How has lr34 yr18 conferred effective rust resistance in wheat for so long
17022011
Bio conference live 2013
Our Test Organism Drosophila simulans. Trait of Interest Red vs. White.
Allele specific PCR or ARMS test Amplification Refractory Mutation System Used to detect point-mutations and small deletions, differentiates between DNA-sequences.
Finding Sequence Motifs in Alu Transposons that Enhance the Expression of Nearby Genes Kendra Baughman York Marahrens’ Lab UCLA.
5.4 Cladistics The ancestry of groups of species can be deduced by comparing their base or amino acid sequences.
LESSON 6: Writing Research Reports PowerPoint slides to accompany Using Bioinformatics : Genetic Research.
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
The Predictivity Concept Peter Propping Institute of Human Genetics University of Bonn, Germany CDBI Seminar on predictivity, genetic tests and insurance.
Optimal designs for one and two-colour microarrays using mixed models
Evolutionary genomics can now be applied beyond ‘model’ organisms
