CASE REPORT Open Access A case of perforation of a pancreatic duct by a pancreatic stent during chemoradiotherapy for pancreatic head cancer: a case report Takuya Mori, Go…
Final Diagnosis Pancreatic Cancer Pancreatic cancer It is a malignant neoplasm of the pancreas. The prognosis is generally poor; less than 5 percent of those diagnosed are…
Copyright 2016© National Comprehensive Cancer Network® All rights reserved No part of this publication may be reproduced or transmitted in any other form or by any means…
1 www.researchreview.co.nz a publication A RESEARCH REVIEW™ EDUCATIONAL SERIES Making Education Easy 2019 Introduction PEI is due to a deficiency in pancreatic digestive…
328JOP. Journal of the Pancreas - http://pancreas.imedpub.com/ - Vol. 17 No. 3 – May 2016. [ISSN 1590-8577] CASE REPORT JOP. J Pancreas (Online) 2016 May 09; 17(3):328-333.…
Slide 1 Journal Reading Slide 2 An Approach to the Diagnosis of Flat Intraepithelial Lesions of the Urinary Bladder Using the World Heath Organization/ International Society…
4 Conjunctival Intraepithelial Neoplasia – Clinical Presentation, Diagnosis and Treatment Possibilities Valentín Huerva1 and Francisco J. Ascaso2 1Department of Ophthalmology,…
Early Diagnosis Steve Pereira Professor of Hepatology Gastroenterology Institute for Liver Digestive Health UCL stephenpereira@uclacuk @PereiraGroup PCUK National Study Day…
This work is licensed under a Creative Commons Attribution 40 License For more information see https:creativecommonsorglicensesby40 This article has been accepted for publication…
Supplementary Table 1. The primers used for quantitative RT-PCR. 770 771 772 Gene name Forward (5’ > 3’) Reverse (5’ > 3’) Human CXCL1 GCGCCCAAACCGAAGTCATA…
Research Article Contrast-Enhanced EUS for Differential Diagnosis of Pancreatic Masses: A Meta-Analysis Sibin Mei12 Mengyu Wang1 and Leimin Sun 12 1Department of Gastroenterology…
TOPICAL REVIEW Laboratory Tests for Diagnosis of Gastrointestinal and Pancreatic Diseases Olivier Dossin, DVM, PhD, Dipl. ECVIM-CA The panel of laboratory tests available…
Pancreatic Exocrine Insufficiency PEI �Definition: Condition in which quantity of enzymes secreted into the duodenum in response to a meal are insufficient for maintaining…
Research Article The Role of Pancreatic Stone Protein in Diagnosis of Early Onset Neonatal Sepsis Anwar A Rass1 Mohamed A Talat1 Mohamed A Arafa1 Hosam F El-Saadany1 Ezzat…
EDUCATIONAL REVIEW Open Access Imaging diagnosis and staging of pancreatic ductal adenocarcinoma: a comprehensive review Khaled Y Elbanna* Hyun-Jung Jang and Tae Kyoung Kim…
Int. J. Med. Sci. 2017, Vol. 14 http://www.medsci.org 412 IInntteerrnnaattiioonnaall JJoouurrnnaall ooff MMeeddiiccaall SScciieenncceess 2017; 14(5): 412-418. doi: 10.7150/ijms.18641…
4 Conjunctival Intraepithelial Neoplasia – Clinical Presentation, Diagnosis and Treatment Possibilities Valentín Huerva1 and Francisco J. Ascaso2 1Department of Ophthalmology,…
Microsoft PowerPoint - 21_JARBOE_Endometrial_Intraepithelial_Neoplasia [Compatibility Mode]5 Mutations in K-ras, β- catenin, emergence of mutant clone Malignant transformation
Metachronous serous endometrial intraepithelial carcinoma and serous peritoneal carcinoma: analysis of probable independent lesionsAbstract Background: Uterine serous endometrial
“Endometrial hyperplasia vs. Intraepithelial neoplasia” Martin Chang, MD PhD FRCPC Pathology Update Friday November 9, 2012 Disclosure Case 1 Gland crowding Gland