Post on 15-Apr-2018
Identification and Identification and quantification of Fusarium species by molecular toolsspecies by molecular tools
Sonja Sletner Klemsdal
Bioforsk
Plant Health and Plant Protection Division
Genetics and Biotechnology Dep.gy p
Identification of a Fusarium culture or in the plantp
Grains with no visible •Grains with no visible symptoms might also contain hi h l l f i high levels of Fusarium, e.g. F. langsethiae
DNA based diagnosis
- Microarray
- DNA sequence analysis
Standard PCR- Standard PCR
- Nested PCRNested PCR
- Real time PCR
DNA based diagnosis
- Microarray
- DNA sequence analysisDNA sequence analysis
- Standard PCR
N t d PCR- Nested PCR
- Real time PCR
14 trichothecene and fumonisinproducing Fusarium in one array (Kristensen et al. 2007)y ( )
DNA based diagnosis
- Microarray
DNA l i- DNA sequence analysis
- Standard PCR
- Nested PCR
- Real time PCR
1. PCR amplification
2. DNA sequencing
3 Compare to DNA sequence databases3. Compare to DNA sequence databases
NCBI GenBank http://www.ncbi.nlm.nih.gov/p g
Fusarium ID http://fusarium.cbio.psu.edu/
Can we trust the accessions in the GenBank?
Which genes or DNA regions should be sequenced?
ITS regions of rDNA
Which genes or DNA regions should be sequenced?
g
β-tubulin gene
TEF : translation elongation factor 1α
”Barcoding”
TCCAATCATAGTAACTGCTACTGAGAAAACTTTCAATTCATAGTGGATTTTGATTGTTTGTCC C G C GC C G G C C C G GG G G G
PCR based diagnosis
- Standard PCR
- Nested PCRNested PCR
- Real time PCR
→ Primer design
☺ Choice of DNA region☺ Choice of DNA region
- Species specific or ”group specific”
- rDNA, β-tubulin etc, RAPD fragments
☺ Spe ifi it !!!!!☺ Specificity !!!!!
3’ end important, experimental verificationp , p
☺ Sensitivity
Theoretically 1 single cell
PCR based diagnosis
- Standard PCR
- Nested PCRNested PCR
- Real time PCR
→ Primer design→ Primer design
→ Inhibition of PCR?
PCR amplification using general PCR primers e.g. ITS
PCR lifi ti f l tPCR amplification of plant genes
cox gene (cytochrome oxidase)g ( y )
Add a DNA fragment in known quantities
PCR based detectionPCR based detection
Species-specific PCRSpecies specific PCRhttp://www.sppadbase.com/
Group-specific PCR
For instance collective detection of species or isolates producing the same species or isolates producing the same mycotoxins
•Trichothecene-producers
F i i d• Fumonisin-producers
• Zearalenone producers• Zearalenone-producers
From Proctor et al. 1995
How to increase the sensitivity of a diagnostic PCR ?
Alt ti I T t th PCR Alternative I: Target the PCR primers to DNA regions previously amplified in the enomeamplified in the genome
E.g. rDNAg
18S 5.8S 28S 18S
ITS1 ITS2 IGS
18S 5.8S 28S 18S
ITS1 ITS2 IGS
PCR Sequencing Primer design
Sensitivity of specific primers forSensitivity of specific primers for F. langsethiae og F. sporotrichioidesF. sporotrichioides
1 5 x 10-8 g1 2 3 4 5 6 7 8 9 1. 5 x 10 g
2. 5 x 10-9 g
3 5 x 10-10 g3. 5 x 10-10 g
4. 5 x 10-11 g
0 125. 5 x 10-12 g
6. 5 x 10-13 g
7. 5 x 10-14 g
8. 5 x 10-15 g
9. Negative control
F langsethiaeF. langsethiae
F poae specific PCR in artificiallyF. poae specific PCR in artificially inoculated cereal grains
1 2 3 4 5 6 7 8 1. Positive control
2 0%2. 0%
3. 1%
Wheat 4. 5%
5. 10%
O t
6. 20%
7. 100%Oats 8. Negative control
Alternative II: Nested PCRAlternative II: Nested PCR
N t d PCR I Nested PCR I PCR program 1 using primer pair 1
Nested PCR IIPCR program 1 and 2 are
The PCR product is diluted and used as a template in
PCR 2 si th s d
PCR program 1 and 2 are programmed to follow each other
PCR program 2 using the second primer pair
All 4 primers are present (Primer pair 1 and 2), but in different concentrations
2 tubes
different concentrations
Twice as expensive
T i s h k
1 tube
Less expensiveTwice as much work
High risk of t i ti
L p n
Less hands-on work
Reduced risk of contaminationcontamination Reduced risk of contamination
Nested PCR assays
Nested in 2 tubes Nested in 1 tubeNested in 2 tubes Nested in 1 tube
1
2Diluted 10.000x
Annealing 70 °C
Annealing 58 °C
Al i PCR dAlternative PCR products
AF BF
BR AR
Nested PCR for deteksjon av F. culmorumNested PCR for deteksjon av F. culmorum
FculA F/R – annealing temperature 70oC FculA F/R annealing temperature 70 C
– concentration 0,005 pmol
FculB F/R annealin temperature 58oC FculB F/R – annealing temperature 58oC
– concentration 50 pmolp
N d PCR f F lNested PCR test for F. culmorum
M 1 2 3 4 5 6 7 8 N1. 50 ng
2 5Nested PCR 2. 5 n g
3. 500 pg
4. 50 p g
5. 5 pg
OBT186. 0,5 pg
7. 0,05 pg
8. 0,005 pg
9. Negative controlg
Klemsdal and Elen (2006) Lett. Appl. Microbiol. 42: 544-548
Standard PCR assays compared toStandard PCR assays compared to Real time PCR assays
• Real-time PCR less time consuming
R l ti PCR b d t d t i th tit• Real-time PCR can be used to determine the quantity
• In principle real-time PCR is more sensitivep p
Primers and probe design
A liPrimer Probe
p g
Amplicon50 - 150 bp in length
Primer
Tm 58 - 60ºC
Probe
Tm 10ºC higher than Primer Tm (7ºC for
As close to the probe as possible
20 - 80% GC
(Allelic Discrimination)
20 - 80% GC p pwithout overlappingLength 9 - 40
2ºC diff i T
Length 9 - 40 bases
<2ºC difference in Tm between the two primers No G on the 5’end
<4 contiguous G’sMaximum of 2 G or C
at 3’ end
4 contiguous G s
Must not have more G’s h C’than C’s
Primers and probe design
Primer Concentration Optimization MATRIX
p g
FORWARD 50 M 300 M 900 MFORWARD
REVERSE
50nM 300nM 900nM
50nM 50/50 300/50 900/50
300nM 50/300 300/300 900/300
900nM 50/900 300/900 900/900
F i DON NIV ZEAF. graminearum – DON, NIV, ZEA
F culmorum – DON NIV ZEAF. culmorum DON, NIV, ZEA
F. poae - NIVF. langsethiae – T-2, HT-2F. sporotrichioides – T-2, HT-2F avenaceum MON ENNs (BEA)F. avenaceum – MON, ENNs, (BEA)F. tricinctum, F. equiseti, F. cerealis…….., q ,
TMTRITMTRI
TMLAN
TMAV
TMTRI
TMAV
TMLAN
Multiplex quantitative PCRMultiplex quantitative PCR- Fluorescent labelled probes e.g. TaqMan (not SYBR green)
- Choose reporters based on wavelengths of the emitted fluorescent signalg
http://www1.qiagen.com/literature/brochures/pcr/1038604_TI-Multiplex.pdf
Choice of probes
D l l b ll d b (TAMRA)- Dual labelled probes (TAMRA)
- Eclipse MGBc pse G
- MGB (Minor Groove Binder)
Multiplex quantitative PCR
- Same sensitivity of the multiplex reaction as in the
Multiplex quantitative PCR
Same sensitivity of the multiplex reaction as in the single PCR reaction
Singleplex F. culmorum Triplex F. culmorum
At present three assays:
I) I)
F. graminearum, F. culmorum and TRI5
II) II)
F. avenaceum and F. poae
III)
F langsethiaeF. langsethiae
Quarantine organisms
e.g. Fusarium foetens
Good luck with your experiments!