5400 HULMEVILLE ROAD BENSALEM, PA 19020...Saint Ephrem Church Bensalem, Pennsylvania December 13,...

8
Rev. Msgr. Kenneth P McAteer, Pastor Rev. Stephen F. Katziner, Parochial Vicar Rev. Timothy F. O’Sullivan, Parochial Vicar Deacon James P. DeBow, Permanent Deacon Deacon Edward J. Dymek, Permanent Deacon Sister Mary Jane Bransfield, I.H.M., Superior Sister Shaun Thomas Callahan, I.H.M., Principal Sister Mary Jane Bransfield I.H.M., 215-639-4332 Pastoral Minister to the Sick & Elderly Mrs. Christianne Quinn, 215-639-4895, C.R.E., P.R.E.P. Mr. Chuck Burgy, 215-245-1698, Business Manager Mr. Ronald Chancler, 267-679-6638 Liturgy and Music Coordinator PARISH STAFF MASS SCHEDULE Sunday Vigil: Saturday 5:00 PM Sunday: 7:30, 10:30 & 12:00 Daily: 7:00 & 8:30 AM - Saturday - 8:30 AM only Holy Days: Schedule Varies, please check website prior to Holy Day CONFESSIONS: Saturdays: 4:00 to 4:45 PM Confessions on Wednesdays after the 8:30 AM Mass. PARISH REGISTRATION: A new parishioner may register in the parish by speaking with one of the priests in the lobby of the church after one of the Sunday Masses or by calling a priest for an appointment. (215-245-1698) 5400 HULMEVILLE ROAD BENSALEM, PA 19020 RECTORY: 215-245-1698 SCHOOL: 215-639-9488 CONVENT: 215-638-1024 HALL : 215-639-5984 SCHOOL WEBSITE:: SAINTEPHREMSCHOOL.COM PARISH WEBSITE: WWW.STEPHREM.COM SCHOOL FACEBOOK PAGE: WWW.FACEBOOK.COM/SAINTEPHREMSCHOOL/

Transcript of 5400 HULMEVILLE ROAD BENSALEM, PA 19020...Saint Ephrem Church Bensalem, Pennsylvania December 13,...

Page 1: 5400 HULMEVILLE ROAD BENSALEM, PA 19020...Saint Ephrem Church Bensalem, Pennsylvania December 13, 2020 1 099 St. Ephrem Texts for Sunday, December 20th 1st Reading: 2 Samuel 7:1-5,

Rev. Msgr. Kenneth P McAteer, Pastor Rev. Stephen F. Katziner, Parochial Vicar Rev. Timothy F. O’Sullivan, Parochial Vicar Deacon James P. DeBow, Permanent Deacon Deacon Edward J. Dymek, Permanent Deacon Sister Mary Jane Bransfield, I.H.M., Superior

Sister Shaun Thomas Callahan, I.H.M., Principal Sister Mary Jane Bransfield I.H.M., 215-639-4332

Pastoral Minister to the Sick & Elderly Mrs. Christianne Quinn, 215-639-4895,

C.R.E., P.R.E.P. Mr. Chuck Burgy, 215-245-1698, Business Manager Mr. Ronald Chancler, 267-679-6638

Liturgy and Music Coordinator

PARISH STAFF

MASS SCHEDULE Sunday Vigil: Saturday 5:00 PM

Sunday: 7:30, 10:30 & 12:00 Daily: 7:00 & 8:30 AM - Saturday - 8:30 AM only

Holy Days: Schedule Varies, please check website prior to Holy Day

CONFESSIONS: Saturdays: 4:00 to 4:45 PM Confessions on Wednesdays after the 8:30 AM Mass.

PARISH REGISTRATION: A new parishioner may register in the parish by

speaking with one of the priests in the lobby of the church after one of the Sunday Masses or by calling a priest for an appointment. (215-245-1698)

5400 HULMEVILLE ROAD BENSALEM, PA 19020 RECTORY: 215-245-1698 SCHOOL: 215-639-9488 CONVENT: 215-638-1024 HALL : 215-639-5984

SCHOOL WEBSITE:: SAINTEPHREMSCHOOL.COM PARISH WEBSITE: WWW.STEPHREM.COM

SCHOOL FACEBOOK PAGE: WWW.FACEBOOK.COM/SAINTEPHREMSCHOOL/

Page 2: 5400 HULMEVILLE ROAD BENSALEM, PA 19020...Saint Ephrem Church Bensalem, Pennsylvania December 13, 2020 1 099 St. Ephrem Texts for Sunday, December 20th 1st Reading: 2 Samuel 7:1-5,

Saint Ephrem Church Bensalem, Pennsylvania

December 13, 2020

099 St. Ephrem 1

Texts for Sunday, December 20th 1st Reading: 2 Samuel 7:1-5, 8b-12, 14a, 16 Responsorial Psalm: Psalms 89:2-5, 27, 29 2nd Reading: Romans 16:25-27 Gospel: Luke 1:26-38

PLEASE PRAY FOR OUR SICK PARISHIONERS, FAMILY MEMBERS AND FRIENDS

Sunday, December 13~ Third Sunday of Advent 7:30 Agnes Schrenk req. by Mike & Janice Gallagher 9:00 Phil DeLeo req. by Linda & Ed Smith 10:30 Jane Nowicki req. by Her Family 12:00 For the St. Ephrem Parish Family

Monday, December 14 7:00 Henry Dubiel req. by Stephanie Morris 8:30 Joanne Kirkley req. by Dyanne Alexy

Tuesday, December 15 7:00 Charles S. Giarratano req. by The Medash & Petta Families 8:30 For the Benefactors of the Sanctuary Endowment Fund

Wednesday, December 16 7:00 Mary Pucher, 8th Anniversary req. by Barbara Pucher 8:30 Anthony Duca req. by Mary Boyle

Thursday, December 17 7:00 Agnes Schrenk req. by The Jones Family 8:30 Deena David req. by Friends of Michelle David

Friday, December 18 7:00 A Special Intention req. by Stephanie Morris 8:30 Marita Cliggett req. by Denny & Pat Ziemba

Saturday, December 19 8:30am Mary Zorek req. by Jean & Jack Pawlowski 5:00pm For the St. Ephrem Parish Family

Sunday, December 20~ Fourth Sunday of Advent 7:30 William J. req. by Steve & Evelyn O’Donnell 9:00 Richard Ziemba req. by Ed & Michelle Daley 10:30 Stella Laskowski req. by Jo & Jack Siwinski 12:00 Christopher Craven req. by Sean, Cole, Dee & His Family

Baptisms Baptisms are held the 2nd and 4th Sundays of each month at

1:30 PM. Please contact one of the parish priests to make arrangements. Both parents must attend a Pre-Jordan class

prior to their child's Baptism. Pre-Jordan is held the 1st Monday of each month at 7:30 PM in Church.

Pre-registration for Pre-Jordan is required, and can be done by calling the rectory at 215-245-1698.

Sharon Edwards Irene McCarthy Baby Owen

Baby Joel Heim Bill Storms Mary Biehn

Carol Higgins Michael Acquaviva Paul McGrath

Margaret Griffiths Catherine, Kelly & Samuel Gabriele

Christina Stockton and Newborn

Brian Matsinger, Sr. John Roley Susan Smith

Patricia Grandinetti Kimberly Ann Pastor

Mary Tilton

E.J. Connell Paula Collins Patrick Collins

Michael McGovern Robert Gilmer E.J. Richmond

Kevin Goodwin Trudy Gryniewicz Margaret and Noreen Jardine

Jacki Brady Baby Nicholas Tom Collins

Jacob Simon Margaret Grone Janine Hee

Baby Dexter James Mike Souders Marcia McCullough

Elizabeth DiPasquale

Mary Ellen Seifert Irene Olsen

Judah Jackson Paul Barrett, II Andrew Samora

Baby Steven Infante

Mary Jane Finley Jack Gallen

Bill Butz Tom Zmigiodski Baby Bennett

Charles Sanford C.J. Gryniewicz Brian Feldman

John O’Donnell Roseann Lantz Michael Schultz

Baby Beatrice Finegan

Baby Harper Giempietro Ann Higgins

Page 3: 5400 HULMEVILLE ROAD BENSALEM, PA 19020...Saint Ephrem Church Bensalem, Pennsylvania December 13, 2020 1 099 St. Ephrem Texts for Sunday, December 20th 1st Reading: 2 Samuel 7:1-5,

We can relax...but just a little ! The Liturgy Office of the Archdiocese of Philadelphia, working closing with the Health Department of the Commonwealth of Pennsylvania, as well as closely

following recommendations from The Center for Disease Control (CDC), has recently recommended to parishes

across the Archdiocese several relaxations of the precautionary protocols that we have had in place

since we resumed our public Mass celebrations earlier this year.

Beginning with the First Sunday of Advent, (Saturday, November 28th) we will return Missals to our pews for

those who wish to use them. 11/22 UPDATE : Holy Water will NOT be returned to the fonts at our Church doors until further notice.

All restrictions on singing have been lifted, with the exception of large choirs; and, we will continue to

sanitize our pews and public spaces on a daily basis. Parishioners are reminded that we (continue to) highly

recommend the wearing of masks (for those over the age of two) for the duration of your time in Church; we will continue to offer Holy Communion on the tongue only from the main celebrant of the Mass as he distributes Holy Communion; and, social distancing in Church remains in place, with every other pew roped off to

ensure proper distancing for all who join us for Mass. We ask that you not move the ropes when entering the

Church, as the ropes indicate what pews have been sanitized. We are grateful to all our parishioners who

are working to keep our Church clean and safe! If any parishioners have any questions, comments or

concerns regarding our parish's COVID precautionary protocols, please call the rectory.

JUST A REMINDER

We are now taping our 5:00pm Saturday evening Mass, which will be available for

viewing after 8:00pm on Saturday evening. The Mass will not be available for live-streaming at 5:00pm Saturday evening, but will be available, for your convenience anytime after 8:00pm on

Saturday evening.

The address for the Mass, which lists all the Masses we have recorded thus far, is:

bit.ly/saintephrembensalem

2 099 St. Ephrem

Altar Server Schedule

Saturday Evening (December 19) 5:00 pm Olivia Wright, Annie Conner

Sunday (December 20) 7:30 am Jake Elkins, Owen Elkins

10:30 am Nicholas Riccio, Nathan Barrett

12 Noon Andrew Mizgerd, Ryan Zebrowski

Are You Called to Be a Deacon?

Archdiocese of Philadelphia Permanent Diaconate Information

Night Webinar

Thursday, December 17, 2020

7:00 PM

We invite Catholic men (and their wives, if married) between the ages of 29 and 55 who would like more information

about serving as a permanent deacon to attend an information night.

Join us for a live webinar from a panel of permanent deacons on discerning a vocation to the Permanent Diaconate

and the School for Diaconal Formation Program.

For more information, or to obtain the preregistration link, please visit the

School of Diaconal Formation website:

https://www.scs.edu/diaconal-formation

Page 4: 5400 HULMEVILLE ROAD BENSALEM, PA 19020...Saint Ephrem Church Bensalem, Pennsylvania December 13, 2020 1 099 St. Ephrem Texts for Sunday, December 20th 1st Reading: 2 Samuel 7:1-5,

099 St. Ephrem 3

A Two-Pronged Response to the Addiction Crisis The Church desires to be close to her children who are

struggling with addiction and to bring them the healing power of Jesus Christ's love. The Archdiocese of Philadelphia

offers a two-pronged response to the addiction crisis, which aims to attend to the needs of the whole person, body, mind and spirit. The resources below are for those struggling with

an addiction and/or their family and loved ones: For clinical and social service resources such as local

treatment facilities, AA, NA and Al-Anon groups, insurance information, crisis support, and other

services, visit RecoveryAndHope.org For Catholic spiritual support for addiction offered by our

local Catholic community, please explore the Hope in Christ website at archphila.org/hope.

Nourish for Caregivers Support Group In a recent Sunday Gospel Jesus reminds us that he

desires mercy, not sacrifice. (Mt 9:13) For caregivers, life is often all about sacrifice. Whether it is putting their own needs aside until the end of the day or forgoing self-care altogether, exhaustion & frustration can be

ever present companions. This month, Nourish offers the topic "The Thing About Compassion." We focus on

caring for the caregiver because this role is not just about sacrifice, but also availing one's self to the loving embrace from our merciful Jesus and his most Blessed

Mother. The ministry meets in-person at a variety of times and locations throughout the Archdiocese as well

as virtually via Zoom. For more information visit http://www.phillyevang.org/nourish/ or contact

Aimee Gustitis at 610-724-8950 or [email protected].

CHRISTMAS OUTREACH OPPORTUNITY As we prepare our hearts for the Advent season, we are asked to continue to remember the less

fortunate at this time. If you are able, please consider reaching out to others who are

in need.

The annual CHRISTMAS OUTREACH assists families from St. Ephrem’s Parish who in

need of help with providing a Happy Christmas for their families

Gift cards are a good choice. Food gift cards provide needed money for family dinners and the other store

gift cards assist parents in purchasing needed clothing, etc.

In your generosity we are asking you to donate GIFT CARDS from your choice from the

following stores: GIANT, ACME, SHOP RITE, WAL-MART, KOHL’S, TARGET, DOLLAR

TREE AND AMAZON.

Please drop all gift cards off at the rectory or in the collection basket only Please mark the envelope

“CHRISTMAS OUTREACH” Donations are due by Monday, Dec. 14 so we can

deliver to the families in sufficient time for shopping for their needs.

If you are in need of help, or know someone who is in need, please contact

Sr. Mary Jane –215-639-4332.

Thank you for your Generosity and God bless you!

Extra Advent Confession Times

Wednesday, December 16th join us for our Parish Penance Service from 7-8pm

(extra priests available)

Saturday, December 19th from 3:00-4:45pm

Every Saturday from 4:00-4:45pm.

Every Wednesday at 9:00am, following the 8:30am Mass.

Anytime by appointment.

Call the rectory (215-245-1698) to schedule.

Pre-Cana at Christ the King Christ the King Parish will offer the Pre-Cana program

on Saturday, 1/30/21. Engaged couples of nearby parishes who are planning to celebrate the Sacrament of Matrimony next year are most welcome. Masks, social

distancing and other health-related steps will be in place. For information, please contact Rich Green,

Christ the King Pre-Cana Coordinator, at [email protected].

AANNOUNCEMENT

Dear Parish Family,

As a result of the Covid situation, we have decided to cancel the Appreciation Luncheon normally held in early January. We want all of our parish volunteers to know, however, that we appreciate all that you do to enrich the growth and prosperity of our parish family. Please be assured that we couldn't do it without you! We love you.

Gratefully, Msgr. McAteer

Page 5: 5400 HULMEVILLE ROAD BENSALEM, PA 19020...Saint Ephrem Church Bensalem, Pennsylvania December 13, 2020 1 099 St. Ephrem Texts for Sunday, December 20th 1st Reading: 2 Samuel 7:1-5,

099 St. Ephrem 4

This & That (Fr. S. Katziner)

Christmas Confessions at St. Ephrem– On a Lighter Note

Years ago on a Christmas Eve around 6:30 pm parishioner Ron Ritz was on his way home from work.

A light amount of snow had fallen, around 2-3 inches. He decided to stop at St. Ephrem to make sure everything was ready for midnight Mass. When he pulled into the

parking lot, he saw all of the lights on in the church and he went in. Msgr. Musial (pastor from 1973-1996) and the assistant were hearing confessions. Ron checked all of the lights and decorations, and, as he was leaving, he saw that the front walk was not cleared of snow, so he

looked around for a snow shovel. Ron knew that if someone did not shovel the walk, Msgr. would do it himself, so he started to clear the snow. As he was

shoveling the snow, an elderly woman arrived and asked if they were hearing confessions. Ron said, “Yes, Msgr. was inside.” And as she was walking into church, Ron

added, “Be careful what you tell him, because I just went to confession and this is what I received for my

penance.” Ron then said, “She smiled and thanked me, but went into confession anyway.”

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Ron is an original member and continues to usher at the 7:30 AM Sunday Mass.

Thank you, Ron, for your sense of humor and all of your efforts on behalf of the church.

RCIA–Rite of Christian Initiation of Adults RCIA is a series of weekly study, prayer & reflective

presentations created to provide non-Catholic adults with a greater understanding of the Catholic faith. RCIA is designed as the process for individuals who desire to convert or join the Catholic Church. RCIA provides an

in-depth review of the practices, beliefs and customs of the Catholic faith. In addition, any baptized Catholic who

has not received all of the sacraments is welcome to rediscover their faith and commitment to Christ through

the RCIA process and the reception of these sacraments.

While the classes usually start in September, due to concern for the ongoing Covid-19 issues, we have

decided to begin the RCIA classes in January 2021. The classes will be presented on Wednesday nights from 7:30 to 9:00 P.M. in the Church. The first class

will be a Welcome Night on January 13, 2021. Classes will continue on every Wednesday through

the end of May. If you are considering coming to RCIA or would like more information, please contact Msgr. McAteer at the rectory

at 215-245-1698 or Gerri Donnelly at 215-638-7184.

Cathedral Virtual Christmas Concert Sunday, December 13th, 2020-2:00 PM

The Cathedral Basilica of Saints Peter and Paul proudly presents our first-ever Virtual Christmas Concert, Prayer for Peace, on December 13, 2020 at 2pm.

Join the Cathedral choir and instrumentalists as they perform works by Abbie Betinis, Frank La Rocca, Julian Wachner, William Walton, as well as beloved Christmas Carols for all to participate. May we all experience the

hope, joy and love of our Lord, Jesus Christ, throughout the Christmas season. A link to the concert will be

emailed to you on the day of the concert, or any subsequent day after Dec. 13 when a ticket is purchased.

For tickets, please visit. http://cathedralphila.org/music/choirs-at-the-

cathedral-basilica/

Come and See Events Come and See Events begin in January 2021 and are designed to let young men (high school age and above) who are discerning

the priesthood. Come and See Events are available for high school men (single day program) and post-high school men

(overnight). These events are held monthly between January and March 2021. Specific dates are listed below - to register for one

of these events, please visit Heedthecall.org/comeandsee or contact Fr. DeLacy at [email protected].

High School Days of Discernment Sunday, January 17, 2021

Saturday, February 20, 2021 Saturday, March 13, 2021

Post-High School Overnights January 22-23, 2021 February 26-27, 2021 March 19-20, 2021

Page 6: 5400 HULMEVILLE ROAD BENSALEM, PA 19020...Saint Ephrem Church Bensalem, Pennsylvania December 13, 2020 1 099 St. Ephrem Texts for Sunday, December 20th 1st Reading: 2 Samuel 7:1-5,

099 St. Ephrem, Bensalem, PA (3) John Patrick Publishing Company Inc. 1.800.333.3166 • www.jppc.net

PLUMBING, HEATING, DRAIN CLEANING & AIR CONDITIONING

SENIOR CITIZEN DISCOUNTFREE ESTIMATES

Ph: (215) 728-1482Fax: (215) 742-7098

8675 Torresdale Ave.Philadelphia, PA 19136

WWW.BILLFRUSCO.COM

2436 Bristol Road • Bensalem

Dan Shurdich Offi ce: (215) 752-0560 Owner Fax: (215) 752-0561 Member of Parish Cell Ph. (267) 228-5718

Adjusting Your Insurance Claims Is Our Top Priority!Residential & Commercial • Serving all of PA and NJLicensed and Bonded by the Insurance Department

Paul & Karen LaichParishioners www.flowergirlflorist.com

Showcase Plaza • 2832 Street Road • Bensalem, PA 19020

Wedding Specialist

Steve’s Automotive & Collision5526 Hulmeville Rd. (Right Up The St.)

215-639-9851Discount For St. Ephrem Parishioners With Ad

www.Stevesautomotiveandcollision.netFOR ALL YOUR VEHICLE NEEDS!

Burns Funeral HomesBurns Funeral Homes

9708 Frankford Ave.Phila., PA 19114

(South of Grant Ave.)215-637-1414

Gerard J. Burns, Supv.

1514 Woodbourne Rd.Levittown, PA 19057(Next to K of C Hall)215-547-3040

Lisa Burns Campbell, Supv.

1428 E. Columbia Ave.Phila., PA 19125

(At Frankford Ave.)215-634-6858

Joseph J. Burns, Supv.

Family Owned and Operated Since 1939Family Owned and Operated Since 1939

www.burnsfuneralhome.www.burnsfuneralhome.comcomAllbrook Plumbing Company

www.AllbrookPlumbing.comPlease Check Out Our Website for

Money Saving Specials!215.990.7879 • Bensalem, PA

PA Lic#RCC508 • PA HIC#118447

MAGGIE VELEKNo Nonsense Just Results

Re/Max Realty ServicesCell-215-805-1611Offi [email protected]

It’s a sellers’ market and inventory is needed!If you are wondering what your home is worth in this

market, call me for a free evaluation right away!

ParishionerStephen Gannon

THE GANNON INSURANCE AGENCY

2704 Street RoadBensalem, PA 19020(215) 891-9990

AUTO • HOMELIFE • BUSINESS

[email protected] Office: 215.395.6277

DAN PITTSRealtor® & Parishioner

215.760.7604

In Our 4th Decade of Quality Service

French Drains • Foundation Repair • Mold Remediation

215-639-8500www.morganbasementwaterproofing.com

All Work Guaranteed

MGCLANDSCAPING

Landscaping & Lawn MaintenanceBushes & Trees Thinned

Topped & RemovedStump GrindingFULLY INSUREDFREE ESTIMATES

638-3311PARISHIONER

Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M

To all those essential workers keeping us safe,

yourservice is

invaluable & appreciated.

afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg

y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis

cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfornfornfornfornfornfornfornformatimammmmmmammmmmm o

echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n

acturing - Chemical &&&&&&&&&&&l &l & l & l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens

dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans

ortation &&&&& & && & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker

CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufacturing - Cheml l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo Materials Financia

ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw EnEEE forcforcforcffforcforcforcforcforcforcforceement, Public Safety - O

To all those nforcement, Public Sanforcement, Public Sa

essentiallture - Energylture - EnergyWater aste TraWater aste Tra

workerscs - Public Wors - Public WorCommunicatioCommunicatio

keeping echnology Wochnology Woovernment Wovernment W

us safe,acturing Caterials Finanaterials Finan

yournicationnicationWorkerWorke

service isovernment Workovernment Workacturing Chemacturing Chem

invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar

ment, Public Safety - OSafety - Othan

k yo

u

g gyWatateatttatatatattaaaaaa rwaswaswawaswaswawwwaswaswwwwwasswasawaw ste -tetttttttttteee Transportation & Log

cccscccccc - PPPPPPPPPPPPPPubliubliubliubliublililublibbliububuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrkrkkkkkrr & - & -& -&& -&& -&&&& -&& -&&&&& -&&&& -&& InfrInfInfrnfrInfInfrnfrIInffI ffInI fnfI fInfnfInnnfn astructuCCoCoCoCoCoCoCCoCCoCCCoooCCCCCCCC mmunmmunmmmmmmunmmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicatcaticaticatcatcatcatcattcatcatcatcattcatcatcatcatccacatcccacc ionsionsionsonsionononsonsiooionssonsonsonsiononoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornforforfnfnfornfornfornfornforfofornfornforrrfornnfforrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmatim

echhhhhhhhhnolonononoonnoloonolonnoln lonolonoooloonnnn onolonoln oonoo ggy Wgggg orkers - Community

PERSONAL TRAININGColin Hartmann

ACSM Certifi ed • Crossfi t Level 1 Certifi ed

215-450-7588 [email protected]

Sweat is Calories Crying

BASEMENTWATERPROOFING

FOUNDATION REPAIRMOLD REMEDIATION

1-888-5DRY-TECHwww.DryTechCorp.com

Neighboring Parishioner

Page 7: 5400 HULMEVILLE ROAD BENSALEM, PA 19020...Saint Ephrem Church Bensalem, Pennsylvania December 13, 2020 1 099 St. Ephrem Texts for Sunday, December 20th 1st Reading: 2 Samuel 7:1-5,

099 St. Ephrem, Bensalem, PA (I) John Patrick Publishing Company Inc. 1.800.333.3166 • www.jppc.net

James J. DoughertyJames J. DoughertyFuneral Home. Inc.Funeral Home. Inc.

John J. Bonner, Jr., Supervisor2200 Trenton Road, Levittown, PA 19056

215-943-7240

FINN PLUMBINGSERVICE/REPAIRSCOMPLETE BATH

REMODELING215-547-5424

Experience Peace of Mind:Pre-Arrange Your Burial at an

Archdiocese of Philadelphia Cemetery.

• Save today through pre-planning• Convenient terms for all of your burial needs• Traditional in ground, mausoleum & cremation options available at most cemeteries

CALL 215-352-4001 TODAY

Visit Our

New LocationFREE Logo Set-Upwith mention of this ad ($35 Value)

Glenn Reineke, OwnerJill Fallon Payne, Manager/AR Grad

Screen Printing • Embroidery • Online SpiritwearTeam/League Uniforms • Corporate Apparel • Banners & Signs

215-752-32232159 Galloway Road • Bensalem

Family owned & operated Since 1898

215-639-3130

864 Bristol Pike (Rt. 13) • 864 Bristol Pike (Rt. 13) • Bensalem, PA 19020Bensalem, PA 19020Joan Fluehr, Owner • Robert J. Mahan, SupervisorJoan Fluehr, Owner • Robert J. Mahan, Supervisor

Only location in Bucks CountyOnly location in Bucks CountyPre-Arranged Funerals • Traditional FuneralsPre-Arranged Funerals • Traditional Funerals

Crematory on PremisesCrematory on Premiseswww.fluehrfh.comwww.fluehrfh.com

$350Off Any New Stairlift With This Ad

• FREE in home evaluations• Family owned & operated for more than 20 years

1.888.900.8883www.Tri-StateStairlifts.com

NAMI of Bucks CountyIS HERE TO HELP

If you or someone you know struggles with Depression, Bipolar Disorder, OCD, Anxiety, PTSD, Schizophrenia, BPD,

Co-occuring mental illness and substance abuse...WE ARE HERE FOR YOU!

• Attend Our FREE Support Groups and/or Forums• Take Our FREE Education Classes (Starting in the Fall)

Bucks County Voice on Mental Illness • Call Our Helpline1(866) 399-NAMI (6264) • www.namibucks.org

Mallory’s Army Foundation

United Together In The Fight Against Bullying...

Don’t Just Teach Kindness...

B E K I N D N E S S !www.MallorysArmy.com

(973) [email protected]

It’s easy to join our mailing list! Just send your email address by text message:

Text MALLORYSARMY to 22828 to get started.

Message and data rates may apply.

B U I L D I N G A B U I L D I N G A S T R O N G E RS T R O N G E R

C O M M U N I T YC O M M U N I T Y

Page 8: 5400 HULMEVILLE ROAD BENSALEM, PA 19020...Saint Ephrem Church Bensalem, Pennsylvania December 13, 2020 1 099 St. Ephrem Texts for Sunday, December 20th 1st Reading: 2 Samuel 7:1-5,

099 St. Ephrem, Bensalem, PA (B) John Patrick Publishing Company Inc. 1.800.333.3166 • www.jppc.net

A Pharmacy that cares for you!

2217 Bristol Pike - Suite 2Bensalem, PA 19020

tel 215.639.6680www.ricciofamilypharmacy.com

Free Delivery

We Accept Scrip

Customer Loyalty Program

Parishioner

Joe CunninghamJoe CunninghamRE/MAX Eastern, Inc.2471 Grant Avenue • Philadelphia, PA 19114

215-961-6011www.joecsells.com

“I am never too busy for you or your referrals.”

Each Offi ce independently owned and operatedDiocesan MemberDiocesan Member

Jim Byrd, ABR, CDPE, SFR, SRES, Realtor

Cell: 215-840-8019Offi ce: 215-638-3830 [email protected] Bristol Road

www.BucksAndPhillyRealEstate.comONLY 1 ($500) REBATE PER TRANSACTION PAYABLE AT SETTLEMENT

Sell • Buy • Invest$500 Discount

For Parish Members

215-752-9080Plumbing • HeatingOil Burner Servicewww.keseifert.com

John’s Barbershop1664 Street Rd.

Open EarlyMonday to Saturday

215-639-1149

Seniorand

MilitaryDiscounts

THE ORIGINAL

RICK’S

215-785-2168

MentionYour Church

For$50 OFFAny Service

over $500

STOKES MASONRY CONCRETE

BRICK & BLOCK WORKBRICK PAVERS750-3356

"We pave you save"

Serving Community 30+ Years104 E. Maple Ave., Langhorne, PA

215-752-2346www.asphaltpa.com

TOMLINSON FUNERAL HOME, TOMLINSON FUNERAL HOME, P.CP.C.Robert M. Tomlinson, Supervisor

2207 Bristol Pike (at Simons Ave.) Bensalem, PA639-0422639-0422

www.tomlinsonfh.comwww.tomlinsonfh.com

In Business Since 1945In Business Since 1945

PRE-ARRANGED FUNERALS

Gregory Dental Associates, P.C.Gregory Dental Associates, P.C.Christina A. Gregory, DMDChristina A. Gregory, DMD

Archdiocesan MemberArchdiocesan Member

Cosmetic & Family DentistryCosmetic & Family Dentistry2218 Bristol Pike • Bensalem, PA 19020

215-639-6133215-639-6133

Parishioner

CALL TODAY AT 215 752 6145

Home of the$79.95 Diagnos c

Roof Repairand the

Guaranteed Leak RepairNew Roofs & Gu ers • Roof & Gu er Repairs

Siding & Windows • Garage Door Installa on/Repairwww.abrooksconstruc on.com

#PA009390

James O. Bradley Funeral Home Inc.James O. Bradley Funeral Home Inc.260 Bellevue Ave. Penndel, PA 19047

215-757-3379Traditional Funerals & Cremation ServicesTraditional Funerals & Cremation Services

Pre-Planning and Pre-Paid Arrangements AvailableKevin J. Diabelko, SupervisorKevin J. Diabelko, Supervisor

James A. Heisler, EA, CFP® - IRS Enrolled Agent

215-332-4968 • [email protected] Parishioner

Financial planning/Investment ManagementLife/Health/Medicare Insurance/Tax Prep

Special help for women going through divorce or have lost their spouse.

Now Hiring friends and family caregivers.Call today to learn more!

(215) 419-7868www.Bayada.com/careathome

Quality Senior Home Care Services since 1975.

www.stacareers.com