;12:23–8.

14] Taori SK, Hall V, Poxton IR. Changes in antibiotic susceptibility and ribotypes inClostridium difficile isolates from southern Scotland, 1979–2004. J Med Micro-biol 2010;59:338–44.

15] Spigaglia P, Barbanti F, Dionisi AM, Mastrantonio P. Clostridium difficile isolatesresistant to fluoroquinolones in Italy: emergence of PCR ribotype 018. J ClinMicrobiol 2010;48:2892–6.

16] Pituch H, Obuch-Woszczatynski P, Wultanska D, Nurzynska G, Harmanus C,Banaszkiewicz A, et al. Characterization and antimicrobial susceptibility ofClostridium difficile strains isolated from adult patients with diarrhoea hos-pitalized in two university hospitals in Poland, 2004–2006. J Med Microbiol2011;60:1200–5.

17] Hecht DW, Galang MA, Sambol SP, Osmolski JR, Johnson S, Gerding DN. In vitroactivities of 15 antimicrobial agents against 110 toxigenic Clostridium difficileclinical isolates collected from 1983 to 2004. Antimicrob Agents Chemother2007;51:2716–19.

18] Jiang ZD, DuPont HL, La Rocco M, Garey KW. In vitro susceptibility of Clostridiumdifficile to rifaximin and rifampin in 359 consecutive isolates at a universityhospital in Houston, Texas. J Clin Pathol 2010;63:355–8.

19] Curry SR, Marsh JW, Shutt KA, Muto CA, O’Leary MM, Saul MI, et al.High frequency of rifampin resistance identified in an epidemic Clostrid-ium difficile clone from a large teaching hospital. Clin Infect Dis 2009;48:425–9.

20] Baines SD, O’Connor R, Freeman J, Fawley WN, Harmanus C, MastrantonioP, et al. Emergence of reduced susceptibility to metronidazole in Clostridiumdifficile. J Antimicrob Chemother 2008;62:1046–52.

21] Bauer MP, Notermans DW, van Benthem BH, Brazier JS, Wilcox MH, Rupnik M,et al. Clostridium difficile infection in Europe: a hospital-based survey. Lancet2011;377:63–73.

22] John R, Brazier JS. Antimicrobial susceptibility of polymerase chain reaction

ribotypes of Clostridium difficile commonly isolated from symptomatic hospitalpatients in the UK. J Hosp Infect 2005;61:11–14.

23] Barbut F, Mastrantonio P, Delmee M, Brazier J, Kuijper E, Poxton I. Prospectivestudy of Clostridium difficile infections in Europe with phenotypic and genotypiccharacterisation of the isolates. Clin Microbiol Infect 2007;13:1048–57.

of Ant

[

[

[

[

[

[

J. Kim et al. / International Journal

24] Noren T, Alriksson I, Akerlund T, Burman LG, Unemo M. In vitro susceptibility to17 antimicrobials of clinical Clostridium difficile isolates collected in 1993–2007in Sweden. Clin Microbiol Infect 2010;16:1104–10.

25] Goorhuis A, Debast SB, Dutilh JC, van Kinschot CM, Harmanus C, CannegieterSC, et al. Type-specific risk factors and outcome in an outbreak with 2 dif-ferent Clostridium difficile types simultaneously in 1 hospital. Clin Infect Dis2011;53:860–9.

26] Kim J, Pai H, Seo MR, Kang JO. Epidemiology and clinical characteristics of

Clostridium difficile infection in a Korean tertiary hospital. J Korean Med Sci2011;26:1258–64.

27] Bendle JS, James PA, Bennett PM, Avison MB, Macgowan AP, Al-Shafi KM. Resis-tance determinants in strains of Clostridium difficile from two geographicallydistinct populations. Int J Antimicrob Agents 2004;24:619–21.

[

imicrobial Agents 40 (2012) 24– 29 29

28] Pituch H, van Leeuwen W, Maquelin K, Wultanska D, Obuch-WoszczatynskiP, Nurzynska G, et al. Toxin profiles and resistances to macrolides and newerfluoroquinolones as epidemicity determinants of clinical isolates of Clostridiumdifficile from Warsaw, Poland. J Clin Microbiol 2007;45:1607–10.

29] Goorhuis A, Legaria MC, van den Berg RJ, Harmanus C, Klaassen CH, Brazier JS,et al. Application of multiple-locus variable-number tandem-repeat analysisto determine clonal spread of toxin A-negative Clostridium difficile in a generalhospital in Buenos Aires, Argentina. Clin Microbiol Infect 2009;15:1080–6.

30] Pituch H, Brazier JS, Obuch-Woszczatynski P, Wultanska D, Meisel-Mikolajczyk F, Luczak M. Prevalence and association of PCR ribotypes ofClostridium difficile isolated from symptomatic patients from Warsaw withmacrolide–lincosamide–streptogramin B (MLSB) type resistance. J Med Micro-biol 2006;55:207–13.