1

1

A multiplex PCR assay, targeting a di-guanylate cyclase encoding gene, cdgc1 to differentiate 2

species within the genus Cronobacter 3

4

L. Carter1, L. A. Lindsey1, C. J. Grim1, 2, V. Sathyamoorthy1, K. G. Jarvis1, G. Gopinath1, C. 5

Lee1, J. A. Sadowski1, L. Trach1, M. Pava-Ripoll3, B. A. McCardell1, B. D. Tall1 and L. Hu1* 6

7

CFSAN, FDA, 1Laurel, 3College Park, MD, 2Oak Ridge Institute for Science and Education, Oak 8

Ridge, TN, 9

10

Running title: Cronobacter species-specific GGDEF multiplex PCR assay 11

Key words: Cronobacter, GGDEF, multiplex PCR assay, cyclic diguanylate 12

13

14

15

*Please send reviewers' comments and galley proofs to: Lan Hu, M.D., Ph.D. Room, 3408 MOD 16

1 Facility, Virulence Mechanisms Branch, (HFS-025), Division of Virulence Assessment, 17

OARSA, Center for Food Safety and Applied Nutrition, U. S. Food and Drug Administration, 18

8301 Muirkirk Rd, Laurel, Maryland 20708, Phone#: 301-210-6279; Fax#: 301-210-7976, Email 19

address: lan16686@yahoo.com 20

21

22

Copyright © 2012, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.02898-12 AEM Accepts, published online ahead of print on 9 November 2012

on April 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

2

Abstract 23

Compared to the widely used Cronobacter rpoB-PCR assay, a highly specific 24

multiplexed PCR assay, based on cdgc1, a di-guanylate cyclase gene was designed that 25

identified all of the targeted six species among 305 Cronobacter isolates. This assay will be a 26

valuable tool for identifying suspected Cronobacter isolates from foodborne investigations.27

on April 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

3

Cronobacter spp. are Gram-negative, opportunistic pathogens that cause meningitis, 28

necrotizing enterocolitis, and septicemia in neonates and elderly individuals (3, 14, 20). 29

Cronobacter are ubiquitous in nature, and have been isolated from clinical, environmental and 30

from food sources, most notably powdered infant formula and other dried foods (14, 20) and 31

more recently, from surfaces and intestinal tracts of wild filth flies (15). The Cronobacter genus 32

consists of seven species: C. condimenti, C. dublinensis, C. malonaticus, C. muytjensii, C. 33

sakazakii, C. turicensis, and C. universalis (6, 8). Although all species, except C. condimenti 34

have been associated with clinical infections, C. sakazakii and C. malonaticus isolates are 35

responsible for causing the majority of infantile illnesses (9). It is important to identify 36

Cronobacter quickly and precisely. Current Cronobacter identification and subtyping methods 37

include 16S rDNA gene sequencing, ribotyping, DNA-DNA hybridization, rpoB PCR, Pulsed-38

field gel electrophoresis, plasmidotyping, and molecular serogrouping assays (1, 2, 6, 7, 13, 18, 39

20). These methods have detected considerable diversity among Cronobacter, however many of 40

these are not rapid or require multiple PCR reactions to identify or characterize isolates. Also, 41

16S rDNA sequence analysis has limitations for discriminating between very closely related 42

organisms, such as C. malonaticus and C. sakazakii, because of minimal sequence diversity or 43

the presence of multiple copies of 16S rDNA loci. It is necessary to ensure that reliable and 44

robust identification methods are used so that the control of contamination by these organisms 45

during the food manufacturing process and the reduction of exposure to susceptible high risk 46

individuals are achieved. 47

Cyclic di-guanylate (c-di-GMP) is a bacterial signal-transduction second messenger 48

recognized for its involvement in the regulation of a number of complex physiological processes, 49

including bacterial virulence, biofilm formation, and persistence (long-term survival) (16). Di-50

on April 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

4

guanylate cyclase, which synthesizes cyclic-di-guanylate, possesses a conserved active domain 51

of five amino acids, Gly-Gly-Asp-Glu-Phe, or GGDEF (16). Several foodborne pathogens such 52

as Vibrio cholerae, Salmonella, and E. coli encode variable numbers of GGDEF domain proteins 53

(16). 54

Analysis of 12 Cronobacter genomes revealed seven GGDEF-domain encoding genes, 55

which were conserved among all Cronobacter (5, 12, 17). Phylogenetic analysis of each set of 56

homologous genes from the available genomes revealed that homologs of two of the seven 57

genes, (ESA_04212 and ESA_03399 of C. sakazakii ATCC BAA-894) were highly similar 58

within the genus, and, one of these, within the Enterobacteriaceae (data not shown). In contrast, 59

the other five GGDEF domain-encoding genes (homologs of ESA_01230, ESA_01822, 60

ESA_03401, ESA_03491, and ESA_ 04315 from C. sakazakii ATCC BAA-894) showed 61

species-specific allelic divergence (Fig. 1A), some of which recapitulated the species-specific 62

phylogenetic relationships within the genus (Fig. 1B), previously described by Iversen et al. (6), 63

and as determined through MLST (10), rpoB sequencing analyses (18), and whole genome 64

phylogenetic reconstruction (5). 65

In particular, multiple sequence alignment of homologues of ESA_01230 from C. 66

sakazakii ATCC BAA-894 (Fig. 1A), annotated as a putative Cronobacter di-guanylate cyclase 67

(containing a GGDEF domain) and designated here as cdgc1, yielded a phylogeny in which all 68

six species formed discrete, distinct lineages, with relationships in agreement with whole genome 69

analysis (Fig. 1B). Further, we hypothesized that this gene would be amenable to species-70

specific primer design, based on length of the coding sequences and the depth of branching 71

exhibited between species, which, taken together, would provide a significant number of variable 72

sites (SNPs) for species-specific primer design (Supplemental Figure 1). 73

on April 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

5

These observations led us to design a set of species-specific multiplex PCR primers, 74

which could be used to identify strains of Cronobacter in a single multiplex PCR assay (Table 75

1). Primer sequences were chosen by multiple alignment analysis of the respective cgdg1 76

sequences using MEGA5 (19). The primer sequences were evaluated for their ability to form 77

homo- and heterodimers as well as hairpins by using oligo-analyzer 3.1 (Integrated DNA 78

Technologies, Coralville, IA). All primers were synthesized by (Integrated DNA Technologies). 79

Empirical primer concentration and PCR optimization studies were performed by changing 80

primer and template concentrations and PCR assay parameter conditions so that optimal kinetics 81

were achieved. 82

PCR mixtures were prepared using the GoTaq Green master mix (Promega Corp., 83

Madison, WI) according to the manufacturer’s instructions using boiled genomic DNA 84

preparations (approximately 50 ng DNA/25-μl reaction mixture) as DNA template (11). 85

GoTaq® Hot Start Green Master Mix (a–c) is a premixed, proprietary, ready-to-use solution 86

containing GoTaq® Hot Start Polymerase, dNTPs, MgCl2 and reaction buffers at optimal 87

concentrations for efficient amplification of DNA templates by PCR. GoTaq® Hot Start 88

Polymerase is supplied in 2X Green GoTaq® Reaction Buffer (pH 8.5), 400 μM dATP, 400 μM 89

dGTP, 400 μM dCTP, 400 μM dTTP and 4mM MgCl2. In all PCR reactions, the polymerase 90

was activated by using a 3-min predenaturation step at 94°C, followed by 25 cycles of 91

denaturation at 94°C for 30 s, annealing of 62°C for 30 s, and one min extension at 72°C, 92

following by a final extension step of 72°C for five min. PCR amplicons were subjected to 93

agarose gel electrophoresis using 1.3% Tris-borate-EDTA (TBE, Invitrogen, Carlsbad, CA) 94

agarose gels in a RunOne (Embi Tec, San Diego, CA) horizontal electrophoresis unit and were 95

on April 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

6

photographed with trans-illuminated UV light using a Bio-Rad Molecular Imager Gel-Chem-Doc 96

XR imaging system (Bio-Rad Laboratories, Hercules, CA). 97

Examples of the cdgc1 PCR assay results for type strains of Cronobacter are shown in 98

Fig. 3. Because C. condimenti is recently described and the taxonomic description is based on a 99

single isolate, this species was not included in these studies. The multiplex PCR assay was 100

evaluated by interrogating a collection of 305 well characterized Cronobacter strains (2, 4-7, 11), 101

which included 15 strains of C. dublinensis, two strains of C. universalis, 12 strains of C. 102

muytjensii, 11 strains of C. turicensis, 231 strains of C. sakazakii, and 34 strains of C. 103

malonaticus. The strain collection included isolates from clinical (69 strains), food (144 strains), 104

environmental (63 strains), flies (18 strains) and unknown (11 strains) sources which were 105

obtained from diverse geographic locations worldwide. These isolates were initially 106

characterized biochemically according to Iversen et al. (6), and later confirmed using the species-107

specific rpoB PCR assays as described by Stoop et al. (18). Additionally, this collection of 108

isolates was subjected to repF1B “plasmidotyping” (2) and molecular serogrouping (7, 13), the 109

results of which further corroborated the rpoB-based PCR species identification for each strain. 110

The multiplex cdgc1 PCR assay correctly identified (100%) the species identity of the 305 111

Cronobacter isolates. These results confirm the species-specificity of the cdgc1 multiplex PCR 112

assay. To test for exclusivity, twenty non-Cronobacter strains, which included Enterobacter 113

amnigenus, E. aerogenes, E. gergoviae, E. asburiae, E. cancerogenus, E. cloacae, E. cloacae 114

subsp. dissolvans, E. helveticus, E. pulveris, and E. turicencis, Citrobacter koseri, Pantoea 115

agglomerans, Erwinia carotovora, Kluyvera intermedia, Listeria monocytogenes, Escherichia 116

coli O157:H7, and Salmonella enterica subsp. enterica serovar Enteritidis, were assayed and all 117

were negative using these PCR primers. 118

on April 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

7

In conclusion this study demonstrates that the Cronobacter multiplex cdgc1 PCR assay 119

can be used to identify Cronobacter strains in a single reaction. The PCR assay described in this 120

report was found to be 100% specific (305/305 correctly identified as Cronobacter spp. strains) 121

and 100% sensitive (did not identify 20/20 non-Cronobacter species). Its main advantage over 122

the currently used rpoB PCR method is that species-identity of C. sakazakii and C. malonaticus 123

can be accomplished in a single reaction as opposed to two separate PCR reactions. The assay 124

reported here will be a valuable tool for identifying suspected Cronobacter isolates from clinical, 125

environmental, and foodborne outbreak and surveillance investigations, quickly and precisely. 126

127

Acknowledgements 128

L. A. Lindsey was a recipient of a 2011 National Association for Equal Opportunity in Higher 129

Education internship program fellowship, Washington, DC and is now a graduate student 130

researcher in the Department of Food and Nutritional Sciences at Tuskegee University in 131

Tuskegee, AL. C. Lee, L. Trach, and J. A. Sadowski were supported by Joint Institute of Food 132

Safety and Applied Nutrition student internship program, University of Maryland College Park. 133

134

on April 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

8

References 135 136

1. Brengi SP, O’Brien SB, Pichel M, Iversen C, Arduino M, Binsztein N, Jensen B, 137

Pagotto F, Ribot EM, Stephan R, Cernela N, Cooper K, Fanning S. 2012. 138

Development and validation of a PulseNet standardized protocol for subtyping isolates of 139

Cronobacter species. Foodborne Pathogen Dis. 9:861-867. 140

2. Franco AA, Hu L, Grim CJ, Gopinath G, Sathyamoorthy V, Jarvis KG, Lee C, 141

Sadowski J, Kim J, Kothary MH, McCardell BA, Tall BD. 2011. Characterization of 142

putative virulence genes on the related RepFIB plasmids harbored by Cronobacter spp. 143

Appl. Environ. Microbiol. 77:3255-3267. 144

3. Gosney MA, Martin MV, Wright AE, Gallagher M. 2006. Enterobacter sakazakii in 145

the mouths of stroke patients and its association with aspiration pneumonia. Eur. J. 146

Intern. Med. 17:185-188. 147

4. Grim CJ, Kothary MH, Gopinath G, Jarvis KG, Beaubrun JJ, McClelland M, Tall 148

BD, Franco AA. 2012. Identification and characterization of Cronobacter spp. iron 149

acquisition systems. Appl. Environ. Microbiol. 78:6035-6050. 150

5. Grim CJ, Kotewicz ML, Power KA, Franco AA, Gopinath G, Jarvis KG, 151

Yan QQ, Jackson SA, Hu L, Sathyamoorthy V, Pagotto F, Iversen C, Lehner A, 152

Stephan R, Fanning S, Tall BD. 2012. Genomic analysis of the pan genome of the 153

emerging bacterial foodborne pathogen Cronobacter spp. suggests a species-level 154

bidirectional divergence from a conserved genomic core. BMC Genomics (under review). 155

6. Iversen C, Mullane N, McCardell B, Tall BD, Lehner A, Fanning S, Stephan R, and 156

Joosten H. 2008. Cronobacter gen. nov., a new genus to accommodate the biogroups of 157

on April 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

9

Enterobacter sakazakii, and proposal of Cronobacter sakazakii gen. nov., comb. nov., 158

Cronobacter malonaticus sp. nov., Cronobacter turicensis sp. nov., Cronobacter 159

muytjensii sp. nov., Cronobacter dublinensis sp. nov., Cronobacter genomospecies 1, and 160

of three subspecies, Cronobacter dublinensis subsp. dublinensis subsp. nov., Cronobacter 161

dublinensis subsp. lausannensis subsp. nov. and Cronobacter dublinensis subsp. lactaridi 162

subsp. nov. Int. J. Syst. Evol. Microbiol. 58:1442-1447. 163

7. Jarvis KG, Grim CJ, Franco AA, Gopinath G, Sathyamoorthy V, Hu L, Sadowski 164

JA, Lee CS, Tall BD. 2011. Molecular Characterization of Cronobacter 165

Lipopolysaccharide O-Antigen Gene Clusters and Development of Serotype-Specific 166

PCR Assays. Appl. Environ. Microbiol. 77:4017-4026. 167

8. Joseph S, Cetinkaya E, Drahovska H, Ababneh QO, Levican A, Figueras MJ, 168

Forsythe SJ. 2011. Cronobacter condimenti sp. nov., isolated from spiced meat and 169

Cronobacter universalis sp. nov., a novel species designation for Cronobacter sp. 170

genomospecies 1 recovered from a leg infection water and food ingredients. Int. J. Sys. 171

Evol. Microbiol. 62:1277-1283. 172

9. Joseph S, Forsythe SJ. 2011. Predominance of Cronobacter sakazakii sequence type 4 173

in neonatal infections. Emerg. Infect. Dis. 17:1713-1715. 174

10. Joseph S, Sonbol H, Hariri S, Desai P, McClelland M, Forsythe SJ. 2012. Diversity of 175

the Cronobacter genus as revealed by multi locus sequence typing. J. Clin. Microbiol. 176

50:3031-3039. 177

11. Kothary MH, McCardell BA, Frazer CD, Deer D, and Tall BD. 2007. 178

Characterization of the zinc-containing metalloprotease (zpx) and development of a 179

on April 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

10

species-specific detection method for Enterobacter sakazakii. Appl. Environ. Microbiol. 180

73:4142–4151. 181

12. Kucerova E, Clifton SW, Xia XQ, Long F, Porwollik S, Fulton L, Fronick C, Minx 182

P, Kyung K, Warren W, Fulton R, Feng D, Wollam A, Shah N, Bhonagiri V, Nash, 183

K. Hallsworth-Pepin WE, Wilson RK, McClelland M, Forsythe SJ 2010. Genome 184

sequence of Cronobacter sakazakii BAA-894 and comparative genomic hybridization 185

analysis with other Cronobacter species. PLoS One. 5:e9556. 186

13. Mullane N, O'Gaora P, Nally JE, Iversen C, Whyte P, Wall PG, Fanning S. 2008. 187

Molecular analysis of the Enterobacter sakazakii O-antigen gene locus. Appl. Environ. 188

Microbiol. 74:3783-3794. 189

14. Nazarowec-White M, Farber JM. 1997. Enterobacter sakazakii: a review. Int. J. Food 190

Microbiol. 34:103-113. 191

15. Pava-Ripoll M, Pearson REG, Miller AK, Ziobro GC. 2012. Prevalence and relative 192

risk of Cronobacter spp., Salmonella spp. and Listeria monocytogenes associated with 193

the body surface and the guts of individual filth flies. Appl. Environ. Microbiol. 78:7891-194

7902. 195

16. Sondermann H, Shikuma NJ, Yildiz FH. 2012. You’ve come a long way: c-di-GMP 196

signaling. Curr. Opin. Microbiol. 15:140-146. 197

17. Stephan R, Lehner A, Tischler P, Rattei T. 2011. Complete genome sequence of 198

Cronobacter turicensis LMG 23827, a food-borne pathogen causing deaths in neonates. 199

J. Bacteriol. 193:309-310. 200

18. Stoop B, Lehner A, Iversen C, Fanning S, Stephan R. 2009. Development and 201

on April 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

11

evaluation of rpoB based PCR systems to differentiate the six proposed species within the 202

genus Cronobacter. Int. J. Food Microbiol. 136:165-168. 203

19. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGA5: 204

molecular evolutionary genetics analysis using maximum likelihood, evolutionary 205

distance, and maximum parsimony methods. Mol. Biol. Evol. 28:2731-2739. 206

20. Yan QQ, Condell O, Power KA, Butler F, Tall BD, Fanning S. 2012. Cronobacter 207

species (formerly known as Enterobacter sakazakii) in powdered infant formula: a 208

review of our current understanding of the biology of this bacterium. J. Appl. Microbiol. 209

113:1-15. 210

on April 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

12

Table 1. Cronobacter species-specific cdgc1 PCR primers used in this study 211

212

*The PCR primer, Cdm-469R, used in multiplex reactions, with primers Cdub-40F and Cmuy-213

209F identify C. dublinensis and C. muytjensii strains, respectively. PCR primer Cmstu-825F, 214

used in multiplex reactions, with primers Ctur-1036R, Cuni-1133R, Csak-1317R and Cmal-215

1410R identify C. malonaticus, C. sakazakii, C. turicensis, and C. universalis, strains, 216

respectively. The numbers comprising each primer name represents the 5’ bp location within the 217

aligned nucleotide sequence of cdgc1 (Supplemental Figure 1). 218

219

Primers Sequence Amplicon (bp) Species ID

Cdm-469R* CCACATGGCCGATATGCACGCC

Cdub-40F GATACCTCTCTGGGCCGCAGC 430 C. dublinensis

Cmuy-209F TTCTTCAGGCGGAGCTGACCT 260 C. muytjensii

Cmstu-825F* GGTGGCSGGGTATGACAAAGAC

Ctur-1036R TCGCCATCGAGTGCAGCGTAT 211 C. turicensis

Cuni-1133R GAAACAGGCTGTCCGGTCACG 308 C. universalis

Csak-1317R GGCGGACGAAGCCTCAGAGAGT 492 C. sakazakii

Cmal-1410R GGTGACCACACCTTCAGGCAGA 585 C. malonaticus

on April 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

13

220

221

Figure 1. Evolutionary reconstruction of (A.) homologues of GGDEF domain-encoding gene C. 222

sakazakii ATCC BAA-894 ESA_01230 (*) among Cronobacter, and (B.) the genus Cronobacter 223

using 0.5 Mb of syntenic whole genome nucleotide sequence (4). Evolutionary analyses were 224

conducted in MEGA5 (19). The evolutionary history was inferred using the Neighbor-Joining 225

method. The bootstrap consensus tree inferred from 1000 replicates. The evolutionary distances 226

were computed using the Maximum Composite Likelihood method and are in the units of the 227

number of base substitutions per site. 228

Figure 2. Schematic map of cdgc1 showing locations of PCR primers. Smallest tick of the scale 229

represents 50 bp nucleotide positions with larger ticks representing 100 bp and 1kbp nucleotide 230

positions. See Table 1 for explanation of primer names and nucleotide bp positions. 231

Figure 3. Representative gel image of Cronobacter species-specific GGDEF multiplex PCR. 232

Lanes 1 and 10, TrackIt 100 bp DNA Ladder (Invitrogen); lanes 2, C. dublinensis strain LMG 233

23823T; lane 3, C. universalis strain NCTC 9529; lane 4, C. muytjensii strain ATCC 51329; lane 234

5, C. malonaticus strain LMG 23826T; lane 6, C. sakazakii strains BAA-894; lane 7, C. 235

turicensis strain z3032; lane 8, Enterobacter helveticus strain z513, and lane 9, no DNA template 236

control. Five µl of each PCR reaction (amplicons) was subjected to gel electrophoresis using 237

1.5% agarose gels and were visualized with ethidium bromide (at a final concentration of 0.5 238

µg/ml). 239

240

on April 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

14

Supplemental Figure 1. Multiple alignment of cdcg1 of the different targeted species with 241

marked primer sequence (underlined). 242

243

on April 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

A.

**

B.

Figure 1. Evolutionary reconstruction of (A.) homologues of GGDEF domain-encoding gene C. sakazakiiATCC BAA-894 ESA_01230 (*) among Cronobacter, and (B.) the genus Cronobacter using 0.5 Mb of syntenic whole genome nucleotide sequence [4]. Evolutionary analyses were conducted in MEGA5 [19]. The evolutionary history was inferred using the Neighbor-Joining method. The bootstrap consensus tree inferred from 1000 replicates. The evolutionary distances were computed using the Maximum Composite Likelihood method and are in the units of the number of base substitutions per site.

on April 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

cdgc1

1 1542

Figure 2. Schematic map of cdgc1showing locations of PCR primers. Smallest tick of the scale represents 50 bp nucleotide positions with larger ticks representing 100 bp p p p g p g pand 1kbp nucleotide positions. See Table 1 for explanation of primer names and nucleotide bp positions.

on April 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from

1 2 3 4 5 6 7 8 109

500 bp500bp

Figure 3. Representative gel image of Cronobacter species-specific GGDEF multiplex PCR. Lanes 1 and 10, TrackIt 100 bp DNA Ladder (Invitrogen); lanes 2, C. dublinensis strain LMG 23823T; lane 3, , p ( g ); , ; ,C. universalis strain NCTC 9529; lane 4, C. muytjensii strain ATCC 51329; lane 5, C. malonaticus strain LMG 23826T; lane 6, C. sakazakii strains BAA-894; lane 7, C. turicensis strain z3032; lane 8, Enterobacter helveticus strain z513, and lane 9, no DNA template control. Five µl of each PCR reaction (amplicons) was subjected to gel electrophoresis using 1.5% agarose gels and were visualized with ethidium bromide (at a final concentration of 0.5 µg/ml).

on April 8, 2018 by guest

http://aem.asm

.org/D

ownloaded from