Inducing systemic resistance against some tomato virus ... · Title: INDUCING SYSTEMIC RESISTANCE...

Inducing systemic resistance

against some tomato virus diseases

By

E m an Shahw an M oheb E lE m an Shahw an M oheb E lE m an Shahw an M oheb E lE m an Shahw an M oheb E l----D in Shahw anD in Shahw anD in Shahw anD in Shahw an

B.Sc. Agric. Sci., (Plant Pathology) 2002 M.Sc. Agric. Sci. (Plant Pathology) 2007

Fac. Agric., Moshtohor, Banha Univ.

DISSERTATION

Submitted in Partial Fulfillment of the Requirements for

The Degree of

DOCTOR OF PHILOSOPHY

in PLANT PATHOLOGY

(V iral D iseasesV iral D iseasesV iral D iseasesV iral D iseases)

Agricultural Botany Department (Plant Pathology)

Faculty of Agriculture, Moshtohor Banha University

2010

Title: INDUCING SYSTEMIC RESISTANCE AGAINST SOME TOMATO VIRUS DISEASES

Name: E m an Shahw an M oheb E lE m an Shahw an M oheb E lE m an Shahw an M oheb E lE m an Shahw an M oheb E l----D in Shahw anD in Shahw anD in Shahw anD in Shahw an

Degree: DOCTOR OF PHILOSOPHY

Department: Agricultural Botany (Plant Pathology)

ABSTRACT

The objectives of this study were isolation and identification of the most

frequently and economically viruses causing serious losses in tomato crop in

the different location of Qalyoubia Governorate, evaluating some medicinal

plant extracts and kombucha filtrate as biotic inducers to induction systemic

acquired resistance in the tomato plants against CMV and using more effective

bioinducers as bioelicitors for control viruses infection via induction

'pathogenesis-related' (PR-1a) genes.

Target virus was chosen according to its more frequently and severity

among the isolated viruses in these locations at the winter season from the

study year. Isolated virus was confirmed biologically and serologically assays.

Extracts of two medicinal plants (Clerodendrum inerme L. Gaertn and

Mirabilis jalapa L.) and were individually or in mixture in addition to

kombucha filtrate were evaluated as bioinducers. All the four inducers were

successfully in the induction of systemic acquire resistance (SAR) in the

uninoculated tomato plants and sprayed with (50% v/v) of inducers.

Tested bioinducers were used as biocontrol to inhibiting the virus

infection of tomato plants as spraying every 15 days under greenhouse

conditions. Pathogenesis-related (PR-1a) gene was molecularly isolated and

identified via sequencer which compared with those recorded in the Gen-Bank.

In conclusion, using medicinal extracts and other natural inducers were promise with good systemic acquired resistance against the great numbers of plant pathogens. In future, induction of resistance can be done cheaply and easily using natural substances

CONTENTS Page

LIST OF FIGURES ...................................................................................... i LIST OF TABLES ......................................................................................iv LIST OF PLATES..................................................................................... vii LIST OF ABBREVIATIONS .................................................................ix INTRODUCTION ........................................................................................1 REVIEW OF LITERATURE..................................................................4 MATERIALS AND METHODS ..........................................................44 EXPERIMENTAL RESULTS ..............................................................73

Part I 1- Disease incidence and frequency of virus ....................................73 2- Confirmation of Cucumber mosaic virus (CMV) ......................75

2.1. Host range .........................................................................................75 2.2. Transmission of CMV ...................................................................78 2.3. In vitro properties............................................................................78 2.4. Inclusion bodies...............................................................................80 2.5. Dot blot immunoassay (DBIA) ...................................................80

Part II Evaluation of biotic inducers of systemic acquired resistance and biocontrol of CMV ................................................ 82 A. Induction of systemic acquired resistance (SAR)

by biotic inducers before virus inoculation ....................82 1. Histopathology changes ...........................................................82 2. Biochemical changes .................................................................86

2.1. Antiviral Proteins......................................................................86 a. Determination the elicited antiviral protein as response to

induction SAR (pre-inoculation) after 7-days...........................86 b. Determination the elicited antiviral protein as response to

induction SAR (post-inoculation) after 25-days.......................89 2.2- Oxidative enzymes .......................................................................92 a. Peroxidase isozyme in tomato plants sprayed with biotic

inducers to induce SAR (pre-inoculation) after 7-days ............92 b. Peroxidase isozyme in tomato plants sprayed with biotic

inducers to induce SAR (post-inoculation) after 25-days........95 c. Polyphenol oxidase isozyme in tomato plants sprayed

with biotic to induce SAR (pre-inoculation) after 7-days........ 98

d. Polyphenol oxidase isozyme in tomato plants sprayed with biotic to induce SAR (pre-inoculation) after 25-day.... 101

2.3. Quantification of total SA in tomato plants treated with biotic pre-virus inoculation .....................104

2.4. Photosynthetic pigments content..........................................109 2.5. Determination of phenolic compounds ..........................110 2.6. RNA determination in tomato plants treated with

biotic inducers pre-virus inoculation.......................... 112 3. Molecular marker for SAR detection ............................113

Analysis of molecular data by Bioinformatics ...................... 116 1- Nucleotide sequence....................................................................... 116 2- Translation of partial nucleotide sequence of PR-la

gene for tomato plants treated with biotic inducers ....121 4- Effect of biotic inducers on virus infectivity during

induction of SAR as follows................................................... 126 B- Using of biotic inducers as bioinducers to control CMV

infection ................................................................................................ 128 1. Histopathological changes ....................................................... 128 2. Biochemical changes ................................................................... 131

2.1. Antiviral proteins.................................................................. 131 a. Determination the elicited antiviral protein as

response to treatment with bioinducers to control infected tomato plants after 7 days of spraying............... 131

b. Determination the elicited antiviral protein as response to treatment with bioinducers to control infected tomato plants after 25 days of spraying ............ 134

2.2. Oxidative enzymes................................................................ 137 a. Peroxidase isozyme in infected tomato plants and

sprayed with bioinducers to control CMV after 7 days of spraying.................................................................................. 137

b. Peroxidase isozyme in infected tomato plants and sprayed with bioinducers to control CMV after 25-days of spraying........................................................................ 139

c. Polyphenol oxidase isozyme in infected tomato plants and sprayed with bioinducers to control CMV after 7 days of spraying .......................................................... 143

d. Polyphenol oxidase isozyme in infected tomato plants and sprayed with bioinducers to control CMV after 25 days of spraying........................................................ 145

2.3- Photosynthetic pigments content ................................... 149 2.4. Determination of total phenols ........................................ 151 2.5. Total free amino acids content in inoculated

tomato plants and treated with bioinducers ............ 152 2.6. Total carbohydrates content in inoculated tomato

plants and treated with bioinducers ........................... 154 3. Effect of bioinducers on virus infectivity ........................... 155

DISCUSSION ............................................................................................ 157 SUMMERY ................................................................................................ 188 REFERENCES ......................................................................................... 198 ARABIC SUMMARY

i

LIST OF FIGURES Page

Figure 1 Conceptual model for the pathway leading to the establishment of SAR...........................................................29

Figure 2 Standard curve of the protein concentration using bovine serum albumin as a standard protein. ..................................57

Figure 3 Standard curve of glucose for determination total carbohydrate. ........................................................................66

Figure 4 Standard curve of total RNA................................................67

Figure 5 Disease incidence and disease severity of natural viruses affecting tomato at 5 different locations in Qalyoubia Governorate. .........................................................................74

Figure 6 Effect of biotic inducers on protein content in tomato plants pre virus inoculation...................................................87

Figure 7 Effect of biotic inducers on protein content in tomato plants post virus inoculation .................................................90

Figure 8 Effect of biotic inducers on POD activity in tomato before CMV inoculation. .................................................................92

Figure 9 Effect of biotic inducers on POD activity in tomato plants infected with CMV...............................................................95

Figure 10 Effect of biotic inducers on PPO activity in tomato plants pre- CMV inoculation. .........................................................98

Figure 11 Effect of biotic inducers on PPO activity in tomato plants infected with CMV.............................................................. 101

Figure 12 HPLC quantification of free and endogenous SA in induced tomato plants......................................................... 105

Figure 13 Histogram illustrates the RNA content values in the leaves of tomato plants treated with bioinducers compared with healthy ........................................................ 113

ii

Figure 14 The partial nucleotide sequence of DNA (182 bp) from mRNA of PR-la gene of tomato plants treated with biotic inducers. .............................................................................. 115

Figure 15 Multiple sequence alignment of the partial nucleotide sequence of the PR-1a gene for tomato plants with the corresponding sequence of six pathogenesis related protein available in Gen-Bank............................................ 119

Figure 16 A Phylogenetic tree of tomato plants treated with bioinducers and other crops. ............................................ 120

Figure 17 Histogram illustrates nucleotide frequencies of PR- gene of tomato plants related to other PR-la gene of different crops in GenBank.............................................. 120

Figure 18 Translation of partial nucleotide sequence of PR-la gene for tomato plants treated with biotic inducers produced 60 amino acids with MW = 6.383 kDa. .............................. 121

Figure 19 Multiple amino acids sequence aligned of the partial PR-1a gene of the studied tomato plants with the corresponding amino acid sequence of eleven pathogenesis related protein of different hosts available in GenBank. ............................... 123

Figure 20 A phylogenetic tree of PR-la gene tomato based on the amino acid sequence of the PR-la gene. ................................ 124

Figure 21 Effect of bioinducers on disease severity and virus infectivity in tomato plants.................................................. 127

Figure 22 Effect of bioinducers on protein content in tomato plants infected with CMV (after 7 days)......................................... 132

Figure 23 Effect of bioinducers on protein content in tomato plants infected with CMV (after 25 days)....................................... 135

Figure 24 Effect of bioinducers on POD activity in tomato plants infected with CMV (after 7 days) ........................................ 137

Figure 25 Effect of bioinducers on POD activity in tomato plants infected with CMV (after 25 days). ..................................... 140

iii

Figure 26 Effect of bioinducers on PPO activity in tomato plants infected with CMV ............................................................. 143

Figure 27 Effect of bioinducers on PPO activity in tomato plants infected with CMV. ............................................................. 146

Figure 28 Effect of bioinducers on total free amino acids in tomato plants infected with CMV. .................................................. 153

Figure 29 Effect of bioinducers on total carbohydrates content in tomato plants infected with CMV ...................................... 155

Figure 30 Effect of bioinducers on CMV infectivity in tomato plants.156

iv

LIST OF TABLES Page

Table 1 Preparation of SDS-PAGE gels. ..............................................59

Table 2 Pathogenesis related protein (PR-1a gene) of different crops in GenBank. ...................................................................71

Table 3 Eleven Pathogenesis related protein (PR-1a gene) amino acids of different hosts published in GenBank........................72

Table 4 Detection of viruses naturally infected tomato plants. ............73

Table 5 The disease incidence and disease severity of naturally viral infected tomato plants in different 5 locations (Qalyoubia Governorate).........................................................74

Table 6 The reactions of plant host species and cultivars inoculated with CMV isolate. ...................................................................76

Table 7 In vitro properties of CMV isolate in infectious crude sap under laboratory conditions.....................................................79

Table 8 Anatomical variations of tomato leaf treated with biotic inducers (lengths measured by µm).........................................83

Table 9 Protein content and enzyme activities in tomato plants treated with biotic extracts........................................................87

Table 10 Protein fractions of tomato plants treated with bioinducers using SDS-PAGE.....................................................................88

Table 11 Protein content and enzyme activities in infected tomato plants then treated with biotic extracts. ...................................90

Table 12 Protein fractions of CMV infected tomato plants treated with bioinducers using SDS-PAGE. ......................................91

Table 13 Disc-PAGE banding patterns of peroxidase isozymes of tomato plants non-inoculated with CMV and treated with bioinducers. .............................................................................94

Table 14 Disc-PAGE banding patterns of peroxidase isozymes of tomato plants treated with bioinducers then infected by CMV........................................................................................97

Table 15 Disc-PAGE banding patterns of polyphenol oxidase isozymes of tomato plants treated with bioinducers ............100

v

Table 16 Disc-PAGE banding pattern of polyphenol oxidase isozymes of tomato plants treated with bioinducers then infected by CMV. ...........................................................102

Table 17 Protein genetic markers of tomato plants produced by bioinducers as indication of systemic acquired resistance against CMV infection ........................................................104

Table 18 Quantification of total SA in tomato plants treated with bioinducers compared with healthy plant.....................105

Table 19 Chlorophyll and carotenoid contents (mg/g FW) in tomato plants treated with biotic inducers........................................110

Table 20 Free, conjugated and total phenols content in tomato plants treated with biotic inducers. ..................................................111

Table 21 Comparison between tomato plants (treated with biotic inducers) in RNA contents and healthy, inoculated controls.112

Table 22 Comparison between bases composition of partial PR-la gene for tomato plants treated with biotic inducers and six pathogenesis related protein published in Gen-Bank............117

Table 23 Comparison between amino acids composition of partial PR-la gene sequence for tomato plants treated with bioinducers and 11 pathogenesis related protein of different hosts published in GenBank. ..................................125

Table 24 Effect of bioinducers on CMV infectivity in tomato plants. .....126

Table 25 Effect of bioinducers on anatomical structure of tomato leaves post-CMV inoculation (lengths measured by µm). ..................................................................129

Table 26 Protein content and enzyme activities in tomato plants infected with CMV and treated with biotic extracts (after 7 days).......................................................................................132

Table 27 Protein fractions of tomato plants infected with CMV and treated with bioinducers using SDS-PAGE...........................133

Table 28 Protein content and enzyme activities in tomato plants infected with CMV and treated with biotic extracts (after 25 days)..................................................................................135

vi

Table 29 Protein fractions of CMV infected tomato plants treated with bioinducers using SDS-PAGE................................136

Table 30 Disc-PAGE banding patterns of peroxidase isozymes of CMV infected tomato plants treated with bioinducers..........138

Table 31 Disc-PAGE banding patterns of peroxidase isozymes of CMV infected tomato plants treated with bioinducers..........141

Table 32 Disc-PAGE banding patterns of polyphenol oxidase isozymes of CMV infected tomato plants treated with bioinducers. ...........................................................................144

Table 33 Disc-PAGE banding patterns of polyphenol oxidase isozymes of CMV infected tomato plants treated with bioinducers. ...........................................................................147

Table 34 Disc-PAGE banding patterns of polyphenol oxidase isozymes of CMV infected tomato plants treated with bioinducers. .......149

Table 35 Chlorophyll and carotenoid contents in tomato plants treated with bioinducers after CMV inoculation...............................150

Table 36 Free, conjugated and total phenols content in tomato plants treated with bioinducers after CMV inoculation. ..................152

Table 37 Total free amino acids content in tomato plants treated with bioinducers.............................................................................153

Table 38 Total carbohydrates content (mg/g FW) in infected tomato plants treated with bioinducers..............................................154

Table 39 Effect of individual bioinducers on post CMV infection in tomato........................................................................................... 156

vii

LIST OF PLATES Page

Plate 1 Different types of natural infection symptoms on tomato leaves showing mosaic, mottling, blisters, crinkle, yellowing, malformation and erecting..........................................................45

Plate 2 Plant leaves inoculated with CMV isolate showing local symptoms on Chenopodium murale, C. quinoa, C. amaranticolor and Datura metel. ...............................................77

Plate 3 Host plants mechanically inoculated with CMV isolate showing different types of symptoms on leaves. ......................................77

Plate 4 Epidermal strips and hairs of cucumber leaves infected with CMV (15 days post inoculation) showing cytoplasmic inclusion bodies, (Magnification of Light micrograph 400X). (A) CI: Crystalline inclusion bodies. (B) AI: Amorphous inclusion bodies.. ..................80

Plate 5 Dot Blot Immunoassay for CMV precipitation against specific IgG-CMV polyclonal. ................................................................81

Plate 6A Anatomical variations in tomato leaves treated with bioinducers. ................................................................................84

Plate 6B Light micrograph of tomato leaves sprayed with biotic inducers and infected with CMV showing different changes in cells and tissues (40X)............................................................85

Plate 7 Protein fractions of tomato plants treated with bioinducers pre CMV inoculation using SDS-PAGE. ...................................88

Plate 8 Protein fractions of tomato plants treated with bioinducers post CMV inoculation using SDS-PAGE. .................................91

Plate 9 Native acrylamide gel (7%) electrophoresis of POD isozymes produced in tomato plants treated with bioinducers pre CMV inoculation. .................................................................................94

Plate 10 Native acrylamide gel (7%) electrophoresis of POD isozymes produced in tomato plants treated with bioinducers post CMV inoculation. .................................................................................97

viii

Plate 11 Native acrylamide gel (7%) electrophoresis of PPO isozymes produced in tomato plants treated with bioinducers pre-CMV inoculation. ...............................................................................100

Plate 12 Native polyacrylamide gel (7%) electrophoresis of PPO isozymes produced in tomato plants treated with bioinducers post CMV inoculation. ............................................................103

Plate 13 2.5% agarose gel electrophoresis showing the amplified PCR product of mRNA of PR-1a gene of tomato plants treated with bioinducers at the correct size (182 bp). ..........................114

Plate 14 Light micrograph of tomato plant treated with bioinducers post CMV inoculation showing different changes in cells and tissues (40X).............................................................................130

Plate 15 Protein fractions of tomato plants treated with bioinducers post CMV inoculation using SDS-PAGE. ...............................133

Plate 16 Protein fractions of tomato plants treated with bioinducers post CMV inoculation using SDS-PAGE. ...............................136

Plate 17 Native acrylamide gel (7%) electrophoresis of POD isozymes produced in tomato plants treated with bioinducers post CMV inoculation......................................................................139

Plate 18 Native acrylamide gel (7%) electrophoresis of POD isozymes produced in tomato plants treated with bioinducers post CMV inoculation......................................................................142

Plate 19 Native acrylamide gel (7%) electrophoresis of PPO isozymes produced in tomato plants treated with bioinducers post CMV inoculation......................................................................145

Plate 20 Native acrylamide gel (7%) electrophoresis of PPO isozymes produced in tomato plants treated with bioinducers post CMV inoculation......................................................................148

ix

LIST OF ABBREVIATIONS

A :Adenine

AIB :Amorphous inclusion bodies

APS :Ammonium persulfate

ASA :Acetyl salicylic acid.

AVP :Antiviral protein.

Bp :Base pair

BA :Benzioc acid

BA2H :Benzioc acid 2- hydroxylase

BI :Biotic inducer

BSA :Bovine serum albumin

BPB :Bromophenol blue

C :Cytosine

CarMV :Carnation mosaic virus

°C :Centegrate

Chl.a :Chlorophyll a.

Chl.b :Chlorophyll b.

cm :Centimeter

Cp :Coat protein

cDNA :Complement deoxyribonucleic acid

CBB :Coomassie brilliant blue

CIB :Crystalline inclusion bodies

Ci :Clerodendrum inerme

CMV :Cucumber mosaic cucumovirus

cv. :Cultivar

dNTP :Dideoxy nucleotide triphosphate

DEP :Dilution end point

DS :Disease severity

DTT :Dithiothreotol

DBIA :Dot blot immunoassay

DAS-ELISA :Double antibody sandwich enzyme-linked immunosorbent assay

EDTA :Ethylene diamine tetra acetic acid

e.g. :For example (Exempli gratia)

EAVPs :Endogenous antiviral proteins

et al. :And other (et alii)

FW :Fresh weight

g :Gram

G :Guanine

HPLC :High performance liquid chromatography

x

hr :Hour

HR :Hypersensitive reaction

i.e. :That is (id est)

IgG :Immunoglobulin G

I-ELISA :Indirect enzyme-linked immunosorbent assay

IAA :Indole acetic acid

ISR :Induced systemic resistance

K :Kombucha

KDa :Kilo Dalton

Kg :Kilo gram

L-DOPA :L-Dihydroxy phenylalanine

LAR :Local acquired resistance

L.L. :Local lesion

LIV :Longevity in vitro

ml :Milliliter

mg :Milligram

min :Minute

Mixed(Mj+Ci) :Mixed (Mirabilis jalapa + Clerodendron inerme)

Mj :Mirabilis jalapa

mM :Millimole

µg :Microgram

µl :Microliter

M :Molar

nm :Nanometer

NRC :National research centre

nt :Nucleotide

O.D :Optical density

pH :Hydrogen ion concentration

PRs :Pathogenesis related proteins

POD :Peroxidase

PMSF :Phenyl methyl sulfonyl

PA :Phenylalanine

PAL :Phenylalanine ammonia-lyase

PBS :Phosphate buffer saline

PBST :Phosphate buffer saline-Tween

PGPR :Plant growth promoting rhizobacteria

PAGE :Polyacrylamide gel electrophoresis

PEG :Polyethylene glycol

PCR :Polymerase chain reaction

PPO :Polyphenol oxidase

xi

PVP :Polyvinyl pyrrolidine

PPB :Potassium phosphate buffer

PVX :Potato virus X

R.I. :Reduction of infection

RT-PCR :Reverse transcriptase polymerase chain reaction

RPM :Revolution per minute

RNA :Ribonucleic acid

RIPs :Ribosome inactivation proteins

RNAsin :RNAase inhibitor

SAG :Glycosyl salicylic acid

SA :Salicylic acid

sat RNA :Satellite RNA

SNL :Small necrotic lesions

SDS-PAGE :Sodium dodecyl sulfate polyacrylamide gel electrophoresis

SAR :Systemic acquired resistance

SRIs :Systemic resistance inducers

T :Thiamine

TEMED :Tetra methylene di amine

TIP :Thermal inactivation point

TMV :Tobacco mosaic virus

TNV :Tobacco necrosis virus

TRV :Tobacco rattle tobravirus

ToMoV :Tomato mottle virus

TSWV :Tomato spotted wilt-virus

UV :Ultraviolet

VIA :Virus inhibitory agent

V/V :Volume per Volume

W/V :Weight/Volume

ACKNOWLEDGMENT

All the greatest gratefulness, deepest appreciation and sincerest

thanks to ALLAH for all gifts which given me and for enabling to

overcome all problems which faced in my and throughout the course

of this investigation and helping me to achieve this hard work in the

ideal form to bring-forth to light this thesis.

The author wishes to express her deepest gratitude and

indebtedness to the supervisor of the present work Prof. D r. A bdou Prof. D r. A bdou Prof. D r. A bdou Prof. D r. A bdou

M ahdy M oham ed M ahdyM ahdy M oham ed M ahdyM ahdy M oham ed M ahdyM ahdy M oham ed M ahdy Professor of Plant Pathology and Vice Dean of Faculty for Community Service and Development of Environment, Botany Dept., Fac. Agric., Banha Univ., for his constructive supervision, valuable advice, kind guidance, great assistance in the preparation of this manuscript and for his help in putting thesis in its final from.

I would like to thank P rof. D r. P rof. D r. P rof. D r. P rof. D r. K haled A bdelK haled A bdelK haled A bdelK haled A bdel----F atah E lF atah E lF atah E lF atah E l----D ogdogD ogdogD ogdogD ogdog

Professor of Plant Virology, Microbiology Dept., Fac. Agric., Ain-Shams Univ., for his great help, encouragement, invaluable guidance and his kind attitude toward me during all time of this research and in the final preparation of this manuscript.

The author indebted to Prof. D r. P rof. D r. P rof. D r. P rof. D r. R aR aR aR aoooouf N aguuf N aguuf N aguuf N agu iiiib F aw zyb F aw zyb F aw zyb F aw zy

Professor of Plant Pathology, Botany Dept., Fac. Agric., Banha Univ., for his sincere encouragement, scientific support, keeping interest and his helps in provision of all facilities needed for the present work.

I’m also indebted to D r. M oham ed A lD r. M oham ed A lD r. M oham ed A lD r. M oham ed A l----Sayed H afezSayed H afezSayed H afezSayed H afez Ass.

Professor of Plant Pathology, Botany Dept., Fac. Agric., Banha Univ., for his unlimited valuable help.

Thanks are also due to all staff members of the Fungi and Plant

Pathology Branch, Agric. Botany Dept., Fac. Agric., Banha Univ., for their kindness and technical assistance.

Introduction - 1 -

INTRODUCTION

Tomato (Lycopersicon esculentum Mill., Solanum lycopersicon

L.), belongs to a large family of plants called the Solanaceae. It's one

of the most important commercially grown vegetables in Egypt and

the most popular vegetable throughout the world, and the importance

of its cultivation is threatened by a wide array of pathogens. In the

last twenty years this plant has been successfully used as a model

plant to investigate the induction of defense pathways after exposure

to fungal, bacterial, viral and abiotic molecules, showing triggering of

different mechanisms of resistance (Lancioni, 2008).

Egypt ranks fifth in the world for tomato production (FAO,

2010). In 2009/2010, farmers produced about 9,204,097 million tons

of tomato from total area of 476.190 feddan plus 2314 protected

houses (Year Book of Ministry of Agriculture & Land Reclamation).

Tomato also contains important vitamins, minerals and antioxidants.

Tomato is susceptible to many viruses and considerable yield

losses and diminished fruit quality can occur due to single or multiple

viral infections. The power of growth; decrease of yield and quality

of tomato were observed under protective and open field cultivation

(Rampersad, 2006).

Virus diseases are considered one of the most important

problems affecting tomato production in many countries. There are

about 75 viruses infecting this crop (Mohamed, 2010).

Cucumber mosaic virus (CMV), is the type species of the genus

Cucumovirus, family Bromoviridae, has isometric particles and a

positive-sense RNA with a tripartite genome. Cucumber mosaic virus

has a worldwide distribution and is of economic importance in many

Introduction - 2 -

crops, vegetables, fruits and ornamentals. Cucumber mosaic virus is

difficult to control because of its extremely broad host range in

excess of 800 plant species and transmission in a non-persistent

manner by more than 60 species of aphids. On tomato, symptoms of

CMV infection include stunting of vegetative growth, distortion and

mottling of new growth, and a characteristic shoestring-like leaf

appearance (Sudhakar et al., 2007).

Virus infections cause great damage to economical crops, this

loss is so clear especially in developing countries. Investigators were

aiming to control such incurable pathogen using an alternative

biological controlling strategy depending on a clean agriculture

system. Systemic resistance for virus infections can be induced in

plants treated with certain bacteria or with bacterial products, and

also by treatment with some chemicals which may be more risky

when compared with bacteria. The role of such induced systemic

resistance described by the enhancement of the production of plant

antioxidant protective enzyme, peroxidase, besides the activation of

some plant defense genes producing pathogenesis related proteins

(PR-Ps), which are not well studied yet for its mode of action

(Shehata and El-Borollosy, 2008).

Plant viruses seem nearly impossible to control, instead,

practical attempts are made to keep them in check, to reduce losses,

basically to manage their existence within a crop. The availability of

genetically resistant varieties is clearly the best approach for all

cultivated crops; however, such varieties are often not available, and

even when they are available, there is the possibility for the

occurrence of other viruses or viral strains that are not affected by the

Introduction - 3 -

resistance. The basic premise behind these approaches is to delay the

introduction of virus into the crop thereby allowing the plant to

mature to a stage of development that will essentially tolerate the

infection. Virus infection of a more mature plant typically results in

delayed movement of virus throughout the plant, reduced virus

accumulation, reduced symptom severity and losses in yield. It is

noticed that tobacco plants exhibited ‘systemic acquired resistance’

following local infection with tobacco mosaic virus. Other terms that

have been used to describe systemic resistance in plants include

‘translocated resistance’, ‘plant immunization’ and ‘induced systemic

resistance’. The term ‘induced systemic resistance’ (ISR) is used to

denote induced systemic resistance by non-pathogenic biotic agents

and may differ mechanistically from resistance induced by other

elicitors. Inducible defenses in plants may have selective advantages

over constitutive defenses. While inducible defenses are often

localized at the site of attack, plant defense mechanisms may be

activated systemically throughout the plant following a localized

infection or attack (Rampersad, 2006).

Therefore, the objective of this investigation is evaluating some

biotic inducers (water extracts of Clerodendrum inerme, Mirabilis

jalapa or their mixture and kombucha filtrate) to induce acquired

systemic resistance and safe means to control virus infection in

tomato either in the greenhouse or in the open field conditions.

Review of Literature - 4 -

REVIEW OF LITERATURE

Part I

1- Disease incidence and frequency of virus(es):

The incidence of virus diseases of tomato (Lycopersicon

esculentum) in Mauritius was investigated in field's samples by electron

microscopy and enzyme-linked immunosorbent assay (ELISA). Two

virus diseases, potato virus Y (PVY) and tomato mosaic virus (ToMV)

were found to be widespread. ELISA may differentiate two strains of the

PVY virus (Ganoo and Saumtally, 1999).

A survey of tomato ant pepper viruses was conducted in Sudan

during the last ten years. It covered Central, Northern, Eastern, South-

eastern and Western regions of Sudan. The results revealed the

presence of many mosaic - inducing virus and virus like agents.

Cucumber mosaic virus (CMV), tomato mosaic virus (ToMV),

tobacco mosaic virus (TMV), Tomato yellow leaf curl virus (TYLCV)

and potato virus Y (PVY) were all found to infect both tomato and

pepper (Elshafie et al., 2005).

Yardimci and Eryigit (2006) showed that, leaf samples were

collected from 138 tomato (Lycopersicon esculentum) plants showing

symptoms of Cucumber mosaic virus (CMV) in the north-west

Mediterranean region of Turkey. The samples were first tested by

double antibody sandwich-enzyme linked immunosorbent assay

(DAS-ELISA) using CMV specific polyclonal antibody. The DAS-

ELISA revealed that 53 of the 138 leaf samples tested were infected

with CMV. One of the ELISA-positive CMV isolates was


mechanically inoculated into a set of indicator plants by conventional

leaf inoculation method for further characterization. The virus was

multiplied and showed systemic symptoms in Nicotiana tabacum

'Xanthii', Nicotiana tabacum 'Samsun NN', and Capsicum annuum.

Michael (2009) found that, A survey was conducted to determine

the incidence of Cucumber mosaic virus (CMV), Beet curly top virus

(BCTV), Tomato yellow leaf curl virus (TYLCV), Tomato chlorotic spot

virus (TcSV), Potato virus Y (PVY), Potato virus S (PVS), Tomato

spotted wilt virus (TSWV), Tomato ringspot virus (TRSV), Tomato

aspermy virus (TAV), Arabis mosaic virus (ArMV), Tobacco streak

virus (TSV), Tomato bushy stunt virus (TBSV), Tobacco mosaic virus

(TMV), and Tomato mosaic virus (ToMV) on tomato (Solanum

lycopersicum) in the major horticultural crop growing areas in the

southeast and central regions of Iran. Samples of symptomatic plants

were analyzed for virus infection by enzyme-linked immunosorbent

assay (ELISA) using specific polyclonal antibodies. ArMV and CMV

were the most frequently found viruses, accounting for 25.6 and 23.4%,

respectively, of the collected samples. BCTV, TSWV, TMV, PVY,

ToMV, and TYLCV were detected in 6.1, 5.8, 5.6, 5, 4.8, and 1.6% of

the samples, respectively. TBSV, TAV, TSV, PVS, and TRSV were not

detected in any of the samples tested. Double and triple infections

involving different combination of viruses were found in 13.9 and 1.7%

of samples, respectively. This is the first report of PVY and ArMV as

viruses naturally infecting tomato in Iran.

A survey was conducted to determine the incidence of Cucumber

mosaic virus (CMV), Beet curly top virus (BCTV), Tomato yellow leaf


curl virus (TYLCV), Tomato chlorotic spot virus (TcSV), Potato virus Y

(PVY), Potato virus S (PVS), Tomato spotted wilt virus (TSWV),

Tomato ringspot virus (TRSV), Tomato aspermy virus (TAV), Arabis

mosaic virus (ArMV), Tobacco streak virus (TSV), Tomato bushy stunt

virus (TBSV), Tobacco mosaic virus (TMV), and Tomato mosaic virus

(ToMV) on tomato (Solanum lycopersicum) in the major horticultural

crop growing areas in the southeast and central regions of Iran. A total of

1307 symptomatic leaf samples from fields and 603 samples from

greenhouses were collected from January 2003 to July 2005 in five

southeastern and central provinces of Iran. Samples of symptomatic

plants were analyzed for virus infection by enzyme-linked

immunosorbent assay (ELISA) using specific polyclonal antibodies

(Massumi et al., 2009).

Lin et al. (2010) found that, Cucumber mosaic virus (CMV) has

been identified as the causal agent of several disease epidemics in

most countries of the world. Insect-mediated virus diseases, such as

those caused by CMV, caused remarkable loss of tomato (Solanum

lycopersicon) production in Taiwan.

2- Confirmation of Cucumber mosaic cucumovirus (CMV):

1. Biological characters:

1.1- Symptomatology and Host range:

In Egypt, CMV was isolated from Nicotiana gluaca (Eid et al.,

1984) sugar beet (Omar et al., 1994), pepper (Khalil et al., 1985),

cucumber (El-Baz, 2004; El-Afifi et al., 2007; Megahed, 2008 and

Taha, 2010) and tomato (Mohamed, 2010).


Tomato plants infected with CMV are often showing stunted,

have short internodes, and may have extremely distorted and

malformed leaves, known as fern-leaf (Megahed, 2008 and Taha,

2010). Hellwald et al. (2000) mentioned that, a selection of cucumber

mosaic virus (CMV) subgroup I strains originating from Asia and

Fny-CMV isolated in USA were studied for their interaction with

tomato plants. All strains caused mosaic, fern leaf expression and

stunting of tomato plants.

CMV has a wide range of hosts and attacks a great variety of

vegetables, ornamentals, and other plants (as many as 191 host species

in 40 families). Among the most important vegetables affected by

cucumber mosaic are peppers (Capsicum annuum L.), cucurbits,

tomatoes (Lycopersicon esculentum Mill.), and bananas (Musa spp.

L.) (Chabbouh and Cherif, 1990).

Fawzy et al. (1992) reported that, C. amaranticolor, C. album and

C. quinoa infected with a strain of CMV showing local infection.

Chaumpluk et al. (1994) found that, two strains of CMV caused severe

necrotic ring spot on Tetragonia expansa, contained without satellite

RNA, another strain C7-2, caused mild mosaic with ring scar on T.

expansa. Espinha and Gasper (1997) reported that, mosaic and

distortion symptoms in Cucurbita pepo, Nicotiana tabacum, Cucumis

sativus, Lycopersicon esculentum and Datura stramonium infecting with

CMV. While it gave local symptoms on C. quinoa and Gomphrena

globosa.

Barbosa et al. (1998) found that, CMV diseased banana plants

was detected by mechanically inoculated on the indicator species,


Nicotiana glutinosa, Cucurbita pepo cv. Caserta. Mosaic symptoms

observed in N. glutinosa plant and local lesions in C. pepo. Chen and

Hu (1999) stated that, CMV was shown to infect 27 plant species of 9

families, 20 species appeared systemic infection and 7 species

appeared as local lesion hosts. The virus infected many species in the

family Cucurbitaceae, but it did not infect Phaseolus vulgaris or

Vigna unguiculata.

Fukumoto et al. (2003) reported that, necrotic diseases of the

stems, petioles and leaves of pea plants (Pisum sativum) leading to

wilting and death caused by CMV. Takarai et al. (2006) found that,

green mottle, green mosaic, and chlorotic spots symptoms produced in

Momordica charantia L. plants systemically infected with Cucumber

mosaic virus (CMV).

Montasser et al. (2006) showed that, three strains of Cucumber

mosaic virus (CMV) have been found to cause a lethal disease,

referred to as fern leaf syndromes and mild mosaic symptoms in

tomato (Lycopersicon esculentum Mill.) crops grown in Kuwait. CMV

strains were detected and identified based on host range,

symptomatology, serology, electron microscopy, and ribonucleic acid

(RNA) electrophoresis in polyacrylamide gels.

Sudhakar et al. (2006) observed during a survey in January 2006

near Salem in Tamil Nadu (south India), Cucumber mosaic virus that

infecting tomatoes with an incidence of more than 70%. Plants exhibiting

severe mosaic, leaf puckering, and stunted growth were collected, and the

virus was identified using diagnostic hosts, evaluation of physical

properties of the virus, compound enzyme-linked immunosorbent assay


(ELISA) (ELISA Lab, Washington State University, Prosser), reverse-

transcription polymerase chain reaction (RT-PCR), and restriction

fragment length polymorphism analysis (DSMZ, S. Winter, Germany).

Balogun and Daudu (2007) reported that, the general symptoms

observed on Lycopersicon esculentum cv. Manuella were included pale

green to yellowish mosaic pattern on plant foliage, subsequent stunting of

plant, extremely distorted and malformed leaves (fern leaf) as severe

cases of CMV infection. Akhtar et al. (2008) found that, a severe

infection with CMV observed among all tomato cultivars grown in

Pakistan, evoking severe leaf malformation and shoe stringing.

Zitikait ė and Samuitienė (2009) showed that, Cucumber

mosaic virus (CMV) causing viral diseases in forage, fruit, ornamental

and vegetable crops worldwide has been isolated in Lithuania from

sweet pepper (Capsicum annuum L.) plants exhibiting mottle-mosaic

and distortion of leaves and fruits, and plant stunt symptoms.

The family of Cucurbitaceae were reacted with different symptoms

such as cucumber plants showed severe mosaic, blisters and

malformation while, squash plants gave vein clearing, severe mosaic,

green vein banding, blisters and malformation. Different symptoms

produced on some other species belonging to different families; N.

glutinosa appeared severe mosaic, fern leaf and malformation; N

tabacum cv. White Burly produced severe mosaic; D. metel showing

severe mosaic and malformation, Helicrysum bracteatum showed

yellowing symptoms and Petunia hybrida gave severe mosaic,

malformation and discoloration (Megahed, 2008 and Taha, 2010).


1.2-Transmission of CMV:

A- Mechanical transmission:

El-Baz (2004); Davino et al. (2005); Takarai et al. (2006); El-

Afifi et al. (2007); Akhtar et al. (2008); Megahed (2008) and Taha

(2010) reported that, CMV strains were transmitted mechanically by

infectious sap.

Ali and Kobayashi (2010) reported that, CMV transmitted to

healthy pepper through seeds.

B- Aphid transmission:

The aphid species Myzus persicae, Aphis gossypii and Aphis

craccivora Koch were shown to be vectors of CMV in Sudan. Aphis

gossypii seemed the most efficient. The virus was not transmitted

through 300 seeds from 3 plant species (Abdul Magid, 1990).

CMV is transmitted in a non-persistent manner by more than 80

aphid species. The spread of the virus is generally over short distances

and aphids only remain infective for periods from a few minutes up to a

few hours. During our surveys of the Wimmera cropping region over a

number of years the following aphid vectors of CMV were found:

lucerne blue green aphid (Acyrthosiphon kondoi), cowpea aphid (Aphis

craccivora), foxglove aphid (Aulacorthum solani), ornate aphid (Myzus

ornatus), green peach aphid (Myzus persicae), cabbage aphid

(Brevicoryne brassicae), sowthistle green aphid (Hypermyzus lactucae)

and sowthistle brown aphid (Uroleocon sonchi) (Freeman and

Horsham, 2006; Gildow et al., 2008 and Dheepa and Paranjothi,

2010).


1.3- In vitro properties:

Park et al. (1990) reported that, thermal inactivation point of

CMV was 65°C, dilution end point 10-3 and its longevity in vitro 3-4

days. Fawzy et al. (1992) mentioned that, the thermal inactivation

point of CMV was 60-65°C, the dilution end point 10-4-10-5 and the

longevity of the strain in vitro was 48-60 hours.

Kiranmai et al. (1997) reported that, CMV has longevity in

vitro was 3-4 days, the thermal inactivation point was 60-65°C and the

dilution end point 10-3-10-5 for the three isolates. Lee et al. (1997)

found that, the stability of CMV-FK was 55°C of thermal inactivation

point, dilution end point was 10-3 and longevity in vitro was 2-3 days.

El-Baz (2004) showed that, thermal inactivation point of CMV

was 60°C, dilution end point was 10-4 and longevity in vitro was 4

days. Megahed (2008) showed that, thermal inactivation point of

CMV was 70°C, dilution end point was 10-4 and longevity in vitro was

4 days.

1.4- Inclusion bodies:

Zambolim et al. (1994) stated that, CMV caused crystalloid

inclusions in mesophyll cells of banana leaves.

El-Baz (2004), Megahed (2008) and Taha (2010) examined

epidermal strips of infected squash and cucumber leaves after 36 and

15 days, respectively after CMV inoculation showed cytoplasmic

inclusion bodies in the hair cells. Amorphous inclusion bodies

detected in the hair cells since these stained with red color and


crystalline inclusion bodies observed in hair cells of the epidermal

strips of CMV-infected squash and cucumber leaves.

2.2- Serological identification:

Barbosa et al. (1998) reported that, indirect ELISA and other

serological tests were used for differentiation between CMV isolated

from banana plants into severe strains (B-CMV-1 and B-CMV-2) and

1 mild strain (B-CMV-3).

Tessitori et al. (2002) stated that, ELISA of infected leaf tissue

of Polygala myrtifolia revealed the presence of CMV. El-Baz (2004)

used ELISA test for detection CMV isolated from cucumber plants.

Sharma et al. (2005) found that, CMV was detected and

characterized by bioassay, double antibody sandwich enzyme linked

immunosorbent assay (DAS-ELISA). El-Afifi et al. (2007) used

indirect enzyme linked immunosorbent assay (I-ELISA) for CMV

detection in cucumber plants. Cardin and Moury (2007) reported

that, positive reactions against CMV in leaves of Echium candicans in

France were recorded by double antibody sandwich-ELISA to CMV

specific polyclonal antibodies as well as Aramburu et al. (2007) who

stated that, DAS-ELISA analysis revealed the presence of Cucumber

mosaic virus (CMV) in the infected tomato plants. Megahed (2008)

and Sankaran et al. (2010) found that, the dot blot immunoassay

(DBIA) is very sensitive to detect CMV in infected cucumber plants

using specific polyclonal IgG-CMV.


Part II

Induction of systemic acquired resistance (SAR) by

biotic inducers:

I- General features of systemic acquired resistance:

The phenomenon of SAR against disease in plants following

infection has been recorded, but often not been documented as early as

the 19th century, the natural phenomenon of resistance in response to

pathogen infection or plant immunity was first recognized in 1901 by

Ray, when they worked on Botrytis cinerea. The virulence of a sterile

strain of B. cinerea could be varied by environmental parameters like

heat, cold or cultural conditions. Both researchers then used such

attenuated fungal strains to induce SAR in Begonia, either by planting in

soil inoculated with the attenuated strains or by injecting inoculums into

the plants at many points, (Ray, 1901). Carbone and Kalaljev (1932)

confirmed previous studies and showed that acquired resistance also

depends on the general fitness of the host. Chester (1933) reviewed 201

studies dealing with "the problem of acquired physiological immunity in

plants". Acquired resistance, first described by Gilpatrick and

Weintraub (1952) on Dianthus barbatus when the lower leaves were

inoculated with Carnation mosaic virus (CarMV), the upper leaves were

appeared resistant to the infection. Ross (1961a, 1961b) first investigated

the induction of resistance by localizes viruses and demonstrated the

presence of a zone around each local lesion on tobacco which was more

resistant to a second infection by the same virus. This phenomenon was

called local acquired resistance (LAR). Other leaves on the same plant


also showed resistance to a second infection, which was called systemic

acquired resistance (SAR).

Other terms that have been used to describe systemic resistance

in plants "translocated resistance" Hubert and Helton (1967), "plant

immunization" Kuc (1987) and "induced systemic resistance"

Hammerschmidt et al. (1982).

Hammerschmidt (1999) reported that, the phenomenon of

induced or acquired resistance to disease in plants has been studied

intensively in recent years. This has led to a better understanding of

the signaling pathways involved in the expression of systemic

resistance as well as the genetic regulation of induced or acquired

resistance. Although the induction of resistance to disease results in

the expression of less disease in the plant after challenge with

pathogens, how the plant is able to restrict the development of the

pathogen is not clearly defined. In this paper, some of the defenses

expressed in plants with induced resistance will be discussed in

relation to how the induced plants may restrict disease development.

Choudhary et al. (2007) mentioned that, plants possess a range of

active defense apparatuses that can be actively expressed in response to

biotic stresses (pathogens and parasites) of various scales (ranging from

microscopic viruses to phytophagous insect). The timing of this defense

response is critical and reflects on the difference between coping and

succumbing to such biotic challenge of necrotizing pathogens/parasites.

If defense mechanisms are triggered by a stimulus prior to infection by a

plant pathogen, disease can be reduced. Induced resistance is a state of

enhanced defensive capacity developed by a plant when appropriately


stimulated. Several rhizobacteria trigger the salicylic acid (SA)-

dependent SAR pathway by producing SA at the root surface whereas

other rhizobacteria trigger different signaling pathway independent of

SA. The existence of SA-independent ISR pathway has been studied in

Arabidopsis thaliana, which is dependent on jasmonic acid (JA) and

ethylene signaling.

Systemic acquired resistance (SAR) is a form of induced

resistance that is activated by pathogens that induce localized necrotic

disease lesions or a hypersensitive response. SAR is dependent on

salicylic acid signaling and is typically associated with systemic

expression of pathogenesis-related protein genes and other putative

defenses. Once induced, SAR-expressing plants are primed to respond

to subsequent pathogen infection by induction of defenses that are

localized at the site of attempted pathogen ingress. Finally, SAR

typically does not provide full resistance to disease indicating that the

practical application of this form of resistance will require the use of

other disease management tools (Hammerschmidt, 2009).

Biotic Inducers:

Management of viral disease can also be accomplished through

the induction of plants natural defenses, e.g., systemic acquired

resistance, Ryals et al. (1994). SAR against viral infection has been

documented using biological and chemical inducing agents Kessman

(1994); Raupach et al. (1996); Murphy et al. (2000); Zehnder et al.

(2000); Jetiyanon et al. (2003); Abo El-Nasr et al. (2004);

Fakhourin et al. (2004); Galal (2006) and Park et al. (2007).


A- Plant extracts:

The botanicals may induce resistance or they themselves may

act as inhibitors of viral replication. Ribosome Inactivating Proteins

(RIPs) and glycoproteins may block the replication sites. A mobile

inducing signal may be produced in treated leaves after the botanical

resistance inducers bind with the host plant surface. This signal

produces virus-inhibiting agent in the entire plant system. Certain low

molecular weight pathogenesis related proteins might also play a role

in the induction of systemic acquired resistance. Thus, biologically

active compounds present in plant products act as elicitors and induce

resistance in host plants resulting in reduction of disease development

(Verma et al., 1998).

The major chemical constituents present in Clerodendrum genus

were identified as phenolics, flavonoids, terpenes, steroids and oils

(Shrivastava and Patel, 2007).

A novel single resistance inducing protein (Crip-31) was

isolated and purified from the leaves of Clerodendrum inerme, which

is a very potent, highly stable, basic in nature, 31 kDa in molecular

mass having hydrophobic residues and induces a high degree of

localized as well as systemic resistance against three different groups

of plant viruses (i.e. CMV, PVY and ToMV), which differ at their

genomic organization and having different replication strategies,

infection in susceptible host Nicotiana tabacum. Minimum amount of

purified preparation sufficient for systemic resistance induction was ~

25 µgml−1. The systemic inhibitory activity of the Crip-31 provides

protection to whole plants within 40–60 min of its application. The


systemic resistance inducing properties of this protein can be of

immense biological importance, as it is similar to ribosome

inactivating proteins (RIPs) (Praveen et al., 2001).

Clerodendrum inerme contain basic protein which resistant to

proteases. Induces systemic resistance reversible by actinomycin D

inhibits infectivity of many plant viruses (Verma et al., 1991).

Two systemic antiviral resistance-inducing proteins, namely CIP-

29 and CIP-34, isolated from Clerodendrum inerme leaves, for ribosome-

inactivating properties. CIP-29 has a polynucleotide: adenosine

glycosidase (ribosome-inactivating protein), that inhibits protein

synthesis both in cell-free systems and, at higher concentrations, in cells,

and releases adenine from ribosomes, RNA, poly (A) and DNA. As

compared with other known RIPs, CIP-29 deadenylates DNA at a high

rate, and induces systemic antiviral resistance in susceptible plants

(Olivieri et al., 1996).

Chemical analysis of clavillia (Mirabilis jalapa) was rich in

many active compounds including triterpenes, proteins, flavonoids,

alkaloids, and steroids. Purified an antiviral proteins from roots,

shoots, leaves, fruits, and seeds of Mirabilis jalapa are employed for

different affections. Thus, information about the reproductive pattern

of this culture is important for implementing experimental procedures

(Leal et al., 2001). MAPs in clavillia as being effective in protecting

economically-important crops (such as tobacco, corn, and potatoes)

from a large variety of plant viruses (such as tobacco mosaic virus,

spotted leaf virus and root rot virus) (Vivanco et al., 1999).


Mirabilis jalapa (Nyctaginaceae), containing a ribosome

inactivating protein (RIP) called Mirabilis antiviral protein (MAP),

against infection by potato virus X, potato virus Y, potato leaf roll

virus and potato spindle tuber viroid. Root extracts of M. jalapa

sprayed on test plants 24 h before virus or viroid inoculation inhibited

infection by almost 100%, as corroborated by infectivity assays and

the nucleic acid spot hybridization test (Vivanco et al., 1999). They

also, isolated mirabilis antiviral protein (MAP) from roots and leaves

of Mirabilis jalapa L. which possess repellent properties against

aphids and white flies. MAP showed antiviral activity against

mechanically transmitted viruses but not against aphid transmitted

viruses. MAP was highly effective in inhibiting TSWV at 60%

saturation. A minimum concentration of 400µg/ml of MAP was

sufficient to inhibit TSWV (Devi et al., 2004).

β-farnesene volatiles emitted by the whole plant as well as by

detached flowers of Mirabilis jalapa. Most remarkable were findings

that assigned the use of β-farnesene as an alarm pheromone for aphids.

By taking advantage of the aphid alarm signal, plants are able to repel

herbivores as reported for the wild potato Solanum berthaultii

(Effmert et al., 2005).

Foliar sprays of the Mirabilis jalapa leaf extract caused marked

symptom suppression, improved growth and flowering and

considerably reduced the virus multiplication rate in tomato treated

against tomato yellow mottle (tobacco mosaic virus str.) and tomato

yellow mosaic viruses, cucumber against cucumber mosaic and

cucumber green mottle viruses, and Phaseolus (Vigna) mungo against


bean mosaic virus. The aphid and whitefly (Bemisia tabaci)

populations were much lower on treated than control plants (Verma

and Kumar, 1982).

The development of viral resistance towards antiviral agent

enhances the need for new effective compounds against viral infections.

B- Kombucha fermented tea:

The Kombucha "mushroom" is a symbiotic colony of several

species of yeast and bacteria that are bound together by a surrounding

thin membrane. Although the composition of the Kombucha colony

varies, some of the species reportedly found in the mushroom include

Saccharomyces ludwigii, Bacterium xylinum, B. gluconicum, B.

xylinoides, B. katogenum, Pichia fermentans and Torula sp. Each

strain of kombucha may contain some of the following components

depending on the source of culture strain: Acetic acid, Butyric acid,

Gluconic acid, Lactic acid, Malic acid, Oxalic acid, and Usnic acid.

Kombucha also contains vitamin groups B and C, beneficial yeasts

and bacteria (Stamets, 1994).

Kombucha tea can contain up to 105% alcohol and a variety of

other metabolites (e.g, ethyl acetate, acetic acid, and lactate). During

incubation, the thin, gelatinous mushroom floats in the tea and

duplicates itself by producing a "baby" on top of original mushroom.

These offspring are then given to other persons for starting their own

cultures. FDA has evaluated the practices of the commercial producers

of the kombucha mushroom and has found no pathogenic organisms

or hygiene violations (Food and Drug Administration, 1995). When


prepared as directed, the pH of the tea decreases to 1.8 in 24 hours.

Although this level of acidity should prevent the survival of most

potentially contaminating organisms, tea drinkers have reported molds

growing on the Kombucha (CDC, unpublished data).

Kombucha tea is never static. New acids and nutrients are

constantly created and combined, into ever-changing–though predictable

zymurgy (Chen and Liu, 2000). Kombucha contains many different pro-

biotic cultures along with several organic acids, active enzymes, amino

acids, anti-oxidants, and polyphenols. According to Roussin (2003), the

typical composition may [not always] include: some microorganisms, i.e.

Bacterium gluconicum, B. xylinum, Acetobacter xylinum, A. xylinoides,

A. ketogenum, Saccharomycodes ludwigii, S. cerevisiae, S. apiculatus,

Schzosaccharomyces pombe, Zygosaccharomyces. Some compounds i.e.

Acetic acid, Acetoacetic acid, Benzoic acid, propenyl ester, Benzonitrile,

Butanoic acid, Caffeine, Citric acid, Cyanocobalamin, Decanoic acid,

Ethyl acetate, Fructose, d-Gluconic acid, Glucose, Hexanoic acid,

Itaconic acid, 2-keto-gluconic acid, 5-keto-gluconic acid, 2-keto-3-

deoxy-gluconic acid, Lactic acid, Niacinamide, Nicotinic acid,

Pantothenic acid, Phenethyl Alcohol, Phenol, 4-ethyl, 6-Phospho

gluconate, Propionic acid, Octanoic acid, Oxalic acid, Riboflavin, d-

Saccharic acid (Glucaric acid), Succinic acid and Thiamin plus 40 other

acid esters in trace amount.

Shehata and Lila (2005) reported that fermented tea beverage has

antimicrobial activity against a wide spectrum of organisms including

some phytopathogenic fungi (i.e. Fusarium oxysporum, Alternaria

solani, Aspergillus niger, Penicillium).


Antioxidant and antimicrobial activities were achieved after

fermenting sugared black tea, green tea or tea manufacture waste with

tea fungus (Kombucha) for 12 to 15 days (Jayabalan et al., 2007).

Hafez (2008) found that, kombucha filtrate, expensive

consumption as a healthful beverage as it is easily and safely produced at

home, but scrimpy in the cost, can be useful as commercial applicable

alternative antifungal to control table grape bunch rot near-harvesting

without need to any chemical or fungicide applications and improving

grape quality. Kombucha produced many vitamins, enzymes, organic

acids etc., so can be used on organically certified grapes. Kombucha is a

natural alternative antifungal which could be used as near-harvest dipping

application without need to any chemical or fungicidal applications pre-

and post-harvest especially for exportation grapes. Grapes quality was

not negatively affected as result to using a new tested substance.

Biochemical and physiological changes in induced plants:

There is a number of chemical and physiological changes have

been established to be associated with SAR state. These include, cell

death and the oxidative burst (Low and Merida, 1996), deposition of

callose and lignin (Vance et al., 1980 and Kauss, 1987), the synthesis

of phytoalexins (Dixon, 1986) and novel proteins (Gianinazzi et al.,

1970; Mahmoud, 2000, 2003; Abo El-Nasr et al., 2004 and Sekine

et al., 2006).

Many authors reported that, a large number of enzymes have

been associated with SAR, including peroxidase, phenyalanine

ammonialayase, lipoxygenase, β-1,3-glucanase, chitinase, poly


phenoloxidase and catalase (Van Loon, 1997; Abo El-Nasr et al.,

2004; Silva et al., 2004; Trebbi et al., 2007; Megahed, 2008 and

Taha, 2010).

The relationship between isozyme composition of host plant and

plant resistance or susceptibility to disease has been studied in some

phytosystems. Isozyme spectra of malte- dehydrogenase, peroxidase

and esterase of 10 flax cultivars were separated by PAGE. Data

indicated that, PAGE of isozyme may provide a supplementary assay

to greenhouse and field tests to distinguish qualitatively between

powdery mildew resistant or susceptible cultivars Ali et al. (2006).

Peroxidase and poly phenoloxidase activates were found to be

considerably higher in infected tomato leaves than in healthy ones.

Viral infection with yellow leaf curl and leaf roll of tomato exhibited

higher activity of peroxidase and poly phenoloxidase Disc-PAGE

isozyme, (Sherif and El-Habaa, 2000).

Van Loan (1985) and Neuenschwander et al. (1996) showed

through the analysis of SAR proteins that many of these proteins

belong to the class of pathogenesis related (PRs) proteins, which

originally identified as a new set of proteins that accumulated in

tobacco cultivars that form necrotic lesions following TMV infection

and were also termed "b protein". These proteins are classified as SAR

proteins, when its presence and activity correlates tightly with

maintenance of the resistance state. The systemic acquired induced

resistance (SAR) by biotic or abiotic agents had been recognized to

play an important role in defense against plant viruses, since this

resistance was mainly associated with the introduction of novel


proteins (Faccioli et al., 1994) in treated plants which was the actual

virus inhibitory proteins. These proteins thus induced antiviral state in

plants through formation of new synthesized protein and perhaps were

activate in signaling the activation of defense mechanism in

susceptible hosts and hence had been called systemic resistance

inducers (SRIs) and the novel proteins induced resembled ribosome-

inactivating proteins (Verma and Varsha, 1995).

Chessin et al. (1995) reported that, four types of endogenous

antiviral proteins (EAVPs) had been characterized, and some EVAPs

had been capable of more than one activity, further complicating the

situation. The activities were (1) aggregation (forming a precipitate

with virus), (2) Inhibition of virus establishment, (3) induction of a

systemic viral resistant state, and (4) inhibition of replication by

inactive of protein synthesis (ribosome inactivation).

In tobacco, the set of SAR markers consists of at least nine

families of genes, which are coordinately induced, in uninfected

leaves of inoculated plants. These genes families are now known as

SAR genes. Several of SAR gene products have direct antimicrobial

proteins (Ward et al., 1991 and Meins et al., 1992).

The set of SAR genes that induced differs among plant species.

In cucumber, a class-III chitinase was the most highly induced SAR

gene, while in tobacco and Arabidopsis, PR-1 were the predominant

genes expressed (Cao et al., 1997, 1998).

The products of these genes include PR-1, β-1,3-glucanase, class

II chitinase, having- like protein, thoumatin-like protein, Acidic and

basic forms of class III chitinase, an extracellular β-1,3-glucanase and


the basic isoform of PR-1 and others. Uknes et al. (1992) mentioned

that, in Arabidopsis plants, SAR marker genes are PR-1, PR-2 and

PR-5. Whereas, Smith and Hammerschmidt (1988) showed that,

SAR in cucumber is correlated with increased peroxidase activity and

increase in class III chitinase. In pepper, also chitinase activity was the

protective effect when treated with chemical inducers (Low and

Merida , 1996).

Raskin (1992) reported that, several pathogensis-related

proteins (PRs) were commonly associated with systemic resistance.

Also, β-1,3-glucanase and chitinase were strongly induced after TNV

inoculation or salicylic acid treatment of tobacco and cucumber plants.

Avdiushko et al. (1993) stated that, induced resistance of inoculated

cucumber plants with Colletotrichum lagenarium, TNV or K2HPO4

increased the activity of peroxidase, chitinase and β-1,3-glucanase.

Maurhofer et al. (1994) found that the polyacrilamide gel

electrophoresis and enzyme assays showed that the same amount of

PR proteins (PR-1 group proteins, β-1,3-glucanase and endo-

chitinases) were induced in the intercellular fluid of leaves of plants

grown in the presence of P. fluorescens strain CHAO. The results

indicated also that colonization of tobacco roots by strain CHAO

reduced TNV leaf necrosis and induced physiological changes in the

plant to the same extent as doe's induction of systemic resistance by

leaf inoculation with TNV. Kogel et al. (1994) reported that, induced

systemic resistance ISR against powdery mildew in barley plants is

associated with increase in PR-1, peroxidase and chitinase proteins but

not β-1,3 glucanase.


Mazen (2004) indicated that, faba bean seed treatment or foliar

treatment with biotic inducers i.e. P. fluorescens and P. aeruginosa

increased greatly the activities of peroxidase after 24-h and

polyphenoloxidase after 12-h compared with the untreated control

with superiority of P. aeruginosa than P. fluorescens in this respect.

On the other hand, the highest increase in β-1,3-glucanase activity was

recorded after 24-h in foliar and seed treatments with P. fluorescens

compared with P. areuginosa and control.

Venkatesan et al. (2010) reported that, Pseudomonas fluorescens

(Pf1), plant extract and bioactive compound treatments on induction of

peroxidase (PO), polyphenol oxidase (PPO), phenylalanine ammonia-

lyase (PAL) and accumulation of phenolics in black gram to suppress the

natural incidence of Mung bean yellow mosaic bigeminivirus (MYMV)

was studied. Leaf extracts of Mirabilis jalapa, Datura metel and neem

(Azadirachta indica) oil provided reduced incidence of MYMV with

increased yield in black gram under field conditions. The bio-compatible

products actigard® (acibenzolar-S-methyl), disodium hydrogen

phosphate and alum (aluminium potassium sulphate) also suppressed

MYMV on black gram and increased yield compared with non-treated

plants under field conditions. The mean disease incidence of the two field

trial shows that the foliar spray of P. fluorescens and M. jalapa recorded

the lowest disease incidence of 39.14 and 41.48% with yields of 718 and

716.5 kg per hectare, respectively.


II- Detection of systemic acquired resistance:

1. Biological determinations:

Acquired resistance is measured by the reduction in diameter of

the lesions (and with some viruses, reduction in number). With bean,

one primary leaf is inoculated and the opposite primary leaf

challenged with an inoculation some days later (Megahed, 2008 and

Taha, 2010).

A high degree of resistance to TMV developed in a 1 to 2 mm

zone surrounding TMV local lesions in Samsun NN tobacco. The

zone increased in size and resistance for about 6 days after

inoculation. The zones around TMV lesions were not virus-specific, it

appeared resistant to inoculation with TNV and several other viruses.

Resistance developed not only in uninoculated parts of the inoculated

leaf but also in other leaves of the plant, lesions were about one-fifth

to one-third the size found in control leaves, (Ross, 1961a).

Systemic acquired resistance following a local necrotic reaction

was found by Loebenstein (1963) for D. stramonium L. inoculated

with TMV and Gompherena globosa L. inoculated with potato virus x

(PVX). A significant reduction in the number of lesions as well as in

their size was observed in both host- virus combinations when

uninfected leaf was challenge- inoculated with the same virus. Leaf

extract from resistant Datura tissue reduced the infectivity of TMV

more than control material.

Disease severity and incidence Tomato mottle virus (ToMoV)

disease were reduced in tomato plants under field conditions by seed


treatment with PGPR (Bacillus amyloliquefaciens 937a, B. subtillus

937b and B. pumilus SE34). The seed and soil drench and soil drench

treatments in greenhouse experiments by three PGPR reduced the

percentage of CMV symptomatic tomato plants ranged from 32 to

58% compared with 88 to 98% in untreated plants, (Zehnder et al.,

2000).

2. Physiological and histogical changes in induced plants:

Light microscopy used successfully for plant virus diagnosis

(Fraser and Matthews, 1979).

Dubey and Bhardwaj (1982) found that, the cortical

parenchyma of tomato stem infected with Tobacco mosaic virus are

rounded and sometimes appear wider or smaller than normal. El-

Shamy (1987) showed that, the upper and lower epidermis of infected

leaves (bearing mosaic mottling and abnormalities) had several

protrusions and multicellular glandular hairs with multicellular head.

Eskarous et al. (1991) reported that wall of cortical cells in tomato

stem infected with heat resistant strain of Tobacco mosaic virus are wavy

in outline. Bansal et al. (1992) reported that changes observed in leaves

of summer squash plants infected by CMV induce collapse of the upper

epidermal cells in localized areas, abnormally shaped palisade cells with

fewer chloroplasts, and spongy parenchyma with smaller air space. Plant

with severe mosaic showed disintegration and compaction of mesophyll

tissue, with large vesicles and vascular bundles with filiform symptoms,

the main changes included undifferentiating of mesophyll resulting in the

formation of compact structures lacking air spaces, disintegration and a


scattered arrangement of vascular bundles, hypertrophy of epidermal

cells and scanty chloroplast.

El-Dougdoug et al. (1993) stated that young orange leaves

(Citrus sinensis L.) of Citrus exocortis viroid (CEVd) infected plants

showed less active sieve elements in phloem tissue, phloem radial

thickness and secondary phloem fibers were also reduced. Moreover,

xylem tissue thickness as well as vessel diameter cut down. The

glands reduced also in both number and diameter. As for leaf

mesophyll cells the infection lessened palisade layers, these cells

showed almost cuboidal shape with fewer chloroplast.

El-Shamy et al. (2000) reported that the chloroplasts are great

in number in case of infected tomato leaves compared with healthy

ones. Sayed et al. (2001) showed that, palisade cells of virus infected

tobacco leaves were sometimes small in size rounded or intermingled

with other elongated cells.

3- Biochemical analyses:

A- The role of endogenous salicylic acid (SA) accumulation in

activation of SAR:

Dean and Kuc (1986 a & b) found that through grafting and

stem girdling experiments with cucumber and tobacco plants, the

activation of diseases resistance in parts of plant which remote from

the site of infection, implies the translocation of an endogenous signal.

A model has been proposed where by endogenous signal is

produced at the site of primary infection and is translocated through

the phloem to other parts of the plant (Fig. 1).


Fig (1): Conceptual model for the pathway leading to the

establishment of SAR, (Neuenschwander et al., 1996).

Malamy et al. (1990) and Metraux et al. (1990) showed that

the increase of SA by several hundred folds and the appearance of SA

in phloem sap and in upper non infected leaves of cucumber, tobacco

and Arabidopsis are correlated with the onset of SAR. Yalpani et al.

(1991) and Enydie et al. (1992) reported that in TMV-infected

tobacco, the endogenous level of SA in infected as well as in

uninfected leaves are sufficient to induce resistance and PR-proteins.

Ward et al. (1991); Uknes et al. (1992) and Vernooij et al.

(1995) found that, the exogenous application of SA can induce

expression of SAR genes. Malamy et al. (1990) showed that, the

development of the hypersensitive reaction (HR) and SAR is a

compound of a dramatic increase in the level of endogenous SA in the


inoculated leaves and in the systemically protected tissue, and they

reported that SA levels increase systemically following TMV

inoculation of Xanthi-nc tobacco that carries the N gene to TMV, but

not in a susceptible cultivar (Xanthi-nn).

Gaffeny et al. (1993) and Delancy et al. (1994) provided

evidence supporting this idea comes from the analysis of transgenic

tobacco and Arabidopsis plants that were engineered to over express

SA hydroxylase, an enzyme from P. putida involved in the

metabolism of naphthalene and catalyzing the conversion of SA to the

SAR-inactive catechal. Infected transgenic plants are unable to

accumulate large amounts of SA and are unable express SAR.

Ryals et al. (1996) mentioned that, as much as 70% (tobacco) and

50% (cucumber) of the increase SA in uninfected tissue of pathogen

inoculated plants, results from SA translocation from infected leaves to

uninfected leaves. That implies the systemic translocation of SA from the

site of infection to the other parts of the plants.

SA biosynthesis in plants is not accurately known, but there are

many proposed pathways by different workers. The pathway B proposes

that SA produced only from Benzoic acid (BA) using benzoic acid 2-

hydroxylase (BA2H) enzyme (Yalpani et al., 1993). BA may be

produced by two pathways (β oxidation and non oxidative), and SA after

that, either converted to catechol or conjugated with glucose to produce

β-O-D glucosyl salicylic acid (SAG).

In pathway A, SA produced either from BA through chain of

chemical reactions or directly from trans-cinnamic acid (t-CA) after

establishment of a middle component (2-hydroxy cinnamic acid).


The pathway C is different from the two previous pathways in:

first, proposed that SA may produced from coumaric acid, which can

convert to phenylalanine (PA) the mean component in the biosythesis

of SA; second, proposed that in mycobacteria, SA may produced from

chorismic acid. All three previous pathways share in one singe, that

SA is produced basically from Cinnamic acid, which resulting from

the amino acid PA.

Both BA and SA can be conjugated with another components;

regulation of SA levels through SA or BA conjugation may be

important (Ryals et al., 1996). Conjugation removes SA from the

active pool, once SA accumulates; it is rapidly converted to SAG

(Yalpani et al., 1993). Conversion of SAG to free SA represents

another potential mechanism for increase levels of free SA.

The principal form of conjugation is SA-glucose, though other

forms are found, including the volatile methyl-salicylate (Enydie et

al., 1992; Malamy et al., 1992 and Shulaev et al., 1997).

In contrast to methyl-salicylate, SAG forms free SA accumulate

only in and around HR lesions formed during the incompatible

interaction between plants and viruses, bacteria and fungi (Enydie et al.

1992). Yalpani et al. (1993) suppose that both BA and SA conjugated

with glucose are important to regulate SA levels in induced plants.

Murphy et al. (1999) mentioned that, resistance genes allow plants

to recognize specific pathogens. Recognition results in the activation of a

variety of defense responses, including localized programmed cell death

(the hypersensitive response), synthesis of pathogenesis-related proteins

and induction of systemic acquired resistance. These responses are co-


ordinated by a branching signal transduction pathway. In tobacco, one

branch activates virus resistance, and might require the mitochondrial

alternative oxidase to operate.

Singh et al. (2004) stated that, the plant signal molecule salicylic

acid (SA) can induce resistance to a wide range of pathogen types. In the

case of viruses, SA can stimulate the inhibition of all three main stages in

virus infection: replication, cell-to-cell movement and long-distance

movement. Induction of resistance by SA appears to depend, in part, on

downstream signaling via the mitochondrion. However, evidence has

recently emerged that SA may stimulate a separate downstream pathway,

leading to the induction of an additional mechanism of resistance based

on RNA interference. In this review our aims are to document these

recent advances and to suggest possible future avenues of research on

SA-induced resistance to viruses.

Huang et al. (2006) used the biosensor to observe apoplastic SA

accumulation in Nicotiana tabacum L. cv. Xanthi-nc leaves inoculated

with virulent and HR-eliciting strains of the bacterial plant pathogen

Pseudomonas syringae, then demonstrated that, the Actinobacter sp.

ADP1 biosensor is a useful new tool to non-destructively assay

salicylates in situ and to map their spatial distribution in plant tissues

against TMV infection.

Chaturvedi and Shah (2007) stated that, salicylic acid (SA)

plays an important role in plant defense. Its role in plant disease

resistance is well documented for dicotyledonous plants, where it is

required for basal resistance against pathogens as well as for the

inducible defense mechanism, systemic acquired resistance (SAR),


which confers resistance against a broad-spectrum of pathogens. The

activation of SAR is associated with the heightened level of

expression of the pathogenesis-related proteins, some of which

possess antimicrobial activity. Studies in the model plant Arabidopsis

thaliana have provided important insights into the mechanism of SA

signaling in plant defense.

B- Quantification of total SA:

Raskin et al. (1989) measured free endogenous SA in Alium lily

using HPLC. One gram of frozen tissue was grounded in methanol, to

prepare methanol extract and then, this extract was dried under

vacuum. After resuspention of the pellet, SA was extracted using

mixture of cyclopentane / ethylacetate / isopropanol (50:50:1). This

organic extract was dried under nitrogen and analyzed by HPLC.

Yalpani et al. (1993) measured free SA using HPLC column,

but the preparation of plant samples was different, for instance,

organic extract was also by ethylacetate / cyclopentane / isopropanol,

but in different portions (100:99:1). SA content generally was

determined by UV absorption and fluorescence after separation on a C

18 reverser-phase HPLC column to measure conjugation SA

hydrolysis with β-glucosidase enzyme (Enydie et al., 1992). Or

boiling for 30 min. in acidified phosphate buffer (Ukens et al., 1993),

must be performs.

Deng et al. (2003) found that, salicylic acid (SA) is a signaling

compound in plants such as tobacco, cucumber, and tomato which can

induce systemic acquired resistance. In the work discussed in this


paper a simple, rapid, and sensitive method was developed for

determination of salicylic acid in plant tissues by gas

chromatography–mass spectrometry (GC–MS). SA from tomato

leaves extracted with 9:1 (v/v) methanol–chloroform was derivatized

by use of bis (trimethylsilyl) trifluoroacetamide (BSTFA) under the

optimum reaction conditions (120°C, 60 min). Quantitative analysis

by GC–MS was performed in selected ion monitoring (SIM) mode

using an internal standard. Procedures for sample preparation and

reaction conditions were optimized. Analysis was completed within 2

h. A sensitivity of 10 ng g–1 fresh weight and a relative standard

deviation less than 5.0% for SA in tomato leaves were achieved. The

method could be used for investigation of SA in plant tissues to

monitor fast responses of plant defense.

Salem (2004), Megahed (2008) and Taha (2010) measured free

and endogenous of SA at once in squash, pepper and cucumber plants.

One gram of frozen tissue was grounded in methanol, to prepare

methanol extract and then, this extract was dried under vacuum. The

dried extracts were then resuspended in 3 ml of distilled water at 80°C

and an equal volume of 0.2M sodium acetate buffer, pH 4.5, containing

0.1 mg/ml β-glucosidase, SA was extracted using mixture of

cyclopentane/ ethylacetate/ isopropanol (50:50:1). This organic extract

was dried under nitrogen and analyzed by using HPLC- fluorescence.

Araf (2008) found that, bacterial effect on the level of endogenous SA in

plants after 5th and 7th days of bacterization, generally SA level in

treated plants was high compared to untreated plants in either after 5th or

7th days after bacterization which indicate to the effect of the strains in


enhancing the expression of SA genes but the level of SA was higher at

7th day than 5th which confirm that ISR reach to maximum level after

7th days of stimulation either by biotic or a biotic inducer, after 5th days

of bacterization SA was high in plants treated with Pseudomonas

fluorescence B4 while all the strains were nearly similar in its effect after

7th days of bacterization.

C. Enzyme activity:

C.1- Peroxidase (POD):

Campa (1991) found that, peroxidases have further been divided

into anionic and cationic groups according to their electrophoretic

mobility. Class III POD (EC 1.11.1.7) have been assigned a many

physiological roles in the several primary and secondary metabolic

processes like scavenging of peroxidase, participation in lignifications,

oxidation of toxic compounds, hormonal signaling, plant defense, indole

acetic acid (IAA) metabolism and ethylene biosynthesis.

Wojtaszek (1997) reported that, peroxidases play an important

role in one of the earliest observable aspects of plant defense strategy.

Chittoor et al. (1999) found that, peroxidases are a class of proteins

and therefore, may be directly associated with the increased ability of

systemically protected tissue to lignify when plants are threatened by

microorganisms or physically injured.

The treatment also elicited a systemic increase in peroxidase

activity and increase of two anionic peroxidases on isoelectric focusing

gels which were positively correlated with induced resistance.

Peroxidases are also implicated in hypersensitivity response (Bestwick et


al., 1998), lignin biosynthesis ethylene production and suberization

(Quiroga et al., 2000).

Leaf extract at four o'clock flower (Mirabilis jalapa) is one

agent induced systemic resistance against the attack of red pepper

Cucumber Mosaic Virus (CMV). This study investigated the

peroxidase activity and salicylic acid content in red pepper-induced

ketahananya against CMV by using a leaf extract of M. jalapa. Result

analysis Note that the red pepper plant induced resistance CMV

attacks by leaf extract of M. jalapa shows low intensity CMV attacks,

the low content of virus, an increase in enzyme activity peroxidase 2-

10 times, and salicylic acid content of 1.6 to 5 times compared with no

induction (control). There is a closeness of relationship high between

the intensity of CMV with peroxidase activity (r = 0.94), the

relationship between the intensity of the attacks being CMV with the

content salicylic acid (r = 0.46), low closeness of the relationship

between content of virus with CMV disease intensity (r = 0.32),

salicylic acid with activity peroxidase (r = 0.39), and there is no

closeness between the concentration of virus with salicylic acid

content (r = 0.05) and viral content with activity peroxidase (r = 0.12)

(Hersanti, 2005).

C.2- Polyphenol oxidase (PPO):

Polyphenol oxidases (PPO, EC 1.14.18.1) are involved in the

oxidation of polyphenols into quinones (antimicrobial compounds)

and lignification of plant cells during the microbial invasion. Phenol

oxidases generally catalyze the oxidation of phenolic compounds to


quinones using molecular oxygen as an electron acceptor (Sommer et

al., 1994). The role of PPO in plants is not yet clear, but it has been

proposed that it may be involved in necrosis development around

damaged leaf surfaces and in defense mechanisms against insects and

plant pathogen attack. Phenolic compounds may function by inhibting

bacterial growth or serve as precursors in the formation of physical

polyphenolic barriers, limiting pathogen tanslocation. PPO-generated

quinones modify plant proteins, decreasing the plants nutritive

availability to herbivores or invaders. Polymeric polyphenols seem to

be more toxic to potential phytopathogens than are the phenolic

monomers (Aydemir, 2004).

D- Determination of total amino acids:

Eisa et al. (2006) stated that the soluble protein content in the

5th leaf of the squash plants was responded differently against the

tested treatments. Ascorbic acid "AsA", CoCl2, KH2PO4, SA, MnSO4

and CaCl2 significantly increased the protein content by more than

18.9, 11.6, 10.5, 8.5, 7.9, and 3.0 fold over control treatment. While

Penconazole, OA and BA did not affect the protein content

significantly if compared with the control treatment. The highest

increase in the protein content was associated, in general, with the

middle concentration. As for interaction, AsA induced the highest

increase of soluble protein at 10mM, followed by CuSO4 at 10mM,

CuSO4 at 20mM, CuSO4 at 5mM, CoCl2 at 10mM arid CoCl2 at 20

mM, respectively. On the contrary, BA and OA (at 5, 10 and 20mM),


CaCl2 and CoCl2 (at 5mM) and Penconazole (at 25 ppm) did not affect

the total soluble protein content when compared with control.

E- Determination of carbohydrates:

Zahra (1990) found that, reducing, non-reducing and total

sugars were higher in diseased roots of highest and lowest susceptible

sesame cultivars than in healthy ones. Healthy roots of highest

susceptible cultivar had more reducing and total sugars than in the

lowest susceptible. While, non-reducing sugars content was more in

healthy roots of the lowest susceptible cultivar than the highest

susceptible one.

F- Determination of total phenols

Abd El-Kader (1983) reported that healthy and diseased roots

of resistant soybean cultivars contained more phenolic compounds

than in susceptible cultivar. Infection with Rhizoctonia solani, S.

rolfsii and F. oxysporum increased the phenolic contents of the roots

of both cultivars. The amount of increase was greater in the roots of

resistant cultivars than the susceptible ones.

Pathak et al. (1998) determined the amount of total phenols in

charcoal rot (Macrophomina phaseolina) resistant and susceptible

cultivars of sunflower. They found that amount of total phenols was

the maximum in the immune cultivar and the minimum in the highly

susceptible cultivar.

Kalim et al. (1999) controlled root-rot of cowpea caused by R.

solani and M. phaseolina. Reduction in disease incidence was attributed


to the increased enzymes activity and with higher amounts of total

phenols. Infection also caused an increase in the content of total phenols,

reducing sugar but decrease in O-dihydric phenols, flavanols, total

soluble sugars, non reducing sugars. Several investigators pointed out of

phenolic compounds than the susceptible ones.

Meena et al. (2001) investigated the effect of salicylic acid (SA)

on the induction of resistance in groundnut against late leaf spot. In

salicylic acid (SA) treated leaves, an increase in phenolic content was

observed one day after challenge inoculation with Cercospora

personatum.

Ahmad (2004) revealed that the free, conjugated and total

phenols were affected significantly by the tested treatments. All tested

treatments increased the free phenol. The highest increase in the free

phenols was induced by Topas-00 followed by K2HPO4. As for the

total phenols, all tested treatments increased the total phenols. The

highest increase in the total phenols was induced by Topas-100

followed by K2HPO4. The conjugated phenols increased by Topas-100

over control.

Sudhakar et al. (2007) indicated that, studies were undertaken

to evaluate ozone (O3) for induction of resistance against Cucumber

mosaic virus in Lycopersicon esculentum cv. PKM1 (tomato) plants.

Callus induced from tomato leaf explants on Murashige & Skoog's

(MS) medium supplemented with benzyladenine (8.82 µM) were

treated with different concentrations of ozone T(1), T(2), T(3) and for

control (C), filtered air was supplied. Regeneration of shoots was

obtained by culturing ozone treated calli on MS medium containing


17.3 µM benzyladenine. The plants regenerated from ozone treated

callus are referred to as T(1), T(2) and T(3) plants, which hold

remarkably increased soluble phenolic content compared to the

control plants.

Kavino et al. (2008) found that, Pseudomonas fluorescens strains

CHA0 and Pf1 were investigated for their biocontrol efficacy against

Banana bunchy top virus (BBTV) in banana (Musa spp.) alone and in

combination with chitin under glasshouse and field conditions.

Bioformulation of P. fluorescens strain CHA0 with chitin was effective

in reducing the banana bunchy top disease (BBTD) incidence in banana

under glasshouse and field conditions. In addition to disease control,

increased accumulation of oxidative enzymes, peroxidase (PO),

polyphenol oxidase (PPO), phenylalanine ammonia lyase (PAL),

pathogenesis-related (PR) proteins, chitinase, β-1,3-glucanase and

phenolics were observed in CHA0 bioformulation amended with chitin-

treated plants challenged with BBTV under glasshouse conditions.

G- Chlorophyll contents:

Investigation with several host-virus combinations had shown

a reduction in photosynthesis in infected leaves (Bollard and

Mathews, 1966).

Omar et al. (1986) found that Soy bean mosaic virus (SBMV),

Bean common mosaic virus (BCMV) and Lettuce mosaic virus (LMV)

caused a significant reduction in chlorophyll a, b and carotenoid

content in soy bean and lettuce leaves respectively. Brakk et al.

(1986) also found that chlorophyll content of barley plants reduced


due to infection with Barley stripe mosaic virus. Galal (1989) found a

reduction in the total chlorophyll of Cucurbita pepo plants infected

with Cucumber mosaic virus (CMV). Hudgson et al. (1989) found

that TMV-infected spinach leaves showed inhibition of photosynthetic

electron transport through photosystem II. They proposed that the

inhibition of photosynthesis results from the association of viral coat

protein with the PS II complex. In this respect Montalbin and

Lupatill (1989) found that chloroplasts isolated from tobacco leaves

inoculated with TMV from exhibited a strong inhibition of electron

transport by 60- 70%. Also ribulose 1, 5 diphosphate carboxylase was

decreased by 30-40%. Rajeswari and Rajamannar (1991) found

that, Betelvine mosaic virus induced biochemical changes in leaves of

piper betle plants resulting in reduction of 56, 66 and 69% in

chlorophyll a, b and total chlorophyll, respectively.

Chakraboty et al. (1994) reported that, the amounts of chlorophyll

were lower in the leaves of cucumber, pumpkin, sponge ground snake

gourd and bottle gourd, after infection with viruses causing mosaic in

these plants. Nassar (1998) found that by using electron microscope that

TMV-infection of tomato leaves appeared chloroplast with cup shape and

contained large vesicles and reduction in grana stack height if compared

with healthy tomato leaf cells, he also noticed a reduction in chlorophyll

a, b and total pigments. Hou et al. (1998) found that quantitative changes

of chlorophyll and the characteristics of fluorescence spectra of tobacco

leaves infected by TMV had their quantity of chlorophyll decreased.

They also added that, extracts of 8 species of plants, extracts of

Lithospermum erythrhizon and Rosa chinensis were effective in


inhibiting TMV multiplication and protecting the chloroplast from TMV

infection which resulted in an increase in chlorophyll content and

photosynthesis.

H- Molecular genetics response to SAR as pathogenesis related

proteins:

Increase in resistance was correlated with the accumulation of

pathogenesis-related (PR) proteins, generally assumed to be markers

of the defense response (Ward et al., 1991). Various novel proteins

are induced which are collectively referred to as "pathogenesis-related

proteins (PRs). These PRs defined as proteins coded by the host plant

but induced specifically in pathological or related situations (Antoniw

and Pierpoint, 1978 & Van Loon et al., 1994) do not only

accumulate locally in the infected leaf. But are also, induced

systemically, associated with the development of systemic acquired

resistance (SAR) against further infection by fungi, bacteria and

viruses. Induction of PRs had been found in many plant species

belonging to various families (Van Loon, 1999). The induction of PR-

proteins in various plant tissues is one of the major biochemical and

molecular events when plant are subjected to infections with

pathogens such as viroids, viruses, bacteria and fungi (Van Loon,

1997). White and Antoniw (1991) suggest that, induced resistance to

viruses based on formation of PR- protein. The relation between PR-

proteins and resistance to viruses had been confirmed by studying the

interspecific hybrid N. glutinosa x N. debnevi, which contain PR-

proteins and is highly resistant to TMV.


PR proteins are classified into 14 distinct families and include

both basic and acidic isoforms (Van Loon and Van Strien, 1999).

PR-proteins constitute a heterogenous group of proteins whose

expression has served as a reliable marker for induction of SAR. In

tobacco, seven families of PR-proteins are known. Although

enzymatic activities could be assigned to some proteins. Their

functions during the defense response have remained obscure. In

addition to their emergence after pathogen infection. Subsets of PR-

protein are also expressed in substantial amounts in healthy plants.

The tobacco acidic PR-protein of group 1 (PR.1) for example,

accumulate in plants upon transition to flowering (Fraser, 1981).

Grüner and Pfitzner (1994) suggesting that, they play role in defense

reactions against pathogens as well as during plant development. Araf

(2008) reported that, PR-1a mRNA accumulation was examined in a

time course experiments during the early stage of root colonization,

the expression pattern was investigated by using RT-PCR approach

this method which is more sensitive. Allowed the examination of the

expression of PR-1a gene through the use specific primers, mRNAs

for this gene began to accumulate after 1 day of treatment and reached

to high levels at 6th day. This expressed in untreated and treated plants

but increased about two fold in treated plants.

Materials and Methods - 44 -

MATERIALS AND METHODS

This study was conducted at Plant Pathology Lab. and

Greenhouses of Botany Dept., Fac. of Agric., Moshtohor, Banha Univ.

and Virology Lab., Microbiology Dept., Fac. of Agric., Ain-Shams

Univ. During 2007/08 and 2008/09 growing seasons, some tomato

fields at Qalyoubia Governorate were surveyed for viral infections.

Through the assessment of disease incidence and severity, Cucumber

mosaic cucumovirus (CMV) was the dominant one among the tomato

viruses in the surveyed fields. Identification of isolated virus (CMV)

was achieved using host range, transmission, stability in sap, inclusion

bodies and confirmed via Dot blot immunoassay (DBIA). Obtained

results dealing CMV confirmation was completely agreement with the

previous confidential recording. Therefore, many experiments were

successively to deducing if induction of systemic acquired resistance

against CMV was successfully achieved under greenhouse and open

field of tomatoes using four biotic inducers or not.

Part I

1- Disease incidence and frequency of virus(es):

Three hundred and fifty samples of infected tomato plants

showing distinct viral symptoms in the form of mosaic, mottling,

blisters, crinkle, yellowing, malformation and erecting (Plate, 1) were

collected from 5 locations of Qalyoubia Governorate (Banha, Toukh,

Qaha, Shebien El-Qanater and El-Qanater El-Khayria). The symptoms

were recorded using the following rating scale: 0 = No symptoms, 1 =


Vein clearing and mild mosaic, 2 = Severe mosaic, 3 = Crinkle, 4 =

Epinasty and Deformation, 5 = Erect, 6 = Rosette, 7 = Stunting and

leaf narrow and 8 = Leaves showing Vein necrosis. Disease incidence

and severity were calculated using the following formulas according to

Yang et al. (1996):

Σ (disease grade × number of plants in each grade)x 100 Disease severity (DS%) =

Total number of plants × highest disease grade

Plate (1): Different types of natural infection symptoms on tomato

leaves showing mosaic, mottling, blisters, crinkle,

yellowing, malformation and erecting.

Number of infected plants per location × 100 Disease incidence (%) =

Total number of plants/location


The samples were examined serologically by Double Antibody

Sandwich-enzyme Linked Immunosorbent Assay (DAS-ELISA) using

antisera specific to 5 viruses include: Cucumber mosaic virus (CMV),

Tomato mosaic virus (ToMV), Tomato yellow leaf curl virus

(TYLCV) , Potato Y virus (PVY) and Potato X virus (PVX) according

to Clark and Adams (1977) as follow: 200µL of prepared

immunoglobulin G (IgG) against CMV at concentration 1µ g/ml were

diluted in coating buffer, pH 9.6 and incubated in the microtitre plate

at 4°C overnight. The wells were washed three times with washing

buffer, pH 7.4 [phosphate buffer saline (PBS) (0.15 M NaCl)

containing 0.1% Tween-20 and 0.01 sodium azide]. 200µL of each

sample were diluted 1:20 (W/V) in extraction buffer (0.01 M PBS, pH

7.4 containing 0.05% Tween-20, 2% polyvinylpyrrolidine, M.Wt.

40.000) and then incubated at 4°C overnight. The plate was washed

three times with washing buffer. 200 µL of IgG alkaline phosphatase

conjugate diluted at 1/100 in conjugate buffer, pH 7.0 [PBS, 1%

bovine serum albumin (BSA), 0.25% Tween-20] was added to each

well and incubated for 3 hr at 37°C. The conjugate was removed and

the plate washed three times with washing buffer. 200 µL of freshly

prepared substrate (ρ-nitro phenyl phosphate) in substrate buffer (10%

diethanol amine, NaN3 0.01%) at concentration 0.75 mg/ml was added

to each well. The reaction was read spectrophotometrically at wave

length 405 nm after incubation at 37°C for 30-60 min. using ELISA

reader (Labsystems Multiskan MS), after the reaction stopped by

adding 50 µL of 3 M NaOH.


2- Isolation, propagation and identification of an isolated virus:

2.1- Mechanical transmission:

For transmission and host range studies, mechanical inoculations

were carried out by extracting tomato, cucumber or Nicotiana tissues

infected with CMV in 0.1 M phosphate buffer, pH 7.0 containing 1.0%

sodium sulphite (1:2w/v). The infectious sap was applied to healthy

tested plants in addition to tomato. Leaves of the inoculated plants were

previously dusted with 400 mesh carborandum. For control treatment

carborundum dusted leaves were inoculated with phosphate buffer alone.

Inoculated plants were maintained in the greenhouse at 25-30ºC and

inspected daily for symptom development. The inoculated plants were

serologically tested using CMV antiserum (Dheepa and Paranjothi,

2010).

2.2- Host range:

Fourteen plant species belonging to 4 families (Chenopodiaceae,

Cucurbitaceae, Leguminoseae, and Solanaceae), Table (6) were

mechanically inoculated with virus isolate using five plants of each host.

Control plants were inoculated with buffer only. The inoculated plants

were kept under an insect proof in greenhouse conditions and observed

daily for symptoms development. The results were confirmed by Dot blot

immunoassay (DBIA) using specific CMV polyclonal antibodies.

2.3- Aphid transmission:

Pure identified aphids colonies belong to order. Hemiptera; family,

Aphididae; include: Aphis craccivora and Myzus persicae which were

kindly provided by Economic Entomology Branch, Plant Protection


Dept., Fac. of Agric., Moshtohor, Banha Univ. Individual colony of each

was kept in the insect proof and reared on healthy cabbage seedlings

(Brassica oleracea L. subsp. oleracea) until fourth instar nymph has

appeared.

Separately homologous colony of apterus adults of both aphids

were collected to evaluate as the isolated virus vectors. Twenty-five of

both aphids were starved for 2 hours on filter paper (inside Petri-

dishes), allowed to acquisition feeding for 2 min on CMV infected

cucumber, then transferred to 5 healthy tomato seedlings (five aphids

per seedling) for inoculation, feeding period of 24 hours.

For the control, the same procedure was used, but virus-free

aphids where feeding for acquisition on healthy tomato plants. The

inoculated seedlings were then sprayed with the insecticide Malathion

(0.1%). Symptoms and transmission percentage were recorded at 4

weeks after inoculation.

2.4- In vitro properties:

Stability of CMV isolate, [Thermal inactivation point (TIP),

Dilution end point (DEP) and Longevity in vitro (LIV)] were

performed according to Noordam (1973), using C. amaranticolor as

local lesion host to CMV. The fresh infectious crude sap as well as

healthy sap one (control) was used to inoculate 5 plants of C.

amaranticolor. The inoculated plants were kept under the green house

conditions and the numbers of local lesions were recorded.

CMV crude sap from infected N. glutinosa leaves was diluted by

0.1 M phosphate buffer, pH 7.2 at the rate of 1:1 (v/v), and then

distributed as 0.5 ml in eppendorf tubes. The infected sap was heated


for 10 min in controlled water bath at various temperatures (45-75°C

intervals 5°C). The eppendorfs were immediately cooled by dipping in

tap water. Unheated infectious sap was used as a control.

Fresh infectious sap was diluted with distitelled water to prepare

a dilution series from 10-1 to 10-7. Undiluted infectious sap was used

as a control.

The infectious sap was placed in sterilized eppendorf at the rate

0.5 ml/eppendorf and kept at room temperature (25±2°C). The CMV

infectious sap was assayed daily for longevity up to 10 days.

2.5- Inclusion bodies

Crystalline inclusion bodies (CIB) were examined in the

epidermal strips from the lower surface leaves of cucumber plant

inoculated mechanically with CMV isolate (15 days after inoculation).

The strips were removed using forceps, then mounted in a drop of

distilled water on clean glass slide and covered with glass cover, then

examined under light microscope, magnification of 400-X.

The amorphous inclusion bodies (AIB) were examined in the

epidermal strips obtained from leaves of cucumber plant inoculated with

CMV isolate (15 days after inoculation). The strips treated first with 5%

solution of Triton X-100 for 10 min. The strips were immersed in a stain

solution containing 100 mg bromophenol blue and 10 mg mercuric

chloride dissolved in 100 ml distilled water for 15 min. the stained strips

were transferred to 0.5% acetic acid for 15 min and then washed in tap

water for 15 min. Finally, the strips were examined by light microscope,

magnification of 400-X. according to Mazia et al. (1953).


2.6- Serological confirmation

Dot blots immunoassay (DBIA):

Dot blot immunoassay was used for identification of CMV isolate

as described by Lin et al. (1990) as follows: Nitrocellulose membranes,

0.45µM pore size, were marked with a lead pencil into squares of 1 x 1

cm. Healthy and infected samples were ground in phosphate buffer, pH

9.5 (1:10, w/v). Five µl clarified in each square for each of healthy and

virus infected samples were spotted. The membrane was washed three

times with PBS-Tween [phosphate buffer saline (0.15 M NaCl)] at 5 min

interval. Then placed in the blocking solution [1% bovine serum albumin

(BSA) + 2% nonfat dried milk in PBS-Tween] and incubated for 1hr at

room temperature. The membrane was washed three times with PBS-

Tween at 5 min interval. The treated membrane was placed in the virus

specific antiserum diluted in PBS 1:500 and then incubated for 1 hr at

room temperature with gently shacking. The membrane was washed

three times with PBS-Tween at 5 min interval. The goat anti rabbit

immunoglobuline-alkaline phosphate conjugate (Sigma A 4503) dilution

1: 1000 in conjugate buffer (PBST + 2% PVP + 0.2 % Ovalbumin) was

added to the membrane and incubated for 1 hr at room temperature. The

membrane was washed three times with PBS-Tween at 5 min interval.

The substrate solution (Nitro Blue Tetrazolium and 5-bromo 4-chloro 3-

indolyl phosphate) was added and incubated for 5 min at room

temperature. After the color appeared, the membrane was rinsed quickly

with H2O then air-dried.


Part II

Induction of systemic acquired resistance

1- Source and preparation of biotic inducers:

Fresh shoots of 2 medicinal plant [belonging 2 families] were

collected from the botanical garden of Fac. Agric., Banha Univ., and

kombucha (kindly provided by Dr. Mohamad A. Hafez) from Plant

Pathology Lab., Fac. Agric., Moshtohor, Banha Univ. were chosen

depending on previous information’s dealing their systemic resistance

inducers as producers for ribosomal inhibitor proteins (RIPs) such as:

Clerodendrum inerme L. Gaertn (Kumar et al., 1997), Mirabilis

jalapa L. (Leal et al., 2001) and kombucha (Dipti et al., 2003).

Stock aqueous crude extraction for each individual tested plant

was made by blending 1 kg leaves tissue in 1 liter heated distilled

water (65°C), and then filtered through 8 layers of sterilized muslin

cloth. The filtrate was collected and stored in the refrigerator until use.

Stock aqueous crude extract from kombucha was prepared by

fermenting sweetened green tea (100 g sucrose, 10 g Chinese green

tea per liter of water) preparations with a symbiotic colony of yeasts

and bacteria (starter). After 12 days from incubation at 28°C, mother

culture was omitted and extract was kept to self-refermentation for

additional 21 days, extract was collected, centrifuged for 10 min. at

1000 rpm to separate any debris, then sterilized using sintered glass (G6)

funnel (Betsy and Sonford, 1996). Crude kombucha filtrate was used

either as it is (100%) or diluted to 50% with distilled water.


2- Experimental procedures of SAR against viruses:

The sterilized seeds of Lycopersicon esculentum cv.

Supermarmand VFN (Egyptian Company for Seeds, Oils and

Chemicals, 2008) were sowed in clay soil at nursery. After one month,

the seedlings were transplanted in clay pots (Ø 25 cm) with 5

seedlings/pot. The pots were divided into two experiments. The first

experiment was to determine systemic acquired resistances applied to

tomato seedlings at the fourth leaves stage were sprayed (30 ml per

plant) by the potential inducers at wet film according Vivanco et al.

(1999). Five pots for each of 4 biotic inducer [Mirabilis jalapa,

Clerodendrum inerme, mixture of (Mirabilis and Clerodendrum) and

kombucha] as well as control plants which sprayed with water,

treatments were as follows:

1- Tomato plants sprayed with Mirabilis jalapa extract (Mj).

2- Tomato plants sprayed with Clerodendrum inerme extract (Ci).

3- Tomato plants sprayed with mixture of Mirabilis and Clerodendrum extracts (1:1, v: v); (Mj+Ci).

4- Tomato plants sprayed with kombucha (K).

5- Healthy tomato plants non-inoculated with CMV isolate (healthy control); (H).

6- Tomato plants inoculated with CMV isolate (infected control); (V).

Seven days after spraying tomato plants, samples from each

previous treatment (for detection acquired resistance), were taken and

other plants were rub-inoculated with CMV inoculum (CMV


infectious sap 10-1 diluted in phosphate buffer 0.1 M and pH 0.7) by

spatula to all treatments. Healthy control plants were inoculated with

sterile extraction buffer (PPB) and infected control plants were

inoculated with CMV. After 25 days from CMV inoculation, other

samples of tomato plants were taken.

The second experiment (biocontrol) of tomato plants was carried

out by rub-inoculating with CMV inoculum then sprayed by biotic

inducers after 15 days of virus inoculation with the same treatments in

first experiment. Then samples (for determination of biocontrol) were

taken from each treatment after 7 and 25 days of spraying inducers.

The tomato plants were immediately rinsed with water and kept

under greenhouse conditions and observed daily until symptoms

appeared after 25 days. Chenopodium amaranticolor plants were used

for qualitative and quantitative assaying.

3- Parameter and methods of SAR detection and biocontrol:

3-1. Biological detection:

3.1.1. Percentage of virus infection:

The percentage of virus infection was determined and calculated

relative to infected control, 25 days from inoculation with CMV.

3.1.2. Reduction of virus infection (RI):

The reduction of virus infection was calculated to all treatments

as follows:

Control - treated x 100 Reduction of Infection (RI%)=

Control


3.1.3. Disease severity:

All tomato plants in each treatment were examined weekly for

virus symptoms, after 25 days from CMV inoculation. The disease

severity was assessed as mentioned before.

3.1.4. Anatomical studies

It was intended to carry out a comparative anatomical study on

leaves of treated plants and those of the control at 22 days (pre-

inoculated and sprayed with inducers) and 40 days (post-inoculated

and sprayed with inducers) after transplanting. Groups of each

treatment were sprayed with distilled water served as control.

Small pieces were taken from the midrib region of the 4th upper

apical leaf on the main stem, then killed and fixed in FAA (10 ml

formalin, 5 ml glacial acetic acid and 85 ml ethyl alcohol 70%),

washed in 50% ethyl alcohol, dehydrated in a series of ethyl alcohols

(70, 90, 95 and 100%), infiltrated in xylene embedded in paraffin wax

with a melting point 60-63°C. Sections were made at 15-17 µm thick

using rotary microtome, mounted on glass slides and stained with

aqueous Safranin O (1%) and Fast Green (0.1% in 95% ethanol), as

described by Ruzin (1999). Four sections treatment were

microscopically inspected to detect histological manifestations of

noticeable responses resulted from treatments. Counts and

measurements (µ) were taken using a micrometer eye piece. Averages

of readings from 4 slides/treatment were calculated. Number of

epidermal hairs was count in 720 µ in middle of the epidermis.

Sections were examined with SEIWA OPTICAL light

microscope (using a 10x lens) and photographed by Genius P931

digital camera using Image Manager 50 program. Various

measurements were performed on microscopic images.


3-2. Biochemical analyses:

A- Quantification of total salicylic acid (SA):

Free and endogenous of SA were measured at once in the

treatments by a method according to Raskin et al. (1989), with one

modification by Salem (2004). One gram of frozen tissue was ground

in 3 ml of 90% methanol and centrifuged at 6000 rpm for 15 min. The

pellet was back extracted with 3 ml of 99.5% methanol and

centrifuged as above. Methanol extracts were combined and then

centrifuged at 1500 to 2000 rpm for 10 min. the supernatant was dried

at 40°C under vacuum using rotary evaporator (Heidolph.). The dried

extracts were then resuspended in 3 ml of distilled water at 80°C and

an equal volume of 0.2 M sodium acetate buffer, pH 4.5, containing

0.1 mg/ml β-glucosidase (22 unit/mg, Sigma) was added, and then the

mixtures were incubated at 37°C overnight. After digestion, mixtures

were acidified to pH 1 to 1.5 with HCl. SA was extracted by adding

(1:2, v: v) of sample: cyclopentan/ethylacetate/isopropanol (50:50:1).

The organic extract was dried under nitrogen and analyzed by

HPLC [SHIMADZO RF-10 AXL Fluorescence, HPLC Lab., National

Research Center (NRC)]. One hundred microliters of each sample

were injected into Dynamax 60A8 µm guard column (46mm x 1.5cm)

linked to 40°C.

SA was separated with 23% v/v methanol in 20 mM sodium

acetate buffer, pH 5.0 at a flow rate of 1.5 ml min-1. SA level was

determined using standard curve.


B- Detection of antiviral proteins

B.1- Extraction of total proteins:

Tomato leaves were collected from plants treated with biotic

inducers pre and post CMV inoculation. Proteins were extracted

according to Lanna et al. (1996). One gram fresh weight was ground

in a mortar and pestle containing liquid nitrogen. The resulting

powder was macerated for 30 sec in 3 ml extraction buffer [50 mM

sodium phosphate buffer, pH 6.5, 1mM phenylmethylsulfonyl

(PMSF)], then centrifuged at 20.000 rpm for 25 min. at 4°C. The

supernatant was divided and kept in ice for the following

determination.

B.1.1- Determination of protein content:

Principle:

The protein determination is based on the observation that

coomassie brilliant blue G-250 exists in two different colour forms,

red and blue. The red form is converted to the blue form upon binding

of the dye to protein. The protein-dye complex has a high extinction

coefficient thus leading to great sensitivity in measurement of the

protein. The binding of the dye to protein causes a shift in the

absorption maximum of the dye form 465 to 595 nm and the increase

in the absorption at 595 nm in monitored. It is very rapid process

(approximately 2 min), and the protein-dye complex remain dispersed

in solution for a relatively long time (approximately 1 hr), (Bradford,

1976).


Preparation of the protein assay reagent:

One hundred mg of coomassie brilliant blue (CBB) G-250 were

dissolved in 50 ml of 95% ethanol. One hundred ml of 85% (w/v)

orthophosphoric acid was added and the final volume was adjusted to

1 L. The dye solution was filtered and kept for 2 weeks in dark at

20°C before use.

Procedure:

Five hundred µl of protein assay reagent added to 500 µl of

distilled water containing the protein sample. After mixing, the

absorbance was recorded at 595 nm within one hr against a blank control

in 1 cm light path cuvette using Shimadzu UV-2401 PC UV-Vis

recording spectrophotometer (Molecular Biology Lab. NRC). A standard

curve was constructed by using BSA as standard protein (Fig. 2).

0

2

4

6

8

10

12

0 5 10 15Protein concentration (µg/ml)

Abs

orba

nce

at 5

95 n

m

Fig. (2): Standard curve of the protein concentration using bovine

serum albumin as a standard protein.


B.1.2- Qualitative assaying of protein:

1- Sodium dodecyl sulfate poly acrylamide gel electrophoresis

(SDS-PAGE):

Principle:

The strongly an ionic detergent SDS is used in combination with

a reducing agent (sulfhydryl compound) and heat to dissociate the

proteins before they are loaded on the gel. The denatured polypeptides

bind SDS become negatively charged. Since the amount of SDS

bound is almost always proportional to the molecular weight of the

polypeptide and is independent of its sequence, SDS-polypeptide

complexes migrate through poly acrylamide gels in accordance with

the size of the polypeptide. At saturation, approximately 1.4 g of SDS

is bound per 1g of polypeptide (Laemmli, 1970).

Procedure:

1) Gel casting:

Twelve percent acrylamide solution was made up for separating

gel as shown in Table (1) and casted in two vertical slabs (9x10x0.1

cm in size). The solution was carefully overlaid with isobutanol

saturated with water to avoid inhibition of polymerization by oxygen

diffusion and to perform a flat surface. After the polymerization of the

separating gel, the saturated isobutanol was substituted with the

stacking gel (5%) (Table 1), then the appropriate comb was inserted

and the gel was left to be polymerized.


2) Sample Preparation:

The protein samples were denatured by heating them at 95°C for

5 min with an equal volume of the sample buffer to dissociate the

proteins to theirs subunits.

3) Electrophoresis:

After mounting the gel in the electrophoresis apparatus, the

reservoir buffer was added to the top and bottom of the gel and the

samples were loaded into the gel wells submarine. Electrophoresis

was performed at 150 volt per two gels till the marker dye

bromophenol blue (BPB) reach the end of the gels.

4) Staining and destaining:

The gels were stained for 2 hrs in 0.1% (w/v) coomassie brilliant

blue R-250 in 40% methanol and 10% glacial acetic acid solution. The

destaining was carried out by several washes in the same solution

lacking dye.

Table (1): Preparation of SDS-PAGE gels.

Stock solution Separating gel 12% Stacking gel 5%

30% acrylamide 6.0 ml (12%) 1.66 ml (5%)

2% bisacrylamide 2.4 ml (0.32%) 0.65 ml (0.13%)

2.25 M Tris-HCl, pH 8.9 2.5 ml (0.375M) ………………….. 1M Tris-HCl, pH 6.8 ………………… 1.25 ml (0.125M)

H2O 3.97 ml 6.335 ml

20% SDS 0.075 ml (0.1%) 0.05 ml (0.1%)

10% APS 0.05 ml (0.033%) 0.05 ml (0.05%)

TEMED 0.005 ml 0.005 ml

Total volume 15.0 ml 10.0 ml


2- Native polyacrylamide gel electrophoresis (PAGE):

Native polyacrylamide gel electrophoresis was used for isozyme

determination.

Principle:

Polyacrylamide gels are composed of chains of polymerized

acrylamide that are cross-linked by a bifunctional agents such as N,Ń-

methylene bisacrylamide.

The native gel electrophoresis separates proteins based on their

size and charge properties. While the acrylamide pore size serves to

sieve molecules of different sizes, proteins which are more highly

charged at the pH of the separating gel have a greater mobility

(Smith, 1969).

Procedure:

1- Gel casting:

Twenty ml of 7% polyacrylamide gel was prepared by mixing

two volumes of acrylamide monomer solution, one volume of gel

buffer solution, one volume distilled water and four volumes of

freshly prepared ammonium persulfate solution, deaerated rapidly and

casted in two vertical slabs (10×10×0.1 cm in size). The appropriate

comb was inserted and the gel was left to be polymerized.

2- Sample preparation:

The samples were prepared by mixing each sample with an

equal volume of the sample buffer.


3- Electrophoresis:

After mounting the gel in the electrophoresis apparatus, the

reservoir buffer was added to the top and bottom of the gel and the

sample were loaded into the gel wells submarine. Electrophoresis was

performed at 150 volt per two gels till the marker dye BPB reach the end

of the gels. The gels were analyzed using Alpha EaseFC 4.0 software.

C- Determination of Peroxidase (POD):

A- Activity:

Peroxidase activity is routinely assayed by measuring the oxidation

in the presence of hydrogen peroxide and the enzyme every 30 sec

intervals using UV- 2401 PC UV- Vis recording spectrophotometer

(Central lab., fac. of Agri., Banha Univ.) in a 4 ml light path cuvettes.

The reaction mixture (unless other wise stated) contained in a volume of

3 ml : 8 µmoles hydrogen peroxidase, 60 µmoles guaiacol, 60 µmoles

sodium acetate buffer. pH 5.6 and peroxidase at concentrations which

gave a linear response over a period of 3 min. The reaction is initiated by

introducing the enzyme and mixing, a unit of peroxidase activity is

defined as that amount of enzyme which cause one optical density (OD)

change per minute (Ghazi, 1976).

B- Peroxidase activity staining:

Peroxidase activity staining was performed in 7% native

polyacrylamide gel electrophoresis by the method of Ataya (1995).

The gel was immersed in freshly prepared solution contained 266 µ

moles hydrogen peroxide and 2000 µ moles guaiacol in 100 ml of

0.05 M sodium acetate buffer, pH 5.6. The enzymatic reaction was


blocked after appearance of the isozyme bands by 7% acetic acid. The

gel was photographed and then analyzed by gel documentation

software (Alpha Ease FC 4.0 software).

D- Determination of polyphenol oxidase (PPO):

A- Activity:

Polyphenol oxidase activity was determined by measuring the

initial rate of quinine formation, as indicated by an increase in

absorbance at 420 nm, (Coseteng and Lee, 1978) using - 2401 PC

UV- Vis recording spectrophotometer (Central Lab., Fac. of Agri.,

Banha Univ.). One unite of enzyme activity was defined as the

amount of enzyme that caused a change in absorbance of 0.001/min,

PPO activity was assayed in triplicate measurements. The sample

cuvette contained 2.95 ml of 20 nM catechol solution in 0.1 M

phosphate buffer. pH 6.0 and 0.05 ml of the enzyme solution. The

blank sample contained only 3 ml of substrate solution.

B- Polyphenol oxidase activity staining:

The Polyphenol oxidase activity staining was performed

according the method by Aydemir (2004) in 7% native

polyacryamide gel electrophoresis for separating PPO isozymes. The

gel was stained for PPO activity by 2.5 mM (L-dihydroxy

phenylalanine) L-dopa in phosphate buffer pH 8.0. After 1 h of

incubation of the gels, isozyme bands were developed. The gels were

shaken in 1 mM ascorbic acid solution for 5 min and stored in 30%

ethanol and then their photographs were taken and analyzed by gel

documentation software (Alpha Ease FC 4.0 software).


E- Determination of photosynthetic pigments:

Chlorophyll a, b and carotenoids were extracted and estimated

according to Wettstein (1957). As the following procedure: Fresh leaf

samples (0.5g) were homogenized in a mortar with 85% acetone in the

presence of washed dried sand and a little amount of CaCO3 (0.1g) in

order to neutralize organic acids in the homogenate of the fresh leaf.

The homogenate was then filtered through sintered glass funnel. The

residue was washed several times with acetone until the filtrate

became colorless. The optical density of this extract was determined

using a spectrophotometer at 662, 644 nm for Chl. a and b

respectively and 440 nm for carotenoids.

Calculation:

Chlorophyll a = 9.784 × E 662 - 0.99 × E 644 mg/L.

Chlorophyll b = 21.426 × E 664 – 4.65 × E 644 mg/L.

Carotenoid = 4.965 × E 440 – 0.268 × c (a+b) mg/L.

Where: c (a+b) is the sum. of chlorophyll a and b concentration in

mg/L. The results were calculated as mg/g fresh weight.

F- Determination of total phenols:

Five grams of the leaf samples were immediately placed in 50

ml of 95% ethanol in brown bottles and kept in darkness at room

temperature for one month then homogenized in sterile mortar. The

resultant homogenate was filtered through filter paper. The residue

was thoroughly washed with 80% ethanol. The ethanolic extracts were

dried at room temperature until near dryness and then were

quantitatively transferred to 10 ml with 50% isopropanol and stored in


vials at 5°C. The obtained ethanolic extracts were used for phenol

determination.

Phenolic compounds were determined using colorimetric method

described by Snell and Snell (1953). The free phenols were determined

by adding 1.0 ml of Folin reagent and 3.0 ml of sodium carbonate

solution (20%) to 0.025 ml of isopropanol sample. The mixture was

diluted to 10 ml with warm distilled water 30-35°C. The mixture was let

to stand for 20 minutes and then was read at 520 nm using

spectrophotometer model (Beckman-Du 7400). However, the total

phenols (free and conjugate) were determined by adding ten drops of

concentrated hydrochloric acid to 0.025 isopropanol sample, heated

rapidly to boiling over a free flame, with provision for condensation, and

then placed in a boiling water bath for 10 min. after cooling 1.0 ml of

Folin reagent was added and also, 2.5 ml of sodium carbonate (20%).

The mixture was diluted to 10 ml with distilled water, after 20 minutes

was determined at 520 nm on the same former apparatus. The conjugate

phenols were determined subtracting the free phenols from total phenols.

The phenolic contents were calculated as milligrams of catichol (from

standard curve) per one gram fresh weight.

G- Determination of total amino acids:

Total free amino acids in the ethanolic extract were determined

according to the method of Rosin (1957) in which, the following four

reagents (solutions) were used:

Solution A: sodium cyanide 0.01 M (0.49 mg/ml). Solution B:

acetate buffer (pH 5.3- 5.4) prepared by dissolving 270 g sodium


acetate in distilled water and made up to 750 ml distilled water.

Solution C: acetate cyanide: 0.0002 M sodium cyanide (20 ml of stock

solution A) and made up to one 1000 ml with acetate buffer (solution

B). Solution D: Ninhydrin 3% in acetone.

A known volume (0.2 ml) ethanolic extract + 0.5 ml of solution

C + 0.5 ml of solution D (Ninhydrin) were mixed thoroughly and

heated in boiling water bath for 10 min. After cooling under running

water, 5 ml of isopropyl alcohol: water (1:1 v/v) was added and the

developed color was measured using spectrophotometer (Spectronic-

601) at 570 nm. Free amino acids in different samples were calculated

as milligram per gram fresh weight sample.

H- Determination of total carbohydrates:

Total carbohydrates was determined in dry matter of tomato

leaves by using phenol-sulphuric acid method described by Dubois et

al. (1956) and calculated as mg/g dry weight.

Ethanol extraction:

Five grams of powdered leaves oven dried sample were

extracted by boiling in 70% neutral ethanol for 4 hrs. under reflux

condenser (Kawamura et al., 1966). The extract was filtered and the

ethanol was removed by vacuum distillation. The residue was clarified

with neutral lead acetate and the excess of lead salt was precipitated

with potassium oxalate solution.

The last solution filtered, completed to a known volume and

subjected to determination of total soluble carbohydrates (Tanaka et


al., 1975). The total carbohydrates were determined colorimetrically

according to the method of Dubois et al. (1956) as follows:

An aliquot of 1 ml of the solution was quantitatively transferred

into a test tube and treated with 1 ml 5% aqueous phenol solution

followed by 5 ml concentrated analar sulfuric acid. The blank

experiment was carried out using 1 ml of distilled water instead of the

solution. The absorbance of the yellow-orange colour was measured at

490 nm using spectrophotometer model 390. A standard curve was

prepared using known concentrations of glucose where as the

determination as glucose (Fig.3).

0

20

40

60

80

100

120

0 5 10 15

Fig. (3): Standard curve of glucose for determination total carbohydrate.

I- RNA determination:

This was carried out according to the method described by

Schneider (1957). It depends on a calorimetric of the ribose sugar

using orcinol reaction. 1 ml extract was mixed in a test tube with 1 ml

(0.1 g FeCl3 in 100 ml 37% HCl) and 5 mg orcin. The mixture was

heated in a water bath for 15 minutes, cooled and volume was


adjusted to 4 ml with the buffer used in extraction. The optical density

was measured at weave length of 670 nm using U.V-2100

spectrophotometer Unico. The RNA amount was calculated from a

standard curve (Fig. 4) which was constructed using highly

polymerized RNA-sodium salt dissolved in 5% perchloric acid (1

mg/1 ml) at 80°C for 20 minutes.

Fig. (4): Standard curve of total RNA.

3- Molecular detection of pathogenesis related protein genes:

Materials:

Chemicals, enzymes, molecular weight markers and PCR

reagents were obtained from Sigma Chemical (St. Louis, MO, USA)

Roche (Boehringer Mannheim), Promega (Woods Hollow road,

Madison, WI, USA), FMC Bioproducts (Thomaston St., Rockland,

ME, USA), Millipore Intertech (Bedford, MA, USA), Qiagene

(GmbH, Germany) and startagene Inc. (North Torrey Pines Road, La

Jolla, CA, USA).


1- Selected oligonucleotide primers:

The oligoneucleotide primers using on PCR reaction were

synthesized for pathogenesis related protein genes (PR-1a) in operon

(Qiagene Co.), according to Van Loon and Van Strien (1999).

Reverse primer sequence was (3'-GCTCGTAGACAAGTTGGAGTC-5')

while forward primer was (5'-ACCCACATCTTCACAGCAC-3').

2- RT-PCR amplification

A- cDNA synthesis:

Ten µl of total RNA were added to reaction mixture containing 6 µl

of 5x first strand buffer (250 mM Tris-HCl pH 8.3, 375 mM KCl and 15

mM MgCl2), 3 µl of 0.1 M dithiothreitol (DTT), 1µg of complementary

specific primer PR-1a and sterile H2O to a final volume of 30 µl. The

annealing reaction was denatured by heating at 65°C for 5 min and

primer annealing at room temperature for 30-45 min. The annealed

reaction was added to 20 µl of a cDNA reaction mixture containing: 4 µl

of 5x first strand buffer, 2 µl of 0.1 M DTT, 1 µl of RNAsin (40 units,

promega corp., Madison, US), 5 µl of 0.3 M β-mercaptoethanol, 2.5 µl of

10 mM dNTPS and 1 µl of moloney murine leukemia virus (MMLV)

(200 U/ µl) reverse transcriptase (Promega, Corp.). Reaction was mixed

briefly and incubated for 1- 1.5 hr at 42°C.

B- Amplification of PR-1 coding sequence:

Amplification was performed by an initial denaturation step at

95°C for 5 min according to Nie and Singh (2001) in thin-walled

PCR tubes contained the following reaction mixture: Five µl of 10x

PCR buffer (160 mM (NH4)2 SO4, 670 mM Tris-HCl pH 8.8, 0.1%


Tween-20, 25 mM MgCl2), 1 µl of 10 mM dNTPs, 1 µl each of primer

Pr-1F and PR-1R and 2.5 units of Taq DNA polymerase, then

nuclease-free water was added to up the volume to 45 µl. Five µl from

the total DNA was added to PCR mixture and amplified with the

following cycling parameters (denaturation at 94°C for 30 sec). Primer

annealing at 55°C for 30 sec and extension at 72°C for 30 sec) for 30

cycles, with a final extension at 72°C for 5 min and cooling to 4°C.

3- Electrophoresis analysis of PCR product:

PCR amplified DNA products were separated by agarose gel

electrophoresis. Aliquots of 10 µl of PCR products were analyzed on

2.5% agarose gel in TBE buffer (1x = 89 mM Tris HCl, 89 mM borate

and 2.0 mM EDTA pH 8.3) at 100 volt for 1h. The gel was stained

with ethidium bromide at a concentration of 0.5 ml/ml. DNA

molecular weight marker (100, 200, 300, 400, 500, 600 , 700, 800,

900, 1000 bp) 1kb DNA marker was used to determine the size of

PCR amplified cDNA products of PR – mRNA. Bands of DNA were

visualized on a UV transilluminator and photographed using gel

documentation system [BIO-Doc Analyze (Biometra)].

4- Sequencing of pathogenesis related protein gene (PR-1a

gene):

4.1- Purification of DNA fragments from agarose gel:

DNA fragments were purified from agarose gel using the gel

slicing and melting methods described by (Wieslander, 1979). The

Qiagene kit (California, USA) provided rapid and efficient recovery of

DNA (80 %). It is used for recovery and purification of DNA from


ethidium bromide-stained agarose. The desired DNA bands were

excised from the gel using the clean razor blade and put on an

eppendorf tube. 500 µl of the Qiagene buffer was added to 300 mg of

gel fragment and vortexed for 2 min and then incubated at 50°C for 10

min. The sample was pipetted in the upper reservoir of the filter tube

and 500 µl of isopropanol was added to the dissolved gel slice and

centrifuged for 1 min. The flow through was discarded and the filter

tube was reassembled. Add 300 µl of Qiagene buffer (to dissolve

minute gel thin piece) to upper reservoir of the filter tube and

centrifuged for 2 min at 14,000 rpm. Discard the flow through and

again reassemble the filter tube and the used collection tube. Then 500

µl wash buffer PE and 250 µl of 70% ethanol was added to the upper

reservoir and centrifuge 2 min at 14,000 xg, discard the flow through.

The column was carefully removed and placed in 55°C for 2 min to

evaporate residual ethanol. The filter tube and new collection tube

were again reassembled 30 µl warm free nuclease water was added to

the upper reservoir and incubate at room temperature for 10 min then

was centrifuged for 1 min at 12,000 rpm. The flow through was kept

and called first elution. To confirm the presence of DNA fragment in

the eluted DNA, 2 µl of first elution was mixed with 2 µl of dye and

loaded in agarose gel compared to DNA marker. The first and second

elutions combined in eppendorf tube and add 1/10th volume 7.5 mM

ammonium acetate, 2.5 volume 70% ethanol was added, then

incubated at -80°C for 10 min. centrifuged for 20 min at 14,000 rpm,

the supernatant was discarded. 500 µl of 70% ethanol was added to

pellet, centrifuged for 5 min at 14,000 rpm and the pellet was


resuspended in 10 µl of nuclease free water. The nucleotide sequence

of PR-1a gene was obtained using DNAMAN program.

4.2- Sequencing and computer analysis:

Partial nucleotide sequencing of PCR product of PR-1a gene that

amplified with the primers was commercially carried out at Macrogen

3730XL611518-009, Korea by ABI 1.6.0 sequencer. The sequence

data multiple alignment and phytogenetic relationship were translated

and analyzed by DNAMAN program (DNAMAN V 5.2.9 package,

Madison, Wisconsin, USA).

The nucleotides and amino acids sequences of PR-1a gene were

compared with other accessions of PR available in NCBI database

using BLAST algorithm to identify closely related sequences

(http://www.ncbi.nlm.nih.gov). Sequence accessions used for

comparison were provided in Tables (2, 3).

Table (2): Pathogenesis related protein (PR-1a gene) of different crops in Gen-Bank.

No. Crops

1 Solanum lycopersicon

2 Solanum torvum

3 Capsicum annuum

4 Solanum melongena

5 Cucumis melo

6 Cucumis sativus



Table (3): Eleven Pathogenesis related protein (PR-1a gene) amino acids of different hosts published in Gen-Bank.

No. Crops


2 Capsicum annuum

3 Solanum melongena

4 Solanum torvum

5 Vitis pseudoreticulata

6 Cucumis sativus

7 Musa acuminata

8 Betula pendula

9 Brassica napus

10 Eutrema wasabi

11 Linum usitatissimum

Experimental Results - 73 -

EXPERIMENTAL RESULTS

Part I 1- Disease incidence and frequency of virus:

The collected samples of naturally infected tomato plants from

different locations at Qalyoubia Governorate showing mosaic, mottle,

blisters, crinkle, net yellow and malformation were detected by DAS-

ELISA using antisera specific to 5 viruses include: Cucumber mosaic

Cucumovirus (CMV), Tomato mosaic Tobamovirus, Tomato yellow

leaf curl Begomovirus, Potato Y Potyvirus and Potato X Potexvirus.

The ELISA reactions of tomato collected samples at Qalyoubia

Governorate were recorded in Table (4). The data reveal that, CMV

was the most frequently in samples and showed severe symptoms on

tomato; therefore this study aims to induce systemic acquired

resistance against CMV.

Table (4): Detection of viruses naturally infected tomato plants.

Antibodies (Abs) Samples CMV ToMV PVY PVX TYLCV

Banha + + -- -- +

Toukh + -- -- + +

Qaha + + -- -- --

Shebien El-Qanater + + + -- --

El-Qanater El-Khayria + -- -- + +

+ : Positive ELISA reaction -- : Negative ELISA reaction

Disease incidence and disease severity of virus infection in

tomato surveyed locations were recorded in Table (5) and Fig. (5).

The obtained data revealed that, the high level of disease incidence


and severity (96.0 and 33.75%, respectively) was in Qaha followed by

Toukh (94.67 and 20.83%) and Banha gave (94.44 and 27.78%),

while the low disease incidence and disease severity were in Shebien

El-Qanater (83.08 and 21.92%) and El-Qanater El-Khayria (81.43 and

21.79%), respectively.

Table (5): The disease incidence and severity of naturally viral

infected tomato plants in different 5 locations (Qalyoubia Governorate).

Locations Disease incidence (%)

Disease severity (%)

Banha 94.44 27.78

Toukh 94.67 20.83

Qaha 96.00 33.75

Shebien El-Qanater 83.08 21.92

El-Qanater El-Khayria 81.43 21.79

0

20

40

60

80

100

Per

cent

age

(%)

Disease incidence Disease severity

BanhaToukh QahaShebien El-QanaterEl-Qanater El-Khayria

Fig. (5): Disease incidence and severity of natural viruses affecting tomato at 5 different locations in Qalyoubia Governorate.


2- Confirmation of Cucumber mosaic virus (CMV):

1. Host range:

Fourteen plant species belonging to four families were

mechanically inoculated with tested CMV isolate (Table 6). The

reactions of the plants were summarized in three groups; first group,

local symptoms; Chenopodium amaranticolor, C. quinoa and C.

murale produced chlorotic local lesions. While Datura metel produced

necrotic local lesions on inoculated leaves after 7 days post

inoculation (Plate, 2) and second group systemic symptoms were

produced on Nicotiana glutinosa appeared severe mosaic, filiform leaf

and malformation; N. clevelendii and N. tabaccum cv. Samsun

showing severe mosaic and blisters, tomato plants showing vein

clearing, mosaic, vein necrosis, blisters and cucumber plants showing

severe mosaic (Plate, 3). The third group was Vigna unguiculata and

Vicia faba showed no symptoms.


Table (6): The reactions of plant host species and cultivars inoculated

with CMV isolate.

Families Host plant Common name

Symptoms DBIA

Chenopodiaceae

C. quinoa Wild. C. amaranticolor Coste

& Ryn C. murale

Quinoa

Lamb's-quarter

Nettle-leaved Goosefoot.

CLL CLL

CLL

++ ++

++

Cucurbitaceae Cucumis sativus L. Cucurbita pepo L.

Cucumber Squash

SM SM

+++ +++

Leguminosae

Phaseolus vulgaris L. Vigna unguiculata L.

Vicia faba L. Pisum sativum L.

Kidney bean

Cowpea Broad bean

Pea

M NS NS SM

++ -- --

+++

Solanaceae

Datura metel L. L. esculentum N. clevelandii

N. tabacum L., cvs. Samsun

N. glutinosa

Thorn apple Tomato Tobacco

NLL SM, Vc, Mf

M

M SM, Mf

++ ++++ +++

+++ +++

CLL = Chlorotic local lesion, NLL = Necrotic local lesion, M = Mosaic, SM = Severe mosaic, Mf = Malformation, VC = Vein clearing, NS = No symptoms.


Plate (2): Plant leaves inoculated with CMV isolate showing local symptoms on Chenopodium murale (A), C. quinoa (B), C. amaranticolor (C) and Datura metel (D).

Plate (3): Host plants mechanically inoculated with CMV isolate showing mosaic, mottle, blisters, crinkle, net yellow and malformation on Tomato (1,2); blisters, crinkle (3); vein-clearing, net yellow, mottling, and malformation (4,5) on leaves of:

(1), (2) L. esculentum (3) N. clevelendii (4), (5) Cucumis sativus


2. Transmission of CMV:

A- Mechanical transmission:

The virus isolated was mechanically transmitted easily to

healthy tomato plants and differential host plants where as inoculated

with infectious crude tomato sap (Plate 2, 3).

B- Aphid transmission:

The virus isolate was transmitted in a non-persistent manner by

both Myzus persicae and Aphis craccivora from infected cucumber

cultivar source plants to healthy tomato ones.

3. In vitro properties:

The results in Table (7) indicate that, the stability of CMV

isolate in infectious crude sap extracted from infected N. glutinosa. It

was determined by local lesions on leaves of C. amaranticolor as an

indicator host as follows:

1) Thermal inactivation point (TIP):

The infectious crude saps were treated with temperature at 45°C

to 75°C intervals of 5°C for 10 min. in controlled water bath. The

obtained results showed that CMV was inactivated at 70°C for 10 min

in vitro.

2) Dilution end point (DEP):

Several dilutions up to 10-7 were prepared from CMV infectious

sap and results showed that, the infectivity was lost at dilution 10-4.

3) Longevity in vitro (LIV):

The effect of storing the infectious sap for 10 days at room

temperature (25±3°C) on the infectivity of CMV was determined. The

obtained data indicated that, CMV kept its infectivity for 5 days.


Table (7): In vitro properties of CMV isolate in infectious crude sap

under laboratory conditions.

In vitro properties Treatment Mean number of

L. L. per leaf

Relative virus

activity TIP Unheated

45 50 55 60 65 70 75

61.3 8.7 5.7 3.0 2.3 1.3 0.0 0.0

100 14.1 9.2 4.9 3.8 2.2 0 0

DEP Undiluted crude

10-1

10-2 10-3 10-4

10-5 10-6

10-7

61.3 20.0 17.3 7.7 2.3 0.0 0.0 0.0

100 32.6 28.3 12.5 3.8 0 0 0

LIV Zero time

1 2 3 4 5 6

61.3 8.0 3.3 2.3 1.3 0.7 0.0

100 13.0 5.4 3.8 2.2 1.1 0.0

* The results were calculated from 5 replicates. * The virus stability was assayed using C. amaranticolor as local

lesion host.


4. Inclusion bodies:

Light microscopy examination of the epidermal strips from

infected cucumber leaves, 25 days post CMV inoculation showed

cytoplasmic inclusion bodies. The crystalline inclusions are observed

in epidermal and hair cells as well as amorphous inclusions stained by

bromophenol blue and mercuric chloride (Plate, 4).

A B

Plate (4): Epidermal strips and hairs of cucumber leaves infected with CMV (15 days post inoculation) showing cytoplasmic inclusion bodies, (Magnification of Light micrograph 400X). (A) CI: Crystalline inclusion bodies. (B) AI: Amorphous inclusion bodies.

5. Serological identification

- Dot blot immunoassay (DBIA):

The virus antigen was serologically precipitated against specific

polyclonal IgG-CMV by immunoblotting assay Plate (5). The dot blot

immunoassay was found to be sensitive to detect CMV in all infected

plants. A purplish blue color was developed with infected tomato in

the positive reaction, whereas extracts from healthy plants remain

green in the negative reactions.


Plate (5): Dot Blot Immunoassay for CMV precipitation against specific IgG-CMV polyclonal.

+ : Positive - : Negative Infected samples (row 1) N. glutinosa; (rows 2 and 3) Tomato and (rows 4 and 5) Cucumber.


Part II

Evaluation of biotic inducers for induction of systemic

acquired resistance and biocontrol of CMV

A- Induction of systemic acquired resistance (SAR) by biotic

inducers before virus inoculation:

Four biotic inducers (three botanical extracts and kombucha

filtrate) were tested for induction of systemic acquired resistance (SAR)

in tomato plants both pre- and post-inoculated with CMV. Achieved of

SAR was detected by assessment of histopathological; biochemical

[antiviral proteins, protein content, qualitative protein, activity and

isozyme of peroxidase and polyphenol oxidase]; phytochemical [salicylic

acid level, chlorophyll, phenol, total amino acids, total carbohydrate

contents] and molecular of PRs gene changes. Finally, the efficacy of

biotic inducers on the virus isolate infectivity was biologically detected.

1. Histopathological changes:

Histopathological changes in tomato leaves tissues as

evidence of the systemic acquired resistant reaction were elicited

after 7 days of biotic inducers.

In tomato leaves sprayed with biotic inducers, tissue alterations

were observed when tissue was fixed after 7 days of treatment.

Progressive increasing in lignin accumulation in epidermal cells, number

of hairs, thickness of blade, number of xylem arms and phloem layers

(Table, 8) and (Plate, 6B). The alterations included, also, tissue-

shrinkage, intense staining, and precipitation of lignin in sub stomatal

cavity, mesophyll cell showing folding and layering of cell wall and

remains of host palisade cell walls (Plate, 6A).


Plate (6A): Anatomical variations in tomato leaves treated with biotic

inducers (H, A, B, C, 100X and D 60X) H: Healthy. A: Mesophyll cells showing folding and layering of cell walls. B: Precipitation of lignin in sub stomatal cavity. C: Tissue showing intense staining. D: Increasing no. of xylem vessels (left: Non and right: treated).


Plate (6B): Light micrograph of tomato leaves sprayed with

biotic inducers and infected with CMV showing different changes in cells and tissues (40X). H: Healthy. M: tomato leaf treated with M. jalapa extract. Y: tomato leaf treated with C. inerme extract. M+Y: tomato leaf treated with (Mj+Ci) extract. K: tomato leaf treated with Kombucha filtrate.


2. Biochemical changes:

2.1. Antiviral Proteins

a. Determination of the elicited antiviral protein as response to

induction SAR (pre-inoculation) after 7-days:

Protein content was determined in tomato plants treated with biotic

inducers pre-CMV infection related to BSA as standard protein. Total

protein content, in addition enzyme activities were increased in

treated tomato plants than untreated ones. Kombucha filtrate was

the superior in this concern (1.94 mg/g FW), while the mixture

extracts was the lowest (1.28 mg/g FW) comparing with healthy

control (1.05, mg/g FW) [Table (9) and Fig. (6)].

New proteins were elicited interior tomato plants as a result to

spraying with biotic inducers were varied in their number and density.

The variability analysis among inducers appeared 10 protein bands, the

height bands (8 protein fractions) appeared in kombucha filtrate

treatment followed by 7 protein fractions appeared in other inducers (M.

jalapa, C. inerme and mixture extracts), compared with not treated

plants gave 7 protein fractions (Plate, 7).

The molecular weight of each polypeptide was determined related

to protein marker. The most prominent alteration (polymorphic bands)

among the 4 inducers (116, 66, 29, 25 and 18) kDa with percentage

50%. These bands may be related to antiviral proteins. The prominent

polypeptide bands in all inducers (monomorphic or common

polypeptide) were (35 and 14) kDa with percentage 20%. These bands

may be related to tomato plant. The unique (polypeptide markers)

were appeared in tomato plants treated with C. inerme extract, the

mixture extracts and kombucha filtrate are (45, 36 and 17 kDa),

respectively with percentage 30% (Table, 10).


Table (9): Protein content and enzyme activities in tomato plants treated with biotic extracts.

Without virus inoculation Treatment Protein content

(mg/g FW) POD(U/g FW) *POD Specific

activity PPO(U/g FW) *PPO Specific

activity

Healthy c. 1.05 180.30 171.71 102.00 97.14

M. jalapa extract 1.67 262.80 157.37 292.50 175.15

C. inerme extract 1.30 211.70 162.85 219.00 168.46

Mixture (Mj+Ci) extract 1.28 227.60 177.81 114.00 89.06

Kombucha filtrate 1.94 263.60 135.88 152.25 78.48

*Specific activity (unit/mg protein)

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

1.8

2

Pro

tein

co

nte

nt

(mg

/g F

W)

Healthy c. M. jalapa C. inerme Mixture

(Mj+Ci)

Kombucha

Treatments

Fig. (6): Effect of biotic inducers on protein content in tomato plants pre virus inoculation.


Table (10): Protein fractions of tomato plants treated with biotic inducers using SDS-PAGE.

Bioinducers MW (kDa) Untreated plant M Y M+Y K

Polymorphism

116 +++ ++ ++ - + Polymorphic

66 - + - + + polymorphic

45 - - + - - Unique

36 - - - - ++ Unique

35 +++ ++ ++ + +++ Monomorphic

29 - ++ +++ + ++ Polymorphic

25 - +++ +++ ++ + Polymorphic

18 + ++ +++ + + Monomorphic

17 - - - + - Unique

14 ++ ++ ++ ++ +++ Monomorphic

Total polypeptide

4 7 7 7 8

Monomorphic (Common polypeptide). Polymorphic (Specific polypeptide) Unique (Polypeptide marker) or (genetic marker). - = Absence of band. + = presence of band.

Plate (7): Protein fractions of tomato plants treated with biotic inducers pre CMV inoculation using SDS-PAGE.

Mr: Marker. H: Healthy. M: M. jalapa extract. Y: C. inerme extract. M+Y: mixture (Mj+Ci) extracts. K: Kombucha filtrate.


b. Determination the elicited antiviral protein as response to

induction SAR (post-inoculation) after 25-days:

Highest high protein content (2.51 mg/g FW) was due to

kombucha filtrate treatment, while the lowest content (1.62 mg/g FW)

was produced by C. inerme extract, compared with healthy and

Inoculated control (1.09, 1.21 mg/g FW), respectively [Table (11) and

Fig. (7)].

The tomato plants treated with biotic inducers and inoculated

with CMV show that four inducers varied in number and density of

protein. The variability analysis among four inducers appeared 9

protein bands; three inducers (M. jalapa, C. inerme extracts and

kombucha filtrate) gave the same number of bands (6 bands) followed

by mixture gave 5 bands while healthy control and infected plants gave

3 and 5 protein fractions, respectively (Plate, 8).

The molecular weight of each polypeptide was determined

related to protein marker. The most prominent alteration

(polymorphic bands) appeared in (50, 25 and 15) kDa with percentage

33.3%. These bands may be related to antiviral proteins. The

prominent polypeptide bands in all inducers (monomorphic or

common polypeptide) were (60, 35 and 30) kDa with percentage

33.3%. These bands may be related to tomato plant. The unique

(polypeptide markers) were appeared in tomato plants treated with C.

inerme extract and kombucha filtrate in (75, 20 and 18.5) kDa with

percentage 33.3%. These bands may be related to polypeptide

markers (Table, 12).


Table (11): Protein content and enzyme activities in infected

tomato plants then treated with biotic extracts.

Post - virus inoculation (25 days) Treatment Protein content

(mg/g FW) POD(U/g

FW) *POD Specific

activity PPO(U/g FW) *PPO Specific

activity

Healthy control 1.09 170.10 156.06 160.00 146.79

Inoculated control 1.21 191.90 158.60 200.50 165.70

M. jalapa extract 2.18 272.10 124.82 385.50 176.83

C. inerme extract 1.79 195.80 109.39 263.50 147.21

Mixture (Mj+Ci) extracts 1.62 229.00 184.57 278.00 171.60


0

0.5

1

1.5

2

2.5

3

Pro

tein

co

nte

nt

(mg

/g F

W)

Healthy c. Infected c. M. jalapa C. inerme Mixture

(Mj+Ci)

Kombucha

Treatments

Fig. (7): Effect of biotic inducers on protein content in tomato plants post virus inoculation.


Table (12): Protein fractions of CMV infected tomato plants treated with biotic inducers using SDS-PAGE.

Biotic inducers MW (kDa) Untreated plant

Infected tomato M Y M+Y K

Polymorphism

75.0 -- -- -- ++ -- -- Unique

60.0 + ++ +++ ++ ++ +++ Monomorphic

50.0 -- -- + + -- -- Polymorphic

35.0 + + ++ +++ ++ + Monomorphic

30.0 + +++ +++ ++ ++ ++ Monomorphic

25.0 -- + + -- + + Polymorphic

20.0 -- -- -- -- -- ++ Unique

18.5 -- -- -- -- -- + Unique

15.0 -- + + + + + Polymorphic

Total bands 3 5 6 6 5 6

+ = weak band. ++ = moderate band. +++ = strong band

Plate (8): Protein fractions of tomato plants treated with biotic inducers post

CMV inoculation using SDS-PAGE. Mr) Marker. M: M. jalapa extract. Y: C. inerme extract. M+Y: mixture (Mj+Ci) extracts. K: Kombucha filtrate. H: Healthy control. IF: Inoculated control.


2.2- Oxidative enzymes:

Tomato plants treated with biotic inducers show variability in

number and density of polypeptide peroxidase and polyphenol oxidase

isozymes in pre- and post-CMV infection.

a. Peroxidase isozyme in tomato plants sprayed with biotic inducers to induce SAR (pre-inoculation) after 7-days:

1- Enzyme Activities:

The activity of peroxidase isozyme was determined pre-CMV

inoculation. All biotic inducers were increased the peroxidase (POD)

activity in tomato plants especially kombucha filtrate treatment (263.6

U/g FW), while C. inerme extract gave slightly increase (211.7 U/g

FW) comparing with healthy control (180.3U/g FW) Fig. (8).

0

50

100

150

200

250

300

PO

D a

ctiv

ity

(U/g

FW

)

Treatments

Healthy c. M. jalapaC. inerme Mixture (Mj+Ci)Kombucha

Fig. (8): Effect of biotic inducers on POD activity in tomato before

CMV inoculation.


2- Peroxidase activity staining:

The results of pre-virus infection show that the total number of

peroxidase isozyme was 6 bands as shown in Table (13) and Plate (9).

The isozyme bands of 4 treatments were varied in number and

density polypeptide whereas, biotic inducers were revealed 6, 5, 6 and

6 polypeptide bands of M. jalapa, C. inerme, mixture extracts and

kombucha filtrate respectively compared with tomato plants untreated

and Inoculated control appeared 4 and 4 isozymes respectively. The

variability analysis of 4 treatments showed isozyme absent and/or

present in some treatment at RF (1.0 and 2.0) with percentage 33.3%

common in all treated tomato plants and isozyme bands may be related

to tomato plants, (0.7, 1.5, 2. 6 and 3.5 RF) specific bands

(polymorphic bands) with percentage 66.7% appearance may attribute

to the influence of each biotic inducers treatment on tomato plants.


Table (13): Disc-PAGE banding patterns of peroxidase isozymes in non-inoculated tomato plants and treated with biotic inducers.

Biotic inducers Untreated plant M Y M+Y K

RF

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

Po

lym

orp

his

m

0.7 10 +++ 9 + _ 8 ++ 10 +++ Polymorphic

1.0 25 +++ 32 ++++ 35 ++++ 25 ++++ 20 ++++ Monomorphic

1.5 33 ++ 8 + 13 + 7 + 9 + Polymorphic

2.0 21 ++ 21 ++++ 27 ++ 33 +++ 40 +++ Monomorphic

2.6 11 + 10 ++ 10 + 17 ++ 11 ++ Polymorphic

3.5 _ 20 ++ 15 ++ 10 ++ 10 ++ polymorphic

6 bands 4 6 5 6 6

Monomorphic: Common polypeptide Polymorphic: Specific polypeptide. Band density: _ : Absent. +: Weak band. ++: Moderate band. +++: Strong band. ++++: very strong band.

Plate (9): Native acrylamide gel (7%) electrophoresis of POD isozymes produced in tomato plants treated with biotic inducers pre CMV inoculation.

H: Healthy. V: infected tomato. M: tomato leaf treated with Mirabilis extract. Y: tomato leaf treated with Clerodendrum extract. M+Y: tomato leaf treated with Mirabilis+Clerodendrum extract. K: tomato leaf treated with Kombucha filtrate.


b. Peroxidase isozyme in tomato plants sprayed with biotic inducers to induce SAR (post-inoculation) after 25-days:

1- Enzyme Activity:

M. jalapa extract was induced highest peroxidase activity (272.1

U/g FW), followed by kombucha filtrate (265.7 U/g FW), while the

lowest increase POD activity (195.8 U/g FW) was produced by C.

inerme extract compared with healthy and Inoculated control (170.1,

191.9 U/g FW), respectively (Fig. 9).

0

50

100

150

200

250

300

PO

D a

ctiv

ity (

U/g

FW

)

Treatments

Healthy c. Infected c.M. jalapa C. inerme

Mixture (Mj+Ci) Kombucha

Fig. (9): Effect of biotic inducers on POD activity in tomato plants infected with CMV.


B- Peroxidase activity staining:

The results of post virus infection, the total number of

peroxidase isozymes was 4 bands in Table (14) and Plate (10).


density polypeptide whereas, biotic inducers revealed 3,4,4,3 bands of

M. jalapa, C. inerme, mixture extracts and kombucha filtrate

respectively compared with untreated and infected tomato plants

appeared 2 and 3 bands. Variability analysis of 4 treatments showed

some polypeptides bands absent and/or present in some treatment at

RF (2.5, 5.6) polymorphic band with percentage 50%. Two out of 4

isozyme bands were appeared in all treatments monomorphic or

common bands with percentage 50% at RF (3.0, 4.7) these bands

related to tomato plants and the number of isozyme bands was

decreased after 25 days of spraying compared with their after 7 days

due to the presence of the virus.


Table (14): Disc-PAGE banding patterns of peroxidase isozymes of tomato plants treated with biotic inducers then inoculated with CMV.

Biotic inducers Untreated plant


RF

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

Po

lym

orp

his

m

2.5 - - - 20 + 9 + - Polymorphic

3.0 35 ++ 25 ++ 30 ++ 20 ++ 21 ++ 25 + Monomorphic

4.7 65 +++ 55 ++++ 50 +++ 50 +++ 55 +++++ 50 ++ Monomorphic

5.6 - 20 ++ 20 + 10 + 15 ++ 25 + Polymorphic

4 bands 2 3 3 4 4 3

Monomorphic: Common polypeptide Polymorphic: Specific polypeptide Band density: _ : Absent. +: Weak band. ++: Moderate band. +++: Strong band. +++++: very strong band

Plate (10): Native acrylamide gel (7%) electrophoresis of POD isozymes produced in tomato plants treated with biotic inducers post CMV inoculation. H: Healthy. V: infected tomato. M: tomato leaf treated with Mirabilis extract. Y: tomato leaf treated with Clerodendrum extract. M+Y: tomato leaf treated with Mirabilis+C. inerme extract. K: tomato leaf treated with Kombucha filtrate.


c. Polyphenol oxidase isozyme in tomato plants sprayed with biotic inducers to induce SAR (pre-inoculation) after 7-days:

1- Enzyme Activity:

M. jalapa extract was induced highest PPO activity (292.5 U/g

FW), while the lowest PPO activity (114.0 U/g FW) was produced by

mixture, compared with healthy control (102.0 U/g FW), (Fig. 10).

0

50

100

150

200

250

300

PP

O a

ctiv

ity (

U/g

FW

)

Treatments

Healthy c. M. jalapaC. inerme Mixture (Mj+Ci)

Kombucha

Fig. (10): Effect of biotic inducers on PPO activity in tomato plants pre-CMV inoculation.


2- Polyphenol oxidase activity staining:

The obtained results of the total number of polyphenol oxidase

isozyme produced in tomato plants treated with biotic inducers pre-

CMV infection was 6 bands are shown in Table (15) and Plate (11).

The isozyme bands of tomato plants treated with 4 biotic

inducers were varied in number and density polypeptide whereas,

biotic inducers were induced 4,4,4 and 6 polypeptide bands of M.

jalapa, C. inerme, mixture extracts and kombucha filtrate respectively

compared with untreated tomato plants appeared 5 isozymes. The

variability analysis of 4 treatments showed isozyme absent and/or

present in some treatments at RF (1.5 and 2.0) monomorphic common

in all tomato plant treatment with percentage 33.3% and (1.3 and

3.3 RF) polymorphic specific bands with percentage 33.3% may

attributed to the influence of each biotic inducers treatment on tomato

plants, 2 unique isozyme (Genetic marker) with percentage 33.4% for

each biotic inducers (0.8 and 2.5) of Kombucha filtrate treatment.


Table (15): Disc-PAGE banding patterns of polyphenol oxidase isozymes of non-inoculated tomato plants and treated with biotic inducers.

Biotic inducers Untreated plant M Y M+Y K

RF

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

Pol

ymor

phis

m

0.8 _ _ _ _ 7 + Unique

1.3 _ 13 + 9 + 10 + 12 + Polymorphic

1.5 75 +++ 40 ++++ 45 ++++ 50 ++++ 30 +++ Monomorphic

2.0 25 + 20 + 21 + 25 + 11 ++ Monomorphic

2.5 _ _ _ _ 25 +++ Unique

3.3 _ 27 + 25 + 15 + 15 + Polymorphic

6 bands

2 4 4 4 6

Unique: genetic marker monomorphic: common polypeptide. Polymorphic: specific polypeptide. +: weak band. ++: moderate band. +++: strong band

Plate (11): Native acrylamide gel (7%) electrophoresis of PPO isozymes produced in tomato plants treated with biotic inducers pre -CMV inoculation.


d. Polyphenol oxidase isozyme in tomato plants sprayed with biotic inducers to induce SAR (post-inoculation) after 25-days:

1- Enzyme Activity:

M. jalapa extract induced highest PPO activity (385.5 U/g FW),

while the lowest PPO activity (263.0 U/g FW) was produced by C.


200.5 U/g FW), respectively (Fig. 11).

0

50

100

150

200

250

300

350

400

PP

O a

ctiv

ity (

U/g

FW

)

Treatments

Healthy c. Inoculated c. M. jalapa

C. inerme Mixture (Mj+Ci) Kombucha

Fig. (11): Effect of biotic inducers on PPO activity in tomato plants infected with CMV.



Post virus infection, the total no. of polyphenol oxidase isozymes

were 3 bands.

The isozyme bands of tomato plants treated with four biotic

inducers (Table, 16) were varied in number and density polypeptide

whereas inducers were induced 3, 2, 2, 2 bands of M. jalapa, C.

inerme, mixture extracts and kombucha filtrate respectively compared

with untreated and infected tomato plants appeared 2 and 2 bands

respectively. Two out of 3 isozyme bands were appeared in all

treatments monomorphic or common bands at RF (2.1, 3.2) with

percentage 66.6% these bands related to tomato plants. One unique

isozyme (Genetic marker) for kombucha filtrate treatment at RF (1.0)

with percentage 33.34% was detected, Plate (12).

Table (16): Disc-PAGE banding pattern of polyphenol oxidase isozymes of

tomato plants treated with biotic inducers then infected by

CMV.

Bioinducers Untreated plant


RF

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

Pol

ymor

phis

m

1.0 - - 20 + - - - Unique

2.1 30 ++ 65 +++ 45 ++ 40 ++ 55 ++ 30 ++ Monomorphic

3.2 70 ++ 35 ++ 35 ++ 60 ++ 45 ++ 70 +++ Monomorphic

3 bands 2 2 3 2 2 2

Unique: genetic marker. Monomorphic: common polypeptide. Band density: - Absent

+: weak band. ++: moderate band. +++: strong band


Plate (12): Native polyacrylamide gel (7%) electrophoresis of PPO isozymes produced in tomato plants treated with biotic inducers post CMV inoculation.

H: Healthy. V: infected tomato. M: tomato leaf treated with M. jalapa extract. Y: tomato leaf treated with C. inerme extract. M+Y: tomato leaf treated with mixture (Mj+Ci) extract. K: tomato leaf treated with Kombucha filtrate.

We can conclude that, the biotic inducers reveal reproducibility

different levels of acquired resistance according to the number of

protein genetic markers.

Pre-virus infection, kombucha filtrate and mixture extracts

gave a highest level of protein genetic markers followed by C.

inerme and M. jalapa extracts. On the other hand, Post-virus

infection, three biotic inducers (M. jalapa, C. inerme and mixture

extracts) give the same number of genetic markers and kombucha

filtrate gave the low numbers (Table, 17).


Table (17): Protein genetic markers of tomato plants produced by biotic inducers as indication of systemic acquired resistance against CMV infection.

M. jalapa C. inerme Mixture (Mj+Ci)

Kombucha Parameters

*Pre **Post Pre Post Pre Post Pre Post SDS-PAGE - 3 3 2 5 2 6 2

Peroxidase 2 1 2 2 2 2 2 1

Polyphenol oxidase

1 - 2 - 2 - 1 -

Total 3 4 7 4 9 4 9 3

*Pre-virus inoculation **Post-virus inoculation

2.3- Quantification of total SA in tomato plants treated with

biotic pre-virus inoculation:

The obtained results from quantification of total SA in induced

tomato plants before CMV inoculation were tabulated in Table

(18). These results were agreed with percentage of infection, disease

severity and virus concentration; it was observed that, the level of

total SA has been increased in treated plants compared with untreated

tomato plants with biotic inducers (H control, V Inoculated control).

The results indicate that the healthy tomato plant (non-treated)

and tomato treated with M. jalapa, C. inerme, the mixture extracts and

kombucha filtrate refers to the peaks obtained using HPLC,

desired peak must be resulted in the retention time similar to the

retention time of the standard. These peaks were used to calculate total

SA based on the area under peak (Fig. 12).


Kombucha filtrate gave the highest level of SA (9346.61

µg/g FW) followed by C. inerme extract (8652.78 µg/g FW), M.

jalapa extract (7451.63 µg/g FW), while mixture extracts gave

the lowest level of SA (3124.18 µg/g FW) (Table, 18).

Table (18): Quantification of total SA in tomato plants treated with biotic inducers compared with healthy plant.

Treatments No. of peak Ret. time Area Total SA

(µg/g FW)

Standard SA 1 4.301 1195.321 -

Inoculated control 2 4.951 3861.915 1615.43

M. jalapa extract 1 4.892 17814.2 7451.63

C. inerme extract 4 4.050 20685.7 8652.78

Mixture (M+Y) extract 2 4.944 7468.814 3124.18

Kombucha filtrate 6 4.188 22344.2 9346.61

Healthy 4 4.626 702.349 293.79

Fig. (12): HPLC quantification of free and endogenous SA in

induced tomato plants.


Continued Fig. (12): (H): healthy plant.

(V): Inoculated control.


Continued Fig. (12): (M): Tomato leaves treated with M. jalapa extract.

(Y): Tomato leaves treated with C. inerme extract.


Continued Fig. (12): (M+Y): Tomato leaves treated with (Mj+Ci) extracts.

(K): Tomato leaves treated with kombucha filtrate.


2.4- Photosynthetic pigments content:

From the results, it is noticed that in the inoculated tomato plants

there were reduction in Chl a, Chl b and carotenoid contents (0.855,

0.761 and 0.742 mg/g FW) when compared with non-infected plants

(0.714, 0.514 and 0.662 mg/g FW) of Chl a, Chl b and carotenoids,

respectively.

Generally, tomato plants treated with M. jalapa, C. inerme,

mixture extracts and kombucha filtrate resulted an increase in Chl a

contents (1.015, 0.971, 0.944 and 1.005 mg/g FW) whereas Chl b,

(0.878, 0.823, 0.773 and 0.921 mg/g FW) and carotenoid (0.822,

0.795, 0.744 and 0.887 mg/g FW).

On the other hand, in the tomato plants treated with extract of

Mj, Ci, mixture extracts, kombucha filtrate and infected with CMV

there were increase in Chl a Chl b and carotenoids contents compared

with inoculated plants and non-treated with the tested inducers.

The content increasing were (1.485, 1.279, 1.194 and 1.196 mg/ g

FW) Chl a, (1.290, 1.111, 1.008 and 1.045 mg/g FW) Chl b and (1.286,

1.127, 1.026 and 1.495 mg/g FW) carotenoids of in plants treated with

Mj, Ci, (Mj+Ci) extracts and kombucha filtrate respectively (Table, 19).

From the obtained results the M. jalapa, C. inerme, mixture

extracts and kombucha filtrate treatments elicited tomato plants for

increasing total chlorophyll pigments and carotenoid contents as one

evidence for systemic acquired resistance (SAR).


Table (19): Chlorophyll and carotenoid contents (mg/g FW) in tomato plants treated with biotic inducers.

Chlorophyll content

Treatments a b Carotenoids

Healthy plants Untreated 0.855 0.761 0.742

Plants inoculated with virus

Virus treated 0.714 0.514 0.662

Without virus 1.015 0.878 0.822 Plants treated with

M. jalapa extract With virus 1.485 1.290 1.286


C. inerme extract With virus 1.279 1.111 1.127


Mixture ( Mj+Ci) With virus 1.194 1.008 1.026


Kombucha With virus 1.196 1.045 1.495

Chlorophyll content = mg/g FW.

2.5- Determination of phenolic compounds:

Phenolic contents were increased in the non-inoculated plants

and treated with biotic inducers. The highest increase was induced by

M. jalapa extract and kombucha filtrate (49.24 and 48.41 mg/g FW)

total phenols, (29.07 and 24.76 mg/g FW) free phenols and (20.17 and

23.65 mg/g FW) conjugate phenols respectively. While C. inerme and

mixture extracts produced the lowest increase in phenols contents

(33.56 and 32.70 mg/g FW) total phenols, (16.52 and 18.20 mg/g FW)

free phenols and (17.52 and 14.5 mg/g FW) conjugated phenols

respectively compared with healthy and Inoculated controls (32.89

and 31.02 mg/g FW) total phenols, (14.24 and 10.35 mg/g FW) free


phenols and (20.65 and 20.67 mg/g FW) conjugated phenols

respectively (Table, 20).

On the other hand, tomato plants post virus inoculation showed

an increase in phenolic contents in treatments of M. jalapa and

mixture extracts (12.30 and 11.85 mg/g FW) total phenols, (8.71 and

8.58 mg/g FW) free phenols and (3.59 and 3.27 mg/g FW) conjugated

phenols respectively, while kombucha filtrate and C. inerme extract

showed the little increase in phenols contents (9.65 and 8.41 mg/g

FW) total phenols, (7.60 and 6.60 mg/g FW) free phenols and (0.39

and 1.81 mg/g FW) conjugated phenols respectively compared with

healthy and Inoculated controls (8.14 and 7.65 mg/g FW) total

phenols, (7.06 and 6.58 mg/g FW) free phenols and (1.08 and 1.07

mg/g FW) conjugated phenols respectively.

Table (20): Free, conjugated and total phenols content in tomato plants treated with biotic inducers.

Pre virus inoculation Post virus inoculation

Treatments

To

tal

ph

eno

ls

Fre

e p

hen

ols

Co

nju

gat

ed

ph

eno

ls

To

tal

ph

eno

ls

Fre

e p

hen

ols

Co

nju

gat

ed

ph

eno

ls

Healthy control 32.89 12.24 20.65 8.14 7.06 1.08

Inoculated control 31.02 10.35 20.67 7.65 6.58 1.07

M. jalapa extract 49.24 29.07 20.17 12.30 8.71 3.59

C. inerme extract 33.56 16.52 17.04 8.41 6.60 1.81

Mixture (Mj+Ci) extract

32.70 18.20 14.50 11.85 8.58 3.27

Kombucha filtrate 48.41 24.76 23.65 9.65 7.60 0.39


2.6- RNA determination in tomato plants treated with biotic inducers pre-virus inoculation:

The total RNA content values in the leaves of four treatments of

tomato plant compared with healthy and infected are recorded in

Table (21). From the results, the highest value of 342 µg/g was

recorded in tomato plant treated with kombucha filtrate followed by

the value of 325 µg/g in tomato plant treated with M. jalapa extract.

While the lowest value of 305, 284 µg/g were recorded in tomato

plant treated with C. inerme extract and mixture extracts respectively,

compared with the value of 245, 295 µg/g in healthy and infected

respectively (Fig. 13).

Table (21): Comparison between tomato plants (treated with biotic

inducers) in RNA contents and healthy, inoculated

controls.

Tomato plants treated with Treatment Healthy

Inoculated

control M. jalapa C. inerme Mixture (Mj+Ci)

Kombucha

O.D 0.825 1.045 1.145 1.075 1.025 1.152

Conc. (µg/g) 245 295 325 305 284 342


0

0.2

0.4

0.6

0.8

1

1.2

Op

tica

l D

en

sity

245 295 325 305 284 342

Conc. (µg/g)

Healthy

Infe

ste

d c

ontr

ol

M.

jala

pa

C.

inerm

e

Mix

ed (

Mj

+ C

i)

Kom

bucha

Fig. (13): Histogram illustrates the RNA content values in the leaves of tomato plants treated with biotic inducers compared with healthy.

3. Molecular marker for SAR detection: Pathogenesis-related protein associated with plant defense: RT-PCR amplification PR-1a gene:

Total RNA were isolated from tomato plants treated with

biotic inducers using CTAB method with high quality and

substantially free RNA contamination. The RNAs were used

as a template for RT-PCR to amplify of the PR-1a gene via

the QLAGEN PCR system by use of an oligonuclutides

3'-GCTCGTAGACAAGTTGGAGTC-5' and 5'-ACCCACATCTTCACAGCAC-3'

primer sets nearly full length mRNA PR-1a gene could be

synthesized. The amplified PR-1a mRNA was used for

conformation its specificity to the acquired resistance in tomato


plants. The mRNA of PR-1a gene as a PCR product with an

expected size of about 182 bp DNA was amplified (Plate, 13).

Plate (13): 2.5% agarose gel electrophoresis showing the amplified PCR product of mRNA of PR-1a gene of tomato plants treated with biotic inducers at the correct size (182 bp). M: Molecular weight of DNA Marker. K: Tomato leaves treated with kombucha filtrate. M+Y: Tomato leaves treated with mixture (Mj+ Ci) extract. Y: Tomato leaves treated with C. inerme extract. M: Tomato leaves treated with M. jalapa extract. V: Tomato leaves inoculated with CMV. H: Untreated leaves.


PR-1a gene sequence: The DNA sequence was performed using PCR produced

when the specific (downstream and upstream) primers for mRNA of

PR-1a gene of the tomato plants treated with biotic inducers were

used.

The PCR product band was cleaned using gene clearing

kit as mentioned before. The result illustrated in Fig. (14) show

the partial nucleotide sequence of PCR fragment with appeared to

be containing 182 bp. The nucleotide sequence of PR-1a gene was

recorded in Gen-Bank.

Fig. (14): The partial nucleotide sequence of DNA (182 bp) from mRNA of PR-1a gene of tomato plants treated with biotic inducers.

Sequencing analysis:

The partial nucleotide sequence of the PCR-amplified

fragment for the PR-1a gene of the tomato plants treated with biotic

inducers was done to determine the relationship with other

recommended pathogenesis related protein registered in Gen-

Bank (Table, 22). The sequencing was done from the forward

direction at Macro gen 3730XL6-1518-009, Korea.

1 GCTCGTAGAC AAGTTGGAGT CGGTGGTATG ACATGCGACA ATAGGCTAGC GGCCAATGCC 61 CAGCATTACG CCAATCAtAG AGCTGCCGAC TGCAGGATGC AACACTCTGG TGGACCTTAC 121 GGTGAAAACC TAGCTGCCGC TTTCCCCCAG CTCAACGCGG CTGGTGCTGT GAAGATGTGG

181 GT


Analysis of molecular data by Bioinformatics:

1- Nucleotide sequence:

The nucleotide sequence of PR-1a gene for tomato plants treated

with biotic inducers revealed the highest content for Guanine (G) 54

(29.7%) followed by cytosine (C) 48 (26.4%), then adenine (A) 42

(23.1%) and thymine (T) 38 (20.9%) (Table, 22).

The partial nucleotide sequence of PR-1a gene for tomato

plants treated with biotic inducers was an aligned by using

DNAMAN program (Wisconsin. Madison, USA) with six

published pathogenesis related protein in Gen-Bank which are:

Solanum lycopersicon, Solanum torvum, Capsicum annuum,

Solanum melongena, Cucumis melo and Cucumis sativus.

The nucleotide sequence similarity of PR-1a gene for

tomato plants treated with biotic inducers with six published

pathogenesis related protein were shown in Fig. (15). A

phylogenetic tree of PR-1a tomato revealed 95% a moderate

degree of similarity to the other S. lycopersicon pathogenesis

related protein. On the other hand, revealed 84% a moderate

degree of similarity to S. torvum, C. annuum and S. melongena and

60% C. melo and C. sativus pathogenesis related protein (Fig. 16).

Comparison between bases composition of partial PR-1a

gene sequence for tomato plants treated with biotic inducers and

six pathogenesis related protein published in Gen-Bank was

done to determine C+G and A+T ratio between the PR-1a gene and

these international pathogenesis related protein as shown in

Table (22) and Fig. (17).


Table (22): Comparison between bases composition of partial PR-1a gene for tomato plants treated with biotic inducers and six pathogenesis related protein published in Gen- Bank.

Base

A C G T C+G A+T PR-1 gene and

other crops Total (bp.)

Weight (kDa)

No. % No. % No. % No. % No. % No. %

PR-gene tomato

182 55.782 42 23.1 48 26.4 54 29.7 38 20.9 102 56.0 80 44.0

Solanum lycopersicon

832 252.902 242 29.1 165 19.8 168 20.0 257 30.9 333 40.0 499 60.0

Solanum torvum

504 153.789 128 25.4 112 22.2 127 25.2 137 27.2 239 47.4 265 52.6

Capsicum annuum

805 245.211 248 30.8 146 18.1 167 20.7 244 30.3 313 38.9 492 61.1

Solanum melongena

258 79.186 64 24.8 56 21.7 77 29.8 61 23.6 133 51.6 125 48.4

Cucumis melo

456 139.613 130 28.5 89 19.5 118 25.9 119 26.1 207 45.4 249 54.6

Cucumis sativus

423 129.64 118 27.9 90 21.3 114 27.0 101 23.9 204 48.2 219 51.8


Fig. (15): Multiple sequence alignment of the partial nucleotide sequence of the PR-1a gene for tomato plants with the corresponding sequence of six pathogenesis related protein available in Gen-Bank.


PR1 gene tomato

S. lycopersicum

S. torvum

Capsicum annuum

S. melongena

Cucumis melo

Cucumis sativus

95%

89%

88%

84%

73%

60%

100% 60%95%90%85%80%75%70%65%

Fig. (16): A phylogenetic tree of tomato plants treated with

biotic inducers and other crops.

Fig. (17): Histogram illustrates nucleotide frequencies of PR- gene of tomato plants related to other PR-1a gene of different crops in Gen-Bank.


2- Translation of partial nucleotide sequence of PR-1a gene for tomato plants treated with biotic inducers:

The predict number of amino acids were produced from

translation of partial (PR-1a) gene nucleotide sequence were 60 amino

acids starting with Alanine (A) (Fig. 18)

Fig. (18): Translation of partial nucleotide sequence of PR-la gene for

tomato plants treated with biotic inducers produced 60 amino acids with MW = 6.383 kDa.

The partial PR-1a gene sequence for tomato plants was aligned

by using DNAMAN program (Wisconsin, Madison, USA) with

eleven published pathogenesis related protein for different hosts in

Gen-Bank which are: S. lycopersicon, C. annuum, S. melongena, S.

torvum, Vitis pseudoreticulata, C. sativus, Musa acuminate, Betula

pendula, Brassica napus, Eutrema wasabi and Linum usitatissimum.

The partial PR-1a gene sequence similarity of tomato plant treated

with biotic inducers with eleven published pathogenesis related protein of

Translation of PR-1a (1-182) Universal code Total amino acid number: 60, MW= 6383.

10 20 30 40 50 60 1 GCTCGTAGACAAGTTGGAGTCGGTGGTATGACATGCGACAATAGGCTAGCGGCCAATGCC 1 A R R Q V G V G G M T C D N R L A A N A 70 80 90 100 110 120 61 CAGCATTACGCCAATCATAGAGCTGCCGACTGCAGGATGCAACACTCTGGTGGACCTTAC

21 Q H Y A N H R A A D C R M Q H S G G P Y 130 140 150 160 170 180 121 GGTGAAAACCTAGCTGCCGCTTTCCCCCAGCTCAACGCGGCTGGTGCTGTGAAGATGTGG 41 G E N L A A A F P Q L N A A G A V K M W 181 181 GT


different hosts was shown in (Fig. 19). A phylogenetic tree of PR-la gene

tomato divided into two major groups, the 1st group includes 2 sub-

groups. The lst subgroup divided into 2 under subgroups where, one

group include PR-1 gene tomato similarity 89% with Solanum

lycopersicon and Capsicum annuum and another group S. melongena

revealed similarity 85% with the 1st under subgroup (PR-1 gene tomato)

and the 2nd sub group include Solanum torvum similarity 84% with the

1st subgroup. The second major group contain 2 subgroups, the 1st

subgroup divided into 2 under subgroups where, one group include Vitis

pseudoreticulata revealed similarity 61% with the 1st sub group and the

2nd under sub group contain Cucumis sativus revealed similarity 64%

with Musa acuminata. The second subgroup divided into 2 under sub

groups, one group include Betula pendula which revealed a moderate

similarity 68% with the 1st subgroup and Brassica napus revealed

similarity 79% with Eutrema wasabi, while the 2nd under sub group

include Linum usitatissimum revealed similarity 61% with the 1st sub

group. The 1st major group gene tomato revealed a moderate similarity

58% with the 2nd major group (Fig. 20).

Comparison between amino acids composition of partial PR-la

sequence for tomato plants treated with biotic inducers and eleven

pathogenesis related protein of different hosts published in Gen-Bank

was done to determine the similarity in types, percentages and number

of amino acids composition of partial PR-1a gene for tomato plants,

where as PR-1a gene tomato was produced 19 types of 60 amino

acids beginning with Alanine (A) and ended with Tryptophan (W).

The PR-1a tomato was differed in percentage in each amino acid


composition and molecular weight with eleven pathogenesis related

protein of different hosts as shown in Table (23).

Fig. (19): Multiple amino acids sequence aligned of the partial PR-1 a gene

of the studied tomato plants with the corresponding amino acid sequence of eleven pathogenesis related protein of different hosts available in Gen-Bank.


PR1 gene tomato

S. lycopersicum

Capsicum annuum

Solanum melongena

Solanum torvum

V. pseudoreticulata

Cucumis sativus

Musa acuminata

Betula pendula

Brassica napus

Eutrema wasabi

Linum usitatissimum

94%

89%

85%

84%

79%

68%

64%

61%

61%

60%

58%

100% 50%90% 80% 70% 60%

Fig. (20): A phylogenetic tree of PR-la gene tomato based on the amino acid sequence of the PR-la gene.

The dendrogram displaying the percentage of amino acid sequence

homology between the PR-1a gene tomato and the other eleven

pathogenesis related protein of different hosts published in Gen-Bank.


Table (23): Comparison between amino acids composition of partial PR-la gene sequence for tomato plants treated with biotic inducers and 11 pathogenesis related protein of different hosts published in Gen-Bank.

1 2 3 4 5 6 7 8 9 10 11 12 Amino acids

No. % No. % No. % No. % No. % No. % No. % No. % No. % No. % No. % No. %

Ala.(A) 13 21.7 20 11.2 19 10.6 10 11.6 19 11.3 12 6.8 10 11.8 24 14.8 17 16.7 17 10.5 15 9.3 12 14.0

Cyst. (C) 2 3.3 7 3.9 7 3.9 4 4.7 7 4.2 8 4.5 2 2.4 7 4.3 3 2.9 7 4.3 6 3.7 2 2.3

Asp.(D) 2 3.3 8 4.5 8 4.5 3 3.5 8 4.8 8 4.5 5 5.9 6 3.7 7 6.9 6 3.7 8 5.0 4 4.7

Glu.(E) 1 1.7 4 2.2 4 2.2 2 2.3 7 4.2 5 2.8 5 5.9 2 1.2 2 2.0 4 2.5 2 1.2 4 4.7

Phe.(F) 1 1.7 7 3.9 7 3.9 2 2.3 7 4.2 4 2.3 3 3.5 3 1.9 0 0 2 1.2 1 0.6 0 0

Gly.(G) 7 11.7 15 8.4 15 8.4 9 10.5 13 7.7 19 10.8 8 9.4 14 8.6 9 8.8 15 9.3 15 9.3 9 10.5

His.(H) 3 5.0 4 2.2 5 2.8 2 2.3 4 2.4 5 2.8 1 1.2 3 1.9 4 3.9 4 2.5 3 1.9 2 2.3

Ile.(I) 0 0 5 2.8 6 3.4 2 2.3 5 3.0 9 5.1 2 2.4 6 3.7 1 1.0 6 3.7 7 4.3 1 1.2

Lys.(K) 1 1.7 4 2.2 4 2.2 3 3.5 4 2.4 2 1.1 3 3.5 3 1.9 6 5.9 5 3.1 5 3.1 2 2.3

Leu.(L) 3 5.0 10 5.6 9 5.0 2 2.3 8 4.8 12 6.8 4 4.7 5 3.1 6 5.9 11 6.8 11 6.8 4 4.7

Met.(M) 3 5.0 4 2.2 4 2.2 3 3.5 4 2.4 4 2.3 0 0 3 1.9 0 0 1 0.6 3 1.9 3 3.5

Asn.(N) 5 8.3 18 10.1 18 10.1 7 8.1 13 7.7 17 9.7 7 8.2 14 8.6 10 9.8 15 9.3 14 8.7 6 7.0

Pro.(P) 2 3.3 9 5.0 10 5.6 3 3.5 10 6.0 7 4.0 4 4.7 8 4.9 2 2.0 6 3.7 8 5.0 2 2.3

Gln.(Q) 4 6.7 13 7.3 12 6.7 6 7.0 11 6.5 7 4.0 4 4.7 8 4.9 4 3.9 7 4.3 7 4.3 4 4.7

Arg.(R) 5 8.3 11 6.1 11 6.1 5 5.8 9 5.4 6 3.4 4 4.7 8 4.9 1 1.0 11 6.8 11 6.8 5 5.8

Ser.(S) 1 1.7 8 4.5 8 4.5 4 4.7 8 4.8 16 9.1 4 4.7 14 8.6 8 7.8 12 7.4 12 7.5 9 10.5

Thr.(T) 1 1.7 6 3.4 6 3.4 3 3.5 7 4.2 6 3.4 3 3.5 6 3.7 3 2.9 4 2.5 3 1.9 1 1.2

Val.(V) 3 5.0 10 5.6 11 6.1 7 8.1 10 6.0 14 8.0 9 10.6 14 8.6 9 8.8 15 9.3 16 9.9 6 7.0

Trp.(W) 1 1.7 6 3.4 6 3.4 4 4.7 5 3.0 5 2.8 3 3.5 4 2.5 3 2.9 4 2.5 4 2.5 3 3.5

Tyr.(Y) 2 3.3 10 5.6 9 5.0 5 5.8 9 5.4 10 5.7 4 4.7 10 6.2 7 6.9 10 6.2 10 6.2 7 8.1

Total AA no.

60 179 179 86 168 176 85 162 102 162 161 86

MW(kDa) 6.383 20.123 20.094 9.603 18.809 19.182 9.334 17.308 10.82 17.772 17.668 9.410

1= PR-1a gene tomato. 2= S. lycopersicon. 3= C. annuum. 4= S. melongena. 5= S. torvum. 6= V. pseudoreticulata. 7= C. sativus. 8= M. acuminata. 9= B. pendula. 10= B. napus. 11= E. wasabi.12= L. usitatissimum.


4- Effect of biotic inducers on virus infectivity during

induction of SAR as follows:

All tested inducers showed different successful degrees in the

induction of acquired systemic resistance against CMV infection in

tomato plants. Reduction of infection (RI%) percentage are affected as

a result to treatments, e.g. M. jalapa extract gave the highest

percentage of reduction (76.0%), followed by C. inerme extract and

kombucha filtrate (60.0 and 59.2%), while mixture extracts has the

lowest percentage (50.0%) compared with Inoculated control 0.0%

[Table (24) and Fig. (21)].

Table (24): Effect of bioinducers on CMV infectivity in tomato plants.

Treatments Disease incidence%

% of R.I. D.S. (%) *Conc.

Inoculated control 100.0 0.0 96.2 85.5

M. jalapa extract 24.0 76.0 11.5 10.2

C. inerme extract 40.0 60.0 13.7 12.2

Mixture ( Mj+Ci) extracts

50.0 50.0 24.1 21.4

Kombucha filtrate 40.7 59.2 18.0 16.0

R.I. = reduction of virus infection. D.S. = Disease severity. *Virus concentration was biology assayed as mean numbers of local lesions.


0

10

20

30

40

50

60

70

80

90

100V

irus

infe

ctiv

ity

%of infection %of R.I. D.S. (%) Conc.

Infected control M. jalapaC. inerme Mixture (Mj+Ci)Kombucha

Fig. (21): Effect of bioinducers on disease severity and virus

infectivity in tomato plants.


B- Using of biotic inducers as bioinducers to control CMV infection:

Systemic acquired resistance was experimentally achieved using

the tested bioinducers in the tomato plants before inoculation with the

virus isolate. The effect of SAR on the virus infectivity was also

determined.

In this experiment, tomato seedlings were firstly inoculated with

the virus isolate, after 15 days were sprayed with the four tested

bioagents. Seven days later, leaves samples were collected to

determine the following changes between inoculated and non-

inoculated or sprayed or non-sprayed treatments.

1. Histopathological changes:

Transversal sections from treated and non-treated leaves were

examined under light microscope after contrast staining. Observations

showed an important alteration between treated and non-treated samples.

Plants treated with bioinducers were stronger in their growth than non-

treated as a result to the increase in lignin precipitation, numbers of

xylem arms, phloem layers, skin hairs and increasing thickness of cell

wall, and blade (Table, 25). On the other hand, non-treated tomato plants

showed plasmolysis in the mesophyll cells, cell walls collapsed and

plastids become deformed and swollen a loss of orientation along the

inner cell wall. These alterations were intensified with progressive tissue-

shrinkage and desiccation causing the walls of the palisade and spongy

parenchyma to fold in a layering fashion as well as reduction in vascular

bundles (Plate, 14).


Plate (14): Light micrograph of tomato plant treated with bioinducers

post CMV inoculation showing different changes in cells and tissues (40X). H: Healthy. V: infected tomato. M: tomato leaf treated with M. jalapa extract. Y: tomato leaf treated with C. inerme extract. M+Y: tomato leaf treated with mixture (Mj+Ci) extract. K: tomato leaf treated with Kombucha filtrate.


2. Biochemical changes: 2.1. Antiviral Proteins

a. Determination the elicited antiviral protein as response to treatment with bioinducers to control infected tomato plants after 7 days of spraying:

Protein content was determined in treated tomato plants with

bioinducers and infected with CMV related to BSA as standard protein

(Table, 26). All bioinducers caused an increase in total protein content and

enzymes activity in treated tomato plants. Kombucha filtrate induced

highest protein content (1.65 mg/g FW), while the lowest content (0.93

mg/g FW) was produced by mixture extracts, compared with healthy and

Inoculated control (1.05, 1.12 mg/g FW), respectively Fig. (22).

The tomato plants treated with bioinducers and inoculated with

CMV showed clear varied in number and density of protein. The

variability analysis among four bioinducers appeared 12 protein bands

(Plate, 15); eleven protein fractions appeared in tomato plants treated with

M. jalapa extract followed by C. inerme extract (10 protein fractions) and

mixture extracts and kombucha filtrate gave (8 protein fractions), while

non-treated and infected plants gave 4 and 7 protein fractions, respectively.

The molecular weight of each polypeptide was determined related to

protein marker (Table, 27). The most prominent alteration (polymorphic

bands) among 4 bioinducers (70, 50, 45, 36, 35, 20, 14 and 13) kDa with

percentage 66.6%, these bands may be related to antiviral proteins. The

prominent polypeptide bands in all bioinducers (Monomorphic or

common polypeptide) were (25, 18 and 17) kDa with percentage 25%,

these bands may be related to tomato plant. The unique (polypeptide


markers) were appeared in tomato plant treated with M. jalapa extract

(65) kDa with percentage 8.3%, these bands may be related to

polypeptide markers.

Table (26): Protein content and enzyme activities in tomato plants infected with CMV and treated with biotic extracts (after 7 days).

After 7 days of spraying bioinducers Treatments

Protein content (mg/g FW)

POD (U/g FW) *POD Specific activity

PPO (U/g FW)

*PPO Specific activity

Healthy control 1.05 200.30 190.76 102.00 97.14


M. jalapa extract 1.62 268.90 165.99 150.00 92.59

C. inerme extract 1.41 243.60 172.77 127.50 90.43

Mixture extracts 0.93 253.90 273.01 130.50 140.32


*Specific activity (unit/mg protein)

0

0.5

1

1.5

2

Pro

tein

con

tent

(m

g/g

FW

)

After 7 days of spraying bioinducers

Healthy c. Infected c. M. jalapa


Fig. (22): Effect of bioinducers on protein content in tomato plants infected with CMV (after 7 days).


Table (27): Protein fractions of tomato plants infected with CMV and treated with bioinducers using SDS-PAGE.

Bioinducers MW (kDa) Untreated

plant Infected tomato M Y M+Y K

Polymorphism

70 - - + + - - Polymorphic

65 - - ++ - - - Unique 50 + ++ +++ ++ - + Polymorphic

45 - - ++ ++ +++ ++ Polymorphic 36 - ++ +++ +++ - ++ Polymorphic

35 - - - ++ + - Polymorphic

25 ++ +++ +++ +++ ++ +++ Monomorphic

20 - ++ ++ + ++ ++ Polymorphic

18 ++ +++ ++++ ++ +++ +++ Monomorphic 17 + ++ +++ +++ ++ +++ Monomorphic 14 - + ++ ++ ++ ++ Polymorphic 13 - - ++ - ++ - Polymorphic


Monomorphic (common polypeptide). Polymorphic (specific polypeptide). Unique (polypeptide marker) or (genetic marker). - = Absence of band + = presence of band.

Plate (15): Protein fractions of tomato plants treated with bioinducers post CMV inoculation using SDS-PAGE.

H: Healthy. V: Inoculated control. M: M. jalapa extract. Y: C. inerme extract. M+Y: mixture (Mj+Ci) extracts. K: Kombucha filtrate.


b. Determination the elicited antiviral protein as response to treatment with bioinducers on infected tomato plants after 25 days of spraying:

Protein content was determined in CMV infected tomato plants

treated with bioinducers related to BSA as standard protein. All the

used bioinducers caused an increase in total protein content and

enzymes activity in treated tomato plants. M. jalapa extract induced

highest protein content (2.63 mg/g FW), while the lowest content

(1.07 mg/g FW) was produced by C. inerme extract compared with

healthy and Inoculated control (1.09, 1.21 mg/g FW), respectively

[Table (28) and Fig. (23)].

The tomato plants treated with bioinducers and inoculated with

CMV showed clear varied in number and density of protein. The

variability analysis among four bioinducers appeared 8 protein bands

(Plate, 16); seven protein fractions appeared in treatment with mixture

extracts followed by C. inerme extract give 6 protein fractions, M. jalapa

extract and kombucha filtrate gave the same number of protein fraction

(5), while non treated and infected plants gave 4 and 5 protein fractions,

respectively.

The molecular weight of each polypeptide was determined related to

protein marker (Table, 29). The most prominent alteration (polymorphic

bands) among 4 bioinducers (67, 55, 35, 25, 16 and 14) kDa with

percentage 75%. These bands may be related to antiviral proteins. The

prominent polypeptide bands in all bioinducers (monomorphic or

common polypeptide) were (45 and 18) kDa with percentage 25%. These

bands may be related to tomato plant.


Table (28): Protein content and enzyme activities in tomato plants infected with CMV and treated with bioinducers (after 25 days).

After 25 days of spraying bioinducers Treatments

Protein content (mg/g FW)

POD (U/g FW) *POD Specific activity

PPO (U/g FW)

*PPO Specific activity

Healthy control 1.09 192.80 176.88 160.00 146.79


M. jalapa extract 2.63 274.00 66.16 282.50 107.41

C. inerme extract 1.07 202.20 188.97 150.00 140.19

Mixture extracts 1.11 230.00 207.21 208.50 187.84


*Specific activity (unit/ mg protein)

0

0.5

1

1.5

2

2.5

3

Pro

tein

con

tent

(m

g/g

FW

)

After 25 days of spraying bioinducers



Fig. (23): Effect of bioinducers on protein content in tomato plants

infected with CMV (after 25 days).


Table (29): Protein fractions of CMV infected tomato plants treated with bioinducers using SDS-PAGE.

Bioinducers

MW (kDa) Untreated plant


Polymorphism

67 - - - + ++ - Polymorphic 55 - - ++ ++ ++ - Polymorphic 45 ++ +++ ++ ++ +++ +++ Monomorphic 35 ++ ++ - + ++ + Polymorphic 25 +++ ++ ++ + +++ - Polymorphic 18 ++ ++ ++ ++ ++ ++ Monomorphic 16 - - ++ - ++ - Polymorphic 14 - ++ - - - ++ Polymorphic


Monomorphic (common polypeptide). Polymorphic (specific polypeptide).

- = Absence of band + = presence of band.

Plate (16): Protein fractions of tomato plants treated with bioinducers post CMV inoculation using SDS-PAGE. Mr): Marker. H: Healthy. V: Inoculated control. M: M. jalapa extract. Y: C. inerme extract. M+Y: mixture extracts (Mj+Ci) K: Kombucha filtrate.


2.2- Oxidative enzymes:

Tomato plants treated with bioinducers showed variability in

number and density of polypeptide peroxidase and polyphenol oxidase

isozymes in pre and post CMV infection.

a. Peroxidase isozyme in infected tomato plants and sprayed with bioinducers to control CMV after 7 days of spraying:

1- Activity:

The activity of peroxidase isozyme was increased as response to all

bioinducers treatments. M. jalapa extract induced highest peroxidase

activity (268.9 U/g FW), while the lowest POD activity (243.6 U/g FW)

was produced by C. inerme extract compared with healthy and

Inoculated control (200.3, 217.7 U/g FW) respectively, Fig. (24).

0

50

100

150

200

250

300

PO

D a

ctiv

ity

(U/g

FW

)

Treatments



Fig. (24): Effect of bioinducers on POD activity in tomato plants infected with CMV (after 7days).



The results of the total number of peroxidase isozyme after virus

inoculation was 5 bands (Table, 30).


density polypeptide. Bioinducers induced 5, 3, 4 and 3 polypeptide

bands of M. jalapa, C. inerme, mixture extracts of them and kombucha

filtrate respectively compared with tomato plants untreated and

Inoculated control appeared 3 and 3 isozymes respectively. The

variability analysis of 4 treatments showed isozyme absent or present in

some treatment at RF (1.9, 3.9, 4.5) monomorphic bands common in all

tomato plant treatment with percentage 60%. On the other hand,

isozyme band at (1.5 RF) polymorphic band with percentage 20% was

appeared with the treatment of M. jalapa and mixture extracts and other

band presence with M. jalapa extract treatment at RF (5.1) with

percentage 20% as a unique or genetic marker (Plate, 17).

Table (30): Disc-PAGE banding patterns of peroxidase isozymes of CMV infected tomato plants treated with bioinducers.



RF

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

Pol

ymor

phis

m

1.5 - - 10 + - 10 + - Polymorphic

1.9 25 ++ 45 +++ 20 +++ 30 ++ 20 +++ 30 ++ Monomorphic

3.9 50 +++ 45 +++ 40 ++++ 30 ++ 50 ++++ 55 +++ Monomorphic

4.5 25 ++ 10 ++ 20 +++ 40 ++ 20 +++ 15 ++ Monomorphic

5.1 - - 10 ++ - - - Unique

5 bands 3 3 5 3 4 3

Unique: Genetic marker. Monomorphic: Common polypeptide. Polymorphic: Specific polypeptide. Band density: _ : Absent +: Weak band. +: Moderate band. +++: Strong band. ++++: very strong band.


Plate (17): Native acrylamide gel (7%) electrophoresis of POD

isozymes produced in inoculated tomato plants and treated with bioinducers.

b. Peroxidase isozyme in infected tomato plants and sprayed with bioinducers to control CMV after 25 days of spraying:

1- Activity:

Peroxidase activity was increased in all induced tomato plants

(Fig. 25). Kombucha filtrate induced highest activity (274.5 U/g FW),

while C. inerme extract induced the lowest activity (202.2 U/g FW).

M. jalapa and mixture extracts induced different activity (274.0, 230.0

U/g FW) respectively compared with healthy and Inoculated control

(192.8, 201.9 U/g FW) respectively.


0

50

100

150

200

250

300P

OD

act

ivity

(U

/g F

W)

Treatments



Fig. (25): Effect of bioinducers on POD activity in inoculated tomato plants (after 25-days).


The results of the total number of peroxidase isozyme detected in

tomato plants inoculated with CMV and treated with bioinducers was 5

bands (Table, 31).


density polypeptide. Bioinducers were revealed 5, 5, 3 and 3

polypeptide bands of M. jalapa, C. inerme, mixture extracts and

kombucha filtrate respectively compared with tomato plants untreated

and Inoculated control appeared 3 and 4 isozymes respectively. The

variability analysis of 4 treatments showed isozyme absent or present in


some treatment at RF (3.4, 4.9 and 5.6) monomorphic bands common

in all tomato plants with percentage 60%. Two isozyme bands (5.2 and

6.1 RF) specific polypeptide bands with percentage 40% appearance

with treatment of M. jalapa and C. inerme extracts (Plate, 18).

Table (31): Disc-PAGE banding patterns of peroxidase isozymes of CMV infected tomato plants treated with bioinducers.



RF

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

Pol

ymor

phis

m

3.4 25 ++ 30 +++ 20 ++ 15 ++ 45 +++ 35 ++ Monomorphic

4.9 40 ++ 30 +++ 40 +++ 25 ++ 40 ++ 35 ++ Monomorphic

5.2 - 15 ++ 10 ++ 30 ++ - - Polymorphic

5.6 35 ++ 25 +++ 20 ++ 20 ++ 15 ++ 30 ++ Monomorphic

6.1 - - 10 + 10 + - - Polymorphic

5 bands 3 4 5 5 3 3

Monomorphic: Common polypeptide Polymorphic: Specific polypeptide Band density: _ : Absent. +: Weak band. ++: Moderate band. +++: Strong band


Plate (18): Native acrylamide gel (7%) electrophoresis of POD isozymes produced in tomato plants treated with bioinducers post CMV inoculation.

H: Healthy. V: Inoculated with CMV. M: Treated with Mirabilis extract Y: Treated with Clerodendrum extract. M+Y: Treated with Mirabilis + Clerodendrum extracts. K: Treated with Kombucha filtrate.


c. Polyphenol oxidase isozyme in infected tomato plants and sprayed with bioinducers to control CMV after 7 days of spraying:

1- Activity:

Kombucha filtrate induced highest PPO activity (229.5 U/g FW),

while the lowest PPO activity (127.5 U/g FW) was produced by C.


120.0 U/g FW) respectively, Fig (26).

0

50

100

150

200

250

PP

O a

ctiv

ity (

U/g

FW

)

Treatments



Fig. (26): Effect of bioinducers on PPO activity in tomato plants infected with CMV.



isozyme produced in tomato plants treated with bioinducers pre-CMV

infection was 4 bands, Table (32).

The isozyme bands of tomato plants treated with the 4 bioinducers

were varied in number and density polypeptide. Bioinducers were


induced 4, 4, 3 and 3 polypeptide bands of M. jalapa, C. inerme and the

mixture extracts and kombucha filtrate respectively compared with

healthy and inoculated tomato plants appeared 3 and 3 isozymes,

respectively. The variability analysis of 4 treatments showed isozyme

absent or present in some treatment at RF (1.6, 3.4 and 4.0)

monomorphic bands common in all tomato plants with percentage 75%

and polymorphic specific bands at RF (4.2) with percentage 25%

treatment of M. jalapa and C. inerme extracts (Plate, 19).

Table (32): Disc-PAGE banding patterns of polyphenol oxidase isozymes of CMV infected tomato plants treated with bioinducers.

Bioinducers Untreated

plant Infected tomato M Y M+Y K

RF

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

Pol

ymor

phis

m

1.6 10 + 40 +++ 15 ++ 20 ++ 25 + 15 + Monomorphic

3.4 50 +++ 35 +++ 60 +++ 40 +++ 55 +++ 65 +++ Monomorphic

4.0 40 +++ 25 ++ 15 ++ 25 ++ 20 ++ 20 + Monomorphic

4.2 - - 10 + 15 + - - Polymorphic

4 bands 3 3 4 4 3 3

Monomorphic: common polypeptide. Polymorphic: specific polypeptide. Band density: _ : Absent.

+: weak band ++: moderate band. +++: strong band


Plate (19): Native acrylamide gel (7%) electrophoresis of PPO

isozymes produced in tomato plants treated with bioinducers post CMV inoculation. H: Healthy. V: infected tomato. M: tomato leaf treated with M. jalapa

extract. Y: tomato leaf treated with C. inerme. M+Y extracts: tomato leaf treated with mixture (Mj+Ci) extracts. K: tomato leaf treated with Kombucha filtrate.

d. Polyphenol oxidase isozyme in inoculated tomato plants and treated with bioinducers to control CMV (after 25 days of spraying):

1- Activity:

Tomato plants treated with bioinducers produced an increase in

PPO activity by different unit/g FW. M. jalapa extract was found to be

able to induce the highest activity of PPO in tomato (282.5 U/g FW),

while the lowest activity was (150.0 U/g FW) in case of C. inerme

extract compared with healthy and Inoculated control (160.0, 200.0

U/g FW) respectively, Fig. (27).


0

50

100

150

200

250

300P

PO

act

ivity

(U

/g F

W)

Treatments



Fig. (27): Effect of bioinducers on PPO activity in inoculated tomato plants.

2- Polyphenol activity staining:


isozyme produced in tomato plants treated with bioinducers pre-CMV

infection was 6 bands, Table (33).

The isozyme bands of tomato plants treated with the 4 bioinducers

were varied in number and density polypeptide. Bioinducers were

induced 5, 3, 5 and 4 polypeptide bands of M. jalapa, C. inerme, the

mixture extracts and kombucha filtrate respectively compared with

untreated and infected tomato plants appeared 3 and 4 isozymes,

respectively. The variability analysis of 4 treatments showed isozyme

absent or present in some treatment at RF (1.6, 2.2 and 4.6)

monomorphic common in all tomato plant treatment with percentage


50%. (3.2 and 4.9 RF) specific bands with percentage 33.3%

polymorphic bands appearance may attributed to the influence of each

bioinducers treatment on tomato plants, one unique isozyme (Genetic

marker) for (1.0 RF) of mixture treatment, (Plate, 20).

Table (33): Disc-PAGE banding patterns of polyphenol oxidase

isozymes in inoculated tomato plants and treated with bioinducers.



RF

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

%F

ract

ion

Ban

ds

Pol

ymor

phis

m

1.0 - - - - 15 + - Unique

1.6 35 ++ 45 +++ 40 +++ 25 +++ 35 +++ 25 +++ Monomorphic

2.2 40 ++ 15 ++ 15 ++ 20 ++ 20 ++ 30 ++ Monomorphic

3.2 - 10 + 20 + - - - Polymorphic

4.6 25 ++ 30 ++ 10 ++ 55 ++ 20 ++ 35 ++ Monomorphic

4.9 - - 15 ++ - 10 ++ 10 ++ Polymorphic

6 bands 3 4 5 3 5 4

Unique: genetic marker monomorphic: common polypeptide.Polymorphic: specific polypeptide. +: weak band. ++: moderate band. +++: strong band.


Plate (20): Native acrylamide gel (7%) electrophoresis of PPO isozymes produced in tomato plants treated with bioinducers post CMV inoculation.

We can conclude that, the bioinducers revealed reproducibility

different levels of bicontrol according to the number of protein genetic

markers (Table, 34).

The result after 7 and 25 days of treatment revealed that, M.

jalapa extract has a high level of protein genetic markers

followed by C. inerme and mixture extracts, while kombucha

filtrate has the low level of protein genetic markers.


Table (34): Protein genetic markers of tomato plants produced by bioinducers as indication of systemic acquired resistance against CMV infection.

M. jalapa C. inerme Mixture (Mj+Ci) Kombucha Parameters

After 7 days

After 25 days

After 7 days

After 25 days

After 7 days

After 25 days

After 7 days

After 25 days

SDS-PAGE 6 2 6 2 4 3 4 1

Peroxidase 1 2 - 2 1 - - -

Polyphenol oxidase

1 2 1 - - 1 - 1

Total 8 6 7 4 5 4 4 2

2.3- Photosynthetic pigments content:

Virus infection caused marked reduction in Chl a, Chl b and

carotenoid contents (0.714, 0.514 and 0.662 mg/g FW), while it was

(0.855, 0.761 and 0.742 mg/g FW) in non-infected plants for Chl a, Chl

b and carotenoids, respectively.

Generally tomato plants treated with Mj, Ci, mixture extracts and

kombucha filtrate resulted marked increase in Chl a, Chl b and

carotenoid contents after 7 days of spraying. It is recorded (0.926,

0.920, 0.908 and 0.885 mg/g FW) Chl a, (0.780, 0.813, 0.870 and 0.734

mg/g FW) Chl b and (0.793, 0.744, 1.003 and 0.719 mg/g FW)

carotenoid respectively.

On the other hand, tomato plants treated with Mj, Ci, mixture

extracts, kombucha filtrate and infected with CMV showed marked

increase in Chl a Chl b and carotenoids after 25 days of spraying.


The contents were (1.231, 1.236, 1.031 and 1.195 mg/g FW) Chl

a, (1.107, 1.110, 1.172 and 1.156 mg/g FW) Chl b and 1.669, 1.491,

1.303 and 1.346 mg/g FW) carotenoids of Mj, Ci, mixture extracts and

kombucha filtrate respectively (Table, 35).

From the obtained results, the Mj, Ci, mixture extracts and

kombucha filtrate treatment exhibited an increase of total chlorophyll

pigments and carotenoid contents as a bioinducers.

Table (35): Chlorophyll and carotenoid contents in tomato plants treated with bioinducers after CMV inoculation.

Chlorophyll content

Treatments a b Carotenoids

Healthy plants Untreated 0.855 0.761 0.742

Plants inoculated with virus Virus treated 0.714 0.514 0.662

After 7 days 0.926 0.780 0.793 Sprayed with M. jalapa extract

After 25 days 1.231 1.107 1.669

After 7 days 0.920 0.813 0.744 Sprayed with C. inerme extract

After 25 days 1.236 1.110 1.491

After 7 days 0.908 0.870 1.003 Sprayed with mixture (Mj+Ci) extracts After 25 days 1.031 1.172 1.303

After 7 days 0.885 0.734 0.719 Sprayed with Kombucha filtrate

After 25 days 1.195 1.156 1.346

Chlorophyll content = mg/g FW.


2.4- Determination of total phenols:

Phenols contents in tomato plants were differently affected by

tested bioinducers. It is increased in non-infected plants treated with

M. jalapa extract and kombucha filtrate (49.24 and 48.41 mg/g FW)


23.65 mg/g FW) conjugated phenols respectively. While C. inerme

and mixture extracts produced low phenol contents (33.56 and 32.70

mg/g FW) total phenols, (16.52 and 18.20 mg/g FW) free phenols and

(17.52 and 14.5 mg/g FW) conjugated phenols respectively compared

with healthy and Inoculated controls (32.89 and 31.02 mg/g FW) total

phenols, (14.24 and 10.35 mg/g FW) free phenols and (20.65 and

20.67 mg/g FW) conjugated phenols respectively (Table, 36).

On the other hand, inoculated tomato plants with CMV showed

an increase in phenols content after treating with M. jalapa and

mixture extracts (12.30 and 11.85 mg/g FW) total phenols, (8.71 and

8.58 mg/g FW) free phenols and (3.59 and 3.27 mg/g FW) conjugated

phenols respectively, while kombucha filtrate and C. inerme extract

showed little increase in phenols contents (9.65 and 8.41 mg/g FW)


1.81 mg/g FW) conjugated phenols respectively compared with

healthy and inoculated controls (8.14 and 7.65 mg/g FW) total

phenols, (7.06 and 6.58 mg/g FW) free phenols and (1.08 and 1.07

mg/g FW) conjugated phenols, respectively.


Table (36): Free, conjugated and total phenols content in inoculated tomato plants and treated with bioinducers.

After 7 days of spraying After 25 days of spraying

Treatments

Tot

al

phen

ols

Fre

e ph

enol

s

Con

juga

ted

phen

ols

Tot

al

phen

ols

Fre

e ph

enol

s

Con

juga

ted

phen

ols

Healthy control 32.89 12.24 20.65 8.14 7.06 1.08

Inoculated control 31.02 10.35 20.67 7.65 6.58 1.07

M. jalapa extract 38.59 23.15 15.44 8.60 7.21 2.05

C. inerme extract 31.34 16.92 14.42 8.25 7.56 1.39

Mixture ( Mj+Ci) extracts 32.98 23.44 9.55 7.21 6.82 0.69

Kombucha filtrate 41.24 23.57 17.66 8.25 6.80 1.45

2.5- Total free amino acids content in inoculated tomato plants and treated with bioinducers:

In this analysis, amino acids content in tomato leaves inoculated

with CMV and treated with bioinducers was increased comparing with

healthy and Inoculated controls [Table (37) and Fig. (28)]. After 7

days of applying bioinducers, M. jalapa extract and kombucha filtrate

recorded the highest amount of total amino acids content in tomato

plants (12.22 and 11.82 mg/g FW) respectively followed by mixture

and C. inerme extract (9.30 and 7.04 mg/g FW) respectively compared

with healthy and Inoculated controls (9.05 and 7.34 mg/g FW)

respectively. After 25 days of applying bioinducers, M. jalapa extract

and kombucha filtrate produced the highest amount of total amino

acids in tomato plants (19.04 and 16.03 mg/g FW) followed by C.

inerme extract and mixture extracts (14.29 and 11.49 mg/g FW)


respectively compared with healthy and Inoculated controls (14.04

and 8.48 mg/g FW) respectively.

Table (37): Total free amino acids content in tomato plants treated with bioinducers.

Treatments After 7 days of spraying

After 25 days of spraying

Healthy control 9.05 14.04

Inoculated control 7.34 8.48

M. jalapa extract 12.22 19.04

C. inerme extract 7.04 14.29

Mixture ( Mj+Ci) extract 9.30 11.49

Kombucha filtrate 11.82 16.03

0

2

4

6

8

10

12

14

16

18

20

Fre

e am

ino

aci

ds

con

ten

t (m

g/g

FW

)


Healthy control Infected control M. jalapa


Fig. (28): Effect of bioinducers on total free amino acids in tomato plants infected with CMV.


2.6- Total carbohydrates content in inoculated tomato plants and treated with bioinducers:

Total carbohydrates in tomato plants were increased by using

all tested bioinducers [Table (38) and Fig. (29)]. After 7 days from

applying bioinducers, kombucha filtrate and M. jalapa extract

produced the highest increase in total carbohydrates content (8.11 and

6.27 mg/g FW) respectively in tomato plants infested with CMV

followed by mixture extracts and C. inerme extract (6.8 and 5.95 mg/g

FW) respectively comparing with their respective healthy and

Inoculated controls (5.05 and 4.12 mg/g FW) respectively. After 25

days from applying bioinducers, M. jalapa and C. inerme extracts

produced the highest increase in total carbohydrates content (1.68 and

1.67 mg/g FW) respectively in tomato plants infested with CMV

followed by mixture extracts and kombucha filtrate (1.63 and 1.10

mg/g FW) respectively comparing with their respective healthy and

Inoculated controls (1.56 and 1.09 mg/g FW) respectively.

Table (38): Total carbohydrates content (mg/g FW) in inoculated tomato plants and treated with bioinducers.

Treatments After 7 days of spraying

After 25 days of spraying

Healthy control 5.05 1.56

Inoculated control 4.12 1.09

M. jalapa extract 6.27 1.68

C. inerme extract 5.95 1.67

Mixture ( Mj+Ci) extract 6.8 1.63

Kombucha filtrate 8.11 1.10


0

1

2

3

4

5

6

7

8

9T

ota

l car

bo

hyd

rate

s co

nte

nt

(mg

/g F

W)


Healthy control Inoculated controlM. jalapa C. inermeMixture(Mj+Ci) Kombucha

Fig. (29): Effect of bioinducers on total carbohydrates content in tomato plants inoculated with CMV.

3. Effect of bioinducers on virus infectivity:

All treatments showed different control degrees as reduction of

infection percentage (RI%), when tomato plants were treated post

virus inoculation. The M. jalapa extract is the first in this concern

(50.0%) followed by C. inerme extract (46.8%) then kombucha filtrate

(46.1%), while mixture extracts exhibited the lowest effect (36.6%),

compared with non treated control (0.0%) [Table (39) and Fig (30)].


Table (39): Effect of individual bioinducers on tomato inoculated with CMV.

Treatments Disease incidence % %of R.I. D.S. (%) *Conc.

Inoculated control 100.0 0.0 97.5 86.6

M. jalapa extract 50.0 50.0 28.1 25.0

C. inerme extract 53.1 46.8 36.3 32.2

Mixture ( Mj+Ci) extracts

63.3 36.6 35.4 31.4

Kombucha filtrate 53.8 46.1 29.8 26.5

R.I. = reduction of virus infection. D.S. = Disease severity. *Virus concentration was biology assayed as mean numbers of local lesions.

0

10

20

30

40

50

60

70

80

90

100

Viru

s in

fect

ivity

(%

)

%of infection %of R.I. D.S. (%) Conc.Inoculated control M. jalapaC. inerme Mixture (M+Cl)Kombucha

Fig. (30): Effect of bioinducers on CMV infectivity in tomato plants.

Discussion - 157 -

DISCUSSION

The objectives of this study were induction systemic acquired

resistance in some tomato varieties against virus infection with

Cucumber mosaic cucumovirus (CMV). No strategies are currently

available to completely protect these plants against the virus. There

remains another possibility for the management of this disease which

involves the use of biotic inducers of systemic resistance. We try to

realize this purpose, many experiments were successively to deducing

if induction of systemic acquired resistance was successfully achieved

could also protect tomato against infection by CMV.

PART I

1- Disease incidence and frequency of virus:

Cucumber mosaic cucumovirus (CMV) was more incidence and

frequently among 5 viruses found in the all tomato fields surveyed for

viral diseases in the 5 locations at Qalyoubia Governorate were for

virus infection. So, CMV was chosen as target in this study.

These results are in agreement with those previously recorded by

many investigators after surveying tomato fields for virus infection

(Ganoo and Saumtally, 1999; Elshafie et al., 2005 and Massumi et al.,

2009). For example, Yardimci and Eryigit (2006) collected leaf

samples from 138 tomato (Lycopersicon esculentum) plants showing

symptoms of Cucumber mosaic virus (CMV) in the north-west

Mediterranean region of Turkey. The samples were first tested by double

antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA)

using CMV specific polyclonal antibody. The DAS-ELISA revealed that

Discussion - 158 -

53 of the 138 leaf samples tested were infected with CMV. One of the

ELISA-positive CMV isolates was mechanically inoculated into a set of

indicator plants by conventional leaf inoculation method for further

characterization. In the other study, CMV was the most frequently found

viruses, accounting 23.4% of the collected tomato samples in the

Southeast and Central Regions of Iran (Michael, 2009). Lin et al. (2010)

identified Cucumber mosaic virus (CMV) as the causal agent of several

disease epidemics in most countries of the world. Insect-mediated virus

diseases, such as those caused by CMV, caused remarkable loss of

tomato (Solanum lycopersicon) production in Taiwan.

2- Identification of Cucumber mosaic cucumovirus (CMV):

The CMV isolate used in this study was identified based on

biological and serological properties. Chenopodium amaranticolor was

used as local lesion in all assayed trials. Nicotiana glutinosa showed

severe systemic symptoms in the form of severe mosaic and

malformation was used as propagative host. The isolated virus have a

wide host range of plant species and cultivars, this isolate was shown to

infect 11 species and cultivars belonged to 4 families. Eight species and

cultivars showed systemic symptoms while only 3 species showed local

lesions as local hosts. It is easily mechanical transmitted to healthy

susceptible test plants. Also, transmitted in a non-persistent manner by

both Myzus persicae and Aphis craccivora from infected tomato

(Lycopersicon esculentum) source plants to healthy tomato. In vitro

properties were thermal inactivation point is 70°C, dilution end point 10-4

and the virus completely inactivated after 5 days at room temperature

Discussion - 159 -

(25±3°C). Cytoplasmic inclusions (crystalline and amorphous inclusions)

were found in the epidermic cells of the infected leaves. Dot blot

immunoassay was used for identification of CMV isolate. Obtained

results dealing the isolated virus confirmation were corroboratory with

those recorded in the universal virus database of the International

Committee on Taxonomy of Viruses (ICTVdb, 2010) online updated to

July 2010.

PART II

Systemic acquired resistance (SAR) and control: If defense mechanisms are triggered by a stimulus prior to infection

by a plant pathogen, disease can be reduced. This is the basic theory of

induced resistance, one of the most intriguing forms of resistance, in

which a variety of biotic and abiotic treatments prior to infection can turn

a susceptible plant into a resistant one. Induced resistance is not the

creation of resistance where there is none, but the activation of latent

resistance mechanisms that are expressed upon subsequent, so-called

“challenge” inoculation with a pathogen. Induced resistance can be

triggered by certain chemicals, non-pathogens, avirulent forms of

pathogens, incompatible races of pathogens, or by virulent pathogens

under circumstances where infection is stalled due to environmental

conditions. Plant resistance and induced forms of resistance are generally

associated with a rapid response, and the defense compounds are often

the same. Generally, induced resistance is systemic, because the

defensive capacity is increased not only in the primary infected plant

parts, but also in non-infected, spatially separated tissues. The SAR

defense signalling networks appear to share significant overlap with those

Discussion - 160 -

induced by basal defenses against pathogen-associated molecular

patterns. The nature of the molecule that travels through the phloem from

the site of infection to establish systemic immunity has been sought after

for decades. Accumulation of salicylic acid (SA) is required for SAR,

but only in the signal-perceiving systemic tissue and not in the signal

generating tissue. These observations led to the suggestion that systemic

acquired resistance (SAR) might provide a new strategy for crop

protection, either by discovering compounds that stimulate the plants'

natural disease resistance mechanisms, or by developing transgenic

plants that constitutively express components of the disease resistance

mechanism in order to make them more resistant to pathogen attack

(Lancioni, 2008).

Upon primary infection or insect attack, plants develop enhanced

resistance against subsequent invaders. A classic example of such a

systemically induced resistance is activated after primary infection with a

necrotizing pathogen, rendering distant, uninfected plant parts more

resistant towards a broad spectrum of virulent pathogens, including

viruses, bacteria and fungi. This form of induced resistance is often

referred to as systemic acquired resistance (SAR) and has been

demonstrated in many plant–pathogen interactions (Walter et al., 2007).

Firstly, histopathological, histochemical, total RNA and

molecular changes between treated and non-treated plants with bio-

inducers were demonstrated. Comparison between histochemical,

total RNA and molecular changes were made after 7 (pre-inoculation)

and 25 (post-inoculation) days from spraying with inducers. Virus

infectivity was biologically measured to insure of SAR induction.

Discussion - 161 -

Histopathological Studies:

Histopathological changes (as indicator to SAR) in tomato leaf

tissues sprayed before 7 days with inducers and pre-virus inoculation

were examined. Progressive increasing in lignin accumulation in

epidermal cells, number of hairs, thickness of blade, number of xylem

arms and phloem layers. The alterations included tissue-shrinkage,

intense staining and precipitation of lignin in sub stomatal cavity,

mesophyll cell showing folding and layering of cell wall and remains of

host palisade cell walls. Histopathological changes simultaneity with

elicitation of systemic acquired resistance was tend toward growth

enhancement in the sprayed plants with tested bio-inducers than those

untreated ones.

Foliar application of elicitors showed in most cases a significant

increase in plant growth parameters. These increases may be attributed

to elicitors effect on physiological processes in plant such as ion

uptake, cell elongation, cell division, enzymatic activation and protein

synthesis. In this concern, SA enhanced growth of plants. Plants

respond to pathogen attack or elicitor treatments by activating a wide

variety of protective mechanisms designed to prevent pathogen

replication and spreading (Farouk et al., 2008).

Passive defenses include the presence of preformed surface wax

and cell walls, antimicrobial enzymes, and secondary metabolites. The

plant cell wall is the first and the principal physical barrier. This

cellulose-rich structure consists of a highly organized network of

polysaccharides, proteins, and phenylpropanoid polymers that forms a

resistant layer surrounding the cell plasma membrane. Cutin, suberine,

Discussion - 162 -

and waxes also provide protection through the reinforcement of the

epidermal layer of the leaves (Lancioni, 2008).

Lignin is a phenolic polymer. It is the second most abundant bio-

polymer on Earth (after cellulose), and plays an important role in

providing structural support to plants. Its hydrophobicity also facilitates

water transport through the vascular tissue. Finally, the chemical

complexity and apparent lack of regularity in its structure make lignin

extremely suitable as a physical barrier against insects and fungi

(Vermerris and Nicholson, 2006). Lignins are extremely resistant to

microbial degradation and are often induced at sites of pathogen

infection, playing important roles in cell wall reinforcement and,

consequently, increased defense response against infection. The

induction of lignin synthesis or lignin-related genes after virus challenge

has been reported in incompatible interactions in herbaceous plants.

Lignification is seems to help prevent viral infection (Freitas-Astúa et

al., 2007).

Total Protein:

In this study, total protein including biosynthesis proteins (free,

conjugate, pathogenesis-related enzymes, their isozymes and antiviral)

was determined with different techniques and many types of proteins

were found as response to induction treatments. Proteins have a

distinguish role in the resistance to many phytopathogens either before or

after pathogen challenged leaves. The quantitative, qualitative and

activity of antiviral proteins as protein content, patterns, isozymes of

peroxidase and polyphenol oxidase were determined using SDS-PAGE

Discussion - 163 -

as response to sprayed tomato plants with tested electors pre and post

virus inoculation.

Quantitative proteins of induced cucumber plants were

determined using SDS-PAGE, the results indicated that, a new pattern

of proteins were produced, as well as, different increasing in the

density of bands among biotic inducers treatments. It has been

suggested that, the induced proteins may help to limit virus spread or

multiplication (Abu-Jawdah, 1982; Mahmoud, 2000 and Chen et

al., 2006). The continuous accumulations of newly-induced proteins

may help in the localization of viral infection; the reverse is not true,

since the presence of a non significant amount of induced proteins is a

necessary condition to the observed systemic infection.

Based on current knowledge of the biochemistry of resistance, it

can be concluded that SAR results from the expression of several

parameters, including changes in cell wall composition and de novo

synthesis of phytoalexins and PR (pathogenesis related) proteins.

Moreover, the local de novo synthesis of phytoalexins is often related

to the induced resistance stage (Walter et al., 2007).

Botanical Antiviral (Antiviral protein):

The present work was carried out with an objective to Screen

promising botanicals Mirabilis jalapa (Nyctaginaceae), Clerodendrum

inerme (Verbenaceae) and their mixture for their antiviral activity

against CMV in tomato plants.

The botanicals may induce resistance or they themselves may

act as inhibitors of viral replication. Ribosome Inactivating Proteins

Discussion - 164 -

(RIPs) and glycoproteins may block the replication sites. A mobile

inducing signal may be produced in treated leaves after the botanical

resistance inducers bind with the host plant surface. This signal

produces virus-inhibiting agent in the entire plant system. Certain low

molecular weight pathogenesis related proteins might also playa, role

in the induction of systemic acquired resistance. Thus, biologically

active compounds present in plant products act as elicitors and induce

resistance in host plants resulting in reduction of disease development

(Verma et al., 1998).

The roots, leaves and stem of Mirabilis jalapa show high

inhibitory activity against plant viruses. Verma and Kumar (1980)

showed that M. jalapa leaf extract suppressed the disease symptoms

on a few systemic hosts when the extract was used! as a foliar spray 24

h prior to virus inoculation.

Foliar sprays of the M. jalapa leaf extract caused marked symptom

suppression, improved growth and flowering and considerably reduced

the virus multiplication rate in cucumber treated against CMV. The aphid

and whitefly (Bemisia tabaci) populations were much lower on treated

than control plants (Verma and Kumar, 1982).

Antiviral protein designated as MAP [Mirabilis antiviral protein,

30 kDa (ribosome inactivating proteins, RIPs)] extracted from roots

and leaves of M. jalapa was highly active against mechanical

transmission and almost complete inhibition of cucumber mosaic

cucumovirus (Kubo et al., 1990). Hersanti (2005) reported that leaf

extract of Mirabilis jalapa is one agent induced systemic resistance

against the attack of red pepper by CMV.

Discussion - 165 -

A novel single resistance inducing protein (Crip-31) was

isolated and purified from the leaves of Clerodendrum inerme, which

is a very potent, highly stable, basic in nature, 31 kDa in molecular

mass having hydrophobic residues and induces a high degree of

localized as well as systemic resistance against three different groups

of plant viruses (i.e. CMV, PVY and ToMV), which differ at their

genomic organization and having different replication strategies,

infection in susceptible host Nicotiana tabacum. Minimum amount of

purified preparation sufficient for systemic resistance induction was ~

25 µgml−1. The systemic inhibitory activity of the Crip-31 provides

protection to whole plants within 40–60 min of its application. The

systemic resistance inducing properties of this protein can be of

immense biological importance, as it is similar to ribosome

inactivating proteins (RIPs) (Praveen et al., 2001).

The chemical constituents of the Clerodendrum genus were

isolated, identified and biotechnological prospects also characterized.

The major chemical constituents present in this genus were identified

as phenolics, flavonoids, terpenes, steroids and oils (Shrivastava and

Patel (2007).

Kombucha tea is never static. New acids and nutrients are

constantly created and combined, into ever-changing – though predictable

zymurgy (Chen and Liu, 2000). Kombucha contains many different pro-

biotic cultures along with several organic acids, active enzymes, amino

acids, anti-oxidants, and polyphenols.

Accordingly, anti-infective activity may induce one or more of

the following activities:

Discussion - 166 -

In the mechanism of action for any of the antiviral proteins,

there are only tantalizing hints as to where the block occurs in the

virus life cycle. The process of virus infection of a plant can be

separated into two phases establishment and replication. Events which

occur during the establishment phase include initial wounding by

abrasion or a vector, cell penetration and virus uncoating. Replication

is characterized by the various viral nucleic acid and viral protein

synthesis, reassembly of the virion, and subsequent movement into

another cell or another part of the plant. Determining effects on

establishment or replication by utilizing tissue assay are hampered by

the fact that, the period during which the uncoating of the virus

inoculum occurs overlaps the initiation of viral protein and nucleic

acid synthesis (Goodman et al., 1986 and Matthews, 1991).

Considers an inhibitor be an inhibitor of replication of its

effective when applied 5 to 8 hours after virus inoculation

(Loebenstein, 1972). Four types of antiviral protein activities have

been characterized, and some antiviral proteins have been capable of

more than one activity. The activities were (1) Aggregation, (2)

Inhibition of establishment, (3) Induction of a systemic viral resistant

state and (4) Inhibition of replication by inactivation of protein

synthesis, cited from Chessin et al. (1995).

(1) Aggregation: obviously, aggregation is purely a physical

phenomenon, depending on ionic conditions and concentration,

(Kassanis and Kleozkowski, 1948 and Kumon et al., 1990). As a

resulting the antiviral proteins may able to form a precipitate with virus.

Discussion - 167 -

(2) Inhibition of establishment: The virus coat proteins (also virus

genome) compete with AVP for attachment in cell receptors. Whereas

(Mahmoud, 2000) postulated that, the AVP similar to coat protein in

amino groups. These cell receptors might be of common importance to

both virus and infection RNA in early phases of virus establishment.

These sites probably possess a strong affinity for certain amino groups in

the AVP show a stronger reactivity in this respect than similar groups in

the coat protein similar groups in the coat protein of complete virus or

virus RNA. Therefore, AVP may be substitute for the virus particles. It is

well known that, amino groups are necessary in virus to preserve its

biological activity: This hypothesis was confirmed by amino acid

composition for AVP, whereas it had relatively highly content of basic

amino acid and lysine.

(3) Induced of systemic resistance: several plant viruses induce

systemic resistance to virus. A protein virus inhibitory agent (VIA)

can be isolated from the resistant tissue (Faccioli et al., 1994).

(4) Ribosome inactivation: RIPs (ribosome inactivation

proteins) damage ribosomes so that elongation step of protein

synthesis in efficiency prevented. Specifically, RIPs depurinate the

adenine at position 4324 in mammalian 28S rRNA and position 3017

in plant 25S rRNA rendering the 60S ribosomal subunit in capable of

binding EF-2 (Stripe et al., 1992). Generally, RIPs cannot depurinate

prokaryotic ribosomes but can modify naked 235 rRNA (Wood et al.,

1992 and Endo et al., 1988).

Meanwhile, Mirabilis jalapa (Nyctaginaceae), containing a

ribosome inactivating protein (RIP) called Mirabilis antiviral protein

Discussion - 168 -

(MAP), against infection by potato virus X, potato virus Y, potato leaf

roll virus, and potato spindle tuber viroid. Root extracts of M. jalapa

sprayed on test plants 24 h before virus or viroid inoculation inhibited

infection by almost 100%, as corroborated by infectivity assays and

the nucleic acid spot hybridization test (Vivanco et al., 1999). MAP

was highly effective in inhibiting TSWV at 60% saturation. A

minimum concentration of 400µg/ml of MAP was sufficient to inhibit

TSWV (Devi et al., 2004). In addition, Mirabilis antiviral protein

(MAP) was isolated from roots and leaves of M. jalapa L. which

possess repellent properties against aphids and white flies. MAP

showed antiviral activity against mechanically transmitted viruses but

not against aphid transmitted viruses (Vivanco et al., 1999).

Two systemic antiviral resistance-inducing proteins, CIP-29 and

CIP-34, isolated from Clerodendrum inerme leaves, for ribosome-

inactivating properties. CIP-29 has a polynucleotide: adenosine

glycosidase (ribosome-inactivating protein), that inhibits protein

synthesis both in cell-free systems and, at higher concentrations, in

cells, and releases adenine from ribosomes, RNA, poly (A) and DNA.

As compared with other known RIPs, CIP-29 deadenylates DNA at a

high rate, and induces systemic antiviral resistance in susceptible

plants (Olivieri et al., 1996).

Chemical analysis of clavillia (Mirabilis jalapa) was rich in

many active compounds including triterpenes, proteins, flavonoids,

alkaloids, and steroids. Purified an antiviral proteins from roots,

shoots, leaves, fruits, and seeds of M. jalapa are employed for

different affections. Thus, information about the reproductive pattern

Discussion - 169 -

of this culture is important for implementing experimental procedures

(Leal et al., 2001). MAPs in clavillia as being effective in protecting

economically-important crops (such as tobacco, corn, and potatoes)

from a large variety of plant viruses (such as tobacco mosaic virus,

spotted leaf virus and root rot virus) (Vivanco et al., 1999).

In the present study, applying biotic inducers (M. jalapa, C. inerme,

mixture and kombucha) pre- and post- virus inoculation resulted in an

increase in bio-chemical components i.e total sugars and total free amino

acids content which increased in treated plants to increase the plant

tolerant of infection. These results were agreed with (Kahler and Allard,

1981; Coseteng and Lee, 1978 and Doebley, 1989).

Kombucha tea contains among its symbiotic structure (bacteria

and yeasts) a like-endophytic bacteria named Gluconacetobacter

kombuchae sp. nov. can fixing atmospheric nitrogen which utilized for

plant growth (Dutta and Gachhui, 2007).

Jayabalan et al. (2007) in addition to polyphenolic compounds

found that, concentration of acetic acid has reached maximum up to 9.5

g/l in green tea kombucha on 15th day and glucuronic acid concentration

was reached maximum up to 2.3 g/l in black tea kombucha on 12th day of

fermentation. Köhler and Köhler (1985) observed that glucuronic acid

is able to combine with over two hundred known toxins within the plant

cell and these included substances absorbed from acidic and radioactive

rains and specific chemical groups such as nitrites as well as atmospheric

pollutions from the gases sulphur dioxide and ozone. Most surprising was

the discovery that Kombucha offers genetic protection so that growth

patterns are normalised after disruption by endogenic or exogenic

Discussion - 170 -

poisons. The implications of this for the survival of many species of

plants that have suffered considerable damage as a result of global

environmental pollution are remarkable.

So, we can transpire an important role of kombucha as bioelictor

can be enhanced plant growth and induction systemic acquired

resistance (SAR) against phytopathogens. Possibility of using the

kombucha as bioantiviral against plant viruses is available now.

Enzymes and Isozymes Activities:

SAR in cucumber is correlated with increasing in peroxidase

activity, as well as polyphenol oxidase (PPO) in N. glutinosa (Ali et

al., 2006). In addition, proteins and isozyme polymorphisms are good

indicators of response to biotic and abiotic stresses (Doebley, 1989).

The time course of accumulation of novel proteins was very

essential to accumulate pathogenesis related proteins; such proteins

had been found to play a key role in inducing strong systemic

resistance in susceptible host against viruses (Devi et al., 2004 and

Effmert et al., 2005).

Peroxidases (PO) have been found to play a major role in the

regulation of plant cell elongation, phenolic compounds oxidation,

polysaccharide cross-linking, Indole acetic acid oxidation, cross-linking

of extension monomers and mediate the final step in the biosynthesis of

lignin and other oxidative phenols. PO and PPO activities were greater in

the plants treated with mixtures of rhizobacteria and endophytic bacteria

and challenged with viruliferous aphids, compared to control plants. PPO

can be induced through octadecanoid defense signal pathway and it

Discussion - 171 -

oxidizes phenolic compounds to quinines, and the enzyme itself is

inhibitory to viruses by inactivating the RNA of the virus. Enhanced PPO

activities against disease and insect pests have been reported in several

beneficial plant–microbe interactions (Harish et al., 2009).

Activities of POD in infected leaves tended to increase during

the first phase post-inoculation. After that, POD activities of CMV

singly infected leaves declined first. Whereas the activities of CMV

and satRNAs co-infected leaves increased till day 30 and declined

continuously thereafter (Shang et al., 2009).

Salicylic acid as signal for pathogenesis-related proteins:

When pathogen infection induces a necrotic lesion many

biochemical changes take place. Among these are the induction of the

phenylpropanoid pathway which leads to the synthesis of flavonoids

and lignins and to the synthesis of SA. The SA is released into the

phloem, where it is translocated throughout the plant and is eventually

perceived by its target cells, which comprise the leaf mesophyll cells

and possibly other cell types. Presumably, SA binds a receptor which

transduces the signal, by a process that is apparently independent of

protein synthesis, leading to the induction of a number of genes to

very high levels in the target cells. The proteins synthesized from

these genes then act cooperatively to protect the plant from further

infection by other pathogens (Wray, 1992).

Salicylic acid (SA) belongs to phenolic group and is ubiquitous in

plants. SA is involved in signal transduction, pondering over the plant

resistance to stress and generates significant impact on photosynthesis,

Discussion - 172 -

transpiration, uptake and transport of ions and growth and development.

The increases in endogenous levels of SA either paralleled or preceded

the increase in expression of PR genes and development of SAR.

Salicylic acid SA accumulation is essential for expression of multiple

modes of plant disease resistance (Hayat and Ahmad, 2007).

SA was measured quantitatively in situ Nicotiana tabacum L.

cv. Xanthi-nc leaves inoculated with Tobacco mosaic virus (TMV).

The biosensor revealed accumulation of apoplastic SA before the

visible appearance of hypersensitive response (HR) lesions (Huang et

al., 2006).

Present study revealed that endogenous levels of SA were

increased as response to spraying with tested bioelicitors especially

kombucha.

The rapid accumulation of salicylic acid after Cucumber mosaic

virus inoculation leads to increase in activity of enzymes known to be

involved with systemic acquired resistance such as phenylalanine

ammonialyase, and peroxidase. Salicylic acid is assumed to be the

systemic signal molecule that induces synthesis of pathogenesis-related

proteins and/or other components of systemic acquired resistance.

Salicylic acid activates resistance mechanisms such as phytoalexin

production, proteinase inhibitors, cell wall strengthening and

lignification. Phenylalanine ammonialyase (PAL) catalyses the

deamination of phenylalanine to produce transcinnamic acid, the first step

in controlling the rate of phenylpropanoid metabolism. The production of

phenylpropanoid compounds is important in plant development, plant-

microbe signalling and plant defense. Peroxidase (POX) enzymes

Discussion - 173 -

involved in the oxidation of phenols to more toxic quinones, are known

to increase in several infected plants (Sudhakar et al., 2007).

Salicylic acid (SA) application on tobacco enhanced the resistance

to CMV and the resistance was shown to be due to inhibition of systemic

virus movement. Induction of resistance to CMV occurred via signal

transduction pathway that may also be triggered by antimycin A, an

inducer of the mitochondrial enzyme alternative to oxidase (AOX). In A.

thaliana inhibition of CMV systemic movement was also induced by SA

and antimycin A. In squash (Cucurbita pepo), SA-induced resistance to

CMV was attributed to the inhibition of virus accumulation in directly

inoculated tissue most likely through inhibition of cell-to-cell movement.

Different host plant species may adopt markedly different approaches to

tackle infection by the same virus. It is essential that adequate caution has

to be exercised, while attempting to apply findings on plant-virus

interactions from model systems to a wider range of host species

(Mayers et al., 2005).

The obtained result from quantification of endogenous SA using

HPLC in induced tomato plants were agreed with percentage of

infection, disease severity and CMV concentration.

The same trend was observed by many authors (Vernooij et al.,

1995; Dong and Beer, 2000; Mahmoud, 2003; Abo El-Nasr et al.,

2004; Megahed, 2008 and Taha, 2010).

An increase in endogenous salicylic acid in tobacco infected

with TMV caused a hypersensitive response with systemic induction

of PR proteins (Yalpani et al., 1991). Raskin (1992) found that, it is

Discussion - 174 -

possible that SA is an endogenous messengers that activities important

element of host resistance pathogens.

Endogenous SA is a key signal, involved in the activation of plant

defense responses to fungal, bacterial and viral attacks. Classical studies

performed on tobacco plants, infected with tobacco mosaic virus (TMV)

demonstrated a substantial SA accumulation in these plants, an

acquirement of resistance to subsequent infection, and the development

of systemic resistance in these plants. In 1990s, a correlation was found

between SA content in plants and their resistance to the virus. A necessity

of SA for the development of plant resistance to TMV was substantiated

by using transgenic plants. Later, the involvement of SA in the

development of plant resistance to other pathogens was also shown. Plant

treatment with SA is one of the most efficient ways to protect plants

against unfavorable biotic and abiotic environmental factors (Hayat and

Ahmad, 2007).

Photosynthetic pigments:

Photosynthetic pigments content were positive markedly

affected as result to using the four tested bioelicitors and became one

of visible evidence of sufficient of treatments.

The Chl a and b contents slightly increased with the growth of

N. glutinosa, irrespective of infected N. glutinosa with CMV. There

was no great difference in Chl a and b contents between infected or

healthy leaves after the first week of virus infection, however, 30 days

after virus infection, the infected leaves had a significantly lower Chl

content compared to healthy leaves. Meanwhile, the Chl a/b was not

Discussion - 175 -

significantly influenced by viral infection. Chl content was higher in

CMV infected leaves by using both satRNAs together than by using

single satRNA (Shang et al., 2009).

Repression in gene expression was also observed for some

transcripts that code for the key chlorophyll synthesis enzymes

protoporphyrin IX magnesium chelatase and glutamyl-tRNA

reductase (GluTR) suggesting that, as expected, the presence of the

virus has influence on photosynthesis as well, even before the

appearance of macroscopic symptoms (Freitas-Astúa et al., 2007).

These results are in harmony with the study carried by Farouk et

al. (2008) who recorded that, the application of elicitors increased the

total chlorophyll content of the cucumber plants. This increment may be

due to stimulating pigment formation and enhancing the efficacy of

photosynthetic apparatus with a better potential for resistance and

decrease in photophosphorylation rate usually occurring after infection.

Elicitors were found to increase potassium content, which may increase

the number of chloroplasts per cell, number of cells per leaf and

consequently leaf area. SA increased significantly photosynthetic

pigments content. Moreover, SA proved to decrease ethylene production

and subsequently increased chlorophyll, and activated the synthesis of

carotenoids which protect chlorophyll from oxidation and finally

increased chlorophyll content as reported in this study.

In fact, in a compatible host-pathogen interaction, studying the up-

regulated genes is very important, but a careful review of repressed ones

can be relevant as well. The repressed genes can lead to important cues to

understanding viral interference in plant metabolism in order to establish

Discussion - 176 -

an adequate environment for the development of the disease. Repression

of genes involved in chlorophyll synthesis has been found not only in

plants undergoing biotic, but also abiotic- such as cold-stress. Similarly, it

has been shown that enzymes involved in the photorespiratory pathway,

may play an important role in the response not only to biotic, but also to

abiotic stress (Freitas-Astúa et al., 2007).

It appeared from our results that biotic inducers treatment

induced tomato plants for increasing total chlorophyll pigments and

carotenoids contents as an indication of systemic acquired resistance

and help infected tomato plants to tolerant the virus infection (as

bioinducer agents), while M. jalapa extract and kombucha filtrate

gave the high content of chlorophyll pigments and C. inerme and

mixture extracts gave the lowest chlorophyll content in two cases.

In order to examine the effect of used inducers on the plant

challenged with the virus chlorophyll content was analyzed result in

increasing the percentage of chlorophyll a, b and carotenoids related

to healthy plants may be due to that biotic inducers induce signal

suppress or inhibit virus replication and reduce its spread.

Many plant infections are the cause of localized changes in

chloroplasts and modify their structures and function (Zaitlin and

Hull, 1987 and Galal, 2006). The effect of pathogens on chloroplasts

and cellular processes might be translated into effects on growth and

yield through shifts in carbohydrate metabolism, source-sink

relationships, biomass partitioning between roots and shoots, etc

(Balachandran et al., 1997).

Discussion - 177 -

Chlorophyll lowering was noticed more in a than b in treated

plants comparable to the untreated which mean that virus infection

lead to destroy chlorophyll a at the expense of b. The decrease in

chlorophyll is considered to be a symptom of oxidative stress

condition this decrease after virus infection might be due to the

generation of reactive oxygen species (ROS) causing damage to

chlorophyll a that is mean the plant failed to capture the light and so

photosynthesis will decrease or stopped (Ali et al., 2006).

Phenolic compounds:

Usually increased as response to plant defense against

pathogens or as elicitation by some biotic and abiotic inducers. In this

study, phenol contents were increased after treatments of M. jalapa

extract and kombucha filtrate, C. inerme and mixture extracts either

before or after inoculation with tested virus isolate.

Phenolic acids are generally not abundant in most plants. There

are a few exceptions: gallic acid and salicylic acid (SA). Gallic acid is

a precursor for the ellagitannins and gallotannins. Salicylic acid is an

important defense compound because it mediates systemic acquired

resistance (SAR), a resistance mechanism whereby SA is used as a

signaling molecule to relay information on pathogen attack to other

parts of the plant. Upon receiving the SA signal, a general defense

response is activated that includes the biosynthesis of pathogenesis-

related (PR) proteins (Vermerris and Nicholson, 2006).

Plants have several lines of defense against invading pathogens

including preformed barriers and induced responses. Systemic acquired

Discussion - 178 -

resistance is characteristically associated with accumulation of salicylic

acid, enhanced expression of pathogenesis-related proteins and activation

of phenylpropanoid pathway, leading to the synthesis of higher phenolic

compounds. Phenolics have been associated extensively with the defense

of plants against microbes, insects and other herbivores. A number of

phenols are regarded as pre-infection inhibitors, providing the plant with

a certain degree of basic resistance against pathogenic micro-organisms.

Phenol metabolism and cell wall lignification are thus involved in, and

have consequences for, a number of cellular, whole plant and ecological

processes, that might even provide plants, the immunity against

destructive agents. Several associations have been reported between

phenolics and the resistance of plants to pathogen. Phenolic acids are

involved in phytoalexin accumulation, biosynthesis of lignin and

formation of structural barriers, which play a major role in resistance

against the pathogen (Sudhakar et al., 2007).

It can be easily imagined that, the antimicrobial products of

peroxidase restricts the development of challenging Cucumber mosaic

virus. Peroxidase also catalyses the condensation of phenolic

compounds into lignin and is associated with disease resistance in

plants (Hammerschmidt et al., 1982).

Discussion - 179 -

Amino acids:

Amino acids are the smallest unit in protein structures. The

primary structures of a protein defines the sequence of the amino acid

residues and is dictated by the base sequence of the corresponding

gene(s). Phenolic compounds, enzymatic activity and pathogenesis-

related (PR) proteins are closely related with amino acids. Production

of a new and more amino acids as result to using biotic inducers were

achieved in this study.

It has become clear that there is yet another systemic resistance

phenomenon in plants: RNA silencing. In contrast to SAR and ISR,

RNA silencing is highly specific with respect both to its induction and

activity. RNA silencing is a homology-based RNA degradation

mechanism that probably occurs in all eucaryotes, including plants. In

plants, it appears to function, at least in part, as a defense mechanism

against viruses (Gilliland et al., 2006).

Nucleic Acids:

There are many types of RNAs in the cells of the plant

especially after infection with phytopathogens (fungi, bacteria and

viruses). Some of these closely related with viruses or viroids or virus-

plant interactions. RNA with different sequences was a rise as product

of many physiological processes. In this study, mRNA from plant

cells was induced and elicited pathogenesis-related (PR) proteins

during the induction of systemic acquired resistance (SAR) as

response to spraying tomato plants with the tested biotic inducers

before virus-inoculation.

Discussion - 180 -

Nine classes of mRNAs that accumulate to high levels in

uninfected leaves during the induction of SAR in tobacco have been

identified. The leaves of several plants were pooled and RNA was

extracted. The accumulation of mRNA for PR-1 acidic, PR-1 basic, class

I, II and III glucanase, class I, II, III and IV chitinase, PR-4, PR-5,

SAR8.2 and the lignin-forming peroxidase was determined in these

samples by northern blot analysis. Within 2-4 h after SA treatment RNA

accumulation was dramatically increased for PR-1 acidic, PR-1 basic,

class II and III glucanase, class II, III and IV chitinase. PR-4, PR-5 and

SAR8.2. There was not a consistent increase in the mRNA for class I

glucanase, class I chitinase or the lignin-forming peroxidase (Wray,

1992).

Experiments with Tobacco mosaic virus (TMV) and Potato virus

X (PVX), leaf disks which had been pretreated with SA reduced the

overall accumulation of viral RNA. In tobacco and Arabidopsis, the

defense signal transduction pathway branches downstream of SA

which triggers induction of resistance to DNA and RNA viruses

(Harish et al., 2009).

Molecular marker for SAR:

Hooft Van Huijsduijnen et al. (1986) stated that, in at least 16

plant species, the hypersensitive response to virus infection is

accompanied by the de novo synthesis of 'pathogenesis-related' (PR)

proteins. The association of these proteins with systemic acquired

resistance led to the suggestion that they function in a defence

mechanism. This hypothesis is supported by spraying tobacco plants with

Discussion - 181 -

salicylic acid or acetylsalicylic acid that induces both the synthesis of PR

proteins and resistance to infection with tobacco mosaic virus (TMV).

Moreover, a tobacco hybrid that produces PR proteins constitutively is

highly resistant to TMV infection. To learn more about the functions of

PR proteins, we cloned and sequenced DNA copies of the mRNAs for

the PR-1 proteins of tobacco. This revealed a 90% amino acid sequence

homology between PR-la, -lb and -lc, and showed that PR-1 proteins are

derived from precursors by removal of a signal peptide of 30 amino

acids. This is consistent with the observation that PR proteins accumulate

in the intercellular spaces of the leaf. A 14000 mol. wt. (14K) protein of

tomato (p 14) which is induced by infection with TMV or viroids has a

60% amino acid homology with the tobacco PR-1b protein. An

antiserum against p14 was shown to cross-react with tobacco PR-1

proteins and a PR protein from cowpea, indicating that PR proteins from

different plant species may be closely related.

Our working hypothesis has been that genes responsible for

maintaining an induced resistant state would be expressed at all in

healthy, uninduced tissue, and their expression would increase

concomitantly with the onset of SAR. We refer to genes that would fulfill

these criteria as SAR genes. To determine which of the isolated cDNAs

represented SAR genes, their expression was correlated with the onset of

SAR.

Molecular and biochemical results revealed that the mRNAs for

this gene began to accumulate after one day of treatment and reach to

high levels at 6th day. This mRNA was expressed in untreated and

treated plants but increased about two folds in treated plant. PCR

Discussion - 182 -

approach allowed us to correlate the expression of PR-1a gene with

the early stage of ISR formation, so samples of treated tomato plants

with four biotic inducers were taken after 7 days treatment to correlate

the onset of ISR with the induction of gene expression. RT-PCR of

mRNA PR-1a gene isolated from tomato plants treated with biotic

inducers was used to amplify a fragment of about (182 bp) using

primers according to Van Loon (1999).

In the present study, PR-1a mRNA accumulation was examined

in a time course experiments during the early stage of filtrate, the

expression pattern was investigated by using PCR approach this

method which is more sensitive, allowed the examination of the

expression of PR-1a gene through the use of specific primers. PR-1a

elicited gene was molecularly detected via RT-PCR and sequenced,

then identified compared with the related genes in the Gen-Bank.

The six SAR-related gene families include pathogenesis-related

protein 1 (PR-1), (3-1,3-glucanases, chitinases, protease inhibitors,

pathogenesis-related protein 4 (PR-4) and SAR8.2. The PR-1 family

comprises at least four members that can be grouped into two classes.

Class I includes the acidic, extracellular proteins PR-la, PR-lb and PR-

lc. Class II includes the basic isoform of these proteins which has only

one species identified so far. The function of the PR-1 family is

currently unknown; however, a wealth of data concerning the

characterisation and localisation of the protein, as well as studies on

the PR-1 gene family and its regulation of expression, have been dealt

with in recent reviews (Wray, 1992).

Discussion - 183 -

Many conditions have been described to induce SAR as well as

defence related proteins. Particularly, the expression of a PR-1 gene or

protein is usually taken as a molecular marker to indicate that SAR

was induced. All PR-1 genes in plants appear to be inducible by SA,

and endogenous production or exogenous application of SA has been

shown to be both necessary and sufficient to elicit the induced state.

Pathogen induced synthesis of SA in tobacco is considered to occur

from benzoate, whereas the evidence in Arabidopsis points to

isochorismate as the immediate precursor (Walter et al., 2007).

Plants are challenged by a variety of abiotic and biotic stresses.

The differential activation of distinct sets of genes or gene products in

response to these challenges is referred to as specificity. SA is a key

regulator of pathogen-induced systemic acquired resistance (SAR).

The SA involved plant defense responses are characterized as species

specific. Even in two phylogenetic closely related plant species such

as tomato and tobacco, the SA-dependent defense pathway does not

trigger the same defense responses (Peng et al., 2004).

In case of viruses, SA promotes the inhibition of viral replication,

cell-to-cell movement and also long-distance movement. SA has been

shown to modulate HR-associated cell death, reactive oxygen species

(ROS) level, activation of lipid peroxidation and generation of free

radicals, all of which could potentially influence plant defense against

pathogens. SA at low concentrations also promotes the faster and

stronger activation of callose deposition and gene expression in response

to pathogen or microbial elicitors, a process called 'priming', which

contributes to induced defense mechanisms. The increases in endogenous

Discussion - 184 -

levels of SA either paralleled or preceded the increase in expression of

PR genes and development of SAR. Elevated levels of SA and

constitutive expression of the PR genes also correlated with elevated

resistance to TMV in a Nicotiana glutinosa x N. debneyi hybrid (Hayat

and Ahmad, 2007).

Plant responses to pathogens are a multilayer network of defence

reactions, which try to limit and eventually stop the invading microbial

pathogen. The reactions include the rapid generation of reactive oxygen

species, cross-linking of cell wall polymers, the production of

antimicrobial pathogenesis-related proteins, and low molecular weight

phytoalexins. The network of responses requires common signalling

pathways and one key compound is salicylic acid (SA). When invaded

by pathogens, resistant plants induce defence reactions both locally and

in distant organs. Of interest in this study is the regulation of gene

expression by SA and its analogues which are useful tools for elucidating

SA-signalling pathways (Eichhorn et al., 2006).

Carbohydrates and carbohydrate complexes:

Carbohydrates and carbohydrate complexes, beside other

polymers make the supported cytoskeleton of the plant cells, as well

as binding with proteins to form glycoproteins which referred to as

post-translational modification during biosynthesis of proteins.

Numerous reports have indicated that carbohydrate metabolism in

the source leaf is influenced by viral infection. Infected source leaves are

usually characterized by a decrease in the concentration of soluble sugars,

and often starch accumulation. Changes in the capacities of enzymes in

Discussion - 185 -

various metabolic pathways have been measured during infection of

cotyledons of Cucurbita pepo L. with Cucumber mosaic virus (CMV).

CMV infection significantly altered carbohydrate metabolism, with a

sharp increase in the concentrations of soluble sugars observed in the

infected leaves. These changes were associated with a decrease in leaf

starch content. An increase in reducing sugars and a reduction in starch

content due to CMV-induced higher starch hydrolase and lower ADP-

Glc pyrophosphorylase activities. It has been proposed that the inhibition

of starch accumulation or starch degradation is probably due to the

increased demand for soluble sugars required to maintain the high

respiration rate (Freitas-Astúa et al., 2007).

Virus infectivity:

The first criterion to judge the occurrence of SAR in tomato

plants treated with biotic inducers. The reduction of percentage of

infection, four inducers were able to reduce number of CMV infected

tomato plants. The antiviral activity was assayed by the number of

lesions on the indicator leaf. The reduction in the number of lesions

indicated the resistance of the plant to the virus.

The obtained results showed that four biotic inducers reduce the

CMV infection at range 24.0-50.0% by percentage related to (M.

jalapa extract) (76.0%), (C. inerme extract) (60.0%), mixture extracts

(50.0%) and (kombucha filtrate) (59.2%). The same results were

obtained by many authors (Raupach et al., 1996; Zehnder et al.,

2000; Helmy and Maklad, 2002; Jetiyanon and Kloepper, 2002

and Megahed, 2008).

Discussion - 186 -

The obtained results supports that use of botanicals can be

useful strategy to reduce the incidence of viruses. The botanicals may

induce resistance or they themselves may act as inhibitors of viral

replication. Thus, biologically active compounds present in plant

products act as elicitors and induce resistance in host plants resulting

in reduction of disease development.

Plant immunity:

In the last twenty years the plant immune system has become a

primary topic for Plant Science: inducing forms of resistance in plants

through processes of immunization, or genetically engineering a

cultivar in order to express resistance factors to a particular pathogen,

are not challenges anymore, but real scenarios for plant defense

(Stuiver and Custers, 2001).

Plants have evolved several layers of immunity that recognize

pathogen-associated molecular patterns or pathogen effector molecules

(or their altered host targets) through receptors, such as receptor kinases

containing a leucine-rich repeat domain or resistance proteins containing

a nucleotide-binding site and leucine-rich repeats. This alarm system

activates pathogen-associated molecular pattern-triggered immunity

(non-host/basal resistance) or effector-triggered immunity (resistance

gene-mediated resistance), respectively. Both forms of resistance are

associated with physiological changes in the infected cells, such as a

rapid increase in reactive oxygen species, ion fluxes, the accumulation of

salicylic acid (SA), the synthesis of anti-microbial phytoalexins and the

induction of defense-associated genes, including several families of

pathogenesis-related genes. These immune responses also are often

associated with programmed cell death at the sites of pathogen entry,

Discussion - 187 -

which leads to the formation of necrotic lesions; this phenomenon is

known as the hypersensitive response. In addition, the uninfected

portions of the plant frequently develop SAR, which is accompanied by

increases in SA levels and heightened pathogenesis-related gene

expression. Systemic acquired resistance (SAR) in plants is a state of

heightened defense that provides long-lasting, broad spectrum resistance

to microbial pathogens and is activated systemically following a primary

infection. In many aspects, SAR resembles the immune response in

animals, which is composed of both innate and adaptive components.

The immediate, innate response is nonspecific and mediated by humoral,

chemical, and cellular barriers, whereas the adaptive immune system

involves the recognition of specific “non-self” antigens in the presence of

“self”; this allows the development of immunologi-calmemory.

However, plants lack mobile defender cells and instead rely on the innate

immunity of each cell, which can be activated in uninfected tissues by

systemic signal(s) originating from the site of infection. A number of

studies have provided important insights into the immune response

occurring in infected plant cells (Park et al., 2009).

Plants possess an immune system to defend themselves against

pathogen infection. An intensively studied inducible immune response

occurs when a pathogen carrying an avirulence (avr) gene is recognized

directly or indirectly by a cognate resistance (R) gene in the plant. This

leads to activation of defenses that restrict pathogen growth in infected

tissues and in non-infected tissues by a process referred to as systemic

acquired resistance (SAR) (Brodersen et al., 2005).

Summary and Conclusions - 188 -

SUMMARY

This study was conducted at Plant Pathology Lab. and

Greenhouses of Botany Dept., Fac. of Agric., Moshtohor, Banha Univ.

and Virology Lab., Microbiology Dept., Fac. of Agric., Ain-Shams

Univ. During 2007/2008 and 2008/2009 growing seasons, different

tomato fields at Qalyoubia Governorate were surveyed for viruses

infections.

Part I

Through, the assessment of disease incidence and severity,

Cucumber mosaic cucumovirus (CMV) was the dominant one among

the tomato viruses in the surveyed fields. Identification of isolated

virus (CMV) was achieved using host range, transmissition, stability

in sap, inclusion bodies and confirmed via Dot blot immunoassay

(DBIA). Obtained results dealing CMV confirmation was completely

agreement with the previous confidential recording. Therefore, many

experiments were successively to deducing if induction of systemic

acquired resistance against CMV was successfully achieved under

greenhouse and open field of tomatoes using four biotic inducers or

not.

Part II

The effects of four inducers (three botanical extracts and

kombucha filtrate) in induction systemic resistance (SAR) in tomato

plants against CMV were detected via study the histopathological;

biochemical [dealing antiviral proteins (protein content, qualitative

protein, activity and isozyme of peroxidase and polyphenol oxidase)];

Summary and Conclusions

- 189 -

phytochemically [salicylic acid level, chlorophyll, phenols, total

amino acids, total carbohydrate contents] changes and detection

molecular marker of PRs gene. Virus infectivity was biologically

measured (disease incidence and severity and concentration of virus).

Firstly, SAR induction was check after performed the following

experiments which summarized as:

1- Histopathological changes in tomato leaves sprayed with

biotic inducers, tissue alterations were observed as progressive

increase in lignin accumulation in epidermal cells, number of

hairs, thickness of blade, number of xylem arms and phloem

layers. The alterations included, also, tissue-shrinkage, intense

staining, and precipitation of lignin in sub stomatal cavity,

mesophyll cell showing folding and layering of cell wall and

remains of host palisade cell walls.

2- Antiviral proteins as indicate on elicitations by inducers were

assessed after 7 days from spraying via protein content,

patterns, activities which markedly increased in treated tomato

plants than non-treated ones. In this concern, kombucha

filtrate was superior, but mixture extracts was the lowest

compared with healthy control. After 25 days from spraying

with inducers and inoculated with CMV, also plants treated

with kombucha filtrate produced the highest values of

proteins, while lowest produced as response to C. inerme

extract compared with healthy ones. Electrophoretic for

proteins using SDS-PAGE showed new protein bands with


3- molecular weight previously known for antiviral proteins

were elicited by M. jalapa, C. inerme extracts and kombucha

filtrate. Peroxidase (POD) were markedly increased as result

to mixture extracts treatment, while polyphenol oxidase (PPO)

increased as result to M. jalapa extract treatment when tomato

plants were sprayed with inducers post-inoculation with CMV.

Kombucha filtrate elicited peroxidase isozyme in tomato non-

inoculated with CMV, followed by the mixture extracts, while

post-inoculation M. jalapa extract was induced highest

activity of POD and lowest increase caused by C. inerme

extract. Polyphenol oxidase isozyme was highly activated with

M. jalapa extract, followed by C. inerme extract, then the

mixture of them.

4- Total salicylic acid was quantitatively determined in the

tomato plant sprayed with bioelicitors pre-inoculated with

CMV. SA was increased in the treated plants than non-treated,

and HPLC showed high levels of SA were elicited via

kombucha filtrate, followed by C. inerme, M. jalapa, and the

mixture extracts.

5- Photosynthetic pigments content (as Chlorophyll a, b plus

carotenoids) were reduced, generally in infected plants than

healthy ones. But, when tomato treated with the tested

elicitors pre-inoculation, Chl a, Chl b and carotenoids were

increased as result to spraying with M. jalapa, C. inerme,

mixture extracts and kombucha filtrate. The same trend was


- 191 -

observed when inoculated plants were treated with the same

order of elicitors.

6- Phenols contents, was increased in the non-inoculated plants

and treated with biotic inducers. The highest increase of total,

free and conjugate phenols were induced by M. jalapa extract

and kombucha filtrate, while lowest increase were recorded by

C. inerme and mixture extracts compared with control. Post-

inoculation, all phenol contents were increased as response to

treatments with M. jalapa, mixture extracts, kombucha filtrate

and C. inerme, respectively.

7- Total RNA values (µg/g) were high in the non-inoculated but

treated tomato leaves with kombucha filtrate, M. jalapa

extract, followed by C. inerme extract then mixture extracts.

8- Molecular marker for SAR detection was achieved using RT-

PCR to amplify of the PR-1a gene which elicited with

bioinducers in the tomato plants pre-inoculated. PR-1a gene

was isolated and molecularly sequenced and identified

compared with the related genes in the Gen-Bank.

9- Virus infectivity was determined to insure that systemic

acquired resistance is achieved. Reduction in the disease

severity percentage was recorded as result to spraying tomato

plants with bioelicitors (M. jalapa extract, followed by C.

inerme extract, kombucha filtrate then mixture extracts) then

inoculated with CMV. Also, concentration of the virus was

biologically assayed as means of local lesions.


Secondly, after insure that the tested inducers were elicited

systemic acquired resistance against CMV in tomato plants under

greenhouse conditions, another experiments were performed using the

tested elicitors as biocontrol agents spraying on inoculated plants and

results were summarized as:

1- Histopathological changes as response to SAR induction was

examined in the inoculated tomato leaves and sprayed with

bioelicitors using light microscope. Generally, noticed that

treated plants were stronger in their growth than non-treated

plants as result to the increase in lignin precipitation,

numbers of xylem arms, phloem layers, skin hairs and

increasing thickness of cell wall, and blade. Infected plants

showed plasmolysis in the mesophyll cells, cell walls collapsed

and plastids become deformed and swollen a loss of orientation

along the inner cell wall. These alterations were intensified

with progressive tissue-shrinkage and desiccation causing the

walls of the palisade and spongy parenchyma to fold in a

layering fashion as well as reduction in vascular bundles.

2- Antiviral proteins as one of the protein contents and product

of induction process were increased in the inoculated plants

especially when sprayed with kombucha filtrate, while lowest

increase due to mixture extracts. After 7 days of spraying,

protein bands via variability analysis appeared 12 protein

bands, 11 in tomato plants treated with M. jalapa extract, 10 by

C. inerme extract and 8 for both mixture extracts and kombucha

filtrate, while non-treated and infected plants gave only 4 and 7


- 193 -

protein fractions. Meanwhile, after 25 days proteins content and

enzymes activity were markedly increased as result to

spraying with M. jalapa extract, lowest increase via C. inerme

extract compared to control. Variability analysis appeared 8

protein bands, 7 in mixture extracts, 6 in C. inerme extract,

and 5 in both M. jalapa extract and kombucha filtrate

treatments. Highest peroxidase and its isozyme activities was

induced by M. jalapa extract, and lowest by C. inerme extract

after 7 days of spraying. After 25 days, kombucha filtrate

induced highest peroxidase activity, followed by M. jalapa

extract, mixture extract then C. inerme extract. Peroxidase

isozyme activity was arranged as treatments of M. jalapa, C.

inerme, mixture extracts and kombucha filtrate, while

polyphenole oxidase isozyme was highest activity in

kombucha filtrate treatment, followed by M. jalapa extract,

then lowest increase with other treatments. After 7 days,

polyphenole oxidase activity was similar to peroxidase

isozyme, while after 25 days polyphenole oxidase isozyme

was highest activity in M. jalapa extract treatment, followed

by kombucha filtrate, mixture extracts, but decreased in C.

inerme than control. Variability analysis of polyphenole

oxidase isozyme showed 5, 3, 5 and 4 polypeptide bands of M.

jalapa, C. inerme, the mixture extracts and kombucha filtrate,

respectively. The result after 7 and 25 days, highest level of

protein genetic markers induced by M. jalapa extract

followed by C. inerme and mixture extracts, while


kombucha filtrate induced low level of protein genetic

markers.

3- Photosynthetic pigments content (as Chlorophyll a, b plus

carotenoids) were reduced, generally in infected plants than

healthy ones. But, when tomato treated with the tested

elicitors pre-inoculation, Chl a, Chl b and carotenoids were

increased as result to spraying with M. jalapa, C. inerme,

mixture extracts and kombucha filtrate. The same trend was

observed when inoculated plants were treated with the same

order of elicitors.

4- Total phenols, was increased in the non-inoculated plants and

treated with biotic inducers. The highest increase of total, free

and conjugate phenols were induced by M. jalapa extract and

kombucha filtrate, while lowest increase were recorded by C.

inerme and mixture extracts compared with control. Post-

inoculation, all phenol contents were increased as response to

treatments with M. jalapa, mixture extracts, kombucha filtrate

and C. inerme, respectively.

5- Total free amino acids content were determined in inoculated

tomato leaves then sprayed with bioagents. After 7 days from

spraying, M. jalapa extract and kombucha filtrate recorded the

highest amount of total amino acids, followed by mixture and

C. inerme extracts. While, after 25 days from spraying, M.

jalapa extract and kombucha filtrate produced the highest

amount of total amino acids, followed by C. inerme and

mixture extracts compared with control.


- 195 -

6- Total carbohydrate content was increased after 7 days from

spraying inoculated tomato leaves with kombucha filtrate and

M. jalapa extract, followed by mixture and C. inerme extracts.

After 25 days, M. jalapa and C. inerme extracts produced the

highest increase in total carbohydrates content, followed by

mixture extracts and kombucha filtrate compared with control.

7- Virus infectivity was determined as indicator of control.

Reduction in the disease severity percentage was recorded as

result to spraying tomato plants with M. jalapa extract,

followed by C. inerme extract, kombucha filtrate then mixture

extracts compared with control. Also, concentration of the

virus was biologically assayed as means of local lesions.

Highest inhibition of virus infectivity due to M. jalapa extract,

kombucha filtrate, mixture extracts and C. inerme extract

compared with control.


CONCLUSIONS

The objectives of this study were isolation and identification of the

most frequently and economically viruses causing serious losses in

tomato crop in the different location of Qalyoubia Governorate,

evaluating some medicinal plant extracts and kombucha filtrate as biotic

inducers to induction systemic acquired resistance in the tomato plants

against CMV and using more effective bioinducers as bioelicitors for

control viruses infection via induction 'pathogenesis-related' (PR-1a)

genes.

Target virus was chosen according to its more frequently and

severity among the isolated viruses in these locations at the winter season

from the study year. Isolated virus was confirmed biologically and

serologically assays. Extracts of two medicinal plants (Clerodendrum

inerme L. Gaertn and Mirabilis jalapa L.) and were individually or in

mixture in addition to kombucha filtrate were evaluated as bioinducers.

All the four inducers were successfully in the induction of systemic

acquire resistance (SAR) in the uninoculated tomato plants and sprayed

with (50% v/v) of inducers.

Tested bioinducers were used as biocontrol to inhibiting the virus

infection of tomato plants as spraying every 15 days under greenhouse

conditions. Pathogenesis-related (PR-1a) gene was molecularly isolated

and identified via sequencer which compared with those recorded in the

Gen-Bank.

In conclusion, using medicinal extracts and other natural inducers

were promise with good systemic acquired resistance against the great

numbers of plant pathogens. In future, induction of resistance can be

done cheaply and easily using natural substances.


- 197 -

RECOMMENDATIONS

This study can be recommended, for obtained healthy tomato

plants and reduced crop losses, with the following:

1- Periodicity explore the tomato plants from sowing date until

harvested and eliminate any plants exhibited virus-like

symptoms and burn them.

2- Surrounded the small cultivated area (for seed production or

breeding program searches) with enclosure of Mirabilis

jalapa L. plants as an embellishment plant which release

volatile substances work as antifeedant for numbers of pest

insects (as virus vectors).

3- Soak the root system of tomato seedlings in the 50% of the

following inducers, and spraying tomato plants every 15

days with 50% of water extracts of both Clerodendrum

inerme and Mirabilis jalapa or their mixture, or kombucha

filtrate from transplanting date to harvest.

References 198

REFERENCES

Abd El-Kader, M.A.M. (1983): Studies on certain diseases of

soybean. Ph.D. Thesis, Fac. of Agric. Assiut Univ.

Abdul Magid, A. (1990): Studies on the host range and transmission

of an isolate of Cucumber Mosaic Virus. East African

Agricultural and Forestry Journal, 56, No 1-4.

Abo EI-Nasr, M.A.; El-Dougdoug, Kh.A.; El-Kattan, M .H. and

Salem, E.A. (2004): Induction of salicylic acid in cucumber

against ZYMV potyvirus by some nutrient chemicals. Egyptian.

J. Virol., 1:301-312.

Abu-Jawdah, Y. (1982): Changes in the soluble protein patterns of

bean leaves upon fungal or viral infections after chemical injury.

Phytopathologia meditterranea, 103: 272-279.

Ahmad, G.A. (2004): Using plant extracts to control powdery mildew

disease that attack cucumber plants under protected houses. M. Sc.

Fac. of Agric., Moshtohor. Zagazig Univ., Benha Branch 170pp.

Akhtar, K.P.; Ryu, K.H.; Saleem, M.Y.; Asghsr, M.; Jamil, F.F.;

Haq, M.A. and Khan, I.A. (2008): Occurrence of Cucumber

mosaic virus subgroup IA in tomato in Pakistan. Journal of Plant

Disease and Protection, 115(1): 2-3.

Ali, A. and Kobayashi, M. (2010): Seed transmission of Cucumber

mosaic virus in pepper. J. of Virology Methods, 163: 234-237.

Ali, S.H.; Eisa, S.S. and El-Dougdoug, Kh. (2006): Role of reactive

oxygen species and anti-oxidants in hypersensitive local virus-

infected plants. J. Agric. Sci. Mansoura Univ. 31(11): 6465-6480.

Antoniw, J.F. and Pierpoint, W.S. (1978): Purification of tobacco

leaf protein associated with resistance to virus infection.

Biochemical Society Transactions, 6: 248-250.

References

199

Araf, Rasha, M. (2008): Molecular genetic studies on biotic

induction of plant resistance to Cucumber mosaic virus. M.Sc.

Thesis, Fac. Agric., Ain Shams University, Cairo, Egypt, 129p.

Aramburu, J.; Galipienso, L. and Lopez, C. (2007): Reappearance

of Cucumber mosaic virus isolates belonging to subgroup IB in

tomato plants in North-eastern Spain. Journal of Phytopathology,

155(9): 513-518.

Avdiushko, S.A.; Ye, X.S. and Kuc, J. (1993): Detection of several

enzymatic activities in leaf prints of cucumber plants.

Physiological and Molecular Plant Pathology, 42:441-454.

Aydemir, T. (2004): Partial purification and characterization of

polyphenol oxidase from artichoke (Cynara scolymus L.) heads.

Food Chemistry, 87: 59-67.

Balachandran, S.; Hurry, V.M.; Kelley, S.E.; Osmond, C.B.;

Robinson, S.A.; Rohozinski, J.; Seaton, G.G.R. and Sims,

D.A. (1997): Concepts of plant biotic stress: Some insights into

the stress physiology of virus-infected plant from the perspective

of photosynthesis. Physiologia plantarum, 100:203-213.

Balogun, O.S. and Daudu, A.K. (2007): Comparative pathogenic

responses of some tomato accessions to Cucumber mosaic virus.

Research on Crops, 8(3): 689-694.

Bansal, R.D.; Sharma, O.P.; Kaul, V.K. and Cheema, S.S. (1992):

Histopathological changes induced in Cucurbita pepo infected

with Cucumber mosaic virus. Indian Journal of Virology, 8(2):

111-114.

Barbosa, C.D.J.; Cumani, L.A.L.; Roes, B.; Olivereira, R.P. and

Silva, K.M.D (1998): Cucumber mosaic virus identification on

banana plants in the north of Parana state. Revista Brasiliara de

Fruicultura, 20(1): 112-114. (English abstract).

References 200

Bestwick, C.S.; Brown, I.R. and Mansfield, J.W. (1998): Localized

changes in peroxidase activity accompany hydrogen peroxidase

generation during the development of a non host hypersensitive

reaction in lettuce. Plant Physiology, 118: 1068-1078.

Betsy, P. and Sonford, H. (1996): Kombucha Phenomenon. The

Miracle Health tea how to safely make and use kombucha. 2nd ed

sierra sunrise Publishing Inc.

Bollard, E.G. and Mathews, R.E.F. (1966): The physiology of

parasitic diseases. In F.C. steward (Ed) plant physiology 4(b)

Acad. Pres, New York, 599p.

Bradford, M.M. (1976): A rapid and sensitive method for

quantification of microgram quantities of protein utilizing the

principal of protein dye binding. Anal. Biochem., 72:248-254.

Brakk, M.K.; White, J.L.; Sawsan, R.G. and Johi (1986):

Chlorophyll, chloroplast and ribosomal RNA are reduced by

Barley strip mosaic virus systemic infection, Phyto, 78: 670-674.

Brodersen P.; Malinovsky, F.G.; Hématy, K.; Newman, M.A. and

Mundy, J. (2005): The role of salicylic acid in the induction of cell

death in Arabidopsis acd11. Plant Physiology, 138: 1037–1045.

Campa, A. (1991): Biological roles of plant peroxidases; known and

potential function, in: J. evrse, M.B. Grisham (eds.), Peroxi-

Boca Raton, pp. 25-50.

Cao, H.; Glazebrook, J.; Clarke, J.; Volko, S. and Dong, X.N.

(1997): The Arabidopsis NPRI gene that controls systemic

acquired resistance encodes a novel protein containing ankyrin

repeats. Cell, 88: 57-63.

Cao, H.; Li, X. and Dong, X.N. (1998): Generation of broad

spectrum disease resistance by over expression of an essential

regulatory gene in systemic acquired resistance. Proc.NAT.

Acad. SCI. USA, 95:6531-6536.

References

201

Carbone, D. and Kalaljev, A. (1932): Ricercha sulla vaccinaxione

della plante. Phtopathologia mediterranea, 5: 91-98.

Cardin, L. and Moury, B. (2007): First report of Cucumber mosaic

virus in Echium candicans in France. Plant Disease, 91(11):

1516.

Chabbouh, N. and Cherif, C. (1990): Cucumber mosaic virus in

artichoke. FAO Plant Prot. Bull., 38:52-53.

Chakraboty, S.; Singa, A. and Reddy, B.V. (1994): Effect of

cucurbit mosaic viruses on chlorophyll and total phenol content

of cucurbits. Crop Research (Hisar), 7(3): 461-465.

Chaturvedi, R. and Shah, J. (2007): Salicylic Acid in Plant Disease

Resistance. Book of Salicylic Acid: A Plant Hormone, pp 335-

370.

Chaumpluk, P.; Saski, Y.; Saitoh, A.; Koiwa, H.; Hikichi, Y . and

Suzuki, A. (1994): Comparison of two isolates of cucumber

mosaic virus (CMV) from gentian plant in Iwate Prefecture. Ann.

of the Society of Plant Protection of North Japan, 45: 88-92.

Chen, C. and Liu, B.Y. (2000): Changes in major components of tea

fungus metabolites during prolonged fermentation. Journal of

Applied Microbiology, 89(5): 834-839.

Chen, C.C. and Hu, C.C. (1999): Purification and characterization of

cucumovirus from Lisianthus rusellianus. Plant Protection

Bulletin Taipei, 14(3): 179-198.

Chen, M.; Qiu, D.W.; Liu, Z.; Yang, X.F. and Cao, K.Q. (2006):

Inhibition of RNA replication and coat protein synthesis in

Tobacco mosaic virus by a plant activator protein. Chinese

Journal of Biological Control, 22 (1): 63-66. (English abstract).

Chessin, M.; Deborde, D. and Zipf, A. (1995): Antiviral proteins in

high plants. CRC press, Boca Raton, Ann Arbor, London,

Tokyo, 180 P.

References 202

Chester, K. (1933): The problem of acquired physiological immunity

in plants. Quart. Rev. Biol. 8: 129-151.

Chittoor, J.M.; Leach, J.E. and White, F.F. (1999): Induction of

peroxidase during defense against pathogens. In: Pathogenesis:

Related proteins in plants, 291 p. S.K. Datta, S. Muthukrishnan

(eds.), CRC Press, Boca Raton, FL

Choudhary, D.K. ; Prakash, A. and Johri, B.N. (2007): Induced

systemic resistance (ISR) in plants: mechanism of action. Indian

Journal of Microbiology. 47 (4): 289-297.

Clark, M.F. and Adams, A.N. (1977): Characteristics of the

microplate method of enzyme-linked immunosorbent assay for

the detection of plant viruses. J. of Gen. Virology, 34: 475-483.

Coseteng, M.Y. and Lee, C.Y. (1978): Changes in apple polyphenol

oxidase and polyphenol concentrations in relation to degree of

browning. Journal of Food Science. 52: 985.

Davino, S.; Bellardi, M.G.; Bella, M.D.; Davino, M. and

Bertaccini, A. (2005): Characterization of a Cucumber mosaic

virus isolate infecting Mandevilla sanderi (Hemsl.) Woodson.

Phytopathologia Mediterranea, 44: 220-225.

Dean, R.A. and Kuc, J. (1986a): Induced systemic protection in

cucumber: the source of the signal. Physiol. Mol. Plant Pathol.,

28: 227-233.

Dean, R.A., and Kuc, J. (1986b): Induced systemic protection in

cucumber: time of production and movement of the signal.

Phytopathology, 76: 966-970.

Delancy, T.; Uknes, S.; Vernoij, B.; Friedrich, L.; Weymann, K.;

Negrotto, D.; Gaffney, T.; Gut-Rella, T.; Kessmann, M.;

Ward, H. and Ryals, J. (1994): A central role of salicylic acid

in plant disease resistance. Science, 266: 1247-1250.

References

203

Deng, C.; Zhang, X.; Zhang, J.; Qian, J. and Zhu, W. (2003):

Rapid Determination of Salicylic Acid in Plant Materials by Gas

Chromatography–Mass Spectrometry. Journal Chromatographia,

58(3-4): 225-229.

Devi, P.R.; Doraiswamy, S.; Nakkeeran, S.; Rabindran, R.;

Ganapathy, T.; Ramiah, M. and Mathiyazhagan, S. (2004):

Antiviral action of Harpulia Cupanioides and Mirabilis Jalapa

against tomato spotted wilt virus. Archives of Phytopathology

and Plant Protection, 37(4): 245-259.

Dheepa, R. and Paranjothi, S. (2010): Transmission of Cucumber

Mosaic Virus (CMV) infecting banana by aphid and mechanical

methods. Emir. J. Food Agric., 22 (2): 117-129.

Dipti, P.; Yogesh, B.; Kain, A.K.; Pauline, T.; Anju, B.; Sairam,

M.; Singh, B.; Mongia, S.S.; Kumar, G.I. and Selvamurthy,

W. (2003): Lead induced oxidative stress: beneficial effects of

Kombucha tea. Biomed Environ Sci., 16(3):276-82.

Dixon, R.A. (1986): The phytoalexin response: Elicitation, signaling,

and control of host gene expression. Biol. Can. Philos. Soc. 61:

239-292.

Doebley, J. (1989): Isozymic evidence and the evolution of crop

plants, In: Isozymes in Plant Biology, D. Soltis, and P. Soltis,

eds. (Portland, Oregon: Dioscorides Press), pp. 165-191.

Dong, H. and Beer, S.V. (2000): Riboflavin induces disease

resistance in plants by activating a novel signal transduction

pathway. Phytopathology, 90(8): 801-811.

Dubey, G.S. and Bhardwaj, S.V. (1982): Histopathological studies

in tomato infected with TMV. Indian Phtopathology, 35(1): 175.

Dutta, D. and Gachhui, R. (2007): Nitrogen-fixing and cellulose-

producing Gluconacetobacter kombuchae sp. nov., isolated from

References 204

Kombucha tea. International Journal of Systematic and

Evolutionary Microbiology, 57, 353–357.

Effmert, U.; Große, J.; Röse, U.S.R.; Ehrig, F.; Kägi, R. and

Piechulla, B. (2005): Volatile composition, emission pattern,

and localization of floral scent emission in Mirabilis jalapa

(Nyctaginaceae). American Journal of Botany, 92(1): 2–12.

Eichhorn, H.; Klinghammer, M.; Becht, P. and Tenhaken, R. (2006):

Isolation of a novel ABC-transporter gene from soybean induced

by salicylic acid. Journal of Experimental Botany, 57, (10): 2193–

2201.

Eid, S.A.; Kishtah, A.A. and Abu-Zeid, A.A. (1984): Nicotiana

gluaca L., a natural host for cucumber mosaic virus. Agric. Res.

Rev. 62: 367-378.

Eisa, Nawal A.; El-Fiki, A.I.I.; Mohamed, F.G. and El-Habbak,

M.H. (2006): Biochemical changes in squash leaves sprayed

with some chemicals for inducing resistance to powdery mildew.

The 2nd Conf. On farm Integrated Pest Management 2006,

Fayoum, Egypt., pp. 211-222.

El-Afifi, Sohir, L; EI-BoroIIosy, A.M. and Mahmoud, S.Y.M.

(2007): Tobacco callus culture as a propagating medium for

Cucumber mosaic cucumovirus. Intern. J. Virology, 3(2): 73-79.

El-Baz, Reham, M. (2004): Physicochemical, physiological and

histopathological studies on cucumber mosaic virus. M.Sc.

Thesis. Fac. of Sci. Helwan Univ., Cairo, Egypt, 192 p.

El-Dougdoug, Kh.A.; El-Deeb, S.H. and Abou-Zeid, A.A. (1993):

Anatomical and ultra-structural changes in orange leaves

infected with Citrus exocortis viroid (CEVd). Annals

Agriculture Science. Ain Shams University, 38 (1): 101-117.

Elshafie, E.; Daffalla, G.; Gebre, K. and Marchoux, G. (2005):

Mosaic -Inducing Viruses And Virus Like- Agents Infecting

References

205

Tomato And Pepper In Sudan. International Journal of Virology,

1(1): 28-28.

El-Shamy, M.M. (1987): Studies on a virus naturally infecting plants

of economic importance to Egypt. M.Sc. Thesis Faculty of

Science, Menoufia University, Egypt, 173p.

El-Shamy, M.M; Sayed, E.T.A. and Soweiha, H.E. (2000): Light

microscopic anatomical studies of tomato leaves infected with a

new yellow severe strain of Tobacco mosaic virus. Bulletin

Faculty of Science, Assiut University, Egypt, 173p.

Endo, Y.; Tsurugi, K. and Lambert, J.M. (1988): The site of action

of six different ribosome-inactivation proteins from plants in

eukaryotic ribosomes: the RNA N-glycosidase activity of the

proteins. Biochemistry Biophysics Research of Community,

150: 1032-1039.

Enyedi, A.J.; Yalpani, N.; Silverman, P. and Raskin, I. (1992):

Localization, conjugation and function of salicylic acid in

tobacco during the hypersensitive reaction to tobacco mosaic

virus. Proc. Natl. Acad. Sci. USA, 89: 2480-2484.

Eskarous, J.K.; Sayed, E.T. and El-Shamy, M.M. (1991):

Histopathology of tomato root, stem and leaf infected with a heat

resistant strain of TMV. Mansura Science Bulletin, 18(2): 219.

Espinha, L.M. and Caspar, J.O. (1997): Partial chracterrization of

cucumber mosaic virus isolated from Catharanthus roseus.

Fitopatologia Brasileira, 22(2): 209-212.

Faccioli, G.; Forni, M. and Bizzi, L. (1994): Further characteristics

of antiviral factors (AVF) produced by virus-infected plants.

Phytopathologia Mediterranea, 33(1): 17-26.

Fakhourin, W.D.; Neemann, M.; Walker, F. and Buchenauer, H.

(2004): Application of fluorescent pseudomonads in combination

with acibenzolar-S-methyl induces disease resistance in tomato and

References 206

tobacco. Zeitschrift fur Pflanzenkrankheiten und Pflanzenschutz,

111(5): 494-505. (English abstract).

FAO (2010): FAOSTAT statistical database. Rome (available at

http://faostat.fao.org).

Farouk, S.; Ghoneem, K.M. and Abeer A. Ali (2008): Induction and

expression of systemic resistance to downy mildew disease in

cucumber by elicitors. Egypt. J. Phytopathol., 36(1-2): 95-111.

Fawzy, R.N.; Mahdy, A.M.M. and El-Mageed, A.M.H. (1992):

Identification of a strain of cucumber mosaic virus isolated from

naturally infected Philodendron selloum. Annals of Agric. Sci.,

Moshtohor, 30(3): 1219-1232.

Food and Drug Administration (1995): FDA cautions consumers on

"Kombucha Mushroom Tea" {News release}. Washington, DC:

US Department of Health and Human Services, Public Health

Service, Food and Drug Administration, March 23, 1995.

Fraser, L. and Matthews, R.E.F. (1979): Specific pathways of

cytological change in individual Chinese cabbage protoplasts

infected with Turnip yellow mosaic virus. Journal of General

Virology, 45: 623-630.

Fraser, R.S.S. (1981): Evidence for the occurrence of the

pathogenesis related proteins in leaves of healthy tobacco plants

during flowering. Physiology Plant Pathology, 19:69-76.

Freeman, A. and Horsham, M.A. (2006): Temperate Pulse Viruses:

Cucumber Mosaic Virus (CMV). Information notes No. AG1207,

http://new.dpi.vic.gov.au/agriculture/pests-diseases-and-weeds/plant-

diseases/grains-cereals/general-vegetable-diseases/ag1207-temperate-

pulse-viruses-cucumber-mosaic-virus-cmv

Freitas-Astúa, J.; Bastianel, M.; Locali-Fabris, E.C.; Novelli,

V.M.; Silva-Pinhati, A.C.; Basílio-Palmieri, A.C.; Targon,

M.L.P.N. and Machado, M.A. (2007): Differentially expressed

References

207

stress-related genes in the compatible citrus-Citrus leprosis virus

interaction. Genetics and Molecular Biology, 30 (3 suppl.): 980-

990.

Fukumoto, F.; Masuda, Y. and Hnada, K. (2003): Pea tissue

necrosis induce by Cucumber mosaic virus alone or together

with watermelon mosaic virus. Plant Disease, 87(4): 324-328.

Gaffney, T.; Friedrich, L.; Vernooij, B.; Negrotto, D.; Nye, G.;

Uknes, S.; Ward, E.; Kessmann, H. and Ryals, J. (1993):

Requirement of salicylic acid for the induction of systemic

acquired resistance. Science, 261: 754-756.

Galal, A.M.M. (1989): Antiviral against local and systemic viral

infection of Phaseolus vulgaris. Ph.D. Thesis. Faculty of

Science. Zagazig University, Zagazig, Egypt, 333p.

Galal, A.M.M. (2006): Induction of systemic acquired resistance in

cucumber plant against Cucumber mosaic cucumovirus by local

Streptomyces strains. Plant Pathology Journal Faisalabad, 5(3):

343-349.

Ganoo, S. and Saumtally, S. (1999). Incidence of virus diseases in

tomato. In: Lalouette, J. A., Bachraz, D. Y.; Sakurdeep, N. (eds).

Proceedings of the 3rd Annual Meeting of Agricultural Scientists,

Réduit, Mauritius, 17-18 November 1998. AMAS 1998. Food and

Agricultural Research Council, Réduit, Mauritius.

Ghazi, A.M. (1976): Comparative biochemical studies on plant

peroxidases. Ph.D. Thesis. Fac. of Sci., Al-Azhar Univ., Cairo,

Egypt. 224 p.

Gianinazzi, S.; Martin, C. and Valle, J.C. (1970): Hypersenstivity

to viruses, temperature and solable proteins in Nicotiana xanthi

n.c. Appearance of new macromolecules at the repression of

viral synthesis. Comptes Rendus Acad. Sci. Ser. Paris, 270:

2382-2386. (English abstract).

References 208

Gildow, F.E.; Shah, D.A.; Sackett, W.M.; Butzler, T.; Nault, B.A.

and Fleischer, S.J. (2008): Transmission efficiency of

Cucumber mosaic virus by aphids associated with virus

epidemics in snap bean. Phytopathology, 98(11):1233-41.

Gilpatrick, J.D. and Weintraub, M. (1952): An usual type of

protection with the carnation mosaic virus. Science, 115: 701-702.

Goodman, R.N.; Kiraly, Z. and Wood, K.R. (1986): The

biochemistry and physiology of plant disease, University of

Missouri Press. Columbia, 295P.

Grüner, R. and Pfitzner, U.M. (1994): The upstream region of the gene

for the pathogenesis-related protein 1a from tobacco responds to

environmental as well as to developmental signals in transgenic

plants. European Journal of Biochemistry, 220: 247-255.

Hafez, M.A. (2008): Pre-harvest application of Kombucha filtrate to

control postharvest bunch rot of table grapes. Annals of Agric.

Sci., Moshtohor, 46(2):23-34.

Hammerschmidt, R. (1999): Induced disease resistance: how do

induced plants stop pathogens? Physiological and Molecular

Plant Pathology, 55 (2): 7-84.

Hammerschmidt, R. (2009): Chapter 5 Systemic Acquired

Resistance. Advances in Botanical Research, 51, 173-222.

Hammerschmidt, R.; Nuckles, E.M. and Kuc, J. (1982):

Association of enhanced peroxidase activity with induced

systemic resistance of cucumber to Colletotrichum lagenarium.

Physiol. Plant Pathol., 20: 73-82.

Harish, S.; Kavino, M.; Kumar, N.; Balasubramanian, P. and

Samiyappan, R. (2009): Induction of defense-related proteins

by mixtures of plant growth promoting endophytic bacteria

against Banana bunchy top virus. Biological Control, 51:16–25.

References

209

Hayat, S. and Ahmad, A. (2007): Salicylic Acid: A Plant Hormone. 1st

Ed. Published by Springer, Dordrecht, The Netherlands, 401pp.

Hellwald, K.H.; Zimmermann, C. and Buchenauer, H. (2000):

RNA 2 of Cucumber Mosaic Virus Subgroup I Strain NT-CMV

is Involved in the Induction of Severe Symptoms in Tomato.

European Journal of Plant Pathology, 106(1): 95-99.

Helmy, Yomna, I. and Maklad, F.M. (2002): Induced systemic

resistance in cucumber plants under plastic houses against

cucumber mosaic virus using biotic inducers. Egypt. J. Hort., 29(1):

1-16.

Hersanti, C. (2005): The Analysis of peroxidase activity and salicylic

acid content of resistant red chilli plant to Cucumber mosaic

virus (CMV) induced by crude extract of leaf Mirabilis jalapa.

Indonesian Journal of Plant Protection, XI:1

Hooft Van Huijsduijnen, R.A.M.; Alblas, S.W.; De Rijk, R.H. and

Bol, J.F. (1986): Induction by salicylic acid of pathogenesis-related

proteins and resistance to Alfalfa mosaic virus infection in various

plant species. J. Gen. Virol., 67: 2135-2143.

Hopper, D.G.; Venere, R.J.; Brinkerhoff, L.A. and Ghoslson, R.K.

(1975): Necrosis induction in cotton. Phytopathology, 65: 206-

213.

Hou, L.; Li, C.; Liu, Y.; Cai, Z.; Fei, J.; Hou, Y. and Cai, Z.N.

(1998): Effects of antiviral agents to interaction of TMV with

tobacco chloroplast. Plant Protection, 24: (2): 10-13.

Huang, W.E.; Huang, L.F.; Preston, G.M.; Naylor, M.; Carr, J.P.;

Li, Y.H.; Singer, A.C.; Whiteley, A.S. and Wang, H. (2006):

Quantitative in situ assay of salicylic acid in tobacco leaves

using a genetically modified biosensor strain of Acinetobacter

sp. ADP1. Plant J., 46(6): 1073-1083.

References 210

Hubert, J.J. and Helton, A.W. (1967): A translocatable-resistance

phenomenon in Prunus domesticu induced by initial infection

with Cytospora cineta. Phytopathology, 57: 1094-1098.

Hudgson, R.A.; Beachy, R.N. and Pakrasi, H.B. (1989): A selective

inhibition of photosystem II in spanich by Tobacco mosaic virus:

An effect of the viral coat protein. Febsett, 245(2):267-270.

ICTVdB (2010): Index of Viruses – Bromoviridae. The ICTVdB virus

code 00.010.0.04. Cucumovirus, In: ICTVdB - The Universal Virus

Database of the International Committee on Taxonomy of Viruses

version 4. Büchen-Osmond, C (Ed), Columbia University, New

York, USA.http://www.ncbi.nlm.nih.gov/ICTVdb/Ictv/fs_index.htm Jayabalan, R.; Marimuthu, S. and Swaminathan, K. (2007):

Changes in content of organic acids and tea polyphenols during

kombucha tea fermentation. Food Chemistry, 102(1): 392-398.

Jetiyanon, K. and J.W. Kloepper (2002). Mixtures of plant growth-

promoting rhizobacteria for induction of systemic resistance

against multiple plant diseases. Biological Control, 24: 285-291.

Jetiyanon, K.; Fowler, W.D. and Kleopper, J.W. (2003): Broad-

spectrum protection against several pathogens by PGPR

mixtures under field conditions in Thailand. Plant Disease,

87(11): 1390-1394.

Kahler, A.L. and Allard, R.W. (1981): Worldwide patterns of

genetics variation among four esterase loci in barely (Hordeum).

Journal of TAG Theoretical and Applied Genetics, 59: 101-111.

Kalim, S.; Luthra, Y.P. and Gandhi, S.K. (1999): Copper induced

effect on biochemical constituents in cowpea suscebtible to

Rhizoctonia species. Acta Phytopathologica et Entomologica

Hungarica, 34(3): 199-210.

References

211

Kassanis, B. and Kleozkowski, A. (1948): The isolation and some

properties of a virus-inhibiting protein from Phytolacca

esculenta. Journal of Genetics Microbiology, 2: 143-147.

Kauss, H. (1987): Some aspects of calcium-dependent regulation in

plant metabolism. Annu. Rev. Plant Physiol., 38: 47-72.

Kavino, M.; Harish, S.; Kumar, N.; Saravanakumar, D. and

Samiyappan, R. (2008): Induction of systemic resistance in

banana (Musa spp.) against Banana bunchy top virus (BBTV) by

combining chitin with root-colonizing Pseudomonas fluorescens

strain CHA0. European Journal of Plant Pathology, 120 (4): 353-

362.

Kawamura, S.; Tada, M. and Narsaki, T. (1966): Sugar of

cotyledon, hull and hypocotyls of soybean. J. Jap. Soc. Food and

Nutr., 19: 268.

Kessman, H.; Staub, T.; Hofmann, C.; Maetzke, T.; Herzog, J.;

Ward, E.; Uknes, S. and Rvals, J. (1994): Induction of

systemic acquired disease resistance in plants by chemicals.

Annu. Rev. Phytopathol., 32: 439-459.

Khalil, E.M.; Hassan, El.Sh. and Bekhit, R.S. (1985): Reaction of

selected pepper cultivars to mosaic virus diseases under Egypt

conditions. The 1st Nat. Conf. of Pests and Dis. of Veg. and Field

Crops in Egypt. Ismailia, Egypt.

Kiranmai, G.; Sreenivasulu, P. and Nayudu, M.V. (1997):

Characterization of cucumber mosaic cucumovirus isolates

naturally infecting three solanaceous vegatible crops in Andhra

Prodesh. Indian Phytopathology, 50(3): 416-425.

Kogel, K.H.; Beckhove, U.; Dreschers, J.; Munch, S. and Romme, Y.

(1994): Acquired resistance in barley (The resistance mechanism

induced by 2,6-Dichloroisonicotinic acid is a phenocopy of a

References 212

genetically based mechanism governing race- specific powedery

mildew resistance). Plant Physiol., 106(4): 1269-1277.

Köhler, Valentin and Köhler, J. (1985): Glucuronic acid as an ecological aid.

In the Book: Sofotheilung des Waldes, Vol.1, 2nd Edt. (H. Kaegelmann

ed.), Windecke-Rosbach (in German)

Kubo, S.; Ikeda, T.; Imaizumi, S.; Takanami, Y. and Mikami, Y.

(1990): A potent plant virus inhibitor found in Mirabilis

jalapa L. Annals of the Phytopathological Society of Japan,

56(4):481-487.

Kuc, J. (1987): Plant immunization and its applicability for disease

control. In: 1. Chet (ed), Innovative Approaches to Plant Disease

Control. John Wiley, New York. pp. 225-274.

Kumar, D.; Verma, H.N.; Tuteja, N. and Tewari, K.K. (1997):

Cloning and characterisation of a gene encoding an antiviral

protein from Clerodendrum aculeatum L. Plant Molecular

Biology, 33: 745–751.

Kumon, K.; Sasski, K.; Sejima, M.; Akeuchi, Y.T. and Hayashi,

Y. (1990): Interactions between Tobacco mosaic virus, pokweed

antiviral protein and tobacco cell wall. Phytopathology, 80: 636-

640.

Laemmli, U.K. (1970): Cleavage of structural proteins during the

assembly of the head of bacteriophage. T4. Nature, 227: 680-685.

Lancioni, P. (2008): Studies on biotic and abiotic elicitors inducing

defense responses in tomato. Ph.D. Thesis, Phytopathology

Dept., Fac. Agric., University of Bologna, Italy 125pp.

Lanna, A.C.; Oliveira, M.G.A.; Barros, E.G. and Moreira, M.A.

(1996): Kinatic parameters of leaf lipoxygenase pool from

normal soybean genotypes and from a line devoid of seed

lipoxygenase. Rev. Bras. Fisiol. Vegetal., 8: 87-92.

Leal, A.A.; Terada, Y. and Machado, M.P. (2001): Floral biology

of a population of Mirabilis jalapa L. (Nyctaginaceae) from

References

213

Southern Brazil.Acta Scientiarum Maringá, 23(2): 587-591.

Lee, S.Y.; Park, S.J. and Choi, J.K. (1997): Characterization of an ;

isolate of cucumber mosaic virus from Forsythia (Forsythia

koreana nakai). Korean Journal of Plant Pathology, 13(5): 358-363.

Yalpani, N.; Leon, J.; Lawton, M.A. and Raskin, I. (1993):

Pathway of Salicylic Acid Biosynthesis in Healthy and Virus-

Inoculated Tobacco. Plant Physiology, 103(2): 315-321.

Lin, C.H.; Sheu, F.; Lin, H.T. and Pan, T.M. (2010): Allergenicity

Assessment of Genetically Modified Cucumber Mosaic Virus

(CMV) Resistant Tomato (Solanum lycopersicon). J. Agric.

Food Chem., 58 (4): 2302–2306.

Loebenstein, G. (1963): Further evidence on systemic resistance

induced by localized necrotic virus infections in plants.


Loebenstein, G. (1972): Localization and induced resistance in virus

infected plants. Annual Review of Phytopathology, 10: 177-181.

Low, P.S. and Merida, J.R. (1996): The oxidative burst in plant

defense: function and signal transduction. Physiol. Plant., 96:

533-542.

Gilliland, A.; Murphy, A.M.; Wong, C.; Carson, R. and Carr, J.P.

(2006): Mechanisms Involved in Induced Resistance to Plant

Viruses. In: Multigenic and Induced Systemic Resistance in

Plants, 2006, 335-359.

Magid, A.G.M.A. (1991): Host range and transmission of an isolate

of cucumber mosaic virus from the Sudan. East African

Agricultural and Forestry Journal, 56(1-4): 63-67.

Mahmoud, S.Y.M. (2000): Antiviral substances induced in plants as

a result of virus infection. Ph.D. Thesis. Faculty of Agriculture,

Ain Shams University, Cairo, Egypt, 171 p.

References 214

Mahmoud, S.Y.M. (2003): Systemic acquired resistance induced in

viral infected tobacco plants via viral necrotizing and plant

decapitation. Assiut Journal of Agricultural Science, 34(5): 334-

351.

Malamy, J.; Carr, J.P.; Klessig, D.F. and Rasken, I. (1990):

Salicylic acid: a likely endogenous signal in the resistance

response of tobacco to viral infection. Science, 250: 1002-1004.

Malamy, J.; Hennig, J. and Klessig, D.F. (1992): Temperature-

dependent induction of salicylic acid and its conjugates during

the resistance response to tobacco mosaic virus infection. Plant

Cell, 4: 359-366.

Massumi, H.; Shaabanian, M.; Pour, A.H.; Heydarnejad, J. and

Rahimian, H. (2009): Incidence of Viruses Infecting Tomato

and Their Natural Hosts in the Southeast and Central Regions of

Iran. Plant Disease, 93(1): 67-72.

Matthews, F.E.F. (1970): Student edition, plant virology. Academic

press, INC., New York, 778p.

Maurhofer, M.; Hase, C.; Meuwly, P.; Metraux, J.P. and Defago,

G. (1994): Induction of systemic resistance to tobacco necrosis

virus by the root-colonizing Pseudomonas fluorescens strain

CHAO: Influence of the gacA gene and pyoverdine production.


Maurhofer, M.; Hase, C.; Meuwly, P.; Metraux, P. and Defago, G.

(1993): Induction of systemic resistance of tobacco to tobacco

necrosis virus by the root – colonizing Pseudomonas fluorescens

strain GHAO : influence of the gac A Gene and of Phyoverdine

production. Phytopathology, 24 (2): 139- 146.

Mayers, C.N.; Lee, K.C.; Moore, C.A.; Wong, C.A. and Carr, J.P.

(2005): Salicylic acid- induced resistance to Cucumber mosaic

virus in squash and Arabidopsis thaliana: contrasting

References

215

mechanisms of induction and antiviral action. Mol. Plant

Microbe Interact., 18: 428-434.

Mazen, M.A. (2004): Resistance induction against diseases of faba bean

crop. Ph.D. Thesis., Fac. of Agric., Suez Canal Univ., 159pp.

Mazia, D.; Brewer, P.A. and Alfert, M. (1953): The cytochemical

staining and measurement of protein with mercuric bromophenol

blue. Biol. Bull. 35: c 17.

Meena, B.; Marimuthu, T. and Velazhahan, R. (2001): Salicylic

acid induces systemic resistance in groundnut against late leaf

spot caused by Cercosporidium persenatum. Journal of

Mycology and Plant Pathology, 31(2): 139-145.

Megahed, A.A. (2008): Effect of antiviral proteins produced by

bacterial and fungal isolates on some viruses infecting vegetable

crops. M.Sc. Thesis, Faculty of Agriculture, Ain Shams

University, Cairo, Egypt. 193p.

Meins, F.; Neuhaus, J.M.; Sperison, C. and Ryals, J. (1992): The

primary structure of plant pathogenesis-related glucano-

hydrolases and their genes. pp. 245-282. In: Genes Involved in

Plant Defense, eds. T. Boiler, FJ Meins, Vienna: Springer-

Verlag, Heidekberg, Berlin, Germany.

Metraux, J.P.; Singer, H.; Ryals, J.; Ward, E.; Wyss-Benz, M.;

Gaudin, J.; Raschdofr, K.; Schmid, E.; Blim, W. and Inverardi,

B. (1990): Increase in salicylic acid at the onset of systemic

acquired resistance in cucumber. Science, 250: 1004-1006.

Michael, R.D. (2009): Incidence of Viruses Infecting Tomato and

Their Natural Hosts in the Southeast and Central Regions of

Iran, 93(1):67-72.

Mohamed, E.F. (2010): Interaction Between Some Viruses Which

Attack Tomato (Lycopersicon esculentum Mill.) Plants and

References 216

Their Effect on Growth and Yield of Tomato Plants. Journal of

American Science, 6(8): 311-320.

Montalbin, P. and Lupatill, M. (1989): Effect of localized and systemic

Tobacco mosaic virus infection on some photochemical and

enzymatic activities in tobacco. Phytopathology, 75(2): 126-132.

Montasser, M.S.; Dashti, N.H.; Ali, N.Y.; Bhardwaj, R.G. and Al-

Hamar, B. (2006): Occurrence of Three Strains of Cucumber

mosaic virus Affecting Tomato in Kuwait. Archive Detail,

22(1): 51-62.

Murphy, A.M.; Chivasa, S.; Singh, D.P. and Carr, J.P. (1999):

Salicylic acid induced resistance to viruses and other pathogens:

a parting of the ways?. Trends in Plant Science, 4, 155-160.

Murphy, J.F.; Zehnder, G.W.; Schuster, D.J.; Sikora E.J.;

Polston, J.E. and Kloepper, J.W. (2000): Plant growth-

promoting rhizobacterial mediated protection in tomato against

tomato mottle virus. Plant Disease. 84: 779-784.

Nassar, G.A. (1998): Algal activity against local and systemic plant

viral infection. Ph.D. Thesis, Faculty of Science, Zagazig

University, Zagazig, Egypt, 164p.

Neuenschwander, U.; Lawton, K. and Ryals, J. (1996): Systemic

acquired resistance in Plant-Microbe Interaction, Vol. 1, pp. SI-108.

G. Stacey and N.T. Keen, eds New York: Chapman and Hall.

Nie, X. and Singh, R.P. (2001): Differential accumulation of Potato

virus x and expression of pathogenesis-related genes in resistant

potato cv. Shepody upon graft inoculation. Phytopathology, 91:

197-203.

Noordam, D. (1973): Identification of Plant Viruses: Methods and

Experiments. Center for Agriculture Publishing and

Documentation, Wageningen, the Netherlands, 207 p.

References

217

Olivieri, F.; Prasad, V.; Valbonesi, P.; Srivastava, S.; Ghosal-

Chowdhury, P.; Barbieri, L.; Bolognesi, A. and Stirpe, F.

(1996): A systemic antiviral resistance-inducing protein isolated

from Clerodendrum inerme Gaertn. is a polynucleotide: adenosine

glycosidase (ribosome-inactivating protein). FEBS Lett., 396(2-3):

132-134.

Omar, R.A.; Mehiar, F.F.; Zayed, E.A. and Dief, A.A. (1986):

Physiological and biochemical studies on soy beans and lettuce

plants infected with seed borne virus. Acta Phytopathological et

Entomological Hungarica, 21: 63-72.

Omar, R.A; EL-Kewey, S.A.; Sidaros, S.A. and Mahmoud, S.Y.

(1994): Unusual strain of CMV affecting sugar beet in Egypt.

Proc. of the seventh Congress of Phytopathology. 1:14, Cairo,

Egypt.

Park, S.W.; Kaimoyo, E.; Kumar, D.; Mosher, S. and KIcssig,

D.F. (2007): Methyl salicylate is a critical mobile signal for

plant systemic acquired resistance. Science Washington,

318(5847): 113-116.

Park, S.W.; Liu, P.P.; Forouhar, F.; Vlot, A.C.; Tong, L.; Tietjen, K.

and Klessig, D.F. (2009): Use of a synthetic salicylic acid analog

to investigate the roles of methyl salicylate and its esterases in plant

disease resistance. The Journal of Biological Chemistry,

284(11):7307–7317.

Park, W.M.; Ryu, K.H. and Choi, J.K. (1990): Properties and

purification of cucumber mosaic virus as new strain. Korean

Journal of Plant Pathology, 6(3): 393-401.

Pathak, D.; Srivastava, M.P. and Deka, S.C. (1998): Biochemical

basis of charcoal rot [Rhizoctonia bactericola (Taub.) Buter]

resistant and susceptible cultivars of sunflower in relation to

References 218

total phenols, free amino acids, insoluble pectin and polyphenol

oxidase activity. Annals of Biology (Ludhiana), 14(2): 189-193.

Peng, J.Y.; Deng, X.J.; Huang, J.H.; Jia, S.H.; Miao, X.X. and

Huang, Y.P. (2004): Role of salicylic acid in tomato defense

against Cotton Bollworm, Helicoverpa armigera Hubner. Z.

Naturforsch. 59: 856-862.

Praveen, S.; Tripathi, S. and Varma, A. (2001): Isolation and

characterization of an inducer protein (Crip-31) from

Clerodendrum inerme leaves responsible for induction of

systemic resistance against viruses. Plant Science, 161: 453–459.

Quiroga, M.; Guerrero, C.; Botella, M.A.; Barcelo, A.; Amaya, I.;

Madina, M.I.; Alanso, F.J.; Forchetti, S.M.D.; Tigier, H. and

Valpuesta, V. (2000): A tomato peroxidase involved in the

synthesis of lignin and suberin. Plant Physiol., 122: 1119-1128.

Rajeswari, B. and Rajamannar, M. (1991): Effect of Betelivine

mosaic virus infection on chlorophyll and carbohydrate

fractions. Orissa Journal of Horticulture, 19; 102: 30-31.

Raskin, I. (1992): The role of salicylic acid in plant. Annu. Rev. plant

Physiol. Mol. Boil., 43: 439-463.

Raskin, L; Turner, I.M. and Melander, W.R. (1989): Regulation of

heat production in the inflorescences of an Arum lily by-

endogenous salicylic acid. Proc. Natl. Acad. Sci USA., 86: 2214-

2218.

Raupach, G.S.; Liu, L.; Murphy, J.; Tuzun, S. and Kloepper, J.W.

(1996): Induced systemic resistance in cucumber and tomato

against cucumber mosaic cucumovirus using plant growth-

promoting rhizobacteria (PGPR). Plant Disease, 80: 891-894.

Ray, J. (1901): Les maladies cryptogamiquies des vegetaux.

Rev.Gen. de Bot. 13: 145-154. (c.f. Kessman et al, 1994).

References

219

Rosin, H. (1957): A modified ninhydrin colorimetric analysis for

amino acid. Arch Biochem. Biophys., 67: 10-51.

Ross, A.F. (1961a): Localized acquired resistance induced to plant

virus infection in localized virus infections in hypersensitive

hosts. Virology, 14:329-339.

Ross, A.F. (1961b): Systemic acquired resistance induced by

localized virus infections in plants. Virology, 14: 340-358.

Roussin, M. (2003): Analyses of Kombucha Ferments.

http://www.Kombucha-research.com/.

Ruzin, S.E. (1999): Staining Techniques. In: Ruzin SE, ed. Plant

Microtechnique and Microscopy. New York: Oxford University

Press, 87–116.

Ryals, J.; Neuenschwander, U.; Willits, M.; Molina, A.; Steiner,

H. and Hunt, M. (1996): Systemic acquired resistance. Plant

Cell, 8: 1809-1819.

Ryals, J.; Ukness, S. and Ward, E. (1994): Systemic acquired

resistance. Plant Physiol. 104: 1109-1112.

Salem, E.A. (2004): Induction of salicylic acid by some chemical

substance used to control virus infection under protected

Agriculture. M.Sc. Thesis.Fac. of Agric., Ain Shams.Univ.

Cairo, Egypt, 118 P.

Sankaran, S.; Mishra, A.; Ehsani, R. and Davis, C. (2010): A

review of advanced techniques for detecting plant diseases.

Computers and Electronics in Agriculture, 72: 1-13.

Sayed, E.T.; Soweiha, H.E. and El-Steamy, M.M. (2001):

Anatomical and cytopathological alterations induced by a strain

of Tobacco mosaic virus in tobacco leaf tissues. Egyptian

Journal of Microbiology, 36(3): 329-342.

Schneider, W.C. (1957): Colorimetric analysis of sugar. Methods in

Enzymology, (3). pp. 73-107.

References 220

Sekine, K.; Ishihara, T.; Hase, S.; Kusano, T.; Shah, J. and

Takahashi, H. (2006): Single amino acid alterations in

Arabidopsis haliana RCY1 compromise resistance to Cucumber

mosaic virus, but differentially suppress hypersensitive response-

like cell death, plant Molecular Biology, 62(4-5): 669-682.

Shang, J.; Xi, D.H.; Huang, Q.R.; Xu, M.Y.; Yuan, S.; Wang,

S.D.; Jia, S.D.; Cao, S.; Zhou, Z.L. and Lin, H.L. (2009):

Effect of two satellite RNAs on Nicotiana glutinosa infected

with Cucumber mosaic virus (CMV). Physiological and

Molecular Plant Pathology, 74 : 184-190.

Sharma, A.; Mahinghara, B.K.; Singh, A.K.; Kulshrestha, S.;

Raikhy, G.; Singh, L.; Verma, N.; Hallan, V. Ram, R. and

Zaidi, A.A. (2005): Identification, detection and frequency of

lily iruses in North India. Scientia Horticulturae, 106: 213-227.

Shehata, Sawsan F. and Abdel-Aty, Lila (2005): Antimicrobial

activity of the fermented Kombucha. Annals Agric. Sci., Ain-

Shams Univ., Cairo, 50(2):467-477.

Sherif, E.A. and EI-Habaa, O.M. (2000): Biochemical changes and

specific protein synthesis related to fungal, bacterial and viral

infection in tomato plants. Annals of Agric. Sci. Moshtohor, 38:

165-177.

Shrivastava, N. and Patel, T. (2007): Clerodendrum and Healthcare:

An Overview- Part II: Phytochemistry and Biotechnology.

Medicinal and Aromatic Plant Science and Biotechnology, 1(2):

209-223.

Shulaev, V.; Silverman, P. and Raskin, I. (1997): Airborne

signaling by methyl salicylate in plant pathogen resistance.

Nature, 385: 718-721.

Silva, H.S.A.; Romeiro, R.S.; Macagnon, D.; Halfeld-Viera, B.A.;

Pereira, M.C.B. and Mounteer, A. (2004): Rhizobacterial

References

221

induction of systemic resistance in tomato plants: non-specific

protection and increase in enzyme activities. Biological Control.

29: 288-295.

Singh, D.P.; Moore, C.A.; Gilliland, A. and Carr, J.P. (2004):

Activation of multiple antiviral defense mechanisms by salicylic

acid. Molecular Plant Pathology, 5, 57–63.

Smith, J. and Hammerschmidt, R. (1988): Comparative study of

acidic peroxidase associated with induced resistance in

cucumber, muskmelon and watermelon. Physiol. Mol. Plant

Pathol., 33: 255-261.

Snell, F.D. and Snell, C.T. (1953): Calorimetric methods of analysis

including some turbidimetric and nephelometric methods. D.

van. Nostrand company Inc. Toronto. New York London., 111,

606pp.

Sommer, A.; Nee'man, E.; Steffens, J.C.; Mayer, A.M. and Harel,

E. (1994): Import, targeting and processing of a plant

polyphenol oxidase, Plant Physiol., 105(4): 1301-1311.

Stall, R.E. and Cook, A.A. (1966): Multiplication of Xanthomonas

vesicatoria and lesion development in resistant and susceptible

pepper. Phytopathology, 56: 1152.

Stamets, P. (1994): My adventures with the blob. Mushroom – the

journal (Winter) 1994:5-9.

Stripe, F.; Parbiri, L.; Batteui, M.G.; Soria, M. A nd Lappi. D.A.

(1992): Ribosome inactivating proteins from plants: present

status and future prospects. Bio- technology, 10: 405-412.

Stuiver, M.H. and Custers, J.H.H.V. (2001): Engineering disease

resistance in plants, Nature, 411: 865-868.

Sudhakar, N.; Nagendra-Prasad, D.; Mohan, N. and Murugesan,

K. (2006): First Report of Cucumber mosaic virus Subgroup II

Infecting Lycopersicon esculentum in India. 90(11): 1457.

References 222

Sudhakar, N.; Nagendra-Prasad, D.; Mohan, N. and Murugesan,

K. (2007): Induction of systemic resistance in Lycopersicon

esculentum cv. PKM1 (tomato) against Cucumber mosaic virus

by using ozone. J. Virol. Methods., 139(1): 71-7.

Taha, M.A.T. (2010): Biological control of cucumber mosaic virus

(cucumovirus) by certain local streptomycetal isolates. M.Sc.

Thesis, Faculty of Agriculture, Ain Shams University, Cairo,

Egypt. 217p.

Takarai, K.; Okubo, H.; Yamasaki, S.; Takeshita, M. and

Takanami, Y. (2006): A Cucumber mosaic virus isolated from

Momordica charantia L. Journal of General Plant Pathology, 72

(6): 391-392.

Tanaka, M.; Thananunkul, D.; Lee, T.C. and Chichester, C.O.

(1975): A simplified method for the quantitative determination

of sucrose, raffinose and stachyose in legume seeds. J. Food Sci.,

40: 1087.

Tessitori, M.; Rein, A.; Catara, V. and Polizzi, Z. (2002): Polygala

myrtifolia as a new natural host of Cucumber mosaic virus. Plant

Disease, 86(12): 1403-1409.

Trebbi, G.; Borghini, F.; Lazzarato, L.; Torrigiani , P.; Calzoni,

G.L. and Betti, L. (2007): Extremely low frequency weak

magnetic fields enhance resistance of NN tobacco plants to

Tobacco mosaic virus and elicit stress-related biochemical

activities. Bioelectromagnetics, 28(3): 214-223.

Uknes, S.; Mauch-Mani, B.; Moyer, M.; Potter, S.; Williams, S.;

Dincher, S.; Chandler, D.; Slusarenko, A.; Ward, E. and Ryals,

J. (1992): Biological induction of systemic acquired resistance in

Arabidopsis. Mol. Plant Microbe Interact., 6: 692-698.

Uknes, S.; Winter, A.; Delaney, T.; Vernooij, B.; Friedrich, L.;

Morse, A.; Potter, S., Ward, E. and Ryals, J. (1993): Biological

References

223

induction of systemic acquired resistance in Arabidopsis. Mol.

Plant microbe Interact., 6: 692-698.

Van Loon L.C.; Bakker, P.A.H.M. and Pieterse, C.M.J. (1998):

Systemic resistance induced by rhizosphere bacteria. Annu. Rev.

Phytopamol., 36: 453-483.

Van Loon, L.C. (1985): Pathogenesis related proteins. Plant Mol.

Biol., 4:111-116.

Van Loon, L.C. (1997): Induced resistance in plants and the role of

pathogenesis-related proteins. European Journal Plant Pathology,

103:753-765.

Van Loon, L.C. (1999): Occurrence and properties of plant

pathogenesis- related proteins. In: Pathogenesis-related proteins

in plants Datta, S.K.; Muthukrishnan, S. (eds). Boca Raton, FL.

CRC Press. Pp. 1-19.

Van Loon, L.C. and Van Strien, E.A. (1999): The families of

pathogenesis related proteins and comparative analysis of PR-1

type proteins. Physiological and Molecular Plant Pathology,

55:85-97.

Van Loon, L.C.; Pierpoint, W.S.; Boller, T. and Conejero, V.

(1994): Recommendations for naming plant pathogenesis related

proteins. Plant Molecular Biology Reporter, 12: 245-264.

Vance, C.P.; Kirk, T.K. and Sherwood, R.T. (1980): Lignification

as a mechanism of disease resistance. Annu. Rev. Phytopathol.

18:259-288.

Venkatesan, S.; Radjacommare, R.; Nakkeeran, S. and

Chandrasekaran, A. (2010): Effect of biocontrol agent, plant

extracts and safe chemicals in suppression of Mungbean Yellow

Mosaic Virus (MYMV) in black gram (Vigna mungo). Archives

of Phytopathology And Plant Protection, 43(1): 59 – 72.

Verma, H.N.; Baranwal, V.K. and Srivastava, S. (1998): Antiviral

References 224

Substances of Plant Origin. In: Plant Disease Control. Hadidi,

A.; R.K. Khetarpal and H. Koganezawa (Eds.), APS Press, St.

Paul, Minnesota, pp: 154-162.

Verma, H.N. and Kumar, V. (1982): Prevention of plant virus

diseases by Mirabilis jalapa leaf extract. New Botanist, 7:87-91.

Verma, H.N. and Kumar, V. (1980): Prevention of plant virus diseases

by Mirabilis jalapa leaf extract, New Botanist, 7: 87-91.

Verma, H.N. and Varsha, I. (1995): Prevention of natural

occurrence of tobacco leaf curl disease by primed Clerodendrum

aculeatum leaf extract. In: Detection of plant pathogens and their

management J.P. Verma, A. Verma and D.kumar, eds. Ahgeror

publishers (p) Ltd New Delhi, Pages 202-206.

Verma, H.N.; Varsha and Srivastava, S. (1991): Antivral agents

from plants for control of viral diseases, Abstracts: International

Conference on Virology in the Tropics, Lucknow, India, p. 250.

Vermerris, W. and Nicholson, R.L. (2006): Phenolic Compound

Biochemistry. 284 pp. Published by Springer, P.O. Box 17, 3300

AA Dordrecht, The Netherlands.

Vernooij, B.; Friedrich, L.; Ahl-Goy, P.; Staub, T.; Kessmann, H.

and Ryals, J. (1995): 2,6-Dichloroisonicotinic acid-induced

resistance to pathogens does not require the accumulation of

salicylic acid. Mol. Plant-Microbe Interact., 8: 228-234.

Vivanco, J.M.; Querci, M.; and Salazar, L.F. (1999): Antiviral and

antiviroid activity of MAP containing extracts from Mirabilis

jalapa roots. Plant Dis., 83: 1116-1121.

Walter, D.; Newton, A. and Lyon, G.D. (2007): Induced Resistance

for Plant Defence: A Sustainable Approach to Crop Protection.

1st. ed., Blackwell Publishing Ltd, Oxford, UK, 272pp.

Ward, E.R.; Uknes, S.J.; Williams, S.C.; Dincher, S.S.; Wiederhold,

D.L.; Alexander, D.C.; Ahl-Goy, P.; Metraux, J.P. and Ryals,

References

225

J.A. (1991): Coordinate gene activity in response to agents that

induce systemic acquired resistance. Plant Cell, 3: 1085-1094.

Wettstein, D. (1957): Chlorophyll-letale and submikroskopishe

fromvechsel derplastiden. Experimental cell Research, 12: 427-

506. (English abstract)

White, R.F. and Antoniw, J.F. (1991): Virus induced resistance

responses in plants. Plant Science, 9: 443-455.

Wieslander, L. (1979): A simple method to recover high molecular

weight RNA and DNA after electrophoresis separation in low

gelling temperature agarose gels. Anal. Biochem. 98: 305-308.

Wojtaszek, P. (1997): Oxidative burst: an early plant response to

pathogen infection. Biochem.J., 322: 681-692.

Wood, I.G.; Gluck, A. and Endo, Y. (1992): Ribotoxin recognition

of ribosomal RNA and a proposal for the mechanism for

translocation. TIBS, 17: 266-269.

Wray, J.L. (1992): Inducible Plant Proteins: Their Biochemistry and

Molecular Biology. Society for Experimental Biology, Seminar

Series: 49, 1st Pub., Published by the Press Syndicate of the

University of Cambridge, UK, 309pp.

Yalpani, N.; Silverman, P.; Wilson, T.M.A.; Kleier, D.A. and

Raskin, I. (1991): Salicylic acid is a systemic signal and an

inducer of pathogenesis-related proteins in virus-infected

tobacco. Plant Cell, 3:809-818.

Yalpani, N.; Leon, J.; Lawton, M. and Raskin, I. (1993): Pathway

of salicylic acid biosynthesis in healthy and virus-inoculated

tobacco. Plant Physiol. 103:312-315.

Yang, X.; Liangyi, K. and Tien, P. (1996). Resistance of tomato

infected with cucumber mosaic virus satellite RNA to potato

spindle Tuber viroid. Ann. Appl. Biol., 129: 543-551.

References 226

Yardimci, N. and Eryigit, H. (2006): Identification of Cucumber

mosaic virus in tomato (Lycopersicon esculentum) growing areas

in the north-west Mediterranean region of Turkey. New Zealand

Journal of Crop and Horticultural Science, 34(2): 173 – 175.

Zahra, A.M. (1990): Studies on wilt disease of sesame (Sesamum

indicum L.) in upper Egypt. Ph.D. Thesis, Fac. Agric., Assuit Univ.

Zaitlin, M. and Hull, R. (1987): Plant virus-host interactions. Annual

Review of plant Physiology, 38: 291-315.

Zambolim, E.M.; Assais, M.I.T.; Zambolim, L.; Venturia, J.A.

and Carvalho, j.M.G. (1994): Natural infection of banana

cultivar prata (AAB) by cucumber mosaic virus in the state

Minas Gerals, Brazil. Fitopathologia Brasilena, 19(3): 483-484.

Zehnder, G.W.; Yao, C.B.; Murphy, J.F.; Sikora, E.R. and

Kloepper, J.W. (2000): Induction of resistance in tomato

against cucumber mosaic cucumovirus by plant growth-

promoting rhizobacteria. Biocontrol, 45 (1): 127-137.

Zitikait ė, I. and Samuitienė, M. (2009): Detection and

characterization of cucumber mosaic virus isolated from sweet

peppers. Scientific Works of the Lithuanian Institute of

Horticulture and Lithuanian University of agriculture.

Sodininkystėir Daržininkystė, 28(3): 281-288.

استحثاث املقاومة اجلهازية استحثاث املقاومة اجلهازية

ضد بعض أمراض الطماطم الفريوسيةضد بعض أمراض الطماطم الفريوسية

مقدمة منرسالة

á]çã�<àè‚Ö]<g¦<á]çã�<á^µc< <<íéÂ]…ˆÖ]<Ýç×ÃÖ]<Œçè…çÖ^ÓeEl^fÞ<š]†Ú_<DNLLN< <

<íéÂ]…ˆÖ]<Ýç×ÃÖ]<�jŠq^ÚEl^fÞ<š]†Ú_<DNLLS< <

Â]…‡<íé×Ò†ãj�Ú<íI^ãße<íÃÚ^q< <

حلصول على درجة الستيفاء متطلبات ا

يف العلوم الزراعيةدكتوراة الفلسفة

أمراض النبات

)أمراض فريوسية(

قسم النبات الزراعي

)فرع أمراض النبات(

بمشتهركلية الزراعة

جامعة بنها

٢٠١٠

ا�� ا��

- ١ -

א��א��

�� א��א��، �א�� א�� אض ��ع ��و �� !� �א�#א"� $%&� '(�)��*+,!� �א��א�� ،�*�� )� ��و�%�-�، ،�)��א/�.�و�� )��א�01و� ��ع ��

23�4�� )� �א��א��، K6� � �א��7�89 �زא�� ;�� *#�٢٠٠٨L٢٠٠٩�D–�٢٠٠٧L٢٠٠٨=ل��HI�Jא"+G#אم��Eو��א�+K��א��7�89دون�א�N��"אض�א�01و��Oو��א��/��P��"��

�Q�R�א� �ل�א�+#��Sא/��#א ��و�א�.��8و)�T+�א� ��وא��TU�وא��V��א�W��X��Yא��7I�Z8[�1�X��א��א9�)��\�ل�א��]��^K� �

اجلزء األول�א�01وא/�`��*#��D_��8و�,+aא�b#��J�U�+"ل�א��7�89א�UT!��1�+G/א� �"�N

��ل��X��Eא��c��)�6+��א �א��0و�dא"��9א��' e�f�א��U/א� �و��gTא� ��Fא��iא��j�� E�&� �א/�Rد�0��8lو"� ��_�א��0م W�-(زא��0وس�� ،��lزא)-�א��0وس��

�Kو�0وس��2�Iא��7�27�9א/0��،�1Uوس�وא�qא��8�27�9א�#�6ن،��0وس�p #��وאق�א�9��د)��I�4��Q#(#��"0و�� I�r��&و(#��ن�F#c0وس�وא��E��9��6� ��IوF��j��

�א�� دא6� ��0وس Z�E� K��j�� א�01و"�� iא� ��אض q#�]� f�א� �א�� _�e� ��ن و(# ��Z.s�ل�א��&��t.��و[, �א��1א ��و # p� ��jא ��و �א�+��uvwو �01Kو"� ��*�א/�زא)-��و

�*]#tو��x��(�V/א��א��yو�z��U+G/א��lزא)-�א�js��CMVو(#��ن��0وس��{��lא��1د)��و�א�Jא� �א�01و"��"��i�4א��(��W��[.�א��،��%�-�~��{�و[��+{��

�א� ��a� W�� א�01وس �*a�.(� f�א� Qא/�1د� �� [��א/ �א��_ ��]� �א"�9�� `��C.

amaranticolorא�01وس� ��t%א�� K� �]��a� W�� U�א�Nא�01وس�� j�I�~و�زא��]�א"��א]{،�و�#א$�א� �א��،�و�7ق��Kد�6ن�(�#��}+(�&�Z��#��+�و~�א}��+a�1،�א�+G/א�

��אQ،�ودא"��6�א+Eم��)��Z�� א�Q�,��(=6�N�}a�،��א/ 8��א��1�)��'��وD{و��).��UT+/א� ��א��+�� 'aو�� 6+��אdא�� א"�9�� )��א��0و� }+(�&� Z�� '�j+�א�~� و�06א� �ق�وא/ ��N��*��D\�ل�[,�g�Gو[ �)��א�01و"��*��9/��دون��N��א/�א(_�א/

�Kא��[��

��ا�� ا��

- ٢ -

الثانياجلزء ��HIو"�� و��P/��و��א�+��cو��6�Z=ل�א�#א"� �א�+�K)��وא�+��9

� ��"+G#אم �א��Oאض�א�01و"�� 7� �jT+�� U�G+�� j�� و�� Jא�" ��tא��]��a�M. jalapa��وא��;�4א�C. inerme،�9�+و�� Qو��0 �و��1د�

��v�Z�Fא��ل� ��N&%א E� �t�وאt`�א�.�8��j�Fa� �و�.+0)� Q0��q%�+]� ��.]� �,� ��N�� و� �� وא�.��8 �א�� و�� (�Rض�� 8\� }��N� �و[�1ز �R6Oא�q�,�א� W��s�aI� �و��,�9 Q#�� Qد�R�� و��Rدא �א�01و"� �و��+�� و��אد �(��EKא/�Rدא �א��

��N ��ع��אض�א�� .��א��א��jT+�/�0[�-�אR��~�#vو� J�#vو� �*�� )b�6�� d�\�N� ��و ��21a�Nא��ل Jא�"� ��"��p�N� �*c��W�� J�� א0+6 K�'(�)و�

8��Zא�+�#)�א �وא�+�T��א�wو[��وאai��sوא��)��a�.�I�Z��T+��Vא�+��\��jT+�/א��7�89��8و��א�*�ز)��א� �]��a��]��א� ��Z�}��K#]#�א�01و"� �

جتارب استحثاث املقاومة اجلهازية: أوآل١� J א�� א�� א�� א�� א��! א �$#א"�

��%�&�'�(�� %��1 وس�و.$�-ن�+�*��א("��وא�! ��4�5��6-ن�2*��3� �و�+$د ،� �א�� 39:�#$.�;*+��א�*=>��"��>�א��@ א��! א�6��4ز3�دא

A� �אC��Bو��2��א�* �-ذ#ع �+$د ،�4F<א��GHو�� ،� �%��!��Iא�� K�K��G�LM�N3�O� >� ��א�*=> B�"�� ،� PM�6Qא�R@�� >� �!�Fא�� N�S�� ،� �=��Qא�R@�

�Kא��!�#

٢� J ج��V� ��1 وس�+*; �א��P2&�4�5و� �א��6$ א"� �Xא��ش��אد� $@�� *1 و"� �Y6�د� �<��א�>��-��٧و� >� �[��M-� �وM�ن �א��ش، P6� 3�م

�B��]F*��6�^�א��א�`�א��S��و-5*%��ز3�د��<�א�>��א��_*�*6�@6� !�� #�26��H��א� �و 4��א�* � K� ��P6#ش�א�>��א٢٥��2bو�@$ �6�3�

�Y6�د��*1 وس��=��א�@��*6��S��و-�<��45ز3�د��<��d��S-+*;��و��f<Sول ��#�26� �H��א� g*��h� �א�� א�>�� K�]��%Sא�� و��$3�1

��% iن�-و�Mو��P+��3�jא�>��א��*�<��&kم��و��%l��<��*�Gא��و��%��א��ش�*3��%��*m��n��H��Bא�*��n�4א��F*��hא��ش��P+��O�<א�

ا�� ا��

- ٣ -

��Sא�� א�` K�ok�pא� �وא�! �6@�6*��3$2 �א�@�6*� �<�א�>�� و6��%��%��*6�@6� �א�! P+� �א�@�6*� �א�>�� >� �ok�pא�G*�� ط �ز3�د� r&�� Kن��Mو

�א�>�� ]F*��6� ^�*_� �א�� א�>�� >� ;*+-� �$אز�Mא�� و� ��ط K��6-��hא��<�א�>�� M-ن��Ss� �$אز�Mل�-و�<�s�]א��B��g*

4��$אز�<�א�>��Kא�*�M��3א�� وk�V�t��6ط��Sא"�>��1א��ش��א�`�א��1 وس ��2u� !א�� K��6-� ،�א�>�� ]F*��6�^��א��ش�_* P+� �O�<א�� %�*3

��<�� 4��א��ش��B��g*��hא�* �=�� tد��ز3�d��Ss� P2vא�$@�� t�� =��hא��ش��=��א�G*��dY1wא�3k�د��H��و��x1א�>��=��"=*�g*��K�dא��$אز�Mل�-و�<�s�]��*��]ok�pא�t��א��y6K

٣� J �`א�� א�� א�>�� >� tد��ز3� r&��G*��v��R6א�� ]�Sא�� 3$2��n��H��א��ش��g*��hא� �=�� ز3�د� �%��1 وس�3* �%<2&�4�5� ��Sא�

�F*ط�א��*m��n�4� �B�Kא�*

٤� J '� �-ن r&��P+� ��Fא�� א�>�� >� g5�<�� א�>�� >� ]|�Yא�� 4��א�� !��א��+*;��א��א�! ��2u��1 وس��Kא��*�� V(�-ن�א��

�א�� و:�'� ��א�S�#و� �!�'�G�LMو� }� �و -� 4�s#�*M� P6� ��uא]� زאد#� �و-: א ��%<�� ^�*Cא� �n� �H��א� �n� 4��א�* B��g*��h��Sא�� Kא�`B��fא��x1<1 وس�و��2bא� ��Kو��x1א��y6�dn$&��~&9א�>��

٥� J �P6� �*6�@6� �א�! P+� �� وא�@�6*� ��2u� �א�! �א�>�� u� زאد�א�1�>�ل K�B��g*��hא��1�>�ل�א�S*[�<�א�>��*�� k�M��;*+-ن��Mو

�3kא�� وM�ن ��Sא�� #א�` �n� 4��g*��hא�* �א�� א�>�� >� 45-� د��26��#��f<Sول�F*א��^�*:��n��H��و�@$�&�P2א�>��1 وس��Kא�

��h*�ط� �א��ش t�*3� 4��א�* B��g*��h� �א��ش �=�� *Sא�� )�<��א�1 زאد�H�� Kא�1 و"��nא�`�א��S��و-: א�א��ش��g*��hא�

��ا�� ا��

- ٤ -

٦� J ض�א��Qא� �3$2�� %l-� ��P6ع �<��RNA>�و�3 �@1��6� �%��Mو.$�-ن�� *Sא��B��g*��h� �n� ��Sא�� א�` ��1 وس�وא�� 2u� !א�� א�>��

�F*ط�א��*�hא��ش��n��H��%��g*��6א�*3�4� Kא�*

٧� J وس� s��6و�2hص��:��.�4�+�k�1 ��3��vא�� CMV-د�א�@�6*��و�$5��+kل�א��و��s�@6��5�yא+$��K�K��4�5&2>%��1 وس<��א�

�9|�@�� :-� �� P6� PSא�1 وس�و��x1<�� *n�� 26�و�6 �<�� t��#�26و�<��1��א"� ��%n��V�;*+�ج��x1א��وذ��G<��3��P+�Gא�*�mK

٨� J א�� א��ش �=�� א�1 وس ��@s� �n�� $6� �-ن�א:�� وو.$ ��ض�<� ��'pא� �$�� 3$2�� $@�� '�� *� �6� d �'-� �א�� א�>��

�א�>��א�@�6*� K��3$2��$@1 وس��*��]iط�א��א�>�d1@i-�k�1 و-ن�+�*��א��k�M��n��$6�;*+��5�*��@iא��y2��3$2��3א��P+� ��.�� Kk�M��

Kא�1 وس

ملقاومة اجلهازية املستحثةجتارب ا: ثانيا١� J ��&$��dn! א�א��@��א�� א�1 وس�� =��26�و�6��

�א�@�6*� �=�� 2u� �وא�! ��1 وس ��2bא� �א�� K�G*�� P6�א�� 39:� #$.� >� ��א�*=> B�"�� =�� 5-� d��M� �א�>�� -ن א��! א�،� A�vو� B�:� P6� �א�>�5*� ��אQو+ �-+$אد �زאد �א�>�5*�، �אv��א �א:fאق d6و�2s

4F<א��GHزאد��،��*��<�א�>��Kو�G�LMא��@ א�א�!��[��%l9Cא� B�� א��א� >� d*�� Fא�� 4F<*�� Sא�� 3Fد��א�@�� א�>�

�K،�و�>��g5<�+$د�و��4Sאkvم�א��+�|��Eوא("1>=[ �

٢� J א��*��1א��@��א�� א��*��4@sد��#�P6د��א("�1�d��*1 وس �<�א�>��26�و�6 �$3$.��<��<��V�ج��و� K� $@�٧��P6#ش�א�>�� -3�م

��א� � ��2bא� ��*�Gא�� P6� ��M� ;*+-� �א�>�� >� d��S�� Sא�� `�<�و-5*%��ز3�د��M��d<�א�>��א��_*�^��B��]F*��6א�*��4و��Kא��و�

ا�� ا��

- ٥ -

�*6�@6� !��#�26��H��א� � K�$@�� 6-٢٥�d��S��2bא��P6#ش�א�>�� 6�3��S�� א�@�6*� �=�� *1 وس �Y6�د� �<��و� �� ;*+-�>� �ز3�د� �و-45 ��f<Sول ��#�26� �H��א� g*��h� �א�� א�>�� K�]��%Sא�� و��$3�1

��% iن�-و�Mو��P+��3�jא�>��א��*�<��&kم��و��%l��<��*�Gא��و��%��א��ش�*3��%��*m��n��H��Bא�*��n�4א��F*��hא��ش��P+��O�<א�

��Sא�� א�` Kpא� �وא�! �6@�6*��3$2 �א�@�6*� �<�א�>�� و6��%��%��ok��*6�@6� �א�! P+� �א�@�6*� �א�>�� >� �ok�pא�G*�� ط �ز3�د� r&�� Kن��Mو

�א�>�� ]F*��6� ^�*_� �א�� א�>�� >� ;*+-� �$אز�Mא�� و� ��ط K��6-� �<�א�>��א�� M-ن��Ss� �$אز�Mل�-و�<�s�]א��B��g*��h

4��$אز�<�א�>��Kא�*�M��3א�� وk�V�t��6ط��Sא"�>��1א��ش��א�`�א��1 وس ��2u� !א�� K��6-� ،�א�>�� ]F*��6�^��א��ش�_* P+� �O�<א�� %�*3

��<�� 4��א��ش��B��g*��hא�* �=�� tد��ز3�d��Ss� P2vא�$@�� t�� =��א�G*��dY1wא�3k�د��=��א��شH��g*��hא� �K�d*="��=�و��x1א�>�

�$אز�Mل�-و�<�s�]��*��]ok�pא�t��א��y6K

٣� J �P+��Fא��א�>��א��2��Iم��@�*��א��4א��Y|[�<�א�>��!�'�y3ز��n��3��א��* K��@��א�� 2bא� �א�>�� א�1 وس�< �26�و�6 و��&�r-ن

��4-�"�+$�+*;�ز3�د��uאs#�*M�P6��[،�}�� و�G�LM'�!��א�S�#و��و:�'��،� ^�*Cא� �n� �H��א� �n� 4��א�* B�� g*��h� �#א�`�6א�� و-: א ��%<

��Sא��KB��fא��x1<1 وس�و��2bא� ��Kو��x1א��y6�dn$&��~&9א�>��

٤� J +�� زאد�<�א�>��א��2bوא�@�6*�� *Sא��)�<��P�Kא�! �6@�6*�א�1��n�4�1�>�ل�א�S*[�<�א�>��א��B��g*��hא�**�� k�M��;*+-ن��Mو��n��H��g*��hא� �א�� א�>�� >� 45-� �א�3k�د� �وM�ن ��Sא�� #א�`

�26��#��f<Sول�F*א��^�*:� � K�$@٢٥و��P2&�P6א�>��1 وس�زאد�=��א��*Sא��)�<��tא��ش��h*�ط�א�1 و"��א�1*3�4��ش��B��g*��hא�*

�H�� nKא�`�א��S��و-: א�א��ش��g*��hא�

��ا�� ا��

- ٦ -

٥� J � �א�>�و�3 �א�Q�ض �3$2��RNA� $@�� *S�٧��2א�bא� �א�>�� #ش P6� �-3�م�t�*3�4��%��1��6@��<�א�>��א��B��g*��hא�*�M1 وس�و.$�-ن��

��n��Sא�`�א�#�H��و-: א�א��ش��g*��hא�F*א��^�*:�K�$@��6-٢٥�>� �ز3�د� ;*+-� �V� ��Sא�� #א�` t�*3� 4��א�* B��g*��hא��ش�� -د� ��3م

�^�RNAא�Q�ض�א�>�و��3*:��n��H��t<�ذ��Gא��ش��g��hא�*3��*Sא��26��#��f<SولF*א��K

٦� J � ��*Sא��$#א[��Sא��uن�-�r&��$@1 وس�و�� 2bא��-3�م�٧<�א�>��tא��ش�*3�4��P6#�%��5$�زאد��=��א�@�6*��א�`�א��S��B��g*��h��nא�*

�H��א� g*��h� �א��ش �n� ��*�ط K� $@�� 6-٢٥��زאد $2s� �א��ش P6� ��3م�g*��hא��ش�� t�*3� 4��א�* B��g*��hא��ش�� =�� *Sא�� $#א[��Sא�

H��א��ش��א�`�א� t�*3��F*ط�א��*�hא��ش�� =�� ز3�د� 45-�d��Mو�� Kא��S��Vذא�6��d�#�5��f<Sول

٧� J ��א��>�#��Cא�G3وس��6زא s�$i�� א��=�#{��א�2�و��6א��%l-�K�^�� אp'��ض�و��3$2 ��P6:9ل�5��س��$� ��3�O�Gذ��و��$5

�א� �א�1 وس �א��y2��ط �+$د ;*+� �A�<�� .�� א�1 وس k�M�� }�� ]i��*F1<6��*6�@6�4S��t<2&�$@��G�L��gF|�4א��א�@�;*+��Sא��@iא��K�$5و

�^��V�4��Bא�*��g*��h1 وس��2bא��א��-د��#ش��Sא�� #א�` �n��H��ذ��Gא��ش��g*��hא� >� t��א��ض�3* �و-: א��$� ��

m�K*�ط��g*��6א�>��26��#��f<Sول

ا�� ا��

- ٧ -

ةــــــــاخلالص

وس��زא�� ل�و��و��)'&%$��#�"! �א��א��)�*+� #�� ,'�� -.*�� (/� 0� ��א��1 �א�34*.2 5*�*6�� #�� א�7*

��9*�8"! �א��א��#�א�,و� � א:��; <:�� Bא��A@�?�א��%��<��( אCD�5א*��א�%��E*734*.�0�2א�1*.-�א�אK� �

�-Gא�H� 0� ; <:>� IH*'�� א�� 5*�*6�� #�� I�*6�� 5*@%&'(�� J��&'�א�ن��L%�� *�6(�� ;��M�1س�א��%�1*�5א*��L%�� א'C��و�� ،� O'MPא��א�� %Q

�5*�*6��0��E ��#�א1)66*�5א1<:�*>��>*RS��T6<��9U��*3V��R*Cو��,%'W*3O�@%&'(�� T�%C� *X�� א�'&�م *3Q� ،� 5*��א�,و #�� א1')�66 אض�Dא��K

� �א�:�63]* �א]\� *X�� א�6:'�*�Fوא�'&�م #�� אع� ;��#�� :*�%_��:�ن #G*Q`*M�א� L%�� aא �3�� א��*�� ;�وא37 E�0� 5*�G*:�א� �%�� وא]\� #�� و�)',*د

� �א�� 0� �� *" 3d� 8*�9�� `*M�א�#�� <:�� ae��وא� ��Gא!f�א� �א�gא�? #��;��M�1א� h*iDא� �ذ�� L%�� J�د� *3Q� �وא��6*5 �وא��kאن �א�l)*ن 0� אض�Dא

و<*5:�3%�� X*د; ��L%��`�'mאد *On[א��و K��%ن�� و��oG*'��#��I6א��א�?(�>� وس,%�� X*د; و��*5>� ��q'*ج L%�� א�34*.2 5*�*6�� J<n'��א �� א�1אد

��',*و�� K�0� *OH*r� ��s��gوא� ��H�3�:�وא� ��m M'�א� �א�'�� א5 J'69�و5*�و,�*>��>*Rlא��E�5*6��0א��kא�1*و��א�h*<n'��Kא �

��*و�� 0� �א1'&@$ �א�1*و�� Ia� �� و�� ل ��א��א �eCل #�� و��* ��s��gא�5א�*6'Ctא� �4��<�א �6��0*�5א�34*.2 � �وس��زא��א�7*�

��B<��א��a�#��5*��g*�5و��%��*��5)��6א�� *P�oG*'� K�t� *P��QUو��ع��t*x��w*r��M%א1)'&%@*�5وא� א]\�א��u�0�;v'&1-�א�1*و��א�,�*��

y�kو��0א� و�zא�@�<��{�Ju�` X7א|�3ع�א�L%��*[��EKא�,وس� �

��ا�� ا��

- ٨ -

اتـــــــالتوصي

وس��R_�א��א��1*و��א�,و�*�5א��*H�0��R*C34*.�2و%��E 31��Wزא��א�7*��<~�6*ع�א�47א�5א{��

١� J�5*�*6�� `�� وא�'s@*ل �<*�'(*م y�kوא� �وא�@�<� y'M1א� 0� �א��6*�*5 ��>*'� ق��وU>�tولk*>�*O��$%&'�وא��>*@�K� �

٢� J�0��R*Cא��و��Hل�א��kل��و��Hאض�א��5*6�Q�y�%�א��6*�5]?�א��ز��*و��א1)* 5*�*6�� א��<�� oא� >� �و� ��א�6!و ��l'*ج �א1&@@� ;f@�א� 5*H

�#��א�5�M>� 8א�a��L%6*��5ود��ن�א��*3"tو��،�IE f��وذ��!f'�א�#��*V��*و��;� א�5א��4*Mk��3אg�;د�*.�;� ز��אد�.�*,��*O� .

Fא��א� $d� t� ;��M�� h*i�� eCل #�� ; ��'�� Iא��%�1�� E� �� *��و�אق� �א�@�� v'�� !Qو� �א��*�%� א5Mkא� #�� *3kא� 2.*34%��#�� א�:> ��*و�� 0� ��*�,>� _G*1א� *O@%&'(�� )'&�م A�א� �وאg!و

�� אض�و��R*Cא�,و�DאK� �٣� J� ;�1� �א��א�� y6�� א�34*.2 5e'[� ��a!و ��١٥�_G*1א� �א1)'&%$ 0� �د��

�و��y�%�6*�*�5]?�א��:�63]*��א]\�א�3*�،��و��0O��T�%Cو��I�*��אF��3gא� ��Q�>٥٠� � KE٪� �א�34*.2 5*�*6�� <*�'(*م�ش yQ�١٥–��١٠�#�� <�א�� م

6�%*�*�5א�)*<��و��א]\��G*1_�א'&%$�)]'%O*�و�L'Hو��Jא�@�ل�<*1 Qذ��)*�א��Q��*>�*[�63:�א K

Inducing systemic resistance against some tomato virus ... · Title: INDUCING SYSTEMIC RESISTANCE...

Documents

Transcript of Inducing systemic resistance against some tomato virus ... · Title: INDUCING SYSTEMIC RESISTANCE...