Download - Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Transcript
Page 1: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Sequence formats and databases in bioinformatics

• Definitions/Basics

• Sequence formats

• Databases in Biology

Dinesh GuptaStructural and Computational Biology [email protected]

Page 2: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

What is Bioinformatics?•Bioinformatics is the use of computers to solve biological and biomedical problems.

•Bioinformatics is the application of information technology to mine, visualize, analyze, integrate, and manage biological and genetic information, which can then be applied in, among other things, accelerating drug discovery and development.

•Application of tools of computation and analysis to the capture and interpretation of biological data.

•Biological Data management and analysis.

•NIH definition of Bioinformatics (http://www.bisti.nih.gov/CompuBioDef.pdf)

Research, development, or application of computational tools andapproaches for expanding the use of biological, medical, behavioral or health data, including those to acquire, store, organize, archive, analyze, or visualize such data.

Page 3: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Use of Bioinformatics

• DNA analysis– Genome sequencing

• Sequence assembly• Sequence/gene annotations• Genefinding/Sequence translation tools• Sequence Similarity searching (eg. BLAST,

ClustalW)• Comparison between genomes• Evolution of sequences (Phylogenetic analysis)• Gene expression

Page 4: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

• Protein analysis– Structure

• X-ray crystallography• Homology based models• Drug designing

– Sequence• Sequence similarity• Protein family assignments• Conserved motifs• Proteomics data analysis• Protein Evolution

Use of Bioinformatics (..contd.)

Page 5: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

• Other uses:– Drug designing– Vaccine development– Dairy technology– Forensics– Crop improvement– Designing enzymes for detergents– Genetic counseling

Uses of Bioinformatics (..contd.)

Page 6: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Bioinformatics: Integration of several fields

Bioinformatics

Computer Science

Mathematics

Statistics

Chemistry

Physics

Biological Science

Page 7: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Recent events making bioinformatics more important

• Exponential expansion of biological information• Expansion of multiple types of information• Cheaper high throughput technologies• Improvement in computation power• Lack of standards/quality• Need for micro and macro analysis• Need for better algorithms

Page 8: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.
Page 9: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Vast Growth in (Structural) Data...

but number of Fundementally New (Fold) Parts Not Increasing that Fast

New Submissions

New Folds

Total in Databank

Page 10: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Bioinformatics Analysis?

It is like any other lab analysis!• You need to know your data/input sources• You need to understand your methods and their

assumptions• You need a plan to get from point A to point B• You need to understand your equipment• You need to be critical and understand potential

sources of error• You need to interpret your results• Your results need to be reproducible• Your results should be testable

Page 11: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

References, but not limited to:-

• http://www.ncbi.nlm.nih.gov/About/primer/bioinformatics.html

• http://icgeb.res.in/whotdr

• http://en.wikipedia.org/wiki/Bioinformatics

• Baxevanis & Ouellette 2001. Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins 2nd Edition. John Wiley Publishing.

• Gibas & Jambeck 2001. Developing Bioinformatics Computer Skills. O’Reilly.

• Bioinformatics: Genome Sequence Analysis Mount 2001• Bioinformatics For Dummies – Claverie & Notredame 2003• Introduction to Bioinformatics – Lesk 2002

Page 12: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Sequence formats: Basics

• Why different formats?– Type of information– Software requirements– Database requirements

Page 13: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Main file formats used in Bioinformatics

•ASN.1

•EMBL, Swiss Prot

•FASTA

•GCG

•GenBank/GenPept

•PHYLIP

•PIR

Page 14: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

ASN 1: Abstract Syntax Notation 1used by NCBI

Seq-entry ::= set {

class phy-set , descr { pub { pub { article { title { name "Cross-species infection of blood parasites between resident and migratory songbirds in Africa" } , authors { names std { { name name { last "Waldenstroem" , first "Jonas" , initials "J." } } , { name name { last "Bensch" , first "Staffan" , initials "S." } } , { name name { last "Kiboi" , first "Sam" , initials "S." } } , { name name { last "Hasselquist" , first "Dennis" , initials "D." } } , { name name { last "Ottosson" , first "Ulf" , initials "U." } } } , affil std {

Page 15: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

• The first line of each sequence entry is the ID definition line which contains entry name, dataclass, molecule, division and sequence length.

• XX line contains no data, just a separator• The AC line lists the accession number.• DE line gives description about the sequence• FT precise annotation for the sequence• Sequence information SQ in the first two spaces.• The sequence information begins on the fifth line of the sequence entry. • The last line of each sequence entry in the file is a terminator line which has the two

characters // in the first two spaces.

ID AA03518 standard; DNA; FUN; 237 BP. XX AC U03518;XXAC U03518; XX DE Aspergillus awamori internal transcribed spacer 1 (ITS1) and 18S DE rRNA and 5.8S rRNA genes, partial sequence. DE rRNA and 5.8S rRNA genes, partial sequence. RX MEDLINE; 94303342. RX PUBMED; 8030378. XXFT rRNA <1..20 FT /product="18S ribosomal RNA" FT misc_RNA 21..205 FT /standard_name="Internal transcribed spacer 1 (ITS1)" FT rRNA 206..>237 FT /product="5.8S ribosomal RNA" SQ Sequence 237 BP; 41 A; 77 C; 67 G; 52 T; 0 other; aacctgcgga aggatcatta ccgagtgcgg gtcctttggg cccaacctcc catccgtgtc 60 tattgtaccc tgttgcttcg gcgggcccgc cgcttgtcgg ccgccggggg ggcgcctctg 120 ccccccgggc ccgtgcccgc cggagacccc aacacgaaca ctgtctgaaa gcgtgcagtc 180 tgagttgatt gaatgcaatc agttaaaact ttcaacaatg gatctcttgg ttccggc 237 //

EMBL/Swiss Prot (http://www.ebi.ac.uk/help/formats_frame.html)

Page 16: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

•A sequence in Fasta format begins with a single-line description,•followed by lines of sequence data. •The description line is distinguished from the sequence data by a greater-

than (">") symbol in the first column. •It is recommended that all lines of text be shorter than 80 characters in

length.

>U03518 Aspergillus awamori internal transcribed spacer 1 (ITS1) AACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCC TGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGC CGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACT TTCAACAATGGATCTCTTGGTTCCGGC

FASTA

Page 17: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

•Exactly one sequence•Begins with annotation lines•Start of the sequence is marked by a line ending with "..“•This line also contains the sequence identifier, the sequence length and a checksum

ID AA03518 standard; DNA; FUN; 237 BP. XX AC U03518; XX DE Aspergillus awamori internal transcribed spacer 1 (ITS1) and 18S DE rRNA and 5.8S rRNA genes, partial sequence. XX SQ Sequence 237 BP; 41 A; 77 C; 67 G; 52 T; 0 other; AA03518 Length: 237 Check: 4514 .. 1 aacctgcgga aggatcatta ccgagtgcgg gtcctttggg cccaacctcc catccgtgtc 61 tattgtaccc tgttgcttcg gcgggcccgc cgcttgtcgg ccgccggggg ggcgcctctg 121 ccccccgggc ccgtgcccgc cggagacccc aacacgaaca ctgtctgaaa gcgtgcagtc 181 tgagttgatt gaatgcaatc agttaaaact ttcaacaatg gatctcttgg ttccggc

GCG

Page 18: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

GenBank/GenPept The nucleotide (GenBank) and protein (Gen Pept) database entries are available from Entrez in this format

•Can contain several sequences•One sequence starts with: “LOCUS”•The sequence starts with: "ORIGIN“•The sequence ends with: "//“ LOCUS AAU03518 237 bp DNA PLN 04-FEB-1995 DEFINITION Aspergillus awamori internal transcribed spacer 1 (ITS1) and 18S rRNA and 5.8S rRNA genes, partial sequence. ACCESSION U03518 BASE COUNT 41 a 77 c 67 g 52 t ORIGIN 1 aacctgcgga aggatcatta ccgagtgcgg gtcctttggg cccaacctcc catccgtgtc 61 tattgtaccc tgttgcttcg gcgggcccgc cgcttgtcgg ccgccggggg ggcgcctctg121 ccccccgggc ccgtgcccgc cggagacccc aacacgaaca ctgtctgaaa gcgtgcagtc181 tgagttgatt gaatgcaatc agttaaaact ttcaacaatg gatctcttgg ttccggc//

Page 19: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Phylip format2 2000G019uabh ATACATCATA ACACTACTTC CTACCCATAA GCTCCTTTTA ACTTGTTAAAG028uaah CATAAGCTCC TTTTAACTTG TTAAAGTCTT GCTTGAATTA AAGACTTGTT GTCTTGCTTG AATTAAAGAC TTGTTTAAAC ACAAAAATTT AGAGTTTTACTAAACACAAA ATTTAGACTT TTACTCAACA AAAGTGATTG ATTGATTGAT TCAACAAAAG TGATTGATTG ATTGATTGAT TGATTGATGG TTTACAGTAGTGATTGATTG ATGGTTTACA GTAGGACTTC ATTCTAGTCA TTATAGCTGC

• The first line of the input file contains the number of sequences and their length (all should have the same length) separated by blanks.

• The next line contains a sequence name, next lines are the sequence itself in blocks of 10 characters. Then follow rest of sequences.

Page 20: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Other formats

MEGA• #mega• Title: infile.fasta•  • #G019uabh• ATACATCATAACACTACTTCCTACCCATAAGCTCCTTTTAACTTGTTAAAGTCTTGCTTG• AATTAAAGACTTGTTTAAACACAAAAATTTAGAGTTTTACTCAACAAAAGTGATTGATTG• ATTGATTGATTGATTGATGGTTTACAGTAGGACTTCATTCTAGTCATTATAGCTGCTGGC• AGTATAACTGGCCAGCCTTTAATACATTGCTGCTTAGAGTCAAAGCATGTACTTAGAGTT• GGTATGATTTATCTTTTTGGTCTTCTATAGCCTCCTTCCCCATCCCCATCAGTCTTAATC• AGTCTTGTTACGTTATGACTAATCTTTGGGGATTGTGCAGAATGTTATTTTAGATAAGCA• AAACGAGCAAAATGGGGAGTTACTTATATTTCTTTAAAGC• #G028uaah• CATAAGCTCCTTTTAACTTGTTAAAGTCTTGCTTGAATTAAAGACTTGTTTAAACACAAA• ATTTAGACTTTTACTCAACAAAAGTGATTGATTGATTGATTGATTGATTGATGGTTTACA• GTAGGACTTCATTCTAGTCATTATAGCTGCTGGCAGTATAACTGGCCAGCCTTTAATACA• TTGCTGCTTAGAGTCAAAGCATGTACTTAGAGTTGGTATGATTTATCTTTTTGGTCTTCT• ATAGCCTCCTTCCCCATCCCATCAGTCT

Page 21: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Don [email protected], May 2001Indiana University, Bloomington, Indiana

ReadSeq

SeqretA program in EMBOSS suite

http://www.ebi.ac.uk/cgi-bin/readseq.cgi http://bioportal.bic.nus.edu.sg/readseq/readseq.htmlhttp://www-bimas.cit.nih.gov/molbio/readseq/

WWW

Page 22: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.
Page 23: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.
Page 24: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.
Page 25: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.
Page 26: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.
Page 27: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

The Readseq package can read most common formats: examples of all these formats are included in the readseq directory. The formats include:

• IG/Stanford, used by Intelligenetics and others • GenBank/GB, genbank flatfile format • NBRF format (SAM modifications cause this to break when sequences do not have a

terminating asterix) • EMBL, EMBL flatfile format • GCG, single sequence format of GCG software • DNAStrider, for common Mac program • Fitch format, limited use • Pearson/Fasta, a common format used by Fasta programs and others • Zuker format, limited use. Input only. • Olsen, format printed by Olsen VMS sequence editor. Input only. • Phylip3.2, sequential format for Phylip programs • Plain/Raw, sequence data only (no name, document, numbering) • MSF multi sequence format used by GCG software • PAUP's multiple sequence (NEXUS) format • PIR/CODATA format used by PIR

Page 28: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Databases in Biology

Page 29: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.
Page 30: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Need for databases in Biology?

• Need for storing and communicating large datasets

has grown.

• Need to disseminate biological information.

• Provide Organized data for analysis friendly

retrieval.

• Need to make biological data available in computer-

readable form.

Page 31: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Different classifications of databases

• Type of data – nucleotide sequences – protein sequences – proteins sequence patterns or motifs – macromolecular 3D structure – gene expression data – metabolic pathways– proteomics data

Page 32: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Different classifications of databases….

• Primary or derived databases – Primary databases: experimental results

directly into database – Secondary databases: results of analysis of

primary databases – Aggregate of many databases

• Links to other data items • Combination of data • Consolidation of data

Page 33: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Different classifications of databases….

• Technical design – Flat-files – Relational database (SQL) – Exchange/publication technologies (HTML,

CORBA, XML,...)

• Each one of the above are inter convertible

Page 34: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Different classifications of databases….

• Availability – Publicly available, no restrictions – Available, but with copyright – Accessible, but not downloadable – Academic, but not freely available – Proprietary, commercial; possibly free for

academics

Page 35: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Different classifications of databases….

• Content– Protein/DNA/RNA/miRNA etc.– Family: kinases– Common physical properties: membrane bound,

mitochondrial proteins– Common chemical properties: Proteases, reductases

etc.– Sequences of a particular genome/species: e.g.

Influenza sequences, plasmodium sequences etc.– Motifs/domains

Page 36: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Where to look for databases?

• Search Engines

• Journals related to Bioinformatics

• Websites like:– http://www.biophys.uni-duesseldorf.de/BioNet/Pedro/rt_all.html – www.expasy.ch – Several others websites

Page 37: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.
Page 38: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

NAR DB issue 2010

• 58 new dbs since last year!• Total >1230!• (http://www.oxfordjournals.org/nar/

database/a/• Complete list

– Searchable– http://nar.oxfordjournals.org/cgi/content/full/

gkm1037/DC1/1 (html format), also as downloadable word file)

Page 39: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

http://www3.oup.co.uk/nar/database/c/

Page 40: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Database searching tips

• Look for links to Help or Examples

• Always check update dates

• Level of curation

• Try Boolean searches

• Be careful with UK/US spelling differences– leukaemia vs leukemia– haemoglobin vs hemoglobin– colour vs color

Page 41: Sequence formats and databases in bioinformatics Definitions/Basics Sequence formats Databases in Biology Dinesh Gupta Structural and Computational Biology.

Exercise

• Retrieve sequences from sequence databases

• Convert sequence formats

• Study different formats and flow of information