Identification and Identification and quantification of Fusarium species by molecular toolsspecies by molecular tools

Sonja Sletner Klemsdal

Bioforsk

Plant Health and Plant Protection Division

Genetics and Biotechnology Dep.gy p

Identification of a Fusarium culture or in the plantp

Grains with no visible •Grains with no visible symptoms might also contain hi h l l f i high levels of Fusarium, e.g. F. langsethiae

DNA based diagnosis

- Microarray

- DNA sequence analysis

Standard PCR- Standard PCR

- Nested PCRNested PCR

- Real time PCR

DNA based diagnosis

- Microarray

- DNA sequence analysisDNA sequence analysis

- Standard PCR

N t d PCR- Nested PCR

- Real time PCR

14 trichothecene and fumonisinproducing Fusarium in one array (Kristensen et al. 2007)y ( )

DNA based diagnosis

- Microarray

DNA l i- DNA sequence analysis

- Standard PCR

- Nested PCR

- Real time PCR

1. PCR amplification

2. DNA sequencing

3 Compare to DNA sequence databases3. Compare to DNA sequence databases

NCBI GenBank http://www.ncbi.nlm.nih.gov/p g

Fusarium ID http://fusarium.cbio.psu.edu/

Can we trust the accessions in the GenBank?

Which genes or DNA regions should be sequenced?

ITS regions of rDNA

Which genes or DNA regions should be sequenced?

g

β-tubulin gene

TEF : translation elongation factor 1α

”Barcoding”

TCCAATCATAGTAACTGCTACTGAGAAAACTTTCAATTCATAGTGGATTTTGATTGTTTGTCC C G C GC C G G C C C G GG G G G

PCR based diagnosis

- Standard PCR

- Nested PCRNested PCR

- Real time PCR

→ Primer design

☺ Choice of DNA region☺ Choice of DNA region

- Species specific or ”group specific”

- rDNA, β-tubulin etc, RAPD fragments

☺ Spe ifi it !!!!!☺ Specificity !!!!!

3’ end important, experimental verificationp , p

☺ Sensitivity

Theoretically 1 single cell

PCR based diagnosis

- Standard PCR

- Nested PCRNested PCR

- Real time PCR

→ Primer design→ Primer design

→ Inhibition of PCR?

PCR amplification using general PCR primers e.g. ITS

PCR lifi ti f l tPCR amplification of plant genes

cox gene (cytochrome oxidase)g ( y )

Add a DNA fragment in known quantities

PCR based detectionPCR based detection

Species-specific PCRSpecies specific PCRhttp://www.sppadbase.com/

Group-specific PCR

For instance collective detection of species or isolates producing the same species or isolates producing the same mycotoxins

•Trichothecene-producers

F i i d• Fumonisin-producers

• Zearalenone producers• Zearalenone-producers

From Proctor et al. 1995

How to increase the sensitivity of a diagnostic PCR ?

Alt ti I T t th PCR Alternative I: Target the PCR primers to DNA regions previously amplified in the enomeamplified in the genome

E.g. rDNAg

18S 5.8S 28S 18S

ITS1 ITS2 IGS

18S 5.8S 28S 18S

ITS1 ITS2 IGS

PCR Sequencing Primer design

Sensitivity of specific primers forSensitivity of specific primers for F. langsethiae og F. sporotrichioidesF. sporotrichioides

1 5 x 10-8 g1 2 3 4 5 6 7 8 9 1. 5 x 10 g

2. 5 x 10-9 g

3 5 x 10-10 g3. 5 x 10-10 g

4. 5 x 10-11 g

0 125. 5 x 10-12 g

6. 5 x 10-13 g

7. 5 x 10-14 g

8. 5 x 10-15 g

9. Negative control

F langsethiaeF. langsethiae

F poae specific PCR in artificiallyF. poae specific PCR in artificially inoculated cereal grains

1 2 3 4 5 6 7 8 1. Positive control

2 0%2. 0%

3. 1%

Wheat 4. 5%

5. 10%

O t

6. 20%

7. 100%Oats 8. Negative control

Alternative II: Nested PCRAlternative II: Nested PCR

N t d PCR I Nested PCR I PCR program 1 using primer pair 1

Nested PCR IIPCR program 1 and 2 are

The PCR product is diluted and used as a template in

PCR 2 si th s d

PCR program 1 and 2 are programmed to follow each other

PCR program 2 using the second primer pair

All 4 primers are present (Primer pair 1 and 2), but in different concentrations

2 tubes

different concentrations

Twice as expensive

T i s h k

1 tube

Less expensiveTwice as much work

High risk of t i ti

L p n

Less hands-on work

Reduced risk of contaminationcontamination Reduced risk of contamination

Nested PCR assays

Nested in 2 tubes Nested in 1 tubeNested in 2 tubes Nested in 1 tube

1

2Diluted 10.000x

Annealing 70 °C

Annealing 58 °C

Al i PCR dAlternative PCR products

AF BF

BR AR

Nested PCR for deteksjon av F. culmorumNested PCR for deteksjon av F. culmorum

FculA F/R – annealing temperature 70oC FculA F/R annealing temperature 70 C

– concentration 0,005 pmol

FculB F/R annealin temperature 58oC FculB F/R – annealing temperature 58oC

– concentration 50 pmolp

N d PCR f F lNested PCR test for F. culmorum

M 1 2 3 4 5 6 7 8 N1. 50 ng

2 5Nested PCR 2. 5 n g

3. 500 pg

4. 50 p g

5. 5 pg

OBT186. 0,5 pg

7. 0,05 pg

8. 0,005 pg

9. Negative controlg

Klemsdal and Elen (2006) Lett. Appl. Microbiol. 42: 544-548

Standard PCR assays compared toStandard PCR assays compared to Real time PCR assays

• Real-time PCR less time consuming

R l ti PCR b d t d t i th tit• Real-time PCR can be used to determine the quantity

• In principle real-time PCR is more sensitivep p

Primers and probe design

A liPrimer Probe

p g

Amplicon50 - 150 bp in length

Primer

Tm 58 - 60ºC

Probe

Tm 10ºC higher than Primer Tm (7ºC for

As close to the probe as possible

20 - 80% GC

(Allelic Discrimination)

20 - 80% GC p pwithout overlappingLength 9 - 40

2ºC diff i T

Length 9 - 40 bases

<2ºC difference in Tm between the two primers No G on the 5’end

<4 contiguous G’sMaximum of 2 G or C

at 3’ end

4 contiguous G s

Must not have more G’s h C’than C’s

Primers and probe design

Primer Concentration Optimization MATRIX

p g

FORWARD 50 M 300 M 900 MFORWARD

REVERSE

50nM 300nM 900nM

50nM 50/50 300/50 900/50

300nM 50/300 300/300 900/300

900nM 50/900 300/900 900/900

F i DON NIV ZEAF. graminearum – DON, NIV, ZEA

F culmorum – DON NIV ZEAF. culmorum DON, NIV, ZEA

F. poae - NIVF. langsethiae – T-2, HT-2F. sporotrichioides – T-2, HT-2F avenaceum MON ENNs (BEA)F. avenaceum – MON, ENNs, (BEA)F. tricinctum, F. equiseti, F. cerealis…….., q ,

TMTRITMTRI

TMLAN

TMAV

TMTRI

TMAV

TMLAN

Multiplex quantitative PCRMultiplex quantitative PCR- Fluorescent labelled probes e.g. TaqMan (not SYBR green)

- Choose reporters based on wavelengths of the emitted fluorescent signalg

http://www1.qiagen.com/literature/brochures/pcr/1038604_TI-Multiplex.pdf

Choice of probes

D l l b ll d b (TAMRA)- Dual labelled probes (TAMRA)

- Eclipse MGBc pse G

- MGB (Minor Groove Binder)

Multiplex quantitative PCR

- Same sensitivity of the multiplex reaction as in the

Multiplex quantitative PCR

Same sensitivity of the multiplex reaction as in the single PCR reaction

Singleplex F. culmorum Triplex F. culmorum

At present three assays:

I) I)

F. graminearum, F. culmorum and TRI5

II) II)

F. avenaceum and F. poae

III)

F langsethiaeF. langsethiae

Quarantine organisms

e.g. Fusarium foetens

Good luck with your experiments!