Download - Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Transcript
Page 1: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Taqman Technology and Taqman Technology and Its Application to Its Application to

EpidemiologyEpidemiology

Yuko You, M.S., Ph.D.Yuko You, M.S., Ph.D.

EPI 243, May 15th, 2008

Page 2: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Current Techniques for Current Techniques for SNPSNP

PCR-RFLPPCR-RFLP TaqmanTaqman Other technologiesOther technologies

SequencingSequencing Microarray (DNA chips)Microarray (DNA chips) SNPlexSNPlex Illumina SNP panelIllumina SNP panel

Page 3: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

PCR-RFLPPCR-RFLP

Page 4: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

What is PCR?What is PCR? Polymerase Chain ReactionPolymerase Chain Reaction

A laboratory technique that can A laboratory technique that can amplify the amount of DNA from amplify the amount of DNA from a tiny sample to a large amount a tiny sample to a large amount within just a few hours. within just a few hours.

Applications for basic science, Applications for basic science, epidemiology, evolution, linkage epidemiology, evolution, linkage analysis, forensics, anthropologyanalysis, forensics, anthropology

Page 5: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

How PCR is done ?How PCR is done ?

Primers ---->

Page 6: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

How PCR is done ?How PCR is done ?

Page 7: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Typical PCR Reaction Typical PCR Reaction MixMix

Component CONTENT FUNCTION

Water H2O Adjusted PCR reaction to appropriate concentration

PCR buffer KCl, Tris and MgCl2 For their efficiency in supporting the activity of the Taq polymerase.

dNTP dATP, dTTP, dCTP, dGTP deoxynucleotides

Provide both the energy and nucleosides for the synthesis of DNA

DMSO dimethyl sulphoxide Improve amplification efficiency

Primers Short pieces of DNA Bind to DNA template allowing Taq DNA polymerase enzyme to initiate incorporation of the deoxynucleotides.

Taq A heat stable enzyme that adds the deoxynucleotides to the DNA template

DNA The DNA template which will be amplified by the PCR reaction.

Page 8: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Typical PCR programTypical PCR program

95C 95C

55C

72C 72C

4C

10min 1min

1min

1min 7min

x30 cycles

Depend on primers design

Page 9: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

PrimersPrimers Primers are short, artificial DNA strands — Primers are short, artificial DNA strands —

often not more than 50 and usually only 18 to often not more than 50 and usually only 18 to 25 base pairs long — that are complementary 25 base pairs long — that are complementary to the beginning or the end of the DNA to the beginning or the end of the DNA fragment to be amplified. fragment to be amplified.

They anneal by adhering to the DNA template They anneal by adhering to the DNA template at these starting and ending points, where the at these starting and ending points, where the DNA polymerase binds and begins the DNA polymerase binds and begins the synthesis of the new DNA strand.synthesis of the new DNA strand.

Page 10: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Example: CAPN10Example: CAPN10

25741 acgtgctctg cctgccgaag tgaggaggct gggcacggtg cctgggttcc ccctgcccag 25741 acgtgctctg cctgccgaag tgaggaggct gggcacggtg cctgggttcc ccctgcccag

25801 gcccagtttg gttctcttca gcgtggaga25801 gcccagtttg gttctcttca gcgtggagagg atgattctgt cccaggagcc gggaggagggatgattctgt cccaggagcc gggaggaggg

25861 25861 tgatgattct gtcccaggag ctgggaggagtgatgattct gtcccaggag ctgggaggag ggtggtgggcttg tgggaggggc tggctctgtc gggcttg tgggaggggc tggctctgtc

25921 tgtggccgta gctgctgctt agaccctgcc agggttcatg aggccaccgt ggcgggaggc 25921 tgtggccgta gctgctgctt agaccctgcc agggttcatg aggccaccgt ggcgggaggc

25981 cagcgaggag ccgtgtccca cagctgatgc ctggtgtttt ctcactagag aggctgctct 25981 cagcgaggag ccgtgtccca cagctgatgc ctggtgtttt ctcactagag aggctgctct

26041 gccatacgcg ggcgctgcct ggggcctggg tcaagggcca gtcagcagga ggctgccgga26041 gccatacgcg ggcgctgcct ggggcctggg tcaagggcca gtcagcagga ggctgccgga

5’-GTTTGGTTCTCTTCAGCGTGGAG-3’ 5’-GTTTGGTTCTCTTCAGCGTGGAG-3’

5-CATGAACCCTGGCAGGGTCTAAG-3’5-CATGAACCCTGGCAGGGTCTAAG-3’

Annealing time calculateAnnealing time calculate Tm = 4(G + C) + 2(A + T)°CTm = 4(G + C) + 2(A + T)°C

= 66°C= 66°C

= 62°C= 62°C

Page 11: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

PCR-RFLPPCR-RFLP Restriction fragment length polymorphismRestriction fragment length polymorphism

The purpose is to The purpose is to detection of point mutations detection of point mutations after the genomic sequences are amplified by the after the genomic sequences are amplified by the PCR PCR

A restriction enzymeA restriction enzyme (or (or restriction restriction endonucleaseendonuclease) is an enzyme that cuts double-) is an enzyme that cuts double-stranded DNA. The recognition sites are usually stranded DNA. The recognition sites are usually 4 to 6 base pairs in length 4 to 6 base pairs in length

Use gel electrophoresis easily identifies the Use gel electrophoresis easily identifies the mutations, since mutant allele generate smaller mutations, since mutant allele generate smaller DNA fragments DNA fragments

Page 12: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

List of Restriction List of Restriction EnzymeEnzyme

Page 13: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

PCR-RFLPPCR-RFLP

How a restriction enzyme work?How a restriction enzyme work? i.e. EcoRIi.e. EcoRI

Page 14: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Genotype scoringGenotype scoring

Sample results of PCR-RFLP Sample results of PCR-RFLP (CAPN10)(CAPN10)

12

12

22

22

22

22

22

11

12

12

22

11

22

12

11

12

12

11

12

12

12

22

22

22

12

12

12

12

11

12

11

11

22

11

1 = major allele2 = minor allele

Page 15: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Taqman SNP Taqman SNP assayassay

Page 16: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Taqman SNP assayTaqman SNP assay

TaqMan SNP Genotyping Assays provide optimized assays for genotyping single nucleotide polymorphisms (SNPs).

The products use the 5´ nuclease assay for amplifying and detecting specific SNP alleles in purified genomic DNA samples.

Page 17: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Taqman SNP assayTaqman SNP assay

The TaqMan SNP probe contains a The TaqMan SNP probe contains a reporter dye at the 5´ end of the probe reporter dye at the 5´ end of the probe and a quencher dye at the 3´ end of the and a quencher dye at the 3´ end of the probe.probe.

During the reaction, cleavage of the probe During the reaction, cleavage of the probe separates the reporter dye and the separates the reporter dye and the quencher dye, which results in increased quencher dye, which results in increased fluorescence of the reporter. fluorescence of the reporter.

Accumulation of PCR products is detected Accumulation of PCR products is detected directly by monitoring the increase in directly by monitoring the increase in fluorescence of the reporter dye.fluorescence of the reporter dye.

Page 18: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Taqman SNP assayTaqman SNP assay

A substantial increase A substantial increase in…..in…..

Indicates……Indicates……

VIC dye fluorescence onlyVIC dye fluorescence only Homozygosity for Allele 1Homozygosity for Allele 1

FAM dye fluorescence onlyFAM dye fluorescence only Homozygosity for Allele 2Homozygosity for Allele 2

Both fluorescence signalsBoth fluorescence signals Allele 1-Allele 2 Allele 1-Allele 2 HeterozygosityHeterozygosity

Page 19: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Probe-Based Assay ChemistryProbe-Based Assay Chemistry

Page 20: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Detector

EmissionFilter

Light Source

ExcitationFilter

How is Fluorescence Data Collected?

Page 21: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

How is Fluorescence Data Collected?

Page 22: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Standard Procedures for Taqman Standard Procedures for Taqman SNP assaySNP assay

Page 23: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Taqman SNP assayTaqman SNP assay

The assays require only three components:

1. 1 to 20 ng of purified genomic DNA template2. SNP Genotyping Assay Mix (specific for each

polymorphism)3. TaqMan Universal PCR Master Mix

The assays require only one amplification step and an endpoint reading to obtain results.

Page 24: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Default Taqman SNP Default Taqman SNP programprogram

95C92C

60C

10min 15sec

1min

x40 cycles

Page 25: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

SNP Genotyping Assay Mix

Sequence-specific forward and reverse Sequence-specific forward and reverse primers to amplify the SNP of interestprimers to amplify the SNP of interest

Two Taqman ProbesTwo Taqman Probes One probe labeled with VIC® dye detects the Allele 1

sequence One probe labeled with FAM™ dye detects the Allele 2

sequence

Assay designed specifically customized to Assay designed specifically customized to fit the default PCR programfit the default PCR program

Page 26: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Genotype scoringGenotype scoring

Page 27: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Compare PCR-RFLP and Compare PCR-RFLP and TaqmanTaqman

PCR-RFLPPCR-RFLP Taqman SNP assayTaqman SNP assay

AdvantageAdvantageInexpensive for small setting Inexpensive for small setting studiesstudiesFlexible for most kind of SNP Flexible for most kind of SNP genotypinggenotyping

Easy to performEasy to performSuitable for high throughput Suitable for high throughput genotypinggenotypingNeed less information about Need less information about target sequencetarget sequenceLess prone to human errorLess prone to human errorFaster, more efficient for SNP Faster, more efficient for SNP genotypinggenotyping

DisadvantageDisadvantageNeed information about target Need information about target sequencesequenceNot suitable for high throughput Not suitable for high throughput genotypinggenotypingProne to human errorProne to human error

Not possible for all SNPs assaysNot possible for all SNPs assaysHigher expenses for equipment Higher expenses for equipment maintenancemaintenance

Page 28: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Limitations of Taqman Limitations of Taqman AssayAssay

Not applicable for multi-allele SNPsNot applicable for multi-allele SNPs No deletionNo deletion No insertionNo insertion No MicrosatellitesNo Microsatellites May not work if too many SNPs May not work if too many SNPs

closed to the targeting siteclosed to the targeting site

Page 29: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Other Molecular Other Molecular TechnologiesTechnologies

1.1. Direct SequencingDirect Sequencing DNA sequencing is the DNA sequencing is the

process of determining the process of determining the nucleotide order of a given nucleotide order of a given DNA fragment DNA fragment

DNA fragments can be DNA fragments can be labeled by using a radioactive labeled by using a radioactive or fluorescent tag on the or fluorescent tag on the primer, in the new DNA primer, in the new DNA strand with a labeled dNTP, strand with a labeled dNTP, or with a labeled ddNTP. or with a labeled ddNTP.

Page 30: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Other Molecular Other Molecular TechnologiesTechnologies

1.1. Direct Sequencing (Continue)Direct Sequencing (Continue)

Page 31: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Other Molecular Other Molecular TechnologiesTechnologies

2.2. Microarray ChipsMicroarray Chips Microarrays measure gene expression by taking Microarrays measure gene expression by taking

advantage of the process of hybridization. advantage of the process of hybridization. Hybridization allows researchers to test whether two Hybridization allows researchers to test whether two pieces of DNA are complementary. pieces of DNA are complementary.

Some form of DNA spotted on a chip (probes)Some form of DNA spotted on a chip (probes) Density of spots importantDensity of spots important One individual sample, many genotypes per assayOne individual sample, many genotypes per assay

Page 32: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Other Molecular Other Molecular TechnologiesTechnologies

3.3. SBE (Single base extension)SBE (Single base extension) Allele specific primers designedAllele specific primers designed polymerase synthezises the primer on the template polymerase synthezises the primer on the template

exact one base before the SNP exact one base before the SNP

4.4. PyrosequencingPyrosequencing short-read DNA sequencing and mutation/SNP short-read DNA sequencing and mutation/SNP

analysis analysis

5.5. SNPlexSNPlex Taqman Assay based (48-96 SNPs per reaction)Taqman Assay based (48-96 SNPs per reaction)

6.6. Illumina SNP panelIllumina SNP panel carried out in 384, 768, and 1536 plex formats using carried out in 384, 768, and 1536 plex formats using

Illumina custom SNP panels or standard validated Illumina custom SNP panels or standard validated pre-manufactured panelspre-manufactured panels

Page 33: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Adaptation of methodAdaptation of method

Many SNPs (>1000) few samples (< 600)Many SNPs (>1000) few samples (< 600) Array platformArray platform

Many genotypes per arrayMany genotypes per array Few arrays per dayFew arrays per day

Few SNPs (< 100) many samples (> 600)Few SNPs (< 100) many samples (> 600) Liquid based platformLiquid based platform

Multi-well plates provide flexibilityMulti-well plates provide flexibility Robotics can increase throughputRobotics can increase throughput Usually many samples/one SNP per plateUsually many samples/one SNP per plate

Not true in “multiplex” situationsNot true in “multiplex” situations

Page 34: Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Multiplexing vs. PoolingMultiplexing vs. Pooling

MultiplexMultiplex Many genotypes from one reaction Many genotypes from one reaction

carried out in one tubecarried out in one tube

PoolingPooling Reactions carried out separately, Reactions carried out separately,

analyzed togetheranalyzed together