THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1985 by The American Society of Biological Chemists, Inc.

Vol, ,260, No. 25, Issue of November 5, pp. 13685-13689,1985 Printed in U. S.A.

Nucleotide Sequence of Cloned cDNA for Pro-opiomelanocortin in the Amphibian Xenopus laevis”

(Received for publication, March 25, 1985)

Gerard J. M. Martens$, Olivier Civelli, and Edward Herbert From the Department of Chemistry, University of Oregon, Eugene, Oregon 97403

The function of a-melanocyte-stimulating hormone (a-MSH) is not known in mammals. It is well-estab- lished in the amphibian Xenopus laevis in which a- MSH mediates the process of adaptation to a dark background. The amino acid sequence of this hormone is, however, not known in amphibians. In order to determine the primary structure of the precursor pro- tein for a-MSH, which in mammals has been called pro-opiomelancortin (POMC), we constructed a cDNA library from Xenopus pituitary mRNA. A pool of syn- thetic oligodeoxyribonucleotide tetradecamers corre- sponding to part of the mammalian a-MSH sequence was used to screen the library. The nucleotide sequence of a 1050-base pair hybridization-positive cDNA clone was determined and the deduced amino acid sequence of Xenopus POMC revealed the sequences of Xenopus 7-MSH, a-MSH, corticotropin-like intermediate lobe peptide, B-MSH, and P-endorphin. Interestingly, the N-terminal amino acid of Xenopus a-MSH, which is N“-acetylated in the biologically active form of the hormone, is different from that of mammalian a-MSH. The distribution of the bioactive domains within Xen- opus POMC is remarkably similar to that in other known POMC molecules and as in mammals the do- mains in the’ amphibian prohormone are flanked on both sides by pairs of basic amino acids.

When the South African clawed toad, Xenopus laeuis, is placed on a dark background, the pigment-containing gran- ules (melanosomes) in the dermal melanophores of the skin disperse, thus imparting a dark color to the animal. Transfer of an animal to a light background causes the melanosomes to aggregate around the nuclei and, consequently, the skin turns pale. This process of background adaptation is mediated by melanocyte-stimulating hormone (MSHl) produced by the pars intermedia of the pituitary gland. A number of investi- gators demonstrated that the amphibian pars intermedia con- tains not one, but several melanotropic peptides (1-5). Pulse-

* This work was supported by research Grants AM16879, AM30155, and DA02736 (to E. H.; principal investigator) from the National Institutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

3 Supported by the Netherlands Organization for the Advancement of Pure Research (Z. W. 0.). Present address: Department of Zoology, University of Nijmegen, Toernooiveld, 6525 ED Nijmegen, The Neth- erlands.

The abbreviations used are: MSH, melanocyte-stimulating hor- mone; CLIP, corticotropin-like intermediate lobe peptide; POMC, pro-opiomelanocortin; SDS, sodium dodecyl sulfate; bp, base pair; ACTH, adrenocorticotropic hormone.

chase analyses of biosynthetic events in neurointermediate lobes of black background-adapted Xenopus showed that the melanotropic peptides are produced through processing of a precursor protein which in addition appeared to be the pro- hormone for corticotropin-like intermediate lobe peptide (CLIP)-like and endorphin-like peptides (6) . Such a precur- sor-product mode of peptide biosynthesis is also found in mammalian pituitary glands. In the adrenocorticotropic cells of the rat anterior pituitary the precursor is cleaved to adre- nocorticotropic hormone (ACTH) and @-lipotropin while in the rat pars intermedia the same prohormone functions as the precursor for a-MSH, CLIP, and P-endorphin (for review, see Ref. 7). The common prohormone was named pro-opi- omelanocortin (POMC) in order to reflect the full multiplicity of its potential functions (8). The structures of several mam- malian POMC molecules were deduced from the nucleotide sequences of cloned cDNAs or genomic DNA fragments (9- 14). The structural organization of the amphibian prohor- mone and the primary structures of its constituent bioactive domains are, however, not known. In this report we present the structure of Xenopus POMC mRNA which reveals the amino acid sequences of Xenopus a-MSH, @-MSH, y-MSH, CLIP, @-endorphin, ACTH, and @-lipotropin. Also, the eluci- dation of the structure of amphibian POMC has enabled us to identify regions of interspecies divergence and conservation within POMC, thus providing evidence for functionally sig- nificant structures.

EXPERIMENTAL PROCEDURES~

RESULTS AND DISCUSSION

Screening of the Xenopus pituitary cDNA library using as probe a synthetic tetradecamer pool corresponding to part of the mammalian a-MSH sequence showed that 0.5-1% of the clones contained a sequence related to a-MSH. Hybridiza- tion-positive clones pXPD (with an insert of 800 bp), pXPG (850 bp), and pXPK (750 bp) were selected for partial nucleo- tide sequence analysis and clone pXPL, harboring the largest insert (1050 bp), was selected for detailed nucleotide sequence analysis. It appeared that clones pXPD, pXPG, and pXPK contained partial sequences of pXPL.

Fig. 2, which presents the nucleotide sequence of pXPL and the deduced amino acid sequence, shows that in Xenopus the sequences of pMSH, a-MSH, CLIP, @“SHY and @-endor-

Portions of this paper (including “Experimental Procedures” and Fig. 1) are presented in miniprint at the end of this paper. Miniprint is easily read with the aid of a standard magnifying glass. Full size photocopies are available from the Journal of Biological Chemistry, 9650 Rockville Pike, Bethesda, MD 20814. Request Document No. 85M-0926, cite the authors, and include a check or money order for $1.60 per set of photocopies. Full size photocopies are also included in the microfilm edition of the Journal that is available from Waverly Press.

13685

13686 Structure of Amphibian Pro-opiomelanocortin mRNA -80

Leu Pro Val Phe Pro Gly Asn Gly His Leu Gln Pro Leu Ser Glu Ser I le Val Met Thr His Phe Arg Trp Asn 5'------WG CCU GUG UUC CCA GOA AA C GGA CAU UUG CAA CCU W G UCG GAA AGU AUC GUG AUG ACC CAU UUU COO UGG AAU

-70 -60

Lys Phe Gly Are Arq Asn Ser Thr Gly Asn Asp Gly Ser Asn Thr Glu Asp Ile Ser Ser Tyr Pro Val Phe Ser Leu -50 -30

A A A Urm GGC AGA 4GA AAC AGC ACA GGG AAC GAU GGA AGC AAC ACA GAA GAU AW UCC AGU WAC CCU GUA U W AGC CUA Y-M "

-20 Phe Pro Leu Ser. Asp Gln Asn Ala Pro Gly Asp Asn Met Glu Glu Glu Pro Leu Aap Arg Gln Glu Aan W U CCC WA AGU GAU CAG AAU GCU CCA GGU GAC AAC AUG GAA GAG GAA CCC UUA GAC AGG CAA GAG AAC

-1 0

His Phe Arg Trp Gly Lys Pro Val Gly Arg Pro Ile Lps Vn1 Tyr Pro Asn Gly Val Glu Glu Glu Ser Ala Glu Ser Tyr CAC wc CGA UGG MA A A A ccu GUU GGG AGA ccc AW AAG GUG UAC ccc AAU GGA GUG GAA GAA GAG ucu GCU GAG AGC UAC

10 20 70

a"SH - CLIP

50 60 Glu Leu Ser Leu Glu Leu Asp Tyr Pro Glu Ile Asp Leu Asp Glu Asp Ile Glu Asp Aan Glu Val Lys Ser GAA WA UCC CUA GAA C W GAC UAU CCA 4 A A AUC GAC C W GAU GAG GAC AW GAA GAC AAU GAG RUG AAG AGU -

Pro Glu Arg Ser Gln Thr Pro Leu Met Thr Leu Phe Lys Asn Ala Ile Ile Lys Aan Ser His Lys Lys Gly Gln END CCU GAG CGG AGC CAG ACA CCU CUA AUG ACU C W C A A A AAU GCC AUC AW AAA AAC UCC CAC A A A AAG GGU CAG UAG GGAUCWUAGGGUAU

100 110 120

pendorpxn + GGUUUCCAUCCAGAGCUCCAUCCAGAUACACCAGCGUGUWUCAAUAGAUACAGUUCCAUUCAUUCAAUGAUCAAUGCCUAUGAAWUACU~~GUAGUAGGAUAUUUAUCACACU~~W

CACWGAUPJWUUAUCUCCUGUWCUCWAGUUCGGAAUGCACAGUACAOGAACCUCUCCGGUAAAAUGCUGACAWGUAACG~GUACAUAUAGAAAGAAAUAAAUGGWCUAUGAGU

G C A A A A U U G G A U U U ~ ~ U U C A G U W G C U A A A U U A U U U U C A U A U C U G A U A A G A A A A A A U G U A C A A A A U U G U A A A U G A A U G G A A A A A U A A A A C U U U C A G A U C ~ ~ A C ~ ~ ~ ~ ( ~ ~ ) - - - - - - ~ ' + +

FIG. 2. Primary structure of Xenopus pro-opiomelanocortin mRNA and deduced amino acid se- quence. The nucleotide sequence of the mRNA was derived from that of the cDNA insert in pXPL. Amino acid residues are numbered beginning with the first residue of a-MSH and the residues on the I h r m i n a l side of a- MSH are indicated by negative numbers. The sequences of yMSH, a-MSH, CLIP, &MSH, and @-endorphin are underlined with arrows. The pairs of basic amino acids flanking the bioactive domains are boxed. The asterisk below Lys residue 64 indicates that the A nucleotide in that position in pXPL and pXPK is substituted by a G nucleotide in pXPD and pXPG (replacement site substitution, leading to a Glu-residue). The essential part of the recognition site for correct 3' end processing of the primary transcript (AAUAAA) is ouerlined. The sites of polyadenylation in pXPL and pXPD (U nucleotide), and in pXPG (C nucleotide) are indicated by vertical arrows. END indicates translational termination codon.

FIG. 3. a, Northern blot analysis of Xenopus brain total RNA (40 pg, lane I), pituitary total RNA (25 pg, lane 2), pituitary poly(A-) RNA (25 pg, lane 3), and skin total RNA (45 pg, lane 4). RNA was size fractionated on a 1.3% agarose gel in 2.2 M formaldehyde and trans- ferred to nitrocellulose (21). The blot was hybridized with nick-translated Xenopus POMC DNA insert of pXPL, washed, and autoradiographed with an intensifying screen at -70 "C for 3 h. The size markers were 18 S and 28 S rat brain rRNA and a 123-bp ladder. b, ex- tended exposure (4 days with intensify- ing screen at -70 "C) of the blot shown in a, revealing besides the hybridizing species of POMC mRNA with a length of about 1300 nucleotides in Xenopus pituitary RNA a hybridizing band of similar length in Xenopus brain RNA (lane 1 ).

1599- 1230- 861 - 492-

a 1 2 3 4

-Origin

b -285

1 2 3 4

" "T"" - :

Structure of Amphibian Pro-opiomelanocortin mRNA 13687 a

Human X e n o p u s

R a t S a l m o n

-;0

6?

""

-p-MSH - * kendorphin

b 4 4 4 4:

4 d 5" 3' 2

Xenopus Human

L Y-MSH --I

I

La-MSHJ L C L I P 2 LP-MSH JI B-endorphin

0 25-30"/. 50-55% 65-70% 75-80%

a

I 4 i < 2 i

' 100bp i

C 1 v

Xenopus : Salmon : u u c u Human Rat : CAGCCUCUCAG GUU CC --- UUA -- : CAGCCUCU A A GCCGCC --- UUA --

AC G UUGUGGCAAGCAACAC(A,)

FIG. 4. a, alignment of the amino acid sequences of Xenopus, human, rat, and salmon POMC. The one-letter amino acid notation is used. Amino acid residues are numbered beginning with the first residue of a-MSH and the residues on the N-terminal side of a-MSH are indicated by negative numbers. Sets of three (for the N-terminal region) or four identical residues are boxed; the N-terminal region of salmon POMC is not known. Gaps (-) have been introduced to achieve maximum homology. The locations of the sequences of 7-MSH, (Y-MSH, CLIP, 8- MSH, and 0-endorphin are indicated by arrows below the sequences. The human, rat, and salmon sequence data have been taken from Refs. 11, 14, and 28, respectively. b, schematic representation of the nucleotide sequence homology between Xenopus and human POMC mRNA. Deletions of nucleotides, introduced to achieve maximum homology, are shown as loops. The putative signal sites for translational termination (UAG and UGA) and polyadenylation (AAUAAA) are indicated. The locations of the sequences coding for the bioactive domains are shown below the schematic. The human sequence data were taken from Ref. 11. c, alignment of the nucleotide sequences of the regions preceding the poly(A) addition sites in Xenopus, salmon, human, and rat POMC mRNA. Gaps (-) have been introduced to achieve maximum homology. The signals for polyadenylation are boxed. Arrow indicates alternative poly(A) addition site in Xenopus POMC mRNA. Absence of a nucleotide in the sequences of salmon, human or rat POMC mRNA indicates that the sequences of Xenopus and salmon, human, or rat are the same at that position. The salmon, human, and rat sequence data have been taken from Refs. 28, 11, and 14, respectively.

phin are contained in a common precursor protein, much like that of pro-opiomelanocortin (POMC) described in mammals (9-14). The bioactive domains in Xenopus POMC are flanked on both sides by pairs of basic amino acids. This is also the case in mammalian POMC proteins and it is thought that the dibasic residues are recognition sites for proteolytic cleavage enzymes (22). In the amino acid sequence of Xenopus POMC only one potential asparagine-linked N-glycosylation site

(Am-X-Ser/Thr) (23) is found, namely Asn residue -50 (Fig. 2). Previous in vitro labeling studies with [3H]glucosamine showed that this site within y-MSH is indeed used as a glycosylation site and that the Xenopus prohormone is only glycosylated on this residue (24). From the nucleotide se- quence of Xenopus POMC mRNA it is predicted that the N- terminal amino acid of Xenopus a-MSH is not serine, as in all known a-MSH sequences, but alanine. This finding is of

13688 Structure of Amphibian Pro-opiomelanocortin mRNA

great interest since, after being cleaved from the prohormone, the non-acetylated form of a-MSH (des-Ne-acetyl-a-MSH) is acetylated on the N-terminal residue to yield a-MSH (25); this acetylation greatly enhances the biological activity of the hormone (17). It is clear that the substitution of an Ala for a Ser precludes the formation of N,O-diacetyl a-MSH, found in rat pituitary (26), and accounts for the failure to find a diacetyl form of melanotropic peptides in Xenopus neuroin- termediate lobes. Within the structure of Xenopus POMC the a-MSH sequence is C-terminally flanked by Gly-Arg-Lys. As the sequence Gly-basic-basic functions as a combined prote- olysis/amidation signal (27), Xenopus a-MSH is presumably a-amidated at its C terminus.

The size of Xenopus POMC mRNA is about 1300 nucleo- tides, as revealed by Northern blot analysis of Xenopus pitui- tary RNA (Fig. 3a). Extended exposure of the blot showed a hybridizing mRNA of similar length in brain RNA but not in skin RNA (Fig. 3b), suggesting POMC gene expression to high levels in Xenopus pituitary and to low levels in Xenopus brain. From the Northern blot analysis and from the clones thus far examined it appears that only one of the two poly- adenylation signals in Xenopus POMC mRNA (Fig. 2) is used. This suggests that additional sequences besides the hexanucleotide AAUAAA are required to form a complete recognition site for correct mRNA 3’ end formation.

The isolation and characterization of cloned cDNA coding for POMC in the amphibian X . laeuis enables us to identify regions within POMC of interspecies divergence and conser- vation during evolution. A comparison of the amino acid sequences of Xenopus, human (ll), rat (14), and salmon (28) POMC shows that the distribution of bioactive domains within the precursor proteins is remarkably similar among the four species (Fig. 4a). The pairs of basic amino acids flanking the domains largely delineate the regions of conser- vation and divergence. The high degree of conservation of p- endorphin between Xenopus and mammals is noteworthy since the structure of this endogenous opioid peptide is quite different in salmon. The spacer regions between the yMSH and a-MSH domains and between the CLIP and B-MSH structures are very different in the four species. The regions of amino acid homology between Xenopus and human POMC are reflected by regions of nucleotide sequence homology (Fig. 4b). The overall degree of both amino acid and nucleotide sequence homology between the POMC molecules of human and X . lueuis is approximately 55%. In contrast to the situa- tion between Xenopus and mammals, Xenopus and salmon POMC mRNA share more than 80% nucleotide sequence homology in a 30-bp segment immediately preceding the polyadenylation signal (Fig. 4c). This fact is surprising as the amino acid sequence of Xenopus POMC is more related to mammalian POMCs than to salmon POMC. The lengths of the 3’ untranslated regions of the salmon, Xenopus and mammalian POMC mRNAs are considerably different: in salmon this stretch is nearly 900 nucleotides (28), in Xenopus approximately 360 nucleotides, and in mammals 120-170 nucleotides (9-14). The significance of this apparent short- ening of the 3’ untranslated region during evolution of POMC mRNA is not clear at present.

The finding of an apparently single population of Xenopus POMC mRNA (Fig. 3) is interesting in view of the fact that in Xenopus there are gene pairs coding for globin (29), albu- min (30), vitellogenin (31), and proenkephalin (32) and it is believed that duplication of the entire genome of X. h u i s occurred during evolution (33, 34). Moreover, on the basis of biosynthetic studies we have previously suggested that two

structurally different POMC prohormones are produced in Xenopus neurointermediate lobes (24). It is not likely that a second POMC mRNA species went undetected in our study, since the nucleotide sequence homology between the two transcripts is expected to be 92-95%; these percentages are based on the reported sequence homologies between the cod- ing regions of the above-mentioned Xenopus gene pairs (29- 32). The four sequenced cDNA clones investigated in this study are derived from the same mRNA species and we are currently trying to find a clone corresponding to a second Xenopus POMC gene transcript. Southern blot analysis and screening of a genomic library with the Xenopus POMC cDNA probe should tell us whether two POMC genes indeed exist in X. lueuis.

Acknowledgments-We thank Dr. Garrick Little for the purifica- tion of the pool of synthetic oligonucleotides and Bill Hall for tech- nical assistance.

1.

2. 3. 4. 5.

6.

7. 8.

9.

10.

11.

12.

13. 14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

REFERENCES

Burgers, A. C. J., Imai, K. & van Oordt, G. J. (1963) Gen. Comp.

Preslock, J. P. & Brinkley, H. J. (1970) Life Sci. 9, 1369-1380 Hopkins, C. R. (1972) J. Cell BwZ. 5 3 , 642-653 Loh, Y. P. & Gainer, H. (1977) J. Gen. Physwl. 70,37-58 Martens, G. J. M., Jenks, B. G. & van Overbeeke, A. P. (1980)

Martens, G. J . M., Jenks, B. G. & van Overbeeke, A. P. (1982)

Eipper, B. A. & Mains, R. E. (1980) Endocrine Reu. 1 , 1-27 Chritien, M., Benjannet, S., Gossard, F., Gianoulakis, C., Crine,

P., Lis, M. & Seidah, N. G. (1979) Can. J. Biochern. 5 7 , 1111- 1121

Nakanishi, S., Inoue, A,, Kita, T., Nakamura, M., Chang, A. C. Y., Cohen, S. N. & Numa, S. (1979) Nature (Lord.) 278,423- 427

Chang, A. C. Y., Cochet, M. & Cohen, S. N. (1980) Proc. Natl. Acud. Sci. U. S. A. 77,4890-4894

Whitfeld, P. L., Seeburg, P. H. & Shine, J. (1982) DNA (N. Y.)

Boileau, G., Barbeau, C., Jeannotte, L., Chretien, M. & Drouin,

Uhler, M. & Herbert, E. (1983) J. Biol. Chem. 2 5 8 , 257-261 Drouin, J. & Goodman, H. M. (1980) Nature (Lord.) 288 , 610-

Jenks, B. G., van Overbeeke, A. P. & McStay, B. F. (1977) Can.

Cathala, G., Savouret, J.-F., Mendez, B., West, B. L., Karin, M., Martial, J. A. & Baxter, J. D. (1983) DNA (N. Y.) 2,329-335

Schwyzer, R. & Eberle, A. (1977) in Frontiers of Hormone Re- search (van Wimersma Greidanus, Tj. B., ed) pp. 18-25, Karger, Base1

Grunstein, M. & Hogness, D. S. (1975) Proc. Natl. Acud. Sci. U.

Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular Cloning, A Laboratory Manual. pp. 368-369, Cold Spring Har- bor Laboratory, Cold Spring Harbor, NY

Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74,5463-5467

Thomas, P. S. (1980) Proc. Natl. Acad. Sei. U. S. A. 77, 5201- 5205

Douglass, J., Civelli, 0. & Herbert, E. (1984) Annu. Rev. Biochem. 53,665-715

Pless, D. D. & Lennarz, W. J. (1977) Proc. Natl. Acad. Sci. U. S. A. 74,134-138

Martens, G. J. M., Biermans, P. P. J., Jenks, B. G. & van Overbeeke, A. P. (1982) Eur. J. Biochem. 126 , 17-22

Martens, G. J. M., Jenks, B. G. & van Overbeeke, A. P. (1981) Nature (Lord.) 294,558-560

Rudman, D., Chawla, R. K. & Hollins, B. M. (1979) J. Biol. Chem.

Eipper, B. A., Mains, R. E. & Glembotski, C. C. (1983) Proc.

Endocrinol. 3, 53-56

Comp. Bwchem. Physwl. 67B, 493-497

Eur. J. Biochem. 122 , l -10

1 , 133-143

J. (1983) Nucleic Acids Res. 11,8063-8071

61 3

J. ZOO^. 55,922-927

S. A. 72,3961-3965

254,10102-10108

Natl. Acad. Sei. U. S. A. 8 0 , 5144-5148

Structure of Amphibian Pro-opiomelanocortin mRNA 13689

28. Soma, G.-I., Kitahara, N., Nishizawa, T., Nanarni, H., Kotake, Westley, B. & Wahli, W. (1983) Nucleic Acids Res. 11 , 2979- C., Okazaki, H. & Andoh, T. (1984) Nucleic Acids Res. 1 2 , 2997 8029-8041 32. Martens, G. J. M. & Herbert, E. (1984) Nature (Lond.) 310 ,

29. Widmer, H. J., Andres, A.-C., Niessing, J., Hosbach, H. A. & 251-254

30. May, F. E. B., Westley, B. R., Wyler, T. & Weber, R.-(1983) J. Fischberg, M. (1977) Science 195 , 785-787

31. Germond, J-E., ten Heggeler, B., Schubiger, J.-L., Walker, P., 253-257

Weber, R. (1981) Deu. Biol. 88,325-332 33. Bisbee, C. A., Baker, M. A., Wilson, A. C., Hadji-Azimi, I. &

Mol. Biol. 1 6 8 , 229-249 34. Thibbaud, C. & Fischberg, M. (1977) Chromosoma (Berl.) 59,

SUPPLEMENTAL HATERIAL TO

NUCLEGTIDE SEQUENCE OF CLONED CDNA FOR PRO-OPIMELANOCORTIN IN THE AHPHIBIiVi XENOPUS LAEYIS

by

Gerard J.M. Martens. OliYieP Civelli and Edward Herbert

EXPERINRlTAL PROCEDURES

potein-coding sequence; ref. 13) gave no hybridization-psitive signals. probably because of low homology between mou9e and PCUC. It was, therefore. decided to use as hybrid-

representing a l l possible DNA sequences predicted Prom the pentapeptide sequence in s- ization probes a p w l OP 32 synthetic oligOdeO~iD3nuclePtide tetradecamers [Biosearch),

MSH(6-10), His-Phe-A?g-Trp-Gly. excluding the thlrd nucleotide of the Oly-codon; the 9e- puence His-Phe-drg-Trp is conserved in all melanotropic peptides and thi.9 sequence is the

pad was labelled vlth 32P at the 5'ends by polynucleotide kinase (Biolabs) to a specific "classical" tetrapeptide message sequence for melanotropic aotivity (171. The tetradecamer

activity of 2 ~ 1 0 ~ cpm/pmole. &n bacterial colony hybPidizatlon MS pereormed according to ~ e f . 18. Filters were pre-hybridized in 6rSSC L 0.9 H NaC1. 0.09 H sodium citratcl, 0.041 each of bovine serum albumin, Ficoll and palyvinylpyrrolidone. 40 mH sodiumphosphste, (1.1% sodiumpyrophosphate, 0.11 SDS. 200 u g h 1 sonicated and heat-denatured salmon sperm DNA

'were washed in 4xSSC. 0.11 SDS at ~ o o m temperature and 37'C. Plasmid DNA of hybridization- :Sig,I at 55OC PO." 4h. Hybridization w a s in the same buPfv at 40-C fop 20h and the filters

psitive clones vas prepared aecopding to Pef. 19.

Figure 1 Partial restriction map and sequencing stmtegy POP the hybPldization-pojit~ue cDNA insePt in plasmid pXPL. Nucleotides ape numbered in the dweotim f m m 5' t o 3' in the me5-

pOlY(dC).poly(dC) tail3 of the CDNA ln4ePt. For PePePence, the lOcatLOns Of the ooding re- sage strand. Wavy lines PepPeSent the polyLdA).poly(dT) tail at the 3'end and the

gions f o p I-MS. a-MSH and 5-HSH ape indicated below the map. Only IlestPiotion Sites used

mination method (201. Arraws below the map indlcate the direction and extent of sequence determination; the nuoleotide Sequence was read in both directions.

e m DNA sequence analysis ape shorn and sequencing vas perroormed with the dideoxy chain tw-