Accumulation and Biotransformation of BDE-47 by Zebrafish Larvaeand Teratogenicity and Expression of Genes along theHypothalamus−Pituitary−Thyroid AxisXinmei Zheng,† Yuting Zhu,† Chunsheng Liu,† Hongling Liu,*,† John P. Giesy,†,‡,§ Markus Hecker,⊥

Michael H. W. Lam,§ and Hongxia Yu*,†

†State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023,China‡Department of Veterinary Biomedical Sciences and Toxicology Centre, University of Saskatchewan, Saskatoon, Saskatchewan,Canada§Department of Biology and Chemistry and State Key Laboratory for Marine Pollution, City University of Hong Kong, Kowloon,Hong Kong, SAR, China⊥School of Environment and Sustainability and Toxicology Centre, University of Saskatchewan, Saskatoon, Saskatchewan, Canada

*S Supporting Information

ABSTRACT: Accumulation and effects of BDE-47 and two analogues, 6-OH-BDE-47 and 6-MeO-BDE-47, on ontogeny and profiles of transcription of genes along thehypothalamus−pituitary−thyroid (HPT) axis of zebrafish (Danio rerio) embryosexposed from 4 h post fertilization (hpf) to 120 hpf were investigated. The 96 h-LC50of the most toxic compound, based on teratogenicity, was 330 μg of 6-OH-BDE-47/L. 6-OH-BDE-47 significantly down-regulated expression of mRNA of thyroidstimulating hormone receptor (TSHR), thyroid hormone receptors (TRs, includingTRα and TRβ), sodium/iodide symporter (NIS), and transthyretin (TTR) while up-regulating expression of thyroglobulin (TG) and thyrotropin-releasing hormone(TRH). Spontaneous movement was affected by 1 mg of 6-OH-BDE-47/L or 5 mgof 6-MeO-BDE-47/L. BDE-47 did not alter activity of larvae at any concentrationtested. 6-MeO-BDE-47 significantly up-regulated expression of mRNA of TRH,TRα, TRβ and NIS. Both 6-OH-BDE-47 and 6-MeO-BDE-47 affected the thyroidhormone pathway. BDE-47 and 6-MeO-BDE-47 were accumulated more than 6-OH-BDE-47. 6-MeO-BDE-47 was transformedinto 6-OH-BDE-47, but BDE-47 was not transformed into it. In summary, the synthetic brominated flame retardant, BDE-47, didnot elicit the adverse effects caused by the other two analogues and appeared to have less toxicological relevance than the twonatural product analogues 6-OH- and 6-MeO-BDE-47.

■ INTRODUCTION

As one of the predominant polybrominated diphenyl ethers(PBDEs), 2,2′,4,4′-tetrabromodiphenylether (BDE-47) is acontaminant of concern due to its ubiquity and potential tobioaccumulate, especially in aquatic systems.1,2 Concentrationsof BDE-47 in water and sediments in south China were 21 pg/L and greater than 100 ng/g dw, respectively.3 BDE-47 wasdetected in electrical and electronic equipment waste (e-waste)recycling sites at concentrations of 0.83 ng/L in the dissolvedphase and 4.3 ng/L in the particulate phase.4 Meanconcentrations of BDE-47 in the Little River sewage treatmentplant (LRSTP) in Windsor, Ontario, Canada were 102 ± 83ng/L in the influent to the primary sedimentation tanks, 36 ±29 ng/L in primary sedimentation tank effluent, 14 ± 4 ng/L infinal effluent, 586 ± 207 ng/g dry weight (dw) in primarysludge, and 963 ± 415 ng/g dw in waste activated sludge.Concentrations of BDEs in fish, vegetables, meat, and humanmilk in Japan were determined, and it was concluded that

dietary intake of fish was positively correlated with concen-trations of PBDEs in human milk. BDE-47 was thepredominant congener observed among fishes, with a maximumconcentration of 1000 pg/g wet weight (dw).5 Two structuralanalogues of BDE-47, 6-OH-BDE-47 and 6-MeO-BDE-47,were also detected in aquatic biota such as blood and tissues offish and marine mammals and algae and have been shown to beaccumulated through the food chain into top predators.6−10

6-OH-BDE-47 and 6-MeO-BDE-47 were originally thoughtto be biotransformation products or byproducts duringsynthesis of PBDEs.11 However, recent studies have confirmedthat 6-OH-BDE-47 and 6-MeO-BDE-47 are likely naturallyoccurring compounds, with interconversion between 6-MeO-

Received: August 13, 2012Revised: October 25, 2012Accepted: October 30, 2012Published: October 30, 2012

Article

pubs.acs.org/est

© 2012 American Chemical Society 12943 dx.doi.org/10.1021/es303289n | Environ. Sci. Technol. 2012, 46, 12943−12951

BDE47 and 6-OH-BDE47 observed in Japanese medaka(Oryzias latipes).12,13

Several studies of effects of BDE-47 on aquatic organismshave been conducted. Inflated swim bladder and dorsalcurvature of zebrafish (Danio rerio) larva were observed whenzebrafish embryos were exposed to 25 mg BDE-47/L.14 25−50nM (12−24 μg/L) of 6-OH-BDE-47 caused a range ofdevelopmental defects such as pericardial edema, yolk sacdeformations, lesser pigmentation, lessened heart rate, anddelayed development.15 PBDEs, OH-PBDEs, and MeO-PBDEsare structural analogues to chlorinated biphenyls (PCBs),dioxins (PCDD), and furans (PCDF), some of which havestructure similarities to thyroid hormones (THs). However,PBDEs are larger and contain a flexible ether linkage such thatthey are not agonists of the aryl hydrocarbon receptor (AhR).16

Therefore, PBDEs were hypothesized to potentially affectthyroid hormone homeostasis. Concentrations of BDE-47 werenegatively correlated with circulating concentrations of free T4(FT4) in blood plasma of white whales (Delphinapterus leucas)from Svalbard.17 BDE-47 has been reported to alter thyroidstatus and thyroid hormone-regulated gene transcription inpituitary and brain of adult fathead minnows.18 Thehypothalamus−pituitary−thyroid (HPT) axis, also known asthyroid homeostasis or thyrotropic feedback control, is part ofthe endocrine system that is responsible for regulation ofmetabolism and early life-stage development.19,20 In addition tothe gonads, the HPT axis is the target of endocrine-disruptingchemicals (EDCs).21 Altered function of the HPT axis isassociated with endocrine and developmental effects.22

Regulation of expression of genes was found to be affected inembryos exposed to 0.625 ppm 6-OH-BDE 47 from 24 to 28 hpost fertilization (hpf) due to potential disruption of thecholinergic system and thyroid hormone homeostasis.23

Mostly, in vitro studies have shown that PBDEs can havepotential endocrine disrupting properties, a number of whichcan be attributed to the hydroxylated metabolites.24 OH-PBDEs can bind competitively to transthyretin (TTR), thethyroid hormone transport protein, and also can causeestrogenic effects through interaction with the estrogenreceptor.25,26 However, to our knowledge, there has been nopublished information on effects of 6-MeO-BDE-47 on thyroidfunction in fishes. Comparison of the developmental toxicity ofthese three compounds in fish is also limited.Zebrafish embryos/larvae previously have been shown to be

a good model to study effects of chemicals on the HPT axis,and polymerase chain reaction (PCR) methods have been usedto measure expression of mRNA of genes in the thyroidsystem.27−29 In the study upon which we report here, an HPT-PCR array for zebrafish larvae was used to investigate effects of6-OH-BDE-47, BDE-47, and 6-MeO-BDE-47 on the HPT axisand on pathways of thyroid synthesis and to compare theseeffects with developmental and behavioral effects. Furthermore,accumulation and biotransformation of 6-OH-BDE-47, BDE-47, and 6-MeO-BDE-47 by zebrafish larvae were assessed byliquid−liquid extraction coupled with GC/MS.

■ MATERIALS AND METHODSChemicals. BDE-47 (98% purity) was purchased from

Chem Service, Inc. (West Chester, PA, USA). All other PBDEs(11 PBDEs: BDE-17, BDE-28, BDE-71, BDE-66, BDE-100,BDE-99, BDE-85, BDE-154, BDE-138, BDE-183, BDE-190),13C-PCB-178, 13C-2′-OH-BDE-99, and 13C-BDE-139 werepurchased from Cambridge Isotope Laboratories (Andover,

MA, USA). MeO-PBDEs and OH-PBDEs (12 MeO-PBDEs: 6-MeO-BDE-47, 6′-MeO-BDE-17, 2′-MeO-BDE-28, 5-MeO-BDE-47, 4′-MeO-BDE-49, 2′-MeO-BDE-68, 6-MeO-BDE-85,6-MeO-BDE-90, 4-MeO-BDE-90, 3-MeO-BDE-100, 6′-MeO-BDE-123, 6-MeO-BDE-137; 12 OH-PBDEs: 6-OH-BDE-47,2′-OH-BDE-7, 3′-OH-BDE-7, 2′-OH-BDE-17, 2′-OH-BDE-25,2-OH-BDE-28, 4′-OH-BDE-49, 2′-OH-BDE-66, 2′-OH-BDE-68, 6-OH-BDE-85, 6-OH-BDE-90, 6-OH-BDE-137) weresynthesized in the Department of Biology and Chemistry atCity University of Hong Kong, and purities of greater than 98%have been confrmed.30 Stock solutions of chemicals (6-OH-BDE-47, BDE-47, and 6-MeO-BDE-47) were prepared indimethyl sulfoxide (DMSO, Generay Biotech, Shanghai, China)and diluted with embryonic rearing water (60 mg/L instantocean salt in aerated distilled water) to the final concentrationsimmediately before use. The final concentration of solvent(DMSO) in the test solution did not exceed 0.1%. RNAlaterRNA Stabilization Reagents, RNeasy Mini Kit, and OmniscriptRT Kit were purchased from Qiagen (Hilden, Germany). SYBRReal time PCR Master Mix Plus Kits were obtained fromToyobo (Tokyo, Japan).

Maintenance of Zebrafish and Exposure. Adult zebra-fish (4-month old) were obtained from the Institute ofHydrobiology, Chinese Academy of Sciences (Wuhan,China), and maintained in a semiautomatic system with treatedtap water (no residual ammonia, chlorine, chloramines, anddisinfected with UV light) under 14/10 h light/dark photo-period. Fish were fed frozen blood worms or dry food twice aday. Nylon nets were used at the bottom of each tank to isolateeggs and adult fish. Spawning was induced in the morning whenthe light was turned on. Collected embryos were rinsed withembryonic rearing water and examined under an invertedstereomicroscope. The majority of embryos developednormally at the early cleavage stage with cytoplasm streamstoward animal pole to form the blastodisc as determined bymeans of a stereomicroscope at magnification of 50×. 6-wellcell culture plates (Corning Inc. Steuben, New York, USA)were used in the experiments. Twenty normally shapedfertilized embryos were randomly assigned to each wellincluding 10 mL of exposure or vehicle control (DMSO)solution and a medium control each with three replicates at 4 hpost fertilization (hpf). The experiment was terminated at 120hpf. In order to directly compare potencies of the three testchemicals (6-OH-BDE-47, BDE-47, and 6-MeO-BDE-47),fertilized embryos were exposed to the same nominalconcentrations of each compound (0, 8, 40, 200, 1000, or5000 μg/L). Wells were covered with foil to avoid evaporationof test solutions. Development of the embryos was not affectedby the covering of foil on the wells during the exposure sincemortality of embryos was less than 20%. Embryos wereexamined under a multipurpose zoom microscope (Nikon AZ100) at different developmental stages (4, 8, 12, 24, 48, 72, 96,and 120 hpf). Coagulated embryos before hatching are opaque,milky white, and appear dark under the microscope.Toxicological endpoints included whether embryos were clearor opaque, edema at 48, 72, or 96 hpf, structural malformationsat 72 or 96 hpf, and body lengths measured after hatching until120 hpf. Malformations of the crooked spine were defined asscoliosis and curvature of the tail. Mortalities includedcoagulated embryos before hatching and dead larvae afterhatching until 120 hpf. Each exposure experiment wasreplicated three times. The mRNA expression studies wereconducted under the same conditions described above with

Environmental Science & Technology Article

dx.doi.org/10.1021/es303289n | Environ. Sci. Technol. 2012, 46, 12943−1295112944

exposure concentrations of 0, 8, 40, or 200 μg/L for each of thethree chemicals. Duration of exposure was chosen on the basisof the fact that most genes expressed along the HPT axis can bedetected before 96 hpf and that thyroid follicles continue togrow until 120 hpf in zebrafish.31,32 At 120 hpf, larvae wererandomly sampled and stored in RNAlater solution at −20 °Cfor subsequent gene assays. A subset of larvae was analyzed forbioaccumulation of BDEs and presence of metabolites.Isolation of RNA, Reverse Transcription, and Quanti-

tative Real-Time Polymerase Chain Reaction (RT-PCR).Effects of 6-OH-BDE-47, BDE-47, and 6-MeO-BDE-47 onrelative transcription of RNA of key genes involved in HPT axiswere determined by RT-PCR as described previously.33 Wholebodies of larvae were used as the samples because they wereonly 3−4 mm long. Isolation of total RNA was performed usingthe RNeasy Mini Kit (Hilden, Germany), and quantificationand verification were performed by use of a previously reportedprotocol.33 The Omniscript RT Kit was used to synthesizecDNA following the manufacturers’ instructions. Quantitativereal-time PCR was performed using the SYBR Green PCR kitunder Applied Biosystems Stepone Plus Real-time PCR System(Applied biosystems inc. Foster city, CA, USA). The onlinePrimer 3 program (http://frodo.wi.mit.edu) was used to designthe primer sequences for the selected genes (Table S1 ofSupporting Information). Conditions of the RT-PCR reactionwere as follows: initial denaturation step at 95 °C for 2 min,followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min.Melt curves were derived during RT-PCR to validate that allcDNA samples amplified only a single product. The expressionof mRNA for each target gene was normalized to the mRNAcontent of housekeeping gene (rpl8), and the change in themRNA expression of the relevant genes was analyzed by the2−ΔΔCt method.29 Each concentration was measured intriplicate in a composite sample containing 15 larvae.Instrumental Analysis. Zebrafish larvae were collected at

120 hpf, rinsed with Milli-Q water, and gently dried. Larvaefrom each exposure were composited, weighed, and storedseparately at −80 °C until analysis. Detailed protocols for

extraction, clean up, identification, and quantification andquality assurance and quality control (QA/QC) are provided inWen et al.34 Internal dose and potential products oftransformation of the three chemicals were determined asfollows: Briefly, concentrations of individual OH-PBDEs, MeO-PBDEs, and PBDEs were quantified by liquid−liquid extractioncombined with gas chromatography and mass spectrometry(GC/MS). Approximately 0.1 g of larvae sample washomogenized and transferred into amber serum bottles. Thesample was then spiked with the surrogate recovery standard,and 2 mL of Milli-Q water, 50 μL of hydrochloric acid (HCl, 2M), and 2 mL of 2-propanol were added. The thus preparedsample was then extracted three times with 10 mL of n-hexane/methyl tert-butyl ether (MTBE) (1:1, v/v). Extracts wereconcentrated by rotary evaporation and dried under nitrogen.The derivation of PBDEs, MeO-PBDEs, and OH-PBDEs andtheir purification were conducted in accordance with themethod of Wen et al.34 Concentrations of 12 PBDEs, 12 OH-PBDEs, and 12 MeO-PBDEs were determined by use of a TSQQuantum GC/MS (Thermo Scientific, USA) coupled with anAgilent DB-XLB column (15 m × 0.25 mm × 0.25 μm, J&WScientific, USA) in 3 separate runs. Identification of specificPBDEs, OH-PBDEs, and MeO-PBDEs was performed bycomparing relative retention times versus internal standard andproduct ions in SRM mode with the standard chemicals.

QA/QC and Statistical Analysis. Quality assurance andquality control were performed by regular analysis ofprocedural blanks (RSD < 22.6% for 6 replicates). Rates ofrecovery for standard compounds ranged between 93−146%,67−113%, and 103−133% for PBDEs, OH-PBDEs, and MeO-PBDEs, respectively. The limit of detection (LOD) for eachcompound was defined as three times the SD of the laboratoryblanks. For congeners not detected in the blanks, the LOD wasset to the instrumental limit of quantification (LOQ). MethodLODs ranged between 9.2 × 10−2 and 2.9 × 101 ng/g wetweight (ww) for individual PBDEs, OH-PBDEs, and MeO-PBDEs congeners. Concentrations less than the method LODwere assumed to be not detectable. PBDEs, OH-PBDEs, and

Figure 1. Photomicrographs demonstrating changes in morphology at several stages of development after zebrafish embryos were exposed to 6-OH-BDE-47 and 6-MeO-BDE-47. (A) Normal developed embryo (36 hpf). (B) Delayed development embryo exposed to 1000 μg of 6-OH-BDE-47/L(36 hpf). (C) Normal hatched larva (72 hpf). (D) Abnormal embryo exposed to 1000 μg of 6-OH-BDE-47/L (72 hpf). (E) Normal hatched larva(72 hpf). (F) Abnormal larva with pericardial edema after exposure to 5000 μg of 6-MeO-BDE-47/L (72 hpf). (G) Normal hatched larva (96 hpf).(H) Abnormal larva with edema and malformed spine after exposure to 5000 μg of 6-MeO-BDE-47/L (96 hpf).

Environmental Science & Technology Article

dx.doi.org/10.1021/es303289n | Environ. Sci. Technol. 2012, 46, 12943−1295112945

MeO-PBDEs were all quantified in samples extracts relative to13C-PCB-178. Recoveries of surrogate standards 13C-BDE-139and 13C-2-OH-BDE-99 averaged 67.3−118.5% and 77.7−121%, respectively.Statistical analyses were performed with the SPSS 12.0 for

Windows. The Kolmogorov−Smirnov test was used to verifythe normality of the data, and homogeneity of variances wasanalyzed by the Levene’s test. If the data failed theKolmogorov−Smirnov test, logarithmic transformation wasperformed and then checked again for homogeneity ofvariances. Once the data satisfied the assumptions ofhomogeneity of variances, one-way analysis of variance(ANOVA) followed by LSD test was used to evaluate thedifferences between the variables. A value of p < 0.05 wasconsidered as statistically significant. The probit model wasused to calculate the LC50 for the endpoints used tocharacterize teratogenic effects at the different developmentalstages of zebrafish embryos. All values were expressed as mean± standard error (SEM).

■ RESULTSDevelopmental Toxicity. (Raw data of morphological

effects are shown in Tables S2−S4, Supporting Information.)Zebrafish embryos grew well in culture medium with or withoutcarrier solvent (0.1% DMSO). On the basis of nominalconcentrations, 6-OH-BDE-47 was more toxic to zebrafishembryos than was 6-MeO-BDE-47 or BDE-47. Development ofembryos exposed to 1000 μg of 6-OH-BDE-47/L was slower,and embryos had significantly less melanin at 36 hpf comparedwith controls (Figure 1). Development of these larvae wasarrested at 72 hpf. By 96 hpf, all embryos exposed to 1000 or5000 μg/L had died. LC50 values were 1550 and 330 μg 6-OH-BDE-47/L after 48 and 96 h, respectively (Table 1).

Concentrations less than 200 μg of 6-OH-BDE-47/L did notcause significantly mortality compared with the controls after120 hpf. Pericardial edema was observed after 96 hpf inembryos exposed to 5000 μg of 6-MeO-BDE-47/L. None ofthe tested concentrations of 6-MeO-BDE-47 or BDE47 affectedmortality or body lengths in 96 hpf larvae. However, at 120 hpf,edema and curved spine occurred in embryos exposed to 5000μg of 6-MeO-BDE-47/L (Figure 1). Lengths of embryos weresignificantly less when exposed to 5000 μg of 6-MeO-BDE-47/L (3568 ± 167 μm) compared with controls (4241 ± 76 μm).The three target BDE congeners ranked as follows regardingtheir toxic potencies (values from greater to lesser potency): 6-OH-BDE-47 > 6-MeO-BDE-47 > BDE-47.Transcriptional Responses. Exposure to 6-OH-BDE-47

or 6-MeO-BDE-47 but not BDE-47 resulted in significantchanges in gene expression profiles of genes along the HPT axis(Figures 2−4). Expression of mRNA of thyrotropin-releasing

hormone (TRH) was significantly greater (1.77-fold) in larvaeexposed to 40 μg of 6-OH-BDE-47/L and up-regulated by1.60- and 1.72-fold in larvae exposed to 40 or 200 μg of 6-MeO-BDE-47/L, respectively, while no significant alterationswere observed in larvae exposed to BDE-47 (Figure 2A).Transcription of thyrotropin-releasing hormone 1 (TRHR1)and thyroid stimulating hormone β (TSHβ) genes was notaffected by any of the three chemicals at the selectedconcentrations (Figure 2B,C). Expression of mRNA of thyroidhormone receptors (TRs, including TRα and TRβ) showedcontrary effects in larvae exposed to 6-OH-BDE-47 and 6-MeO-BDE-47 (Figure 2D,E). Exposure of 200 μg of 6-OH-BDE-47/L larvae resulted in lesser expression of TRα and TRβmRNA by 2.24- and 3.14-fold, respectively, while 6-MeO-BDE-47 resulted in up-regulation of expression of TRα and TRβmRNA by 1.62- and 2.01-fold, respectively. mRNA expressionof TRα and TRβ after exposure to BDE-47 decreased slightlybut the difference was not statistically significant.Transcriptional profiles of Na+/I− symporter (NIS) and

transthyretin (TTR) genes were both significantly affected byexposure to 6-OH-BDE-47 and 6-MeO-BDE-47 (Figure 3).The effects of 6-OH-BDE-47 and 6-MeO-BDE-47 on theexpression of the NIS genes were concentration dependent(Figure 3A). Expression of the NIS gene was down-regulatedby 1.43- and 3.33-fold in larvae exposed to 40 or 200 μg of 6-OH-BDE-47/L, respectively. However, expression of the NISgene was 3.05-fold greater in larvae exposed to 200 μg of 6-MeO-BDE-47/L. 6-OH-BDE-47 significantly affected expres-sion of the TTR gene (Figure 3B). Exposure to 40 or 200 μg of6-OH-BDE-47/L resulted in 1.48- and 1.50-fold down-regulation of mRNA of TTR, respectively, while 6-MeO-BDE-47 did not significantly affect expression of TTR. Nosignificant effect on expression of mRNA of either the NIS orthe TTR gene was observed after exposure to BDE-47.Transcription of the thyroid stimulating hormone receptor

(TSHR) gene was significantly down-regulated by 7.88-fold inlarvae exposed to 200 μg of 6-OH-BDE-47/L. However, therewas no significant effect of 6-MeO-BDE-47 or BDE-47 (Figure4A). Expression of thyroglobulin (TG) mRNA was significantlyaffected by only 6-OH-BDE-47 (Figure 4B), expression ofwhich was up-regulated by 1.52- and 1.71-fold in larvae exposedto 8 or 40 μg/L, respectively. Transcriptions of Dio1 and Dio2were not significantly affected by any of the three chemicals(Figure 4C,D).

Accumulation and Biotransformation. A concentration-dependent bioconcentration of 6-OH-BDE-47, BDE-47, and 6-MeO-BDE-47 was observed in larvae after 5 days of exposure(Figure 5). Larvae exposed to 200 μg of 6-MeO-BDE-47/L,accumulated 117 ng of 6-OH-BDE-47/g ww (Figure 5). Therewere also small percentages of other isomers detected inzebrafish exposed to each compound. These included 2’-OH-BDE-28, BDE-28, BDE-85 and BDE-99 in zebrafish larvaeexposed to BDE-47; 2’-OH-BDE-28, 6-OH-BDE-85, 6-MeO-BDE-47 and BDE-47 observed in zebrafish larvae exposed to 6-OH-BDE-47; and 2’-OH-BDE-28, 2’-MeO-BDE-28 and BDE-47 observed in zebrafish larvae exposed to 6-MeO-BDE-47.The percentages were all very small and due exclusively toimpurities in test compounds. In larvae exposed to 200 μg of 6-MeO-BDE-47/L, 117 ng of 6-OH-BDE-47/g ww wereobserved (Figure 5). No 6-OH-BDE-47 or 6-MeO-BDE-47was observed in zebrafish exposed to BDE-47, and no 6-MeO-BDE-47 occurred in individuals exposed to 6-OH-BDE-47. In

Table 1. Lethal Concentrations (LC50; μg/L) of 6-OH-BDE-47 to Developing Zebrafish Embryos (μg/L)

duration of development (hpf) LC50 (μg/L) confidence interval (95%)

24 4620 2810−1376036 1690 820−572048 1550 870−371054 1500 880−327060 1190 890−172072 540 340−94096 330 160−990

Environmental Science & Technology Article

dx.doi.org/10.1021/es303289n | Environ. Sci. Technol. 2012, 46, 12943−1295112946

Figure 2. Expressions of (A) TRH, (B) TRHR1, (C) TSHβ, (D) TRα, and (E) TRβ, determined by real-time PCR in zebrafish larvae after exposureto 8, 40, or 200 μg/L of individual chemicals. Results are expressed as means ± SEM of three replicates. *P < 0.05 and **P < 0.01 indicate significantdifference between exposure groups and the control.

Figure 3. Expression of (A) NIS and (B) TTR in zebrafish larvae determined by real-time PCR after exposure to 8, 40, or 200 μg/L individualchemicals. Results are means ± SEM of three replicate samples. *P < 0.05 and **P < 0.01 indicate significant difference between exposure groupsand the control.

Environmental Science & Technology Article

dx.doi.org/10.1021/es303289n | Environ. Sci. Technol. 2012, 46, 12943−1295112947

the control group, neither BDE-47 nor any of the analogues orproducts of biotransformation were detected (Figure 5).Concentrations of BDE-47 and 6-MeO-BDE-47 were

approximately 10- to 100-fold greater than concentrations of6-OH-BDE-47 in larvae that were exposed to similarconcentrations of the three compounds at a nominalconcentration of 200 μg/L. The log Kow for 6-OH-BDE-47 isknown to be less than that of the other compounds,35 whichmight make its excretion more likely to potentially contributeto its lower concentration in zebrafish larvae. The estimatedbioconcentration factors (BCF) for 6-OH-BDE-47 based onmeasured concentrations in larvae divided by the nominalconcentration in water were 0, 3, and 3 with treatment of

nominal concentrations of 8, 40, and 200 μg 6-OH-BDE-47/L,respectively. Estimated BCFs were 13, 4, and 22, when larvaewere exposed to 8, 40, or 200 μg BDE-47/L, respectively, and7, 13, and 70 when exposed to 8, 40, or 200 μg 6-MeO-BDE-47/L, respectively.

■ DISCUSSION

On the basis of the small percentage of each compound presentas an impurity in BDE-47, the concentrations of 2′-OH-BDE-28, BDE-28, BDE-85, and BDE-99 observed in zebrafish larvaeexposed to BDE-47 probably resulted from impurities in theoriginal BDE-47, which indicates that zebrafish might nottransform BDE-47 into OH-PBDEs or MeO-PBDEs. Thisresult is consistent with that of a previous study in which BDE-47 was not converted to 6-OH-BDE-47 or 6-MeO-BDE-47.36

In larvae exposed to 6-OH-BDE-47, 2′-OH-BDE-28, 6-OH-BDE-85, 6-MeO-BDE-47, and BDE-47 were observed, whichmight also come from impurities in the parent compounds. Inzebrafish larvae exposed to 6-MeO-BDE-47, in addition to alarge amount of the precursor, small amounts of 2′-OH-BDE-28, 2′-MeO-BDE-28, and BDE-47 were also observed becauseof the impurities in the precursor material. In addition, 117 ngof 6-OH-BDE-47/g ww was determined in embryos exposed to200 μg/L, so it indicated that 6-OH-BDE-47 could bemetabolized from 6-MeO-BDE-47.This study, for the first time, demonstrated that both 6-OH-

BDE-47 and 6-MeO-BDE-47 can affect expression of specificgenes along the HPT axis as well as resulted in teratogeniceffects in zebrafish embryos, while the man-made BDE-47 didnot result in molecular or pathological effects at exposureconcentrations up to 200 or 5000 μg of BDE-47/L,respectively. Previous studies demonstrated that changes

Figure 4. Expression of (A) TSHR, (B) TG, (C) Dieo1, and (D) Dieo2 in zebrafish larvae determined by real-time PCR after exposure to 8, 40, or200 μg/L of individual chemicals. Results expressed as means ± SEM of three replicate samples. *P < 0.05 and **P < 0.01 indicate significantdifference between exposure groups and the control.

Figure 5. Bioconcentration and metabolism of 6-OH-BDE-47, BDE-47, and 6-MeO-BDE-47 measured in zebrafish larvae after exposure tonominal concentrations of the three chemicals (0, 8, 40, or 200 μg/L)in water with DMSO at 0.1% (v/v) for 5 days.

Environmental Science & Technology Article

dx.doi.org/10.1021/es303289n | Environ. Sci. Technol. 2012, 46, 12943−1295112948

along the HPT axis were often related to specific pathologicalphenomena. For instance, when zebrafish embryos wereexposed to 500 μg/L microcystin-LR, changes in geneexpression along the HPT axis could be correlated with asignificant decrease of body length.37 All BDE-47, TBBPA andBPA were shown to induce alteration of genes along the HPTaxis of zebrafish larvae as well as cause acute toxicity.38 In thisstudy, 6-OH-BDE-47 was acutely toxic with a 96 h-LC50 of 330μg/L while reduced body length and teratogenic effects wereobserved at 5000 μg/L at 120 hpf. These results further suggesta relationship between early molecular-level effects andsubsequent morphological changes. The observed impact ondevelopment of zebrafish is in accordance with the critical roleof the HPT axis in early life-stage development ofvertebrates.19,20

In female C57BL/6 mice, BDE-47 had previously beenreported to decrease total serum T4 concentrations by 43% at100 mg/kg/day treatment, activate the nuclear receptor, CAR,and decrease Mdr1a mRNA expression at 3 mg/kg/day.39 Anearlier study indicated that 96 h-EC50 values of BDE-47 forzebrafish embryos based on hatching success were 20.30 mg/Lbetween 2.03 and 15.23 mg/L, significantly affecting expressionof some genes along the HPT.38 In this study, BDE-47 did notshow developmental or molecular toxicity at exposureconcentrations up to 5000 or 200 μg/L, respectively. Perhaps,because the concentrations used in those studies were greaterthan concentrations tested in our experiments. It could alsohave been due to differences in exposures and differentorganisms. The environmental relevance of such greatexposures, however, would be negligible. In contrast, 6-OH-BDE-47, and to a lesser extent 6-MeO-BDE-47, had significanteffects at the molecular level on the HPT axis in larval zebrafishthat were indicative of developmental effects in this species.The fact that most genes along the HPT axis, such as TSHR,

TRα, TRβ, NIS, and TTR, were down-regulated and only TRHand TG were up-regulated by 6-OH-BDE-47, while exposed to6-MeO-BDE-47, resulted in up-regulation of the expression ofTRH, TRα, TRβ, and NIS, indicating that these two chemicalsaffect the HPT axis of zebrafish through different toxicpathways (Figure S1 of Supporting Information). These resultsare consistent with the findings of a previous study thatreported that cytotoxicity of 6-OH-BDE-47 to E. coli was via amechanism that was different from that of either BDE-47 or 6-MeO-BDE-47.40 In mammals, the hypothalamic tripeptideTRH stimulates thyroid stimulating hormone (TSH) synthesisand release from the anterior pituitary to bind to TSHR in thethyrocytes.41 TRH increases locomotor activity and intake offood, both of which are associated with increases in thehypothalamic expressions of OX and CART in goldfish.42 TSHis a member of a glycoprotein hormone family which iscomposed of common α- and specific β-subunits. TSHR is akey protein in the control of thyroid function, by stimulatingTH synthesis after binding its ligand, the thyrotropin. Thispathway is involved with both growth and functionalcharacteristics, by acting via the cAMP pathway.43 TSHRplays a critical role in certain thyroid diseases, including Graves’disease (GD), multinodular thyroid goiter (MTG), andHashimoto’s thyroiditis (HT).44 When TSH was transferredto thyroid, T4 was produced with the assistant of NIS and TG.As an integral plasma membrane glycoprotein, NIS is localizedin the baso-lateral membrane of thyrocytes. It is necessary forthe transport of iodide for the biosynthesis of TH.45 TG is alarge glycoprotein produced and stored in the follicular lumen

of the thyroid gland. Its primary function is to serve as amacromolecular substrate for coupling of iodide to its tyrosineresidues during synthesis of TH.46 THs bind to and activatenuclear TRs, via 5′ deiodination of T4 in several organs,including brain, pituitary, brown adipose tissue (BAT), skin,placenta, human heart, muscle, and thyroid.47 Modulation oftranscription of TRH and TSH genes is also influenced byconcentrations of THs via negative feedback.29 In this study,most genes including TSHR, TRα, TRβ, NIS, and TTR weredown-regulated after exposure to 6-OH-BDE-47. This is inaccordance with the significant impact of greater concentrationsof this congener on larval development and is indicative of theinvolvement of the disruptions along the thyroid axis in thepathologies observed. Further studies are required, however, toelucidate the specific mechanism by which 6-OH-BDE-47causes developmental effects through the thyroid axis in fishand to help establish specific adverse outcome pathways for thischemical.As members of the nuclear receptor superfamily, thyroid

hormone receptors (TRs) have been shown to be associatedwith postnatal development of birds, metamorphosis ofamphibians, and smoltification of fish.48 TRs including TRαand TRβ can bind to specific DNA sequences (thyroidhormone response elements) on promoters to regulate targetgenes, which are involved in resistance to thyroid hormone(TRH).49 The TRα isoform is predominantly expressed inadipocytes and mediates actions of thyroid hormone in thesecells.50 Thus, up-regulation of TRs could reduce concentrationsof THs. TSH enhances the ability of the thyroid gland to trapiodide. So when TSH is decreased, expression of NIS is down-regulated. TTR is a carrier protein for TH in blood andregulates the supply of the TH to various target tissues.51

Concentrations of THs in blood were directly proportional toexpression of mRNA of TTR, and lesser expression of TTR wasaccompanied by lesser THs in blood plasma.51 The significantdecrease in TTR gene expression observed in this studyindicates that concentrations of THs in zebrafish were likelydecreased by 6-OH-BDE-47. In contrast, the significantincrease in the expression of TRH mRNA could also haveresulted in an increase of THs in larvae exposed to 6-OH-BDE-47. Considering the negative impacts exposure to 6-OH-BDE-47 had on larval development, however, it is hypothesized thatthe increase in TRH mRNA is more likely a compensatoryeffect in an attempt to offset the negative impacts along theHPT axis.Accumulation and toxic potencies varied among the three

compounds tested. While 6-OH-BDE-47 was the leastaccumulated into larvae, it exhibited the greatest toxicity. 6-MeO-BDE-47 was accumulated more than the other twochemicals, and significant amounts of 6-MeO-BDE-47 weretransformed to 6-OH-BDE-47, even though the biotransforma-tion capability of larvae was limited (approximately 0.1% after120 h). This study revealed significant conversion of 6-MeO-BDE-47 but not BDE-47 to 6-OH-BDE-47, which is inaccordance with other studies on different fish species thathypothesized that natural MeO-BDEs and not the man-madeBDEs are the main source of the more toxic OH-congeners.13

Considering the greater concentration of 6-MeO-BDE-47 inmarine environments and its greater potential for bioaccumu-lation and biotransformation of 6-MeO-BDE-47, it is the likelysource of 6-OH-BDE-47 observed in fishes.In conclusion, this study demonstrated that 6-OH-BDE-47,

and to a lesser extent 6-MeO-BDE-47, had significant effects at

Environmental Science & Technology Article

dx.doi.org/10.1021/es303289n | Environ. Sci. Technol. 2012, 46, 12943−1295112949

the molecular level on the HPT axis in larval zebrafish that wereindicative of developmental effects in this species. In contrast,exposure to the man-made BDE-47 did not result in any effectseither at the molecular or the pathological level. Furthermore,this study revealed significant conversion of 6-MeO-BDE-47but not BDE-47 to 6-OH-BDE-47, which is in accordance withother studies on different fish species that hypothesized thatnatural MeO-BDEs and not the man-made BDEs are the mainsource of the more toxic OH-congeners. Although 6-OH-BDE-47 was less bioaccumulative than BDE-47 and 6-MeO-BDE-47,the significant transformation of the highly bioaccumulativeMeO-BDE is likely to represent a continuous internal sourcefor the toxic OH-BDE.

■ ASSOCIATED CONTENT*S Supporting InformationFigure S1, pathway of hypothalamic-pituitary-thyroid (HPT)axis in zebrafish; Table S1, primer sequences for thequantitative reverse transcription-polymerase chain reaction(q-PCR); Table S2, raw data of morphological effect of 6-OH-BDE-47; Table S3, raw data of morphological effect of 6-MeO-BDE-47; Table S4, raw data of morphological effect of BDE-47.This material is available free of charge via the Internet athttp://pubs.acs.org.

■ AUTHOR INFORMATIONCorresponding Author*Tel: 86-25-89680356. Fax: 86-25-89680356. E-mail: hlliu@nju.edu.cn (H.L.); yuhx@nju.edu.cn (H.Y.).NotesThe authors declare no competing financial interest.

■ ACKNOWLEDGMENTSThis work was jointly funded by the National Natural ScienceFoundation of China (Nos. 20977047, 20737001), MajorNational Science and Technology Projects (Nos.2012ZX07506-001, 2012ZX07529-003-02), and the Environ-mental Monitoring Research Foundation of Jiangsu Province(No. 1114). The research was supported by a Discovery Grantfrom the Natural Science and Engineering Research Council ofCanada (Project # 326415-07). J.P.G. and M.H. weresupported by the Canada Research Chair program. Further-more, J.P.G. was supported by an at large Chair Professorshipat the Department of Biology and Chemistry and State KeyLaboratory in Marine Pollution, City University of Hong Kong,and the Einstein Professor Program of the Chinese Academy.

■ REFERENCES(1) Valters, K.; Li, H. X.; Alaee, M.; D’Sa, I.; Marsh, G.; Bergman, A.;Letcher, R. J. Polybrominated diphenyl ethers and hydroxylated andmethoxylated brominated and chlorinated analogues in the plasma offish from the Detroit River. Environ. Sci. Technol. 2005, 39 (15), 5612−5619.(2) Haraguchi, K.; Kotaki, Y.; Relox, J. R.; Romero, M. L. J.; Terada,R. Monitoring of naturally produced brominated phenoxyphenols andphenoxyanisoles in aquatic plants from the Philippines. J. Agric. FoodChem. 2010, 58 (23), 12385−12391.(3) He, M. J.; Luo, X. J.; Chen, M. Y.; Sun, Y. X.; Chen, S. J.; Mai, B.X. Bioaccumulation of polybrominated diphenyl ethers anddecabromodiphenyl ethane in fish from a river system in a highlyindustrialized area, South China. Sci. Total Environ. 2012, 419, 109−115.(4) Qin, X.; Xia, X.; Li, Y.; Zhao, Y.; Yang, Z.; Fu, S.; Tian, M.; Zhao,X.; Qin, Z.; Xu, X.; Yang, Y. Ecotoxicological effects of mixed

pollutants resulted from e-wastes recycling and bioaccumulation ofpolybrominated diphenyl ethers in Chinese loach (Misgurnusanguillicaudatus). J. Environ. Sci. (China) 2009, 21 (12), 1695−1701.(5) Ohta, S.; Ishizuka, D.; Nishimur, H.; Nakao, T. Comparison ofpolybrominated diphenyl ethers in fish, vegetables, and meats andlevels in human milk of nursing women in Japan. Chemosphere 2002,46 (5), 689−696.(6) Valters, K.; Li, H.; Alaee, M.; D’Sa, I.; Marsh, G.; Bergman, A.;Letcher, R. J. Polybrominated diphenyl ethers and hydroxylated andmethoxylated brominated and chlorinated analogues in the plasma offish from the Detroit River. Environ. Sci. Technol. 2005, 39 (15), 5612−5619.(7) Verreault, J.; Gabrielsen, G. W.; Chu, S.; Muir, D. C.; Andersen,M.; Hamaed, A.; Letcher, R. J. Flame retardants and methoxylated andhydroxylated polybrominated diphenyl ethers in two Norwegian Arctictop predators: glaucous gulls and polar bears. Environ. Sci. Technol.2005, 39 (16), 6021−6028.(8) Pettersson, A.; van Bavel, B.; Engwall, M.; Jimenez, B.Polybrominated diphenylethers and methoxylated tetrabromodiphe-nylethers in cetaceans from the Mediterranean Sea. Arch. Environ.Contam. Toxicol. 2004, 47 (4), 542−550.(9) Teuten, E. L.; Johnson, C. G.; Mandalakis, M.; Asplund, L.;Gustafsson, O.; Unger, M.; Marsh, G.; Reddy, C. M. Spectralcharacterization of two bioaccumulated methoxylated polybrominateddiphenyl ethers. Chemosphere 2006, 62 (2), 197−203.(10) Zhang, K.; Wan, Y.; Jones, P. D.; Wiseman, S.; Giesy, J. P.; Hu,J. Occurrences and fates of hydroxylated polybrominated diphenylethers in marine sediments in relation to trophodynamics. Environ. Sci.Technol. 2012, 46 (4), 2148−2155.(11) Hakk, H.; Huwe, J. K.; Murphy, K.; Rutherford, D. Metabolismof 2,2’,4,4’-tetrabromodiphenyl ether (BDE-47) in chickens. J. Agric.Food Chem. 2010, 58 (15), 8757−8762.(12) Wan, Y.; Wiseman, S.; Chang, H.; Zhang, X.; Jones, P. D.;Hecker, M.; Kannan, K.; Tanabe, S.; Hu, J.; Lam, M. H.; Giesy, J. P.Origin of hydroxylated brominated diphenyl ethers: Naturalcompounds or man-made flame retardants? Environ. Sci. Technol.2009, 43 (19), 7536−7542.(13) Wan, Y.; Liu, F.; Wiseman, S.; Zhang, X.; Chang, H.; Hecker,M.; Jones, P. D.; Lam, M. H.; Giesy, J. P. Interconversion ofhydroxylated and methoxylated polybrominated diphenyl ethers inJapanese medaka. Environ. Sci. Technol. 2010, 44 (22), 8729−8735.(14) Wahl, M.; Guenther, R.; Yang, L.; Bergman, A.; Straehle, U.;Strack, S.; Weiss, C. Polybrominated diphenyl ethers and arylhy-drocarbon receptor agonists: Different toxicity and target geneexpression. Toxicol. Lett. 2010, 198 (2), 119−126.(15) van Boxtel, A. L.; Kamstra, J. H.; Cenijn, P. H.; Pieterse, B.;Wagner, J. M.; Antink, M.; Krab, K.; van der Burg, B.; Marsh, G.;Brouwer, A.; Legler, J. Microarray analysis reveals a mechanism ofphenolic polybrominated diphenylether toxicity in zebrafish. Environ.Sci. Technol. 2008, 42 (5), 1773−1779.(16) Wahl, M.; Guenther, R.; Yang, L.; Bergman, A.; Straehle, U.;Strack, S.; Weiss, C. Polybrominated diphenyl ethers and arylhy-drocarbon receptor agonists: Different toxicity and target geneexpression. Toxicol. Lett. 2010, 198 (2), 119−126.(17) Villanger, G. D.; Lydersen, C.; Kovacs, K. M.; Lie, E.; Skaare, J.U.; Jenssen, B. M. Disruptive effects of persistent organohalogencontaminants on thyroid function in white whales (Delphinapterusleucas) from Svalbard. Sci. Total Environ. 2011, 409 (13), 2511−2524.(18) Lema, S. C.; Dickey, J. T.; Schultz, I. R.; Swanson, P. Dietaryexposure to 2,2’,4,4’-tetrabromodiphenyl ether (PBDE-47) altersthyroid status and thyroid hormone-regulated gene transcription inthe pituitary and brain. Environ. Health Perspect. 2008, 116 (12),1694−1699.(19) Perello, M.; Cakir, I.; Cyr, N. E.; Romero, A.; Stuart, R. C.;Chiappini, F.; Hollenberg, A. N.; Nillni, E. A. Maintenance of thethyroid axis during diet-induced obesity in rodents is controlled at thecentral level. Am. J. Physiol. Endocrinol. Metab. 2010, 299 (6), E976−E989.

Environmental Science & Technology Article

dx.doi.org/10.1021/es303289n | Environ. Sci. Technol. 2012, 46, 12943−1295112950

(20) Schaefer, J. S.; Klein, J. R. Immunological regulation ofmetabolisma novel quintessential role for the immune system inhealth and disease. FASEB J. 2011, 25 (1), 29−34.(21) Klammer, H.; Schlecht, C.; Wuttke, W.; Schmutzler, C.;Gotthardt, I.; Kohrle, J.; Jarry, H. Effects of a 5-day treatment with theUV-filter octyl-methoxycinnamate (OMC) on the function of thehypothalamo-pituitary-thyroid function in rats. Toxicology 2007, 238(2−3), 192−199.(22) Spachmo, B.; Arukwe, A. Endocrine and developmental effectsin Atlantic salmon (Salmo salar) exposed to perfluorooctane sulfonicor perfluorooctane carboxylic acids. Aquat. Toxicol. 2012, 108, 112−124.(23) Usenko, C. Y.; Hopkins, D. C.; Trumble, S. J.; Bruce, E. D.Hydroxylated PBDEs induce developmental arrest in zebrafish.Toxicol. Appl. Pharmacol. 2012, 262 (1), 43−51.(24) Canton, R. F.; Scholten, D. E.; Marsh, G.; de Jong, P. C.; vanden Berg, M. Inhibition of human placental aromatase activity byhydroxylated polybrominated diphenyl ethers (OH-PBDEs). Toxicol.Appl. Pharmacol. 2008, 227 (1), 68−75.(25) Meerts, I. A. T. M.; Letcher, R. J.; Hoving, S.; Marsh, G.;Bergman, A.; Lemmen, J. G.; van der Burg, B.; Brouwer, A. In vitroestrogenicity of polybrominated diphenyl ethers, hydroxylated PBDEs,and polybrominated bisphenol A compounds. Environ. Health Perspect.2001, 109 (4), 399−407.(26) Liu, H.; Hu, W.; Sun, H.; Shen, O.; Wang, X. In vitro profilingof endocrine disrupting potency of 2,2’,4,4’-tetrabromodiphenyl ether(BDE47) and related hydroxylated analogues (HO-PBDEs). Mar.Pollut. Bull. 2011, 63, 287−296.(27) Liu, C.; Zhang, X.; Deng, J.; Hecker, M.; Al-Khedhairy, A.;Giesy, J. P.; Zhou, B. Effects of prochloraz or propylthiouracil on thecross-talk between the HPG, HPA, and HPT axes in zebrafish. Environ.Sci. Technol. 2011, 45 (2), 769−775.(28) Shi, X.; Liu, C.; Wu, G.; Zhou, B. Waterborne exposure toPFOS causes disruption of the hypothalamus-pituitary-thyroid axis inzebrafish larvae. Chemosphere 2009, 77 (7), 1010−1018.(29) Yu, L.; Deng, J.; Shi, X.; Liu, C.; Yu, K.; Zhou, B. Exposure toDE-71 alters thyroid hormone levels and gene transcription in thehypothalamic-pituitary-thyroid axis of zebrafish larvae. Aquat. Toxicol.2010, 97 (3), 226−233.(30) Marsh, G.; Stenutz, R.; Bergman, A. Synthesis of hydroxylatedand methoxylated polybrominated diphenyl ethers - Natural productsand potential polybrominated diphenyl ether metabolites. Eur. J. Org.Chem. 2003, 14, 2566−2576.(31) Alt, B.; Reibe, S.; Feitosa, N. M.; Elsalini, O. A.; Wendl, T.;Rohr, K. B. Analysis of origin and growth of the thyroid gland inzebrafish. Dev. Dyn. 2006, 235 (7), 1872−1883.(32) Elsalini, O. A.; von Gartzen, J.; Cramer, M.; Rohr, K. B.Zebrafish hhex, nk2.1a, and pax2.1 regulate thyroid growth anddifferentiation downstream of Nodal-dependent transcription factors.Dev. Biol. 2003, 263 (1), 67−80.(33) Liu, C.; Yan, W.; Zhou, B.; Guo, Y.; Liu, H.; Yu, H.; Giesy, J. P.;Wang, J.; Li, G.; Zhang, X. Characterization of a bystander effectinduced by the endocrine-disrupting chemical 6-propyl-2-thiouracil inzebrafish embryos. Aquat. Toxicol. 2012, 118−119, 108−115.(34) Wen, Q.; Liu, H.; Su, G.; Wei, S.; Feng, J.; Yu, H. Method andapplication of polybrominated diphenyl ethers (PBDEs) and theirderivate analysis in zebrafish eggs. J. Anal. Chem. 2012, 40 (11), 1698−1702.(35) Yu, Y.; Yang, W.; Gao, Z.; Lam, M. H. W.; Liu, X.; Wang, L.; Yu,H. RP-HPLC measurement and quantitative structure-propertyrelationship analysis of the noctanol-water partitioning coefficients ofselected metabolites of polybrominated dyphenyl ethers. Environ.Chem. 2008, 5 (5), 332−339.(36) Wan, Y.; Liu, F. Y.; Wiseman, S.; Zhang, X. W.; Chang, H.;Hecker, M.; Jones, P. D.; Lam, M. H. W.; Giesy, J. P. Interconversionof hydroxylated and methoxylated polybrominated diphenyl ethers inJapanese medaka. Environ. Sci. Technol. 2010, 44 (22), 8729−8735.(37) Yan, W.; Zhou, Y.; Yang, J.; Li, S.; Hu, D.; Wang, J.; Chen, J.; Li,G. Waterborne exposure to microcystin-LR alters thyroid hormone

levels and gene transcription in the hypothalamic-pituitary-thyroid axisin zebrafish larvae. Chemosphere 2012, 87 (11), 1301−1307.(38) Chan, W. K.; Chan, K. M. Disruption of the hypothalamic-pituitary-thyroid axis in zebrafish embryo-larvae following waterborneexposure to BDE-47, TBBPA and BPA. Aquat. Toxicol. 2012, 108,106−111.(39) Richardson, V. M.; Staskal, D. F.; Ross, D. G.; Diliberto, J. J.;DeVito, M. J.; Birnbaum, L. S. Possible mechanisms of thyroidhormone disruption in mice by BDE 47, a major polybrominateddiphenyl ether congener. Toxicol. Appl. Pharmacol. 2008, 226 (3),244−250.(40) Su, G.; Zhang, X.; Liu, H.; Giesy, J. P.; Lam, M. H. W.; Lam, P.K. S.; Siddiqui, M. A.; Musarrat, J.; Al-Khedhairy, A.; Yu, H.Toxicogenomic mechanisms of 6-HO-BDE-47, 6-MeO-BDE-47, andBDE-47 in E. coli. Environ. Sci. Technol. 2012, 46, 1185−1191.(41) Davies, T.; Marians, R.; Latif, R. The TSH receptor reveals itself.J. Clin. Invest. 2002, 110 (2), 161−164.(42) Abbott, M.; Volkoff, H. Thyrotropin releasing hormone (TRH)in goldfish (Carassius auratus): Role in the regulation of feeding andlocomotor behaviors and interactions with the orexin system andcocaine- and amphetamine regulated transcript (CART). Horm. Behav.2011, 59 (2), 236−245.(43) Shao, L.; Jiang, H.; Liang, J.; Niu, X.; Teng, L.; Zhang, H. Studyon the relationship between TSHR gene and thyroid diseases. CellBiochem. Biophys. 2011, 61 (2), 377−382.(44) Tomer, Y. Genetic susceptibility to autoimmune thyroid disease:Past, present, and future. Thyroid 2010, 20 (7), 715−725.(45) Carvalho, D. P.; Ferreira, A. C. The importance of sodium/iodide symporter (NIS) for thyroid cancer management. Arq. Bras.Endocrinol. Metab. 2007, 51 (5), 672−682.(46) Noguchi, Y.; Harii, N.; Giuliani, C.; Tatsuno, I.; Suzuki, K.;Kohn, L. D. Thyroglobulin (Tg) induces thyroid cell growth in aconcentration-specific manner by a mechanism other than thyro-tropin/cAMP stimulation. Biochem. Biophys. Res. Commun. 2010, 391(1), 890−894.(47) Martinez de Mena, R.; Scanlan, T. S.; Obregon, M. J. The T3receptor beta1 isoform regulates UCP1 and D2 deiodinase in ratbrown adipocytes. Endocrinology 2010, 151 (10), 5074−5083.(48) An, K. W.; An, M. I.; Nelson, E. R.; Habibi, H. R.; Choi, C. Y.Gender-related expression of TRalpha and TRbeta in the protandrousblack porgy, Acanthopagrus schlegeli, during sex change processes.Gen. Comp. Endrocrinol. 2010, 165 (1), 11−18.(49) Bassett, J. H.; Harvey, C. B.; Williams, G. R. Mechanisms ofthyroid hormone receptor-specific nuclear and extra nuclear actions.Mol. Cell. Endocrinol. 2003, 213 (1), 1−11.(50) Cai, Z. W.; Sheng, Y. F.; Zhang, L. F.; Wang, Y.; Jiang, X. L.; Lv,Z. Z.; Xu, N. Y. Mapping, expression and regulation of the TRalphagene in porcine adipose tissue. Genet. Mol. Res. 2011, 10 (3), 1320−1330.(51) Power, D. M.; Elias, N. P.; Richardson, S. J.; Mendes, J.; Soares,C. M.; Santos, C. R. Evolution of the thyroid hormone-bindingprotein, transthyretin. Gen. Comp. Endrocrinol. 2000, 119 (3), 241−255.

Environmental Science & Technology Article

dx.doi.org/10.1021/es303289n | Environ. Sci. Technol. 2012, 46, 12943−1295112951

Accumulation and biotransformation of BDE-47 by zebrafish larvae and

teratogenicity and expression of genes along the hypothalamus-pituitary-thyroid

axis

Xinmei Zheng1, Yuting Zhu

1, Chunsheng Liu

1, Hongling Liu

1*, John P. Giesy

1,2,3,

Markus Hecker4, Michael H. W. Lam

3, Hongxia Yu

1*

1 State Key Laboratory of Pollution Control and Resource Reuse, School of the

Environment, Nanjing University, Nanjing 210046, China

2 Department of Veterinary Biomedical Sciences and Toxicology Centre, University

of Saskatchewan, Saskatoon, Saskatchewan, Canada

3 Department of Biology & Chemistry and State Key Laboratory for Marine

Pollution,, City University of Hong Kong, Kowloon, Hong Kong, SAR, China

4 School of Environment and Sustainability and Toxicology Centre, University of

Saskatchewan, Saskatoon, Saskatchewan, Canada

Authors for correspondence:

School of the Environment

Nanjing University

Nanjing 210046, China

Tel: 86-25-89680356

Fax: 86-25-89680356

E-mail: hlliu@nju.edu.cn (Hongling Liu)

yuhx@nju.edu.cn (Hongxia Yu)

Figure S1. Schematic of endocrine pathways along the

hypothalamic-pituitary-thyroid (HPT) axis in zebrafish.

Table S1. Primer sequences for quantitative reverse transcription-polymerase chain

reaction (q-PCR).

Gene

name

Sense primer (5’-3’) Antisense primer

(5’-3’)

Gene bank

accession no.

rpl8

TSHβ

ttgttggtgttgttgctggt

gcagatcctcacttcacctacc

ggatgctcaacaggggttcat

gcacaggtttggagcatctca

NM_200713

AY135147

TSHR gctccttgatgtgtccgaat cgggcagtcaggttacaaat NM_001145763

TG ccagccgaaaggatagagttg atgctgccgtggaatagga XM_001335283

Dio1 gttcaaacagcttgtcaaggact agcaagcctctcctccaagtt BC076008

Dio2 gcataggcagtcgctcattt tgtggtctctcatccaacca NM_212789

TTR cgggtggagtttgacacttt gctcagaaggagagccagta BC081488

TRα ctatgaacagcacatccgacaagag cacaccacacacggctcatc NM_131396

TRβ tgggagatgatacgggttgt ataggtgccgatccaatgtc NM_131340

NIS ggtggcatgaaggctgtaat gcctgattggctccatacat NM_001089391

TRH cacacagatggaggagcaga agcagcatcaggtagcgttt NM_001012365

TRHR1 ctggtggtggtcaactcctt gctttccaccgttgatgttt NM_001114688

Table S2. Raw data for morphological effects of 6-OH-BDE-47.

Repeat

1

Concentrati

on (µg/L)

Total

embryos

24 hpf

coagu

lation

36 hpf

coagulat

ion

48 hpf

coagulat

ion

72 hpf

coagula

tion

72 hpf

hatching

rate

96/120 hpf

coagulation

0 20 4 4 4 4 0.88 4

8 20 4 4 4 4 1 4

40 20 5 5 5 5 1 5

200 20 3 3 3 3 1 3

1000 20 4 4 6 15 0 20

5000 20 8 20 20 20 0 20

Repeat

2

Concentrati

on (µg/L)

Total

embryos

24 hpf

coagu

lation

36 hpf

coagulat

ion

48 hpf

coagulat

ion

72 hpf

coagula

tion

72 hpf

hatching

rate

96/120 hpf

coagulation

0 20 4 4 4 4 1 4

8 20 6 6 6 6 1 6

40 20 2 2 2 2 0.89 2

200 20 2 2 2 2 1 2

1000 20 2 2 3 14 0 20

5000 20 11 20 20 20 0 20

Repeat

3

Concentrati

on (µg/L)

Total

embryos

24 hpf

coagu

lation

36 hpf

coagulat

ion

48 hpf

coagulat

ion

72 hpf

coagula

tion

72 hpf

hatching

rate

96/120 hpf

coagulation

0 20 4 4 4 4 1 4

8 20 7 7 7 7 0.92 7

40 20 4 4 4 4 0.94 4

200 20 5 5 5 5 1 5

1000 20 3 3 5 19 0 20

5000 20 14 20 20 20 0 20

Table S3/ Raw data of morphological effect of 6-MeO-BDE-47.

Repeat

1

Concentration

(µg/L)

Total

embryos

24 hpf

coagulation

72 hpf

hatching

rate

96 hpf

coagulation

120 hpf

spinal

curvature

0 20 3 1 3 0

8 20 4 0.88 4 0

40 20 4 0.88 4 0

200 20 1 1 1 0

1000 20 7 1 7 0

5000 20 7 0.92 7 12

Repeat

2

Concentration

(µg/L)

Total

embryos

24 hpf

coagulation

72 hpf

hatching

rate

96 hpf

coagulation

120 hpf

spinal

curvature

0 20 3 1 3 0

8 20 4 1 4 0

40 20 3 1 3 0

200 20 1 1 1 0

1000 20 4 1 4 0

5000 20 1 1 1 19

Repeat

3

Concentration

(µg/L)

Total

embryos

24 hpf

coagulation

72 hpf

hatching

rate

96 hpf

coagulation

120 hpf

spinal

curvature

0 20 2 0.94 2 0

8 20 3 0.94 3 0

40 20 2 1 2 0

200 20 4 1 4 0

1000 20 4 1 4 0

5000 20 1 0.95 1 2

Table S4. Raw data of morphological effect of BDE-47.

Repeat 1 Concentration

(µg/L) Total embryos

24 hpf

coagulation

72 hpf

hatching

rate

120 hpf

coagulation

0 20 4 1 4

8 20 4 1 4

40 20 4 1 4

200 20 3 1 3

1000 20 4 1 4

5000 20 3 1 3

Repeat 2 Concentration

(µg/L) Total embryos

24 hpf

coagulation

72 hpf

hatching

rate

120 hpf

coagulation

0 20 4 1 4

8 20 5 1 5

40 20 2 1 2

200 20 2 1 2

1000 20 4 1 4

5000 20 3 1 3

Repeat 3 Concentration

(µg/L) Total embryos

24 hpf

coagulation

72 hpf

hatching

rate

120 hpf

coagulation

0 20 4 1 4

8 20 4 1 4

40 20 3 1 3

200 20 2 1 2

1000 20 5 1 5

5000 20 4 1 4