RECOMBINANT PEGYLATED FIRST AND THIRD
GENERATION ADENOVIRUS VECTORS FOR
DELIVERY OF ANTI-HEPATITIS B VIRUS RNA
INTERFERENCE EFFECTORS
Carol Crowther
A thesis submitted to the faculty of Health Sciences, University of the Witwatersrand, in
fulfillment of the requirements for the degree of Doctor of Philosophy
Johannesburg 2013
Declaration ii
DECLARATION
I, Carol Crowther declare that this thesis is my own work. It is being submitted for the degree
of Doctor of Philosophy in the University of the Witwatersrand, Johannesburg. It was not
submitted before for any degree or examination at this or any other University.
..............................................................
3rd
day of June, 2013
iii
DEDICATION
“If we knew what we were doing it would not be called research”-Albert Einstein
To my family:
My devoted husband, Nigel
My darling daughters, Emma and Kate
My mother, Blanche and brother, Kevin
Publication List iv
PUBLICATION LIST
Journal publications related to this thesis
1. Crowther C, M Mowa, D Palmer, P Ng, A Ely and P Arbuthnot. Sustained Hepatitis B
virus inhibition in vivo using helper-dependent adenovirus vectors to deliver antiviral
RNA interference expression cassettes. Hum Gen Ther (under review, included in this
thesis as Chapter 3).
2. Mowa, M, C Crowther, A Ely and P Arbuthnot. Efficient silencing of Hepatitis B virus by
helper-dependent adenovirus vector-mediated delivery of artificial antiviral primary
micro RNAs. MicroRNA, 2012. 1: p. 1-7. ( Printed in full in Appendix A2).
3. Crowther, C, A Ely, J Hornby, S Mufamadi, F Salazar, P Marion and P Arbuthnot.
Efficient inhibition of Hepatitis B virus replication in vivo using PEG-modified
adenovirus vectors. Hum Gene Ther, 2008. 19(11): p. 1325-31. (Included in this thesis as
Chapter 2 and printed in full in Appendix A2).
4. Carmona, S, A Ely, C Crowther, N Moolla, F Salazar, P Marion, N Ferry, M Weinberg
and P Arbuthnot. Effective inhibition of HBV replication in vivo by anti-HBx short
hairpin RNAs. Mol Ther, 2006. 13(2): p. 411-21. (Printed in full in Appendix A2).
Publication List v
Journal publications indirectly related to thesis
5. Hean, J, C Crowther, A Ely, R Islam, S Barachievy, K Bloom, M Weinberg, W van
Otterlo, C de Koning, F Salazar, P Marion, E Roesch, M LeMaitre , P Herdewijn and P
Arbuthnot. Inhibition of Hepatitis B virus in vivo replication using lipoplexes containing
altrilol-modified antiviral siRNAs. Artificial DNA: PNA and XNA, 2010. 1(1): p 17-26.
6. Mevel, M, N Kamaly, S Carmona, M Oliver, M Jorgensen, C Crowther, F Salazar, P
Marion, M Fujino, Y Natori, M Thanou, P Arbuthnot, J Yaouanc, P Jaffres and A Miller.
DODAG; a versatile new cationic lipid that mediates efficient delivery of pDNA and
siRNA. J Control Release, 2010. 43(2): p. 222-32.
7. Carmona, S, M Keller, M Jorgensen, S Kolli, C Crowther, F Salazar, P Marion, M Fujino,
Y Natori, M Thanou, P Arbuthnot and A Miller. Controlling HBV replication in vivo by
intravenous administration of triggered PEGylated siRNA-nanoparticles. Mol Pharm,
2009. 6(3): p. 706-17.
8. Ely, A, T Naidoo, S Mufamadi, C Crowther and P Arbuthnot. Expressed anti-HBV
primary microRNA shuttles inhibit viral replication efficiently in vitro and in vivo. Mol
Ther, 2008. 16(6): p. 1105-12.
Publication List vi
9. Weinberg, M, A Ely, S Barichievy, C Crowther, S Mufamadi, S Carmona and P
Arbuthnot. Specific inhibition of HBV replication in vitro and in vivo with expressed long
hairpin RNA. Mol Ther, 2007. 15(3): p. 534-41.
Book chapters
1. Crowther, C, M Mowa, A Ely and P Arbuthnot. Approaches to delivering RNAi
therapeutics that target Hepatitis B virus. In: Advanced Delivery and Therapeutic
Applications of RNAi. Edited by Kun Cheng and Ram Mahato (In press, used as part of
Introduction in this thesis and printed in full in Appendix A2).
2. Mowa, M, C Crowther and P Arbuthnot. Therapeutic potential of adenoviral vectors for
delivery of expressed RNAi activators. Expert Opinion in Drug Delivery, 2010. 7: p.
1373-1385. (Printed in full in Appendix A2).
Abstract vii
ABSTRACT
Hepatitis B virus (HBV) is hyperendemic to southern Africa and parts of Asia where it is a
major cause of serious liver disease. Licensed antivirals for chronically infected individuals
are only partially effective and approximately one million deaths occur annually as a result of
persistent infection with the virus. Although RNA interference (RNAi) based gene silencing
of HBV has been successfully demonstrated, difficulties with delivery of anti-HBV RNAi
effectors remains an obstacle to their clinical use. Recombinant adenoviruses (Ads), amongst
the most efficient hepatotropic gene vectors following systemic administration, have been
successfully used to deliver expressed anti-HBV RNAi sequences. However, a drawback of
Ad vectors is diminished efficacy and toxicity that results from stimulation of innate and
adaptive immunity.
To attenuate these effects we used polyethylene glycol (PEG) to modify first generation
recombinant Ad (FG Ad) vectors that express an anti-HBV short hairpin (shRNA) sequence.
Efficient hepatocyte transduction occurred and expressed shRNAs were processed to generate
intended HBV-targeting guides. Inhibition of HBV replication was achieved after intravenous
administration of PEGylated or native recombinant first generation Ads (FG Ads) to HBV
transgenic mice. Circulating HBV viral particle equivalents (VPEs) remained low for 3
weeks and began to increase after 5 weeks. A second dose of PEGylated anti-HBV Ad caused
a less sustained decrease in circulating VPEs, but no silencing after a second dose was
observed in animals treated with unmodified vector. Release of inflammatory cytokines was
elevated in animals receiving unmodified vectors and only a modest increase in monocyte
chemotactic protein-1 (MCP-1) was observed in mice that received a second dose of PEG
Abstract viii
Ads. Also, polymer-conjugated vectors induced a weaker adaptive immune response and
were less hepatotoxic than their unmodified counterparts.
To address concerns about the transient nature of transgene expression by FG Ads resulting
from immunostimulation, third generation helper-dependent (HD Ad) were utilised to
delivered anti-HBV RNAi effectors. Seven days after intravenous administration of
infectious HD Ads to HBV transgenic mice, 80-90% of hepatocytes were transduced and
markers of HBV replication were decreased by approximately 95% which was sustained for 8
weeks. HD Ad-induced release of proinflammatory cytokines was minimal in preparations
that were enriched with infectious particles. PEGylated HD Ad vectors caused similar anti-
HBV effects and may be useful to evade interaction with vector-sequestrating receptors and
further attenuate immunostimulation. Collectively these observations indicate that PEG
modification of Ads and the use of HD Ads may have utility for delivery of therapeutic HBV-
silencing sequences. Future work will focus on improving strategies to avoid immune
detection and utilisation of HD Ad vectors for other HBV targeting sequences.
Acknowledgements ix
ACKNOWLEDGMENTS
1. I would like to foremost thank my supervisor Prof. Patrick Arbuthnot for his continued
support, enthusiasm, patience and guidance shown throughout this study, which has
enabled me to complete this degree.
2. I am grateful to Dr. Abdullah Ely for his invaluable assistance and advice over the years
and also thanks to my colleagues Dr. Betty Mowa, Mrs. Gladys Gagliardi, Dr. Sergio
Carmona, Dr. Judith Hornby and Ms. Nazneen Moola for their technical assistance during
this study.
3. I would like to thank Dr. Nicholas Ferry, INSERM CIC-04 and Laboratoire de Thérapie
Génique, Nantes, France, for mass producing the FG Ad vectors for the study.
4. I am grateful to Dr. Philip Ng and Dr. Donna Palmer, Department of Molecular and
Human Genetics, Baylor College of Medicine, Houston, USA, for kindly providing the
cloning vectors (28E4LacZ and AdNg163) and 116 cell line used for the production of
HD Ads. Their technical advice and helpful discussions are also appreciated.
.
5. I would also like to thank Dr. Felix Salazar and Dr. Patricia Marion, Stanford University,
Stanford and Hepadnavirus Testing, Inc. Mountain View, CA, USA, for providing us
with the HBV transgenic mice for the in vivo studies
6. Finally the following funding bodies made these studies possible, South African National
Research Foundation, Poliomyelitis Research Foundation, Cancer Association of South
Acknowledgements x
Africa, Medical Research Council, Sixth Research Framework Programme of the
European Union, Project RIGHT (LSHB-CT-2004-005276), and European-South African
Science and Technology Advancement Programme (ESASTAP).
Table of contents xi
TABLE OF CONTENTS
DECLARATION..................................................................................................................... II
DEDICATION....................................................................................................................... III
PUBLICATION LIST .......................................................................................................... IV
ABSTRACT .......................................................................................................................... VII
ACKNOWLEDGMENTS .................................................................................................... IX
LIST OF FIGURES ............................................................................................................. XV
LIST OF TABLES ............................................................................................................ XVII
LIST OF ABBREVIATIONS ........................................................................................ XVIII
LIST OF SYMBOLS ...................................................................................................... XXIII
1 INTRODUCTION ............................................................................................................ 1
1.1 Hepatitis B virus ........................................................................................................................... 1
1.1.1 HBV prevalence ..................................................................................................................... 1
1.1.2 HBV genome structure........................................................................................................... 3
1.1.3 HBV replication ..................................................................................................................... 3
1.1.4 Current treatment regimens for HBV ..................................................................................... 6
1.1.4.1 Interferons ....................................................................................................................... 6
1.1.4.2 Nucleotide or nucleoside analogues ................................................................................ 7
1.2 RNA interference .......................................................................................................................... 8
1.2.1 RNAi regulatory pathway .................................................................................................... 10
1.2.2 RNAi as a therapeutic strategy ............................................................................................. 10
1.2.3 Hepatitis B virus as a target for RNAi-based gene silencing ............................................... 12
1.3 Suitable vectors for delivery of HBV gene silencers .................................................................. 12
1.3.1 Non-viral vectors.................................................................................................................. 14
1.3.1.1 Using NVVs to deliver anti-HBV siRNAs ................................................................... 17
1.3.1.2 Off-target effects ........................................................................................................... 18
1.3.2 Viral vectors ......................................................................................................................... 19
Table of contents xii
1.3.2.1 Adeno-associated viral vectors ..................................................................................... 19
1.3.2.2 Lentiviral vectors .......................................................................................................... 21
1.3.2.3 Adenoviral vectors ........................................................................................................ 23
1.3.2.3.1 Adenovirus structure .............................................................................................. 23
1.3.2.3.2 Adenovirus genome organisation ........................................................................... 23
1.3.2.3.3 The Cre-lox system of Ad production .................................................................... 28
1.3.2.3.4 Adenoviral vectors in gene therapy........................................................................ 30
1.3.2.3.5 Adenoviral hepatotropism ...................................................................................... 30
1.3.2.3.6 Innate immune response ......................................................................................... 31
1.3.2.3.7 Adaptive immune response .................................................................................... 33
1.3.2.3.8 Strategies used to avoid immune stimulation ......................................................... 34
Helper dependent vectors versus first generation Ad vectors ........................................... 34
Sequestration prevention ................................................................................................... 35
Serotype switching ............................................................................................................ 36
Capsid modification .......................................................................................................... 36
1.3.2.3.9 Adenoviral therapy targeting HBV ........................................................................ 37
1.4 Aims ............................................................................................................................................ 38
2 EFFICIENT INHIBITION OF HEPATITIS B VIRUS REPLICATION IN VIVO
USING PEG-MODIFIED ADENOVIRUS VECTORS ..................................................... 40
2.1 Introduction ................................................................................................................................. 40
2.2 Materials and methods ................................................................................................................ 41
2.2.1 Adenoviral vectors ............................................................................................................... 41
2.2.2 PEGylation of first generation adenoviral vectors ............................................................... 41
2.2.3 Titration of Ad vectors ......................................................................................................... 42
2.2.4 Cell culture and Northern blot analysis ................................................................................ 44
2.2.5 Adenoviral vector administration to HBV transgenic mice ................................................. 45
2.2.6 Serum HBV DNA and liver mRNA quantitation ................................................................ 46
2.2.7 Liver sections ....................................................................................................................... 47
2.2.8 Cytokine assay ..................................................................................................................... 47
2.2.9 Anti-adenovirus immunoglobulin assay .............................................................................. 48
2.2.10 Serum transaminase assay .................................................................................................. 49
2.2.11 Statistical analysis .............................................................................................................. 49
2.3 Results ......................................................................................................................................... 49
2.3.1 HBV target sequence ........................................................................................................... 49
Table of contents xiii
2.3.2 Anti-HBV efficacy of PEG-modified Ad vector ................................................................. 53
2.3.3 Serum cytokine concentrations after injection of PEGylated and unmodified Ad vectors 58
2.3.4 Assay of anti-Ad vector immunoglobulin titres and markers of hepatocyte toxicity .......... 61
2.4 Discussion ................................................................................................................................... 62
3 SUSTAINED HEPATITIS B VIRUS INHIBITION IN VIVO USING HELPER-
DEPENDENT ADENOVIRUS VECTORS TO DELIVER ANTIVIRAL RNA
INTERFERENCE EXPRESSION CASSETTES ............................................................... 67
3.1 Introduction ................................................................................................................................. 67
3.2 Methods and materials ................................................................................................................ 68
3.2.1 First generation adenoviral vectors ...................................................................................... 68
3.2.2 Helper-dependent adenoviral vectors ................................................................................... 68
3.2.3 Titration of adenoviral vectors ............................................................................................. 69
3.2.4 Physical titre ......................................................................................................................... 70
3.2.5 Quantitative PCR to determine helper virus contamination................................................. 71
3.2.6 PEGylation of helper dependent adenoviral vectors ............................................................ 72
3.2.7 Quantitative PCR to detect HD Ad genomes in liver .......................................................... 73
3.2.8 Cell culture and northern blot analysis................................................................................. 73
3.2.9 Adenoviral vector administration and measurement of HBV silencing .............................. 73
3.2.10 β-Galactosidase staining of liver sections .......................................................................... 75
3.2.11 In vivo shRNA processing .................................................................................................. 76
3.2.12 Cytometric bead array assay .............................................................................................. 77
3.2.13 Serum transaminase assay .................................................................................................. 77
3.2.14 Statistical Analysis ............................................................................................................. 77
3.3 Results ......................................................................................................................................... 78
3.3.1 Structure of HD Ads containing anti-HBV RNAi expression cassettes .............................. 78
3.3.2 HD Ad-mediated inhibition of markers of HBV replication in vivo .................................... 80
3.3.3 Hepatotoxicity and cytokine secretion following intravenous injection of HD Ad HBV
shRNA 6........................................................................................................................................ 87
3.4. Discussion .................................................................................................................................. 93
4 CONCLUSIONS ............................................................................................................. 97
5 APPENDIX A ................................................................................................................ 101
A1 Standard laboratory techniques ................................................................................................. 101
A1-1 Tissue culture ..................................................................................................................... 101
Table of contents xiv
A1-2 Experion microchip electrophoresis analysis ..................................................................... 104
A1-3 p28ΔE4LacZ ...................................................................................................................... 105
A1-4 HBV Q-PCR standard curve .............................................................................................. 106
A1-5 Helper virus Q-PCR standard curve .................................................................................. 107
A1-6 HD Ad Q-PCR standard curve............................................................................................... 108
A1-7 -galactosidase ELISA .......................................................................................................... 109
A2 Animal ethics clearance certificate ........................................................................................... 110
A3 Publications ............................................................................................................................... 111
List of Figures xv
LIST OF FIGURES
Figure 1.1: Global prevalence of chronic HBV infection. ......................................................... 2
Figure 1.2: HBV genome organisation. ..................................................................................... 4
Figure 1.3: HBV replication cycle. ............................................................................................ 5
Figure 1.4: The RNA interference pathway. .............................................................................. 9
Figure 1.5: Types of RNAi activators that have been used to silence HBV replication.......... 13
Figure 1.6: Vectors used in gene therapy clinical trials. .......................................................... 24
Figure 1.7: Structure of adenovirus. ....................................................................................... 25
Figure 1.8: Genome organization of the different generations of adenoviral vectors. ............ 27
Figure 1.9: The Cre-lox system of helper dependent adenovirus production. ......................... 29
Figure 2.1: Schematic illustration of Hepatitis B virus genome showing sites targeted by
shRNA sequences. ................................................................................................................... 50
Figure 2.2: shRNA encoding vector targeting HBV. ............................................................... 51
Figure 2.3: Northern hybridisation analysis of expressed anti-HBV sequences. .................... 52
Figure 2.4: Adenoviral vectors efficiently transduce hepatocytes. .......................................... 55
Figure 2.5: Circulating VPEs in HBV transgenic mice after administration of PEG-modified
and native Ads.......................................................................................................................... 56
Figure 2.6: Effects of Ad dose on hepatic HBV mRNA.......................................................... 57
Figure 2.7: Serum cytokine concentrations after first administration of Ads to HBV
transgenic mice. ....................................................................................................................... 59
Figure 2.8: Serum cytokine concentrations after second administration of Ads to HBV
transgenic mice. ....................................................................................................................... 60
Figure 2.9: Relative serum anti-Ad immunoglobulin concentrations after vector
administration to mice.............................................................................................................. 63
List of Figures xvi
Figure 2.10: Serum transaminase activities after vector administration to mice. .................... 64
Figure 3.1: Schematic illustration of anti-HBV Ad vectors. ................................................... 79
Figure 3.2: Processing of anti-HBV shRNA in infected cultured hepatic cells....................... 81
Figure 3.3: HD Ad transduction efficiency in mice. ................................................................ 82
Figure 3.4: Anti-HBV efficacy of first generation and HD Ads and effects of intravenous
administration of HD Ads on circulating HBV surface antigen in HBV transgenic mice. ..... 83
Figure 3.5: Effects of intravenous administration of HD Ads on circulating HBV VPEs. ..... 84
Figure 3.6: Anti-HBV efficacy of first generation and HD Ads.............................................. 86
Figure 3.7: Northern blot hybridization analysis of RNA extracted from mice livers that had
been injected with indicated Ad vectors 7 days previously. .................................................... 88
Figure 3.8: Weight of mice and markers of hepatic inflammation following Ad
administration. ......................................................................................................................... 89
Figure 3.9: Effects of HD Ads on serum cytokine concentrations following vector
administration to HBV transgenic mice. .................................................................................. 91
Figure 3.10: Flow cytometry plots showing effects of Ads on serum cytokine concentrations
following vector administration to HBV transgenic mice. ...................................................... 92
Figure A.1: Experion microchip electrophoresis. .................................................................. 104
Figure A.2: Plasmid map of p28ΔE4LacZ used for cloning of RNAi effector sequences to
generate HD Ads. ................................................................................................................... 105
Figure A.3: HBV Q-PCR standard curve. ............................................................................ 106
Figure A.4: HV Q-PCR standard curve. ................................................................................ 107
Figure A.5: HD Ad Q-PCR standard curve. .......................................................................... 108
Figure A.6: Relative serum anti--galactosidase immunoglobulin concentrations after vector
administration to mice............................................................................................................109
List of Tables xvii
LIST OF TABLES
Table 1.1: Advantages, disadvantages and significant articles describing vectors used for
delivery of nucleic acids to the liver. ....................................................................................... 15
List of Abbreviations xviii
LIST OF ABBREVIATIONS
AAV - Adeno-associated virus
Ad - Adenovirus
Ago 2 - argonaute protein 2
ALT - alanine transaminase
Apo - apolipoprotein
AST - aspartate transaminase
bp - base pair
BSA - bovine serum albumin
CAR - coxsackie-adenovirus receptor
CBA - cytometric bead array
cccDNA - covalently closed circular DNA
CMV - cytomegalovirus
CsCl - cesium chloride
DAB - 3,3'-Diaminobenzidine
DGCR8 - DiGeorge syndrome chromosomal region
dH20 - distilled water
DIG - digoxigenin
DMEM - Dulbecco’s Modified Eagle’s Medium
DODAG - N’,N’-dioctadecyl-N-4,8-diaza-10-
aminodecanoylglycine amide
DOPC - dioleoylphosphatidylcholine
DOPE - dioleoylphosphatidylethanolamine
dsAAV - double-stranded AAV
dsDNA - double-stranded DNA
List of Abbreviations xix
dsRNA - double-stranded RNA
eGFP - enhanced green fluorescent protein
ELISA - enzyme-linked immunosorbent assays
ER - endoplasmic reticulum
FBS - foetal bovine serum
FG Ad - first-generation adenovirus
GAPDH - glyceraldehydes-3-phosphate dehydrogenase
HBcAg - hepatitis B virus core antigen
HBsAg - hepatitis B virus surface antigen
HBV - hepatitis B virus
HCC - hepatocellular carcinoma
HD - high dose
HD Ad - helper-dependent adenovirus
HEK 293 - human embryonic cell line 293
HIV - human immunodeficiency virus
HRP - horseradish peroxidise
HSPG - heparin sulphate proteoglycan
HV - helper virus
HVR1 - hypervariable region 1
IFN - interferon
ifu/ml - infectious Ad particles per ml
Ig - immunoglobulin
IL - interleukin
ITR - inverted terminal repeat
kb - kilobase
kDa - kilo Daltons
KPBS - potassium-buffered saline
List of Abbreviations xx
LD - low dose
lnRNA - long hairpin RNA
LV - lentiviral vector
mA - milli amps
MAP - mitogen activated protein
MAPK - mitogen activated protein kinase
MCP-1 - monocyte chemotactic protein-1
MD - medium dose
MHC - major histocompatibility complex
miRNA - microRNA
moi - multiplicity of infection
mPEG-SPA - methoxypolyethylene glycol propionic acid N-
succinimidyl ester
MW - molecular weight
Nab - neutralizing antibody
nm - nanometre
nt - nucleotide
NVV - non-viral vector
OD - optical density
ORF - open reading frame
OTC - ornithine transcarbamylase
PE - phycoerythrin
PEG - polyethylene glycol
pgRNA - pregenomic RNA
Pol - RNA polymerase
pre-miRNA - precursor miRNA
pri-miRNA - primary miRNA
List of Abbreviations xxi
PTGS - post transcriptional gene silencing
Q-PCR - quantitative polymerase chain reaction
RBC - red blood cells
RCA - replication–competent adenovirus
rcDNA - relaxed circular DNA
RISC - RNA induced silencing complex
RNAi - RNA interference
RPMI - Roswell Park Memorial Institue medium
SAPK/JNK - stress-activated protein kinase/ Jun N-terminal kinase
scAAV - self-complementary AAV
SEM - standard error of the mean
shRNA - short hairpin RNA
siRNA - small interfering RNA
SNALPS - stable nucleic acid-lipid particles
SREBP-1c - sterol regulatory element-binding protein-1c
TALEN - transcription activator-like effector nuclease
TBE - Tris-Borate EDTA
TMB - tetramethylbenzidine
TLR - toll-like receptor
TNF tumour necrosis factor-
tRNA - transfer RNA
TRBP - HIV transactivating response RNA-binding protein
vp - viral particles
VPE - viral particle equivalent
VV - viral vector
WHO - world health organization
X-gal - 5-bromo-4-chloro-indolyl-β-D-galactopyranoside
List of Abbreviations xxii
ZFP - zinc finger protein
List of Symbols xxiii
LIST OF SYMBOLS
- alpha
- beta
Δ - delta
ε - epsilon
γ - gamma
Ψ - psi
Chapter 1 1
1 INTRODUCTION
1.1 Hepatitis B virus
1.1.1 HBV prevalence
According to the World Health Organisation (WHO) 2 billion people have been infected by
Hepatitis B virus (HBV) and there are an estimated 387 million chronic carriers of the virus
world-wide (reviewed in [1]). Carrier rate varies in different regions of the world and is
classified as low (0.1-2%), intermediate (2-8%) or high (8-20%) (Figure 1.1). HBV is highly
prevalent in sub-Saharan Africa, east and south east Asia and the western Pacific islands
where most infections occur perinatally or in early childhood [2]. The age at which HBV is
acquired has a major impact on the development of chronic HBV [3]. Approximately 90% of
infected infants or young children will remain chronically infected as compared to only 5% of
patients infected as adults. [4]. A patient is chronically infected if they have persistence of
HBsAg in their serum for six months or longer. There are ten known HBV genotypes (A-J)
with particular genotypes being more common in certain geographical areas [5, 6]. It has
been approximately 30 years since the first immunization programmes were implemented
which has resulted in a progressive decrease in the number of new cases, yet vaccination has
no benefit to already infected individuals. Persistently infected individuals have an increased
risk of developing cirrhosis and hepatocellular carcinoma (HCC) and more than one million
people are estimated to die annually as a result of HBV associated liver disease [7-9].
Chapter 1 2
Figure 1.1: Global prevalence of chronic HBV infection. Map showing the prevalence of
chronic HBV infection in different regions of the world. HBV is highly prevalent in sub-
Saharan Africa, east and south east Asia and the western Pacific islands. There is a high
prevalence in the far northern regions of Northern America but the numbers of carriers are
low in this part of the world. http://www.stranorlarhealthcentre.com/hepatitis.htm
Chapter 1 3
1.1.2 HBV genome structure
HBV belongs to the Hepadnaviridae family of hepatotropic DNA viruses and has a circular,
partially double-stranded DNA genome of approximately 3.2 kb in length (Figure 1.2) [10,
11]. The infectious Hepatitis B virion, also known as the Dane particle, is a 42-44 nm
spherical double shelled structure. The nucleocapsid is made up of core protein (HBcAg)
which is enveloped by the surface proteins pre-S1, pre-S2 and hepatitis B surface antigen
(HBsAg) embedded in a lipid bilayer [3]. The encapsidated relaxed circular genome (rcDNA)
maintains its circularity by 5′ cohesive ends and is compactly organised with 4 overlapping
reading frames (ORFs) [12, 13]. The ORFs encode seven different viral proteins: the 3 viral
surface glycoproteins (pre-S1, pre-S2 and HBsAg) are encoded for by preS/S ORF; core and
the non-structural Pre C protein (secreted e-antigen, HBeAg) are encoded for by the
precore/core region; the multifunctional viral polymerase is encoded for by the pol ORF and
the X protein by the X ORF [14].
1.1.3 HBV replication
HBV is distinctly liver tropic and viral replication occurs within polarised hepatocytes [15].
The specificity HBV has for the liver can partially be explained by hepatocyte-specific
transcription factors [16]. HB virions bind to a still unknown receptor on hepatocytes and
following endocytosis, the rcDNA is translocated to the nucleus where gaps in the DNA are
repaired by second strand DNA synthesis to yield cccDNA (Figure 1.3) [13]. The cccDNA
serves as the template for the four viral RNAs and the greater than genome length
pregenomic RNA (pgRNA) produced during infection. There are also four promoter and two
enhancer transcription control elements within the cccDNA (Figure 1.2) which direct cellular
RNA polymerase II (pol II) to synthesise pregenomic/preC, preS2, PreS1 and X mRNA.
Chapter 1 4
Figure 1.2: HBV genome organisation. Partially double-stranded HBV DNA consists of
plus and minus strands with cohesive complementary 5′ ends. The circular and rectangular
symbols represent the cis-acting regulatory elements that control transcription. Co-ordinates
of the viral genome are given relative to the unique EcoRI restriction site. The immediately
surrounding arrows indicate the surface, core, polymerase and HBx viral open reading frames
(ORFs) (with initiation codons), encompassing the entire HBV genome. The four outer arrows
indicate the major viral transcripts which have a common 3′ polyadenylation site.
Chapter 1 5
Figure 1.3: HBV replication cycle. Following attachment, endocytosis and nuclear release
of the HB virion, rcDNA is repaired to form cccDNA. The cccDNA acts as a template for
transcription of mRNA and pgRNA. Messenger RNA that codes for proteins and pgRNA
which forms rcDNA are both potential RNA interference targets and are highlighted in red.
The viral polymerase and pgRNA are packaged into capsid particles that comprise core
protein. Within the capsid, pgRNA is reverse transcribed to form rcDNA which is either
transported back into the nucleus and recycled to form more cccDNA, or incorporated into
nascent virions which are secreted from the cell via the endoplasmic reticulum and Golgi
apparatus. cccDNA, covalently closed circular DNA; rcDNA, relaxed circular DNA; pgRNA,
pregenomic RNA; ER, endoplasmic reticulum.
Chapter 1 6
Polyadenylated transcripts are then transported into the cytoplasm where they are translated
into the seven viral proteins which are essential for virion assembly and replication. pgRNA
has repeat sequences at the 5′ and 3′ ends that enables circularisation of reverse transcribed
minus strand DNA which is followed by synthesis of the plus strand of rcDNA. The
envelopment of HBV capsids occurs in the endoplasmic reticulum after which the virions are
secreted and re-infect other hepatocytes. The stable circularised pgRNA and mRNA
encoding the viral proteins are necessary for viral replication, making them an ideal
therapeutic target and they are amenable to disruption by employing a RNA interference
(RNAi) approach [17, 18].
1.1.4 Current treatment regimens for HBV
Effective anti-HBV therapy should achieve long term suppression of HBV replication and
thereby avert the possible development of cirrhosis and HCC. An effective therapeutic
response includes sustained suppression of serum HBV DNA levels, seroconversion of
HBeAg to HBe antibody, loss of HBsAg and normalisation of liver pathology (reviewed in
[18, 19]). Conventional treatments for chronic HBV infection include interferon-IFN,
which functions as an immunomodulator, and nucleoside or nucleotide analogues
(lamivudine, entecovir, adefovir and tenofovir) which inhibit HBV genome replication [20].
There is a variable response to treatment that has been attributed to different HBV genotypes
(reviewed in [5, 6]).
1.1.4.1 Interferons
The development of chronic HBV has partially been attributed to a weak immune response to
the virus [21]. Interferon- has been used for treating HBV positive patients since the early
Chapter 1 7
1980s as it has an immunomodulatory effect in addition to an antiviral effect. Interferon
stimulates cytotoxic T cells and antibody secreting B cells which destroy HBV positive cells
[20]. Presently there are two types of IFN approved for treating chronic HBV: IFN--2b
and polyethylene glycol modified (PEGylated) IFN -2a (PEG IFN -2a) [22, 23]. The
PEGylated form has a longer half-life, thus requiring lower doses to decrease the negative
side effects of the drug. The more common side effects include flu-like symptoms, decreased
white cell counts (leucopenia) and depression. Other drawbacks of this therapy are the
necessity to administer IFN by subcutaneous injection, high cost, patient variable response
to the treatment and the lack of suitability in patients with decompensated liver cirrhosis
(reviewed in [8]).
1.1.4.2 Nucleotide or nucleoside analogues
Nucleotide and nucleoside analogues effectively suppress HBV replication without the side
effects associated with IFN- [24, 25]. They undergo phosphorylation in the cell whereby
their structure changes and mimics naturally occurring nucleosides. During DNA synthesis
these nucleoside analogues are incorporated into new DNA strands which results in
termination of chain elongation and inhibition of DNA synthesis. Some nucleoside
analogues competitively inhibit the reverse transcriptase activity of HBV polymerase
(reviewed in [5]). The emergence of drug resistance to nucleotide and nucleoside analogues is
a major concern and is commonly seen in lamivudine treated patients [24]. There are
however some new generation drugs (entecavir and tenofovir) that hold promise as they do
not drive the development of drug resistant HB virions [26].
Chapter 1 8
It is apparent that the available repertoire of drugs for treating HBV has only limited success
with none of the therapies targeting viral pgDNA or cccDNA. There is a need to develop
alternative therapeutic strategies to inhibit HBV. In recent years there has been some notable
success in preclinical trials employing RNAi strategies to target HBV which may prove to be
a viable option for the management of chronic HBV infection.
1.2 RNA interference
The mechanism of RNAi was first described in 1998 by Fire and Mellow [27] which had
such a profound impact in the field of gene regulation that they received the Nobel Prize for
Physiology or Medicine in 2006. The Nobel citation stated they had “discovered a
fundamental mechanism for controlling the flow of genetic information”. RNAi is an
evolutionary conserved biological process and is involved in a variety of essential cellular
processes, including cell proliferation, apoptosis, and defense against viral infections [27-29].
The process involves the use of naturally occurring small double-stranded RNA molecules
which direct homology-dependent genetic control of an organism. The pathway is activated
by double-stranded RNA (dsRNA) molecules, which are processed to form small, 21–23
nucleotide (nt) guide strands that effect target silencing by pairing with complementary RNA
sequences. Although transcriptional gene silencing has also been described, post
transcriptional gene silencing (PTGS) is the best characterised RNAi-mediated gene
inhibitory mechanism.
Chapter 1 9
Figure 1.4: The RNA interference pathway. The pathway begins with an endogenously
encoded primary microRNA transcript (Pri-miR) that is transcribed by RNA polymerase II
(Pol II) which is then processed by Drosher/DGCR8 enzyme complex to yield precursor
miRNA (Pre-miR). These precursors are exported into the cytoplasm by exportin 5 (Exp 5)
and subsequently bind to the Dicer enzyme complex, which processes the pre-miR into a
double-stranded RNA (dsRNA) for loading on the RISC complex. Within RISC the
passenger (sense) strand is unwound leaving a mature miRNA which recognizes target sites
in the 3′-UTR in the mRNA which mostly leads translational suppression. Exogenously
added dsRNAs such as synthetic siRNAs lead to target degradation or translation
suppression. Exogenous expression cassettes that transcribe miR intermediates, which may be
pri-miR or pre-miR sequences, are typically incorporated into viral vectors. Non-viral vectors
are normally used to deliver siRNA analogues of mature miR duplexes.
Chapter 1 10
1.2.1 RNAi regulatory pathway
The mammalian endogenous microRNA (miRNA) pathway is well characterised and
illustrated in Figure 1.4. The mechanism initially involves nuclear transcription of mono or
polycistronic primary miRNAs (pri-miRNAs) by RNA polymerase II. These sequences,
which contain hairpin-like RNA motifs, are then cleaved by the RNase III enzyme Drosha
and its partner, DiGeorge critical region 8 (DGCR8), to yield precursor miRNAs (pre-
miRNAs). The pre-miRNAs are transported to the cytoplasm for further processing by Dicer,
another RNase III enzyme, to yield a mature duplex miRNA of 21-23 base pairs (bp). One
strand from the miRNA duplex serves as a guide and is incorporated into the RNA inducing
silencing complex (RISC) [30-33]. When the guide and target are completely
complementary, Argonaute protein 2 (Ago2) within RISC inactivates the target RNA by
cleaving it. When siRNA and target sequences are partially complementary, particularly at
the 5′ end, translational suppression is induced without target cleavage. Complimentarity
between the guide’s seed region (nucleotides 2 to 8 from the 5′ end), is all that is required to
effect translational suppression.
1.2.2 RNAi as a therapeutic strategy
There is compelling evidence that exogenous activators can be used to exploit the
endogenous RNAi machinery and achieve specific and potent silencing of genes of interest.
The mechanism provides the means of studying gene function and has potential application to
silencing of pathology-causing genes. The RNAi pathway may be activated by synthetic or
expressed exogenous RNAi activators. Chemically synthesized short interfering RNAs
(siRNAs) typically resemble mature endogenous miRNAs, and DNA expression templates
encode artificial mimics of upstream miRNA intermediates of the RNAi pathway. These
Chapter 1 11
exogenous sequences reprogram the RNAi pathway to silence intended gene targets. The
negative charge, sensitivity to nucleases, hydrophilicity and immunostimulatory effects of
siRNAs has led to investigating use of chemical modifications to confer better therapeutic
properties. These chemical modifications have aimed at improving delivery efficiency,
reducing clearance, increasing stability, enhancing target specificity and minimising
immunostimulatory effects [34-36]. Synthetic siRNAs have a smaller size than RNAi-
activating expression cassettes. This feature, together with the cytoplasmic site of action,
make siRNA delivery and dose control easier to achieve than with expressed RNAi
activators.
The more sustained silencing that may be achieved with expression cassettes is useful for the
treatment of chronic infection caused by HBV [37, 38]. These cassettes may be propagated
conveniently using standard techniques of molecular biology and have been successfully used
in our laboratory to target HBV. They are stable and compatible with incorporation into
highly efficient viral vectors (VVs). Expressed short hairpin RNAs (shRNAs), which mimic
pre-miRNAs, have been widely used to activate the RNAi pathway. Typically, their
expression has been placed under control of RNA polymerase (Pol) III promoters and the
powerful and constitutively active U6 small nuclear RNA promoter has been commonly used
[39]. Although effective silencing is achieved, saturation of the endogenous RNAi pathway
may occur which can lead to fatal toxicity [37]. To overcome these problems and improve
transcriptional control of RNAi activators, pri-miRNA mimics that are compatible with
expression from Pol II promoters have been developed [40-47]. These artificial expression
cassettes are amenable to multimerisation to simulate natural polycistronic miRNAs. Using
such a combinatorial RNAi approach enables simultaneous targeting of various regions of a
viral sequence. This is a useful strategy to improve silencing efficacy and prevent viral
Chapter 1 12
escape [40, 41, 46, 48]. Production of multiple antiviral siRNAs from long hairpin RNAs
(lhRNAs) has also been described, but efficiency with which the individual siRNAs are
generated from these templates is variable [49-51].
1.2.3 Hepatitis B virus as a target for RNAi-based gene silencing
Although evidence exists that viruses have evolved mechanisms to evade cellular RNAi
silencing mechanisms [52], HBV-encoded factors that are capable of suppressing RNAi have
not been described. In support of this, several investigations carried out in vitro and in vivo
demonstrated that the virus is indeed susceptible to RNAi-based inhibition of replication [40,
53-57]. Synthetic and expressed RNAi activators have been used successfully to target
different sites of the viral genome and features of the expressed and synthetic RNAi
activators that have been used to counter HBV replication are described in Figure 1.5. In
addition to typical Pol III expression cassettes, Pol II artificial mono- and polycistronic anti-
HBV pri-miRNAs have been used successfully to knockdown HBV replication [40, 41, 57].
Whilst it is important to demonstrate the RNAi effects in vitro, it is success in vivo which
remains critical, and the ultimate goal to successful gene therapy is the choice of a suitable
vector for target delivery.
1.3 Suitable vectors for delivery of HBV gene silencers
Since HBV replicates and resides in the liver, efficient delivery of RNAi activators to
hepatocytes is critically important to have therapeutic utility. This is challenging as vectors
should ideally take antiviral sequences to their intended sites of action within hepatocytes
after systemic administration. Optimally, only a single administration should be needed to
achieve sustained inhibition of viral replication. If this is not possible vectors should then be
Chapter 1 13
Figure 1.5: Types of RNAi activators that have been used to silence HBV replication. A
and B. Expressed sequences, generated from either Pol III or Pol II promoters, are compatible
with incorporation into viral vectors. C. Synthetic anti-HBV siRNAs are used in non-viral
vector formulations. Characteristics of the different types of RNAi activator are briefly
summarized. For each type of RNAi activator, the mature guide is illustrated in green.
Chapter 1 14
amenable to re-administration and retain efficiency of inhibition of HBV replication. To gain
access to hepatocytes, vectors need to traverse the endothelial fenestrated barrier between the
blood and hepatocytes. Viral vectors (VVs) and non-viral vectors (NVVs) should therefore
ideally have a uniform size of approximately 100 nm to enable them to cross the fenestrated
barrier and come into contact with hepatocytes (reviewed in [41]). Sinusoidal endothelial
cells range from 100-200 nm in size depending on the species, with the fenestrae in a healthy
human liver measuring ±107 nm [58, 59]. NVVs have commonly been used to deliver
synthetic siRNAs, and recombinant VVs engineered to deliver artificial RNAi expression
cassettes. Characteristics of the types of vectors that have been used to silence HBV
replication are summarised in Table 1.1.
1.3.1 Non-viral vectors
As gene delivery vehicles, NVVs offer a number of advantages over VVs. These include low
immunogenicity, ability to accommodate large nucleic acids, modular assembly and the
potential for large scale synthesis which is important for clinical application. Although NVVs
can be complexed with both DNA and RNA, these delivery vehicles have primarily been
used in vivo to deliver siRNAs to target cells. An important reason for this derives from the
fact that delivery of siRNAs to their site of action (the cytoplasm) faces fewer hurdles than
delivery of RNAi expression cassettes that comprise DNA (nuclear action). Nevertheless,
delivery of siRNAs to the cytoplasm of target cells in sufficient quantities to have a desirable
effect remains challenging.
A number of NVVs have been used successfully to deliver siRNA constructs targeting HBV
[41]. These include cationic lipid-containing nucleic acid complexes (lipoplexes) and
polymer-modified nucleic acid complexes (polyplexes) [60, 61]. Several
Chapter 1 15
Table 1.1: Advantages, disadvantages and significant articles describing vectors used
for delivery of nucleic acids to the liver.
Footnote: Ads, adenoviruses; AAVs, adeno-associated viruses; NVVs, non-viral vectors.
Chapter 1 16
other novel non-viral delivery strategies have been developed specifically for siRNA delivery
but not utilised in targeting HBV. They include carbon nanotubes [62], lipidoids [63],
membrane translocation peptides [64], universal base derivatives [65] and modified arginine
peptides [66].
Cationic liposomes have the ability to neutralise the negatively charged siRNA nucleic acid
sequences to facilitate transport across negatively charged lipid-rich membranes. These
liposomes also condense the nucleic acids so that they are ideally contained in uniformly
sized, small particles (presently still technically challenging) which can pass through liver
fenestrations making these vectors suitable for in vivo application [67]. An important
development in advancing lipoplex vectors was the incorporation of neutral lipids such as
DOPE (dioleoylphosphatidylethanolamine) and DOPC (dioleoylphosphatidylcholine) into the
formulations. DOPE improves lipofection by aiding release of NVVs from endosomes [68].
The modular way in which liposome formulations may be assembled has enabled evaluation
of many combinations of cationic lipids, neutral lipids, targeting and ‘stealth’ components.
This has been particularly useful to adjust the composition of lipoplexes to influence
biological properties. Efficient liposome-mediated delivery of siRNAs in a mouse model of
HBV replication achieved potent silencing of viral gene expression for 7 days, which could
be maintained with repeated administrations [69]. The vectors used in this study, termed
stable nucleic acid lipid nanoparticles or SNALPs, have since been used for other hepatic
gene silencing applications [70, 71].
Cationic polymers comprise the second major class of NVVs. This group of compounds, as
with cationic lipids, binds nucleic acids to neutralize negative charges through the formation
of polyplexes. Condensation of nucleic acids enables generation of highly compact
Chapter 1 17
nanoparticles, which may be taken up by cells through endocytosis (reviewed in [60]).
Bioconjugation of the 5′ or 3′ end of the sense or antisense strands of siRNAs with lipids,
proteins, peptides and inorganic molecules has also been explored as a means of targeted
delivery (reviewed in [72]). More recently Zhu and Mahato successfully conjugated
galactose-bound PEG (Gal-PEG) to the 3′ end of the sense strand of siRNAs and
demonstrated silencing of target sequences in hepatocytes [73]. The silencing achieved with
the siRNAs conjugated to Gal-PEG was however improved when encapsulated within a
cationic liposome. Further characterisation of the siRNA conjugates in vitro and in vivo
should provide insights into the therapeutic utility of the technology.
1.3.1.1 Using NVVs to deliver anti-HBV siRNAs
Generally, vectors carry their payloads to hepatocytes passively or by a receptor-mediated
process. Examples of receptor and target pairings include interaction of the hepatocyte
asialogycoprotein receptor [74] with galactose-containing NVVs, and binding of
apolipoprotein A-1 (Apo A-1) [75] in NVVs with the hepatocyte high density lipoprotein
(HDL) receptor. Hepatocytes exclusively and abundantly express the asialoglycoprotein
receptor which interacts specifically to galactose moieties [74]. This fact has often been
exploited to direct NVVs to the liver [76]. A novel galactose-modified DOPE derivative (1,2-
dioleoyl-sn-glycerol-3-phosphatidyl-N-(1-deoxylactito-1-yl)etanolamine or GDOPE) has
been used to prepare liposome formulations that achieve improved hepatocyte delivery of
siRNAs [77].
Apo A-1 interaction with HDL receptors on liver cells has also been exploited to confer
hepatotropism on siRNA-carrying lipoplex formulations [75]. Apo A-1 is a component of
HDL and consequently is involved in the hepatocyte uptake of cholesteryl esters. Apo A-1-
Chapter 1 18
conjugated liposomes were capable of delivering anti-HBV siRNAs to the livers of mice in a
transient HBV replication model. Subsequent studies assessed efficacy of improved Apo A-1
conjugated liposomes carrying siRNAs targeting the hepatitis C virus [78]. These NVVs
demonstrated better liver-specific targeting in vivo, more efficient target knockdown and
minimal toxicity [78]. A novel cationic lipid DODAG (N’,N’-dioctadecyl-N-4,8-diaza-10-
aminodecanoylglycine amide) was recently shown to encapsulate anti-HBV siRNAs and
mediate efficient hepatocyte delivery in a mouse model of virus replication [79]. DODAG-
siRNAs, formulated without a neutral helper lipid, efficiently knocked down viral DNA and
antigen markers of replication. Other lipoplex formulations have also been employed to
deliver anti-HBV siRNAs in vivo [80-82].
Despite the need for repeated administrations of NVV-mediated delivery of siRNAs in
chronic HBV, NVVs in general show potential as delivery vehicles of anti-HBV siRNAs.
The field is developing rapidly and with positive data from clinical trials providing impetus
(reviewed in [83]), NVVs are quickly gaining prominence as hepatotropic delivery vehicles
for therapeutic siRNA sequences.
1.3.1.2 Off-target effects
Induction of an innate immune response by NVVs may reduce the duration of siRNA
silencing [84]. Studies that comprehensively characterise potential toxic side effects of many
of the reported NVVs are incomplete. Administration of dexamethasone prior to a lipoplex
can effectively attenuate the innate immune response but does not have a significant effect on
silencing activity of the siRNA [85]. This drug has similar utility for the reduction of
immunostimulation by hepatotropic Adenoviral vectors (Ads) (see Section 1.3.2.3.8).
Potential toxic side effects may also arise as a consequence of unintended NVV-mediated
Chapter 1 19
delivery of siRNAs to untargeted cells and in general, there is a paucity of comprehensive
analysis of the biodistribution of siRNAs delivered with NVVs [86-88]. Similarly, there is
little information on the subcellular localisation of siRNAs after NVV-mediated delivery to
target cells [88, 89].
1.3.2 Viral vectors
Adenoviruses and adeno-associated viruses (AAVs) are both capable of effective hepatocyte
transduction and are able to achieve long term transgene expression in the liver. Lentiviral
vectors (LVs) transduce hepatocytes stably, but efficiency of transgene delivery to these cells
following systemic administration in adult animals is generally inadequate for treating
chronic HBV infection. Nevertheless, LVs have potential therapeutic utility using ex vivo
approaches.
1.3.2.1 Adeno-associated viral vectors
AAVs are non-enveloped viruses that belong to the Parvoviridae family. They are small (±
20 nm) and have a single-stranded DNA genome of 4.8 kilobases (kb). Recombinant AAVs
can carry an insert of up to 4.6 kb which is adequate for accommodating typical RNAi
expression cassettes [90]. An important advance in AAV vector design was the development
of second generation double stranded or self-complementary AAV vectors (scAAVs).
Transgene expression from these vectors is more efficient and allows for administration of
lower vector doses [91]. There are 81 clinical trials in progress that utilize AAVs
(http://www.abedia.com/wiley/vectors.php). These vectors are suitable for use in humans
because they are non pathogenic, do not replicate without Ad co-infection, have low
immunogenicity and high titres of the vectors may be produced conveniently [92]. Although
Chapter 1 20
AAV safety is an advantage, a recent study showed that AAVs may cause liver inflammation
by activating a Toll-like receptor-2 (TLR-2) mediated responses in hepatocytes [93]. An
additional concern is that there is a high prevalence of neutralising antibodies (NAbs) to
AAV-2 in human populations [94]. Some of the NAbs also cross-react with other AAV
serotypes, which may limit their use as vectors in a clinical setting. Recombinant AAVs lack
the viral Rep protein, which restricts integration into the host genome, and contributes further
to vector safety [95]. The first AAV gene therapy vectors were based on AAV-2, which is
capable of transducing many different cell types [96]. There are currently more than 100
known AAV serotypes and it is possible to package the AAV-2 genome with the capsid of
any of these serotypes (pseudotyping). This feature is useful to change vector tropism and
evade host immune responses. AAV-8 and AAV-9 have a high affinity for hepatocytes (3-4
times higher than AAV-2) and have consequently been used for hepatotropic delivery of
RNAi effectors targeting HBV [97, 98]. Recently, DNA shuffling has been employed to
generate libraries with variations in the exposed loops of AAV capsid proteins [99].
Subsequent positive or negative selection enables purification of vectors with defined
properties, such as specific tissue tropism and attenuated NAb interaction. This method is
likely to be very useful for future application in AAV vectorology.
Grimm et al were the first to demonstrate the utility of scAAV-8 vectors for RNAi-mediated
HBV silencing [37]. However, although HBV replication was efficiently inhibited in the
transgenic mice, there was an associated high mortality. This prompted subsequent studies
which established that high concentrations of exogenous shRNAs compete with the natural
miRNA machinery to prevent processing of essential endogenous miRNAs. Compromised
function of hepatocyte miRNAs resulted in the death of the mice. Other studies have
subsequently employed AAVs to deliver HBV-targeting RNAi expression cassettes. A
Chapter 1 21
dsAAV-2/8 vector, a dsAAV-2 genome pseudotyped with an AAV-8 capsid, was
successfully used to inhibit HBV replication in a transgenic mouse model [100, 101].
Significant HBV inhibition was maintained for 22 weeks. A reduction in appearance of
complicating liver adenomas in HBV transgenic mice was also demonstrated after AAV
delivery of anti-HBV expression cassettes [102, 103]. To overcome problems of neutralising
antibodies to the AAV-8 capsid, a vector expressing the same anti-HBV sequence, but
pseudotyped with AAV-9, was then administered. This dsAAV-2/9 vector silenced HBV
effectively and evaded the AAV-8 NAbs. Thus, for successful repeated administration of
anti-HBV AAVs, the serotype of the capsid protein may be changed for each administration
to avoid neutralising effects of Abs [104].
An important recent advance in AAV vectorology has been the demonstration of clinical
utility of AAVs that effect hepatic blood clotting factor IX gene expression in livers of
haemophiliac patients [105]. This clinical study reported that peripheral vein infusion of the
vectors resulted in improvement in the clotting profiles and 4 of the 6 treated patients did not
require further factor IX prophylaxis. The authors suggest that concerns about toxicity and
immune-mediated elimination of the vector may be countered by treatment with a short
course of immunosuppressive glucocorticoids. This successful clinical study represents a
significant milestone and paves the way for use of AAVs for other applications such as in
RNAi-based HBV therapy.
1.3.2.2 Lentiviral vectors
LVs comprise a subgroup of retroviruses that transduce both dividing and non-dividing cells.
An important feature of the vectors is that stable integration of their proviruses enables long
term and potentially indefinite expression of transgenes, which may be up to 7.5 kb in length
Chapter 1 22
[104, 106]. This is useful to achieve sustained expression of anti-HBV sequences and render
infected cells resistant to HBV. Although provirus integration into host genomes is
potentially mutagenic, targeting to heterochromatin should improve the vectors’ safety profile
[107]. Interestingly, it has recently been demonstrated that LVs were less likely to integrate
into transcriptionally active sites in non-dividing cells than in dividing cells [108]. To date,
LVs have been used in 40 clinical trials (http://www.abedia.com/wiley/vectors.php). Most
trials involve ex vivo modification of hematopoietic stem cells and T-lymphocytes for the
treatment of HIV-1 and monogenic diseases. Although ex vivo modification of hepatocytes to
render them resistant to HBV infection offers interesting therapeutic possibilities, the
methods required to employ this approach are yet to be established. Transduction of
autologous hepatocytes derived from induced pluripotent stem cells followed by hepatic
infusion may become a feasible method of populating the liver with HBV-resistant cells
[109].
As for their utility for treating chronic HBV after systemic administration, a limitation is that
LVs transduce only a small proportion of adult murine hepatocytes [110]. Liver cell
transduction can be improved if cell proliferation is occurring at the time of LV
administration. In support of this, injection of vectors into young and newborn animals [111]
or following partial hepatectomy in adults [112] achieves greater hepatocyte transduction
efficiency. Priming hepatocytes for LV infection by pretreating animals with cholic acid and
phenobarbital has recently been investigated as a clinically relevant alternative to improving
LV transduction of hepatocytes [113]. Interestingly phenobarbital has a weak stimulatory
effect on cell proliferation, but cholic acid has no direct effect on the cell cycle. Without
increasing markers of cell proliferation, both compounds were shown to improve transduction
of hepatocytes in vivo following systemic administered LVs by a factor of 6 to 9 fold. This
Chapter 1 23
priming strategy is easy to implement but may not enable transduction of adequate numbers
of adult hepatocytes to be of use in RNAi-based HBV therapy with LV vectors. Adenoviral
vectors have proven to be far more suitable for the efficient delivery of therapeutics to the
liver.
1.3.2.3 Adenoviral vectors
1.3.2.3.1 Adenovirus structure
Adenoviruses belong to the Adenoviridae family and were discovered in the early 1950s.
They naturally infect epithelial cells resulting in mild infections of the upper respiratory tract
or gastroenteritis which are mostly asymptomatic in a healthy individual [114]. There are at
least 57 known human Ad serotypes belonging to species A-G, with derivatives of human
serotypes 5 (Ad5) and 2 (Ad2) from subgroup C, being most commonly used as gene therapy
vectors, and are thus the best characterised [115, 116]. Adenoviral vectors are currently the
most commonly used vector utilised in approximately 24% of clinical trials (Figure 1.6).
They are relatively large non-enveloped icosohedral viruses and have a double-stranded
linear DNA genome of approximately 36 kb. The capsid consists of 240 hexon capsomers
which form the 20 triangular surfaces of the icosohedron. Three major proteins make up the
capsid, i.e. hexon, penton base and fiber together with some minor proteins (reviewed in
[115]) (Figure 1.7).
1.3.2.3.2 Adenovirus genome organisation
The 36kb linear genome of Ad5 is represented in Figure 1.8 It is flanked by cis-acting
inverted terminal repeats (ITRs) which facilitate viral replication and a packaging signal (Ψ)
Chapter 1 24
Figure 1.6: Vectors used in gene therapy clinical trials. Pie chart showing the proportion
of gene therapy vectors being used in clinical studies as of June 2012.
www.wiley.co.uk/genmed/clinical
Chapter 1 25
Figure 1.7: Structure of adenovirus. The icosohedral virion is 60-90 nm in diameter with
the double-stranded DNA genome enclosed within the capsid made up of 240 hexon
monomers and 12 pentons (152 capsomers).
Chapter 1 26
which enables packaging of the genome into virion capsids. There are 2 sets of genes, the set
expressed before DNA replication (E1A, E1B, E2, E3 and E4) and the late set (L1 to 5)
which are expressed at high levels following initiation of DNA replication (reviewed in
[115]).
Adenoviruses were one of the first vector systems to be developed as they can efficiently
infect a wide range of both dividing and post-mitotic cells (reviewed in [117]). In 1977 the
Human embryonic kidney (HEK 293) cell line was established which stably expressed the E1
genes so the gene product could be provided to the virus in trans thus enabling the mass
production of replication deficient Ad vectors [118]. First generation (FG Ad) Ad5 vectors
were rendered replication deficient by deletion of E1 genes (Figure 1.8). These vectors still
have low level expression of viral antigens which activates a cytotoxic immune response
resulting in limited transgene expression. The E3 gene was then deleted as it is dispensable
for replication but involved with anti-host immunity (reviewed in [115]). However, it was
subsequently discovered that the re-introduction of E3 could actually prolong transgene
expression as it encodes functions involved in aiding viral escape from host immune
responses [119]. The deletion of the E1 and E3 genes also allowed for approximately 6.5 kb
of transgene to be inserted into the vector (reviewed in [115, 116]). It became apparent that
some cells express E1-like proteins which allowed for E2 function at a low level. This
resulted in the production of replication–competent adenovirus (RCA) which is not ideal for
gene therapy applications [120]. Second generation Ad vectors were then developed where
E2 was deleted to remove the risk of RCAs, but the vector’s capsids still stimulated the host
immune response resulting in transient transgene expression [121, 122]. To avoid these
unwanted host immune responses and resulting liver toxicity, third generation, helper-
dependent (HD Ad) or “gutless” vectors were developed which are devoid of all the viral
Chapter 1 27
Figure 1.8: Genome organisation of the different generations of adenoviral vectors.
Genome organisation and transcription map of Ad 5 and Ad 5-derived gene transfer vectors.
The double-stranded ±36 kb Ad genome, which is divided into 100 map units, is
schematically represented in A. Red boxes at the terminal ends represent inverted terminal
repeats (ITR) and Ψ indicates the position of the packaging signal. Arrows show the direction
of transcription for the major mRNAs. E1-E4 indicate early transcripts and L1-L5 represent
late transcripts. B. Represents the first-, second-, and third generation (gutless) Ad vectors
with the light boxes indicating which Ad genes have been deleted in the different vectors.
Chapter 1 28
coding sequences (Figure 1.8). These vectors only contain the cis-elements required for
genome replication and encapsulation so during the production process, a helper virus is used
to provide all the necessary products in trans [117, 123-125]. The production and purification
techniques initially used resulted in significant helper virus contamination but this was
overcome by the development of the Cre/loxP helper-dependent system in 1996 [126-129].
1.3.2.3.3 The Cre-lox system of Ad production
HD Ad production using the Cre/loxP system initially entails inserting the gene of interest
into a bacterial plasmid together with the 500 bp cis-acting viral sequences needed for
replication (ITRs) and packaging (Ψ) (Figure 1.9). A genome that is too small leads to
instability so “stuffer” DNA sequences are inserted to maintain an ideal size ranging from 27-
38 kb [126, 130]. Following successful cloning, the plasmid form of the genome is linearised
by restriction enzyme digestion with rare cutter Pme I (Figure 1.9) and the linear viral form is
transfected into a HEK 293 cell line expressing Cre recombinase (116 cells). This cell line is
then also infected with a helper virus, which is a FG Ad virus that has a packaging signal
flanked by loxP sites. Following infection of the HEK 293 cells Cre-mediated loxP site-
specific recombination excises the packaging signal (Ψ) in the helper virus genome to prevent
packaging of the helper virus [126]. The genome size of the helper virus (HV) (36 kb) and
HD Ad (30 kb) vary which enables them to be physically separated using cesium chloride
(CsCl) density centrifugation thus reducing the chances of HV contamination. Modification
of this system has enabled the mass production of high quality HD Ad with very low levels of
contaminating helper virus [131].
Chapter 1 29
Gutless adenovirusHelper adenovirus
Figure 1.9: The Cre-lox system of helper dependent adenovirus production. The HD Ad
genome is released from a bacterial plasmid (pΔ28LacZ) by restriction enzyme digestion
with PmeI. The HD Ad genome consists of cis-acting sequences required for replication
(ITRs) and packaging (Ψ) and occupies ± 500bp of the genome with the remainder consisting
of “stuffer” sequences and the transgene of interest (shRNA). The liberated genome is
transfected into Cre expressing HEK 293 cells (116 cells) and cells are infected with a helper
virus with a packaging signal flanked by loxP sites. Cre mediated excision of Ψ renders the
helper virus unpackagable yet still able to provide all the necessary factors for propagation of
the HD Ad in trans. Serial coinfections of 116 cells with HD Ad and helper virus are
performed until the desired viral titre is achieved. Adapted from [131]
Chapter 1 30
1.3.2.3.4 Adenoviral vectors in gene therapy
Recombinant Ad vectors are used in 24% of current gene therapy clinical trials as they have
several features which make them an attractive option, with the majority of the clinical
applications being in cancer therapy (http://www.abedia.com/wiley/vectors.php). There are
several advantages to using Ads for gene therapy: 1) they efficiently transduce a broad range
of dividing and non-dividing cell types; 2) they can be produced in high titres (up to 1013
virus particles/ml; 3) they are capable of carrying large transgene inserts; 4) they do not
integrate into the host genome which reduces the chances of insertional mutagenesis or
carcinogenesis and 5) they are extremely hepatotropic which makes them well suited for use
in HBV therapy [116]. HD Ad vectors have the added advantage of being able to carry large
transgene inserts of up to 36 kb in length. Deletion of all of the viral genes in HD Ads limits
induction of a cytotoxic T-cell mediated response and has an additional advantage of
prolonging transgene expression [116, 126]. Therapeutic Ad vectors are most commonly
administered systemically which unfortunately results in a number of adverse responses
triggered by stimulation of host innate and adaptive immune responses and this remains a
significant hurdle for clinical applications.
1.3.2.3.5 Adenoviral hepatotropism
A major advantage of using Ad vectors to target HBV is that they are naturally hepatotropic
[132]. Ad particles have a diameter of 60-110 nm and are able to traverse fenestrations in
liver. The level of transgene expression is often lower in humans than in pre-clinical animal
models which may be attributed to the much smaller fenestrae in the human liver [133]. The
fenestrations allow for access of the Ad to the microvillus surface of hepatocytes to enable
receptor-mediated internalisation into these cells [134, 135]. The conventional understanding
of Ad entry into cells is that there is initial binding of Ad fiber protein to coxsackie-
Chapter 1 31
adenovirus receptors (CAR). This attachment receptor for coxsackie B viruses as well as Ad2
and Ad5 was identified 30 years ago, on non-polarised epithelial cell surfaces [136, 137]. It is
becoming apparent that CAR is an important primary attachment receptor for Ads in vitro but
in vivo other mechanisms play a role in hepatic Ad binding and CAR is of minor importance
[138, 139]. A recently identified vitamin K-dependent pathway is responsible for effective
delivery of systemically administered Ad5 whereby coagulation factors VII, IX, X and
protein C bind to Ad hexon protein and transport the Ad5 to the liver. [140-142]. Coagulation
factor X appears to be the most efficient at mediating binding of the hexon hypervariable
region ofAd5. This interaction then promotes binding to cellular heparin sulphate
proteoglycans (HSPGs) prior to hepatocyte internalisation [142].
The liver is made up of parenchymal hepatocytes (66%) and non-parenchymal/sinusoidal
cells (33%). The non-parenchymal cells consist of endothelial cells (70%), Kupffer cells
(20%), fat storing Stellate cells (10%) and pit cells (< 10%) [143]. The Kupffer and liver
sinusoidal endothelial cells together with the spleen sinosoidal endothelial cells and
macrophages, form part of the mononuclear phagocyte system, previously called the reticulo-
endothelial system which plays an important role in defence [144]. The Kupffer cells are the
most numerous macrophage population in the human body and play an integral role in Ad
vector clearance after systemic delivery and also contribute to the innate immune response
[143].
1.3.2.3.6 Innate immune response
The major challenge for effective Ad-mediated gene therapy targeting HBV is efficient
delivery to parenchymal hepatocytes and the prevention of sequestration of the Ad and
stimulation of the innate immune response by Kupffer cells. Once Ads reach hepatic tissue,
Chapter 1 32
up to 98% of the virus particles are sequestrated by the mononuclear phagocyte system, and
in particular the Kupffer cells [145]. These antigen presenting macrophages express a
scavenger receptor A (SR-A) which binds negatively charged regions on the hypervariable
region 1 (HVR1) of Ad5 hexon protein [146]. Ads are destroyed in the phagocytic Kupffer
cells, which themselves undergo dose-dependent necrosis within 10 minutes of systemic
delivery of the vector [145, 146]. Ad pattern recognition receptors on macrophages and
dendritic cells trigger the innate immune response which results in an increase of chemokine
and inflammatory cytokine levels [144, 147-149]. Activation of this response is characterised
by a rapid release of inflammatory cytokines and may result in acute toxicity which can lead
to systemic inflammatory response syndrome and possible organ failure [148]. The
seriousness of such a response became evident by the unfortunate death of an 18-year old
patient, Jesse Gelsinger, who died as a result of systemic inflammatory response syndrome,
disseminated intravascular coagulation and multiorgan failure after receiving a high dose of
Ad vector containing the ornithine transcarbamylase (OTC) gene [150]. His death highlighted
the importance of understanding host-Ad interactions and the need for developing strategies
to attenuate this response. This response is species-specific, with humans being acutely
sensitive to the innate immune response (reviewed [143]).
The innate immune response is dose-dependent and occurs rapidly within 1 to 6 hours after
intravenous injection of Ads [148, 151]. In mice the innate response is followed by a
secondary release of pro-inflammatory cytokines and chemokines that occurs 5 to 7 days
after infection. This effect is thought to result from an adaptive immune response to
expressed viral proteins [115]. Receptor binding and endocytosis of Ads leads to activation of
P13K and ERK/MAPK pathways causing NF-βdependent activation of the innate response
[152]. There is a release of various chemokines and pro-inflammatory cytokines such as
Chapter 1 33
tumour necrosis factor-TNF, interleukins (IL-6, IL-5, IL-12 and IL-1), monocyte
chemotactic protein-1 (MCP-1) and interferon-(IFN-). The cytokine surge is followed by
leukocyte infiltration which results in liver tissue damage [148]. Toll-like receptors (TLRs)
and MyD88, which is a TLR adapter gene, have been implicated in mediating the response in
vivo [153, 154]. Toll-like receptors 2 and 9 are expressed on Kupffer, spleen and liver
sinusoidal cells and exhibit species differences in expression which may account for
differences seen in the innate response by different animals [154]. IFN- and IFN-
production, which also contributes to the toxic effects of Ads [147, 151, 155, 156], occurs in
splenic cells (myeloid dendritic cells) by a mechanism that is independent of TLRs and
cytosolic receptors of RNA and DNA. The effect is however dependent on endosomal viral
escape which activates MAP kinase and SAPK/JNK signaling pathways [156]. The tissue
damage caused by the innate immune response eliminates the transgene expressing cells and
hence reduces the duration of transgene expression.
1.3.2.3.7 Adaptive immune response
An adaptive immune response can be mounted after a single immunisation with Ads. Host B
cell recognition of an epitope on a foreign antigen is followed by proliferation of T helper
cells and the release of immunoglobulins targeting the Ads. Once an animal has been exposed
to Ad it will trigger a humoral response and the production of Nabs within a week of
exposure which limits the repeated administration of Ad vectors. Major histocompatibility
complex (MHC) class I-restricted CD8+ T cells are directed against cells expressing the
transgene [157]. MHC class II helper CD4+ T cells activate B cells to secrete NAbs directed
at capsid proteins and inhibit transduction by the Ad vectors and decrease the amount of
infectious virus [158-160]. A major obstacle in using Ad5 derived vectors is the high
prevalence of human anti-Ad5 antibodies in humans resulting from previous exposure to Ad5
Chapter 1 34
[161, 162]. The seroprevalence to Ad5 is 80% in sub-Saharan Africa but only 50% in the
USA [19]. The immune response prevents the long-term expression of transgenes and
inability to administer Ad5 vectors to pre-exposed individuals. Fortunately strategies have
been developed to circumvent these potential problems. Overcoming the unintended effects
resulting from immune-stimulation following Ad administration, as well as evading pre-
existing immunity have been a priority of research involving use of Ads for gene therapy
[163].
1.3.2.3.8 Strategies used to avoid immune stimulation
Helper dependent vectors versus first generation Ad vectors
The use of FG Ad generally results in transient gene expression in an Ad naïve animal and
poor expression after repeated administrations resulting from activation of the host immune
response. First generation Ad vectors express viral genes and display viral capsid peptides on
transduced cell membranes resulting in immune clearance and memory T-cell killing of the
transduced cell. It was found that reintroduction of the E3 region actually aids in viral escape
resulting in prolonged transgene expression and decreased NAb generation [119, 164]. The
development of third generation HD Ad vectors which have most of their genome deleted and
do not express viral genes resulted in more sustained transgene expression and an improved
safety profile [126, 165-167]. Although HD Ads and FG Ads induce the same inflammatory
innate response, the inflammatory response does not last longer than 24 hours with HD Ads.
Transgene expression from HD Ad vectors is not permanent, yet there have been reports of
stable, long term-expression of transgenes for over 1 year following administration of a single
dose of HD Ad vectors [168, 169].
Chapter 1 35
Sequestration prevention
Various methods have been employed to avoid Ad sequestration by Kupffer cells. These
include the intravenous administration of chemicals such as clodronate-encapsulated
liposomes or gadolinium chloride which are specifically toxic to Kupffer cells and splenic
macrophages [147, 170, 171]. Alternatively, an Ad5 ‘predosing’ regimen has been employed
where high doses of “null” Ad5 are injected to cause Kupffer cell death. Administration of
the therapeutic viral vector soon thereafter results in greater efficiency of liver cell
transduction as the Kupffer cells are unable to sequestrate the therapeutic Ad vector. [172-
174]. Another strategy that has been employed in mice is preinjection of polyinosinic acid
which is a scavenger receptor A ligand, resulting in decreased Kupffer cell numbers and
increased circulating half-life of the Ad vector [175]. These strategies have been useful for
studying Ad-host interactions in animal models but are not clinically viable. More clinically
relevant approaches that have been employed are the administration of the anti-inflammatory
glucocorticoid dexamethasone, transient pharmacological suppression of B and T cells and
polymer modification of immunostimulatory epitopes [40, 176-181].
Another factor that diminishes efficiency of Ads in a clinical setting is vector sequestration
by the CAR and Complement 1 receptor on human erythrocytes. These receptors are not
present on mouse erythrocytes which emphasises limitations of murine models in predicting
clinical utility of Ad vectors [182, 183]. To overcome this sequestration problem it may be
possible to modify vectors with polymers or to isolate the liver circulation and deliver the Ad
vector directly to hepatocytes by using an intravenous catheter [184, 185].
Chapter 1 36
Serotype switching
With the high seroprevalence to Ad5 in humans, an alternative strategy to allow for repeated
vector administration is serotype switching. There are more than 50 Ad serotypes that can
infect humans. Neutralising Abs against one serotype usually do not cross reacting with
another serotype [162]. Using the Cre/loxP system, it is possible to generate HD Ads with
different serotypes by simply changing the serotype of the helper virus to that of a different
Ad serotype. Replacement of capsid proteins with those from a rare, less seroprevalent Ad
serotype, enables successful repeat administrations of Ad vectors in vivo [186, 187].
Capsid modification
Instead of changing the genetic makeup of Ad capsid proteins, the Ad capsid can be modified
by conjugating polymers to “mask” the capsid from Kupffer cell, red blood cell, and NAb
detection [180, 188, 189]189]. The shielding of the Ad capsid results in reduced innate and
adaptive immune responses and decreased liver damage in vivo [188-190]. The main
neutralizing antibody response is directed at the hexon proteins of the viral capsid but can
also be directed at the fiber of penton base [19, 191]. Two types of synthetic polymer have
been used to modify Ads, PEG and poly-N- (2-hydroxypropyl) methacrylamide. Polyethylene
glycol is the most commonly used polymer and has been utilised since the 1970s to modify
therapeutic peptides and proteins [192, 193]. Conjugation with PEG improves the stability,
pharmacokinetic and toxicity profiles of compounds without decreasing their activity ([178],
reviewed in [194]). Polyethylene glycol is an uncharged, monovalent, hydrophilic, non-
immunogenic synthetic polymer which covalently attaches to hexon proteins on Ad caspids
through free surface reactive amine groups [178]. Conjugation of viral capsids with PEG
shields the negative charges on Ad5 hexon which diminishes vector interaction with Kupffer
cells and subsequent sequestration, thus enabling efficient hepatocyte transduction [188, 190,
Chapter 1 37
195-197]. PEGylation decreases immune detection, improves the toxicity profile and
transduction efficiency of vectors is not compromised in non-primate animal models [198-
201]. It has been noted however that transgene delivery to primate hepatocytes using PEG-
modified vectors may be less efficient [180, 202, 203].
The focus of this thesis has been the employment of the above strategies to attenuate host
immune responses, in particular the use of HD Ad vectors and PEGylated Ad vectors, to
develop a viable delivery vehicle for a RNAi-based therapeutic option for the treatment of
chronic disorders such as HBV.
1.3.2.3.9 Adenoviral therapy targeting HBV
In 2005 Uprichard and colleagues showed that HBV replication was inhibited by a
recombinant first generation Ad vector that delivered a HBV-targeting shRNA expression
cassette [204]. The effect lasted for at least 26 days in a HBV transgenic mouse model
following systemic administration of the vector. In a similar study published by our group in
2006, first generation Ad vectors carrying an RNAi effector targeting the X ORF of HBV
resulted in inhibition of HBV replication [56].
It became apparent that sustained hepatic transgene expression and attenuated immune
stimulation may be achieved with HD Ad vectors [205, 206]. Assessing efficacy of HD Ads
for RNAi-based treatment of other diseases has provided insights that are relevant to using
these vectors for delivering HBV-silencing sequences. In a study aimed at inhibiting an
endogenous hepatic gene, HD Ads successfully delivered an shRNA expression cassette
targeting the gene encoding the sterol regulatory element-binding protein-1c (SREBP-1c)
[207]. This transcription factor is an important mediator of insulin effects on lipid and
Chapter 1 38
carbohydrate metabolism in the liver. Following systemic administration of 2 × 1011
HD Ad
particles to mice that model type 2 diabetes, 90% knockdown of the target gene was observed
in the liver after 1 week and the effect was sustained for 21 days. An interesting observation
was that there appeared to be a limit to the level of gene silencing, and administration of
higher vector doses did not augment knockdown but increased immunostimulatory effects
[207, 208]. Usefulness of RNAi-activating anti-HBV HD Ad vectors has been assessed in
one study reported to date [209]. Although potentially effective, specificity of the silencing
effect could not be confirmed, which highlights the relevance of the work presented in this
thesis.
There is a still a deficit in knowledge concerning Ad and host interactions and a better
understanding of these interactions will enable the generation of safer HD Ad vectors that can
be used in large animal models and ultimately humans. Although studies on use of HD Ads in
large animal models of HBV infection have not yet been reported, results from investigations
in other disease models are relevant. Successful long term expression of transgenes delivered
with HD Ad vectors has been achieved in non-human primates [210-212]. However, when
administered in high doses (>1 × 1013
viral particles) acute and sometimes fatal toxicity was
reported to occur [39, 206]. The structure of the HD Ad virions is the same as that of the first
generation vectors and thus HD Ads are capable of inducing an acute, dose-dependent innate
immune response [39, 92]. This highlights the importance of developing strategies to
attenuate these immune responses for the development of safe therapeutic Ad vectors.
1.4 Aims
An RNAi approach targeting HBV has proved to be successful, however the ultimate success
of RNAi therapy in chronic HBV carriers will be defined by efficiency of the delivery vector.
Chapter 1 39
In recent years there has been a growing interest in nanobiotechnology and the manipulation
of viral vectors, in particular Ad vectors for therapeutic applications. Ads are highly efficient
at transducing liver cells yet can be toxic as a result of the immunostimulatory effects in the
host animal. The initial aim of the study was to investigate whether both the innate and
adaptive immune responses could be attenuated by chemical modification of Ad vectors. FG
Ad vectors carrying efficient anti-HBV RNAi sequences were PEGylated and tested in a
transgenic HBV mouse model.
Chronic carriers of HBV require sustained inhibition of HBV for the therapy to be effective,
so ideally an effective RNAi therapeutic for HBV should demonstrate long-term effects. FG
Ad vectors expressing RNAi sequences have been shown to be efficient at inhibiting HBV
but the effect is only transient. Third generation HD Ad vectors have an attenuated induction
of a cytotoxic T-cell mediated response resulting in prolonged transgene expression. The
principal objective of the second study was to clone anti-HBV RNAi effectors into HD Ad
vectors, with the hope of obtaining sustained expression in the HBV transgenic mice. The
combination of Ad capsid PEGylation and the use of HD Ads has the potential of generating
an efficient delivery vector system for the treatment of HBV using an RNAi approach.
In summary the aims of the research presented in this thesis were to:
1. Chemically modify FG Ad vectors expressing ant-HBV shRNA effectors with the
objective of attenuating immunostimulation and thereby increasing their efficacy in vivo.
2. Compare FG Ad and HD Ad vectors in the same in vivo model to access whether more
sustained HBV inhibition can be achieved with HD Ad vectors.
40
2 EFFICIENT INHIBITION OF HEPATITIS B VIRUS
REPLICATION IN VIVO USING PEG-MODIFIED
ADENOVIRUS VECTORS
2.1 Introduction
Licensed anti-HBV therapeutics are only partially effective [213] and the demonstration that
HBV replication is susceptible to RNAi-mediated silencing [53, 54, 204, 214-216] prompted
investigations aimed at harnessing this pathway for therapeutic application. The HBV
genome has a compact arrangement with overlapping open reading frames (ORFs) and cis
elements embedded within protein-coding sequences (Figure 2.1). There is a single
transcription termination signal, which results in all HBV transcripts having a common 3′ end
that includes HBx. This arrangement limits sequence flexibility of the virus and makes HBx a
particularly good target for RNAi based nucleic acid hybridisation gene silencing. Previous
work from our laboratory demonstrated that Ads expressing hairpin sequences targeting HBx
(HBV co-ordinates 1580–1604) are efficient silencers of HBV gene expression and
replication [56].
The most promising viral vectors that have been used for in vivo delivery of anti-HBV
sequences are recombinant Ads [56, 204] and AAVs [217]. Ads have the useful property of
efficient targeting of hepatocytes in vivo after systemic administration (reviewed in [216]).
However, widespread use of these vectors has been limited by pre-existing immunity and
their powerful induction of innate and adaptive immune responses. Resulting damage to
healthy tissues with decreased transgene expression is thus a significant concern for
therapeutic use of recombinant Ads. Given the importance of Ad capsid proteins in mediating
41
immune responses, methods have been devised to attenuate immunostimulation by modifying
Ad capsid proteins with polymers such as PEG [177]. Chemical modification of Ad capsid
proteins is a well-established strategy and although decreased immunostimulation has been
shown by this approach [178-180, 218, 219], there have been few studies that measured the
efficiency of polymer-modified Ad vectors in vivo in disease models. In this study, we
assessed PEG-modified first-generation vectors that express an RNAi activator that we have
previously shown to silence HBV replication efficiently [56]. We observed that PEGylation
improved silencing of HBV in vivo in a murine transgenic model of HBV replication. This
chemical modification also significantly suppressed immunostimulation and hepatotoxicity.
2.2 Materials and methods
2.2.1 Adenoviral vectors
First-generation adenoviral vectors expressing enhanced green fluorescent protein (eGFP)
together with anti-HBV short hairpin RNA 6 (shRNA 6) or shRNA 10 [56] were previously
generated in our laboratory according to the AdEasy system (Stratagene, CA, USA) [220].
Purification of the recombinant Ad was carried out using a standard two-step CsCl
centrifugation protocol and then the virus was dialysed and stored at -80 ºC.
2.2.2 PEGylation of first generation adenoviral vectors
The method used to modify the viral vectors with PEG was based on previously described
protocols [178, 219]. Activated methoxypolyethylene glycol 5000 propionic acid N-
succinimidyl ester (mPEG-SPA 5000) (Sigma Aldrich, MO, USA) was used to modifiy FG Ad
vectors. Briefly, 1 × 1012
Ad particles were incubated with one ml mPEG-SPA 5000 (1 mg/ml)
42
for one hour at room temperature with constant mixing. Ten-fold excess of L-Lysine, Free
Base, Monohydrate (Calbiochem, CA, USA) was then added to quench the reaction and
incubated for one hour at room temperature with constant mixing. The FG Ad sample was
then transferred to a Slide-A-Lyzer dialysis cassette (Pierce, Thermo Fisher Scientific, IL,
USA) and dialysed overnight at 4 ºC in 10 mM potassium-buffered saline (KPBS), pH 7.4 to
remove unreacted mPEG-SPA5000. The PEG-conjugated Ad was concentrated to the original
volume by placing the Slide-A-Lyzer containing the PEGylated Ad on solid PEG 20 000 for
approximately two hours at room temperature. When the desired volume was reached, the
PEGylated Ad virus was removed from the dialysis cassette and 10% glycerol was added
before aliquoting and storing at -80 ºC. An aliquot was analysed to assess efficiency of
PEGylation. A increase in molecular weight (MW) of the hexon protein results from
PEGylation which was verified by polyacrylamide gel electrophoresis (PAGE) or microchip
electrophoresis. The Experion microchip electrophoresis system (Biorad Laboratories, CA,
USA) was used according to manufacturer’s instructions. Briefly, it involves running the viral
proteins under non-reducing conditions to resolve and quantify the PEG coupled hexon
proteins accurately.
2.2.3 Titration of Ad vectors
The number of infectious particles in PEGylated or unPEGylated preparations was
determined by titrating adenoviral stocks in HEK 293 cells and assaying the cells 48 hours
later for Ad fiber protein expression using immunostaining. The protocol was based on the
Adeno-X rapid titer kit (Clontech, Mountain View, CA, USA) with minor modifications.
Briefly, HEK 293 cells were propagated as detailed in Appendix A1-1 and then plated at 5 ×
105 cells/ml in a 24-well plate. The Ad was serial diluted (10
-2, 10
-3, 10
-4, 10
-5, 10
-6 dilutions)
43
and l of diluent was added to triplicate wells at the time of plating. The cells were
incubated at 37 ºC, 5% CO2 for 48 hours after which the medium was aspirated from the cells
and the plate was allowed to air dry for five minutes. The cells were fixed to the plate by
gently adding ice cold 100% methanol to each well and incubating at -20 ºC for 10 minutes.
The fixative was removed and three washes of phosphate-buffered saline (PBS) + 0.5%
bovine serum albumin (BSA) were performed before adding two drops of diluted protein
block (PBS + 1% BSA) per well which was incubated for five minutes at room temperature.
The wells were then washed once with PBS + 0.5% BSA and the cells were permeabilised by
adding 200 l per well of PBS + 0.5% BSA + 0.25% Triton-X. The wells were again washed
with PBS + 0.5% BSA before adding mouse anti-Ad fiber Ab (Biomeda, CA, USA) (diluted
1/1000 in PBS + 0.5% BSA) which was incubated for an hour at room temperature on an
orbital shaker. The primary antibody was aspirated and the plate was washed once with PBS
+ 0.5% BSA. The buffer was removed and 2 drops of biotinylated secondary Ab (Biomeda,
CA, USA) was added to the wells and incubated for 30 minutes at room temperature. The
secondary Ab was aspirated and the plate washed, before adding 2 drops of diluted Detector
Reagent (biotinylated horseradish peroxidise (HRP) complexed with avidin) (Biomeda, CA,
USA) which was incubated for 30 minutes at room temperature. The wells were then washed
with PBS + 0.5% BSA buffer followed by a distilled water wash before staining with the 3,3'-
Diaminobenzidine (DAB) chromagen. The diluted metal enhanced DAB substrate (Roche
Biochemicals, GmbH, Germany) was added to the wells and incubated at room temperature
until a dark precipitate, which forms in the presence of HRP, was visible (5-15 minutes). The
DAB positive cells were counted using a light microscope. The number of infectious Ad
particles per ml (ifu/ml) of vector sample was determined using the following formula:
Ifu/ml = (infected cells/field) × (fields/well)
volume virus (ml) × dilution factor
44
2.2.4 Cell culture and Northern blot analysis
Culture and infection of Huh7 lines was carried out as detailed in Appendix A1-1. For
Northern blot hybridisation, liver-derived Huh7 cells were infected with an approximate
multiplicity of infection (moi) of 100 recombinant adenovirus vectors per cell and harvested
2 days thereafter, before extracting total RNA with TRI Reagent® (Sigma-Aldrich, MO,
USA). Approximately 20 mg of RNA was separated on a 15% denaturing polyacrylamide
gel. As a molecular marker a mixture of 200 ƒmol digoxigenin (DIG)-labeled probes (18
nucleotide shRNA6 and 24 nt U6 small nuclear RNA) was run alongside the samples. The gel
was stained for 5 minutes in 0.5× Tris-Borate Ethylenediaminetetraacetic Acid (EDTA)
containing 4 µg/ml ethidium bromide. The RNA was visualised under UV illumination to
verify equal loading and quality of the RNA. The RNA was then transferred to Hybond-N+
positively charged nylon membrane (Amersham, NJ, USA) at 4 ºC using the Semi-Dry
Electroblotting Unit Z34,050-2 (Sigma-Aldrich, MO, USA) set at 3.3 mA/cm2 for an hour
The RNA was then cross linked to the membrane using a UV crosslinker (UVP Inc., CA,
USA) set at 20 000 J/cm2.
Probes against the putative 6 guide sequence (5′- TGC ACT TCG CTT CAC CTC -3′) and
the U6 snRNA (5′-TAG TAT ATG TGC TGC CGA AGC GAG -3′) which was used as a
control for equal loading of the cellular RNA [40], were prepared by labelling with the DIG
Oligonucleotide 3′-End Labelling Kit (Roche Applied Science, Mannheim, Germany). The
membrane was pre-hybridised in 10 ml/100 cm2 of DIG Easy-Hyb solution (Roche Applied
Science, Mannheim, Germany) at 42 ºC for 30 minutes. Following pre-hybridisation the
labelled probes were denatured at 95 ºC for 5 minutes and added to the membrane at a
concentration of 10 ng/ml in DIG Easy-Hyb solution and allowed to hybridise at 42 ºC
overnight. Following hybridisation the membrane was subjected to a low stringency wash (5×
45
SSC, 1% SDS) at room temperature for 20 minutes and two high stringency washes (1× SSC,
1% SDS) at 42 ºC for 15 minutes each. The hybridised probes were detected by equilibrating
the membrane in 1× wash buffer (0.1 M malic acid; 0.15 M sodium chloride, pH 7.5; +
0.03% Tween-20) at room temperature for 2 minutes and then blocking in 5% milk powder in
PBS at room temperature for 30 minutes. The Anti-Digoxigenin–Alkaline Phosphatase Fab
Fragment Ab (Roche Diagnostics, IN, USA) (0.5 µl/10ml blocking solution) was then
incubated with the membrane at room temperature for 30 minutes. Unbound Ab was removed
by subjecting the membrane to four 15 minutes washes (1× wash buffer) at room
temperature. The membrane was placed in detection buffer (0.1 M Tris.HCl; 0.1 M sodium
chloride, pH 9.5) for 5 minutes before placing the membrane on a plastic sheet and then
adding 20 drops of the chemiluminescent substrate for alkaline phosphatise, CDP-Star
(Roche Biochemicals, GmbH, Germany). The membrane was covered with another piece of
plastic and incubated at room temperature for 5 minutes before imaging the
chemiluminescent signals using a G:Box Imaging and Analysis System (Syngene,
Cambridge, UK). Membranes were stripped and reprobed with the DIG-labelled
oligonucleotide to detect U6 snRNA.
2.2.5 Adenoviral vector administration to HBV transgenic mice
HBV transgenic mice which constitutively express HBV particles, have a greater than
genome length HBV sequence stably integrated into their genome [221]. The mice were used
to determine the effects of RNAi-activating adenoviral vectors on markers of HBV
replication in vivo. These experiments were carried out in accordance with protocols
approved by the University of the Witwatersrand Animal Ethics Screening Committee. A
dose of 5 × 109, 1 × 10
9, or 5 × 10
8 adenovirus infectious particles was injected as a bolus via
46
the tail vein and blood was collected by retroorbital puncture. In all experiments, groups of
mice comprised eight animals each.
2.2.6 Serum HBV DNA and liver mRNA quantitation
Circulating viral particle equivalents (VPEs) and hepatic HBV mRNA were determined by
real-time quantitative polymerase chain reaction (Q-PCR). An absolute Q-PCR method was
used to measure serum HBV DNA. Total DNA was isolated from 50 µl serum samples using
the MagNA Pure LC Total Nucleic Acid Isolation Kit and MagNA Pure LC system (Roche
Diagnostics, GmbH, Germany). Real-time analysis was performed on the DNA using
SYBR® Green Jumpstart Taq Ready mix (Sigma, MO, USA). The surface antigen region of
HBV DNA was amplified using primer set: HBVs forward: 5′- TGC ACC TGT ATT CCC
ATC -3′, and HBVs reverse: 5′- CTG AAA GCC AAA CAG TGG -3′ on the Roche
Lightcycler v.2 (Roche Diagnostics, GmbH, Germany). Following a 95 ºC hotstart to activate
the Taq polymerase, 50 cycles of the following parameters were used: annealing at 57 ºC for
10 seconds, extension at 72 ºC for 10 seconds and denaturation at 95
ºC for 10 seconds.
Specificity of the amplicons was confirmed by melting curve analysis. The absolute value of
viral particle equivalents was determined using a standard curve that was generated from a
commercial HBV standard obtained from the National Institute of Biological Standards and
Controls (NIBSC, Hertfordshire, UK) (Appendix A1-4).
A relative Q-PCR method was used to measure HBV mRNA in mice livers where HBV
expression was quantified relative to the housekeeping gene glyceraldehyde-3-phosphate
dehydrogenase (GAPDH). Total RNA was extracted from freshly harvested livers using TRI
Reagent® according to procedure detailed in package insert. Approximately 30 ng of RNA
47
was reverse transcribed using Sensiscript® Reverse Transcription Kit (Qiagen, GmbH,
Germany) and oligi-dT primer. The same HBVs primer set as used to measure HBV DNA
was used and the GAPDH expression was determined using primer set: GAPDH forward: 5′-
GAAGGTGAAGGTCGGAGTC -3′; GAPDH reverse: 5′- GAAGATGGTGATGGGATTTC-
3′. HBV surface mRNA was quantified relative to GAPDH expression in the Roche
Lightcycler v.2 using SYBR® Green as detailed above, except that a temperature of 58 ºC
was used in the annealing step.
2.2.7 Liver sections
Adenovirus gene transduction was assessed by detecting eGFP microscopically in frozen
liver sections done on mice sacrificed 48 hr after initial injection with adenovirus.
2.2.8 Cytokine assay
A cytometric bead array (CBA) mouse inflammation kit (BD Biosciences, CA, USA) was
used to measure serum inflammatory cytokine levels. The assay quantitatively measured IL-
6, IL-10, MCP-1, IFN-, TNF-, and IL-12p70 protein levels in the mouse serum samples.
The protocol followed was according to manufacturer’s instructions except that serum
samples were diluted 2-fold. Briefly, the mouse inflammation standard was diluted in assay
diluent and allowed to stand at room temperature for 15 minutes after which a dilution series
was generated by serial dilutions of the standard. Each of the 6 capture beads (specific to
each cytokine) was thoroughly mixed and 10 l of each standard per test was added to make
a stock solution. Fifty microlitres of bead mixture was then added to each assay tube. The
standards and samples (50 l) were then added to appropriate tubes followed by 50 l of
48
Phycoerythrin (PE) detection reagent. The assay tubes were incubated at room temperature
for 2 hours after which they were washed with 1 ml Wash Buffer. The assay tubes were
centrifuged to pellet beads, Wash Buffer was removed and the beads were resuspended in
300 l Wash Buffer. The contents of each tube were transferred to a microtiter plate and the
inflammatory cytokine levels determined using the CBA machine and BD CBA Software
(BD Bioscience, CA, USA).
2.2.9 Anti-adenovirus immunoglobulin assay
To measure mouse antibodies against complete Ad virions, a previously described protocol
was followed [222]. Briefly, individual wells of a MaxiSorp™ ELISA plate (NUNC,
Roskilde, Denmark) were coated with 100 l of 0.05 M carbonate/bicarbonate buffer (pH
9.6) containing 1 × 1010
viral particles of FG Ad shRNA 6. The plate was left at room
temperature overnight after which the coating solution was discarded and the plate washed
three times with washing solution (0.9% NaCl; 0.05% Tween 20). The plate was dried by
inverting on a paper towel. The remaining binding sites in wells were blocked with 150 l
dilution buffer (1 × PBS; 2% non-fat milk powder; 0.05% Tween-20; 0.02% sodium-azide)
for 1 hour at room temperature. The solution was discarded and dried as before. Mouse serum
samples were diluted 1:10 000 and 100 µl of the diluents were added to the ELISA plate
before assaying for the amount of mouse antibodies to Ad hexon protein using the
RIDASCREEN Adenovirus IgG kit (R-Biopharm, Pfungstadt, Germany). The protocol was
followed according to the manufacturer’s instructions except the kit secondary antibody was
substituted with a peroxidase-conjugated secondary anti-mouse immunoglobulin (Dako, CA,
USA) which was detected with o-phenylenediamine dihydrochloride as the chromogenic
substrate. After 15 minutes the reaction was stopped by adding 100 l 1N H2SO4 and the
49
optical density of the samples was measured at 496 nm on a Bio-Rad Microplate Reader,
Model 680 (Bio-Rad, CA, USA).
2.2.10 Serum transaminase assay
Liver secreted aspartate transaminase (AST) and alanine transaminase (ALT) activities were
measured in mouse serum samples by a kinetic assay with an automated photometric analyser
(Roche Diagnostics, Rotkreuz, Switzerland) in a routine chemistry lab.
2.2.11 Statistical analysis
Means ± standard error of the mean (±SEM) were calculated and a statistical difference was
considered significant when p < 0.05 and was determined according to the Student two-tailed
t test. Calculations were performed with the GraphPad Prism software package (GraphPad
Software, CA, USA).
2.3 Results
2.3.1 HBV target sequence
The previously described HBV targets of expressed RNAi activators are located in the HBx
ORF of HBV (Figure 2.1). This viral sequence was selected as it is conserved in HBV
genotypes and is also present in all of the viral transcripts. Previously optimised hairpins
which were complementary to the target sites in HBV, were cloned downstream of a pol III
(U6) promoter within FG Ad vectors and consisted of 25-bp stems with four CA and GU
50
Figure 2.1: Schematic illustration of Hepatitis B virus genome showing sites targeted by
shRNA sequences. Co-ordinates of the viral genome are given relative to the unique EcoRI
restriction site. The surface, core, polymerase and HBx viral open reading frames (ORFs) (with
initiation codons), encompassing the entire genome, are indicated by arrows. Four outer arrows
represent the HBV transcripts with common 3 ends. The sites targeted by HBV shRNA 6 and
HBV shRNA 10 are located within the HBx ORF and are found in all of the viral transcripts.
51
Figure 2.2: shRNA encoding vector targeting HBV. Schematic of the DNA cassette that
was inserted into FG Ad vectors with pol III (U6) promoter, sense miRNA loop and
antisense-encoding sequences is illustrated above. The expressed anti-HBV shRNA 6
indicating miRNA 23 loop and mismatches in the sense strand is shown below.
52
Figure 2.3: Northern hybridisation analysis of expressed anti-HBV sequences. RNA was
extracted from Huh7 cells after infection with recombinant viruses expressing the indicated
shRNA cassettes (shRNA 5, shRNA 6 and control shRNA 10) or from uninfected cells.
Hybridisation of a 32
P labeled probe complementary to the intended shRNA 6 guide strand,
indicates the presence of an efficiently processed 21nt guide sequence. The probe was then
stripped and rehybridised to an endogenous U6 snRNA probe to confirm equal loading of
cellular RNA (bottom).
53
mismatches (Figure 2.2). U6 shRNA 6 is highly effective against HBV, but U6 shRNA 10
does not silence HBV replication and has been used as a control in this study. To assess
potential improvement by polymer modification, we selected the recombinant adenovirus
vector that expresses anti-HBV shRNA 6 (Ad HBV shRNA 6) and subjected this to analysis
after PEG conjugation. After infection of Huh7 cells in culture with Ad HBV shRNA 6, the
intended anti-HBV guide sequence was detected (Figure 2.3), which verified that transcripts
of the expression cassette were indeed processed by the RNAi related machinery.
2.3.2 Anti-HBV efficacy of PEG-modified Ad vector
Ad HBV shRNA 6 vectors were modified with mPEG-SPA, and efficient addition of PEG to
the Ad hexon protein was verified by microchip electrophoretic analysis. An estimated 93.3%
of the hexon protein present in the sample was PEGylated (Appendix A1-2). Titration of
PEG-modified vectors did not result in an appreciable decrease in infectivity, and suitable
concentrations for in vivo application were routinely achieved. Hepatic delivery of transgenes
was assessed after injection of mice with 5 × 109 infectious recombinant virus particles.
Fluorescence microscopy of frozen liver sections showed that approximately 80% of liver
cells were transduced 48 hr after injection, and that this was achieved with both native and
modified vectors (Figure 2.4). Enhanced GFP was also not detectable in any significant
amounts in non-hepatic tissue (data not shown). Our PEG modification procedure therefore
did not compromise delivery efficiency and liver targeting of these vectors after systemic
administration. HBV transgenic mice were then injected with PEGylated and native Ads
expressing HBV shRNA 6 and anti-HBV efficacy was measured by determining the number
of circulating VPEs (Figure 2.5). Initial effects of PEGylated and unmodified vectors on
circulating VPEs were similar in mice treated with both vectors. There was a significant drop
in the circulating VPEs in each of the groups of animals 1 week after administration of the
54
virus. This effect persisted for approximately 4 weeks, and at week 5 the VPE titre had
increased to approach baseline levels. At week 5, a second dose of Ad vectors was
administered to the mice via the tail vein. At week 7, the PEG-modified vectors effected a
decrease in VPEs, which was not observed after treatment with the unmodified Ads. By 3
weeks after the second PEG Ad vector injection the number of circulating VPEs had returned
to baseline concentrations, which indicates that silencing efficacy after the second Ad
injection is less sustained than after the initial vector administration. There appeared to be an
increase in the VPEs measured in mice receiving the PEG-modified vector following the
second administration. However the increase in VPEs was not significantly greater than
baseline levels and is in keeping with the natural variation of HBV levels seen over time, in
the HBV transgenic mice used in this study.
Knockdown of intrahepatic HBV mRNA was also measured 1 week after administration of
various doses of Ad HBV shRNA 6 or control Ad HBV shRNA 10 (Figure 2.6). Quantitative
reverse transcription PCR, using primers that target the HBV surface ORF relative to eGFP
expression (indicative of the amount of vector expressed in the liver), showed that
intrahepatic HBV mRNA was decreased in animals that had been treated with 5 × 109 Ad
HBV shRNA 6 particles. This effect was significant at a high dose but diminished in mice
receiving lower doses of the PEG-modified recombinant vector. Moreover, PEGylated Ad
HBV shRNA 10 did not demonstrate decreased HBV mRNA concentration, which is in
keeping with the previously reported observations showing that this unmodified Ad vector
had no effect against HBV replication [56].
55
Figure 2.4: Adenoviral vectors efficiently transduce hepatocytes. Representative
fluorescence microscopy analysis of frozen sections from mouse liver that was processed 48
hrs after administration of 5 × 109 native (top) and PEG-modified (middle) Ad vectors.
Transduced cells expressing enhanced GFP and the location of the portal vein (PV) is
indicated. Saline control mice livers showed no eGFP expression.
56
Figure 2.5: Circulating VPEs in HBV transgenic mice after administration of PEG-
modified and native Ads. Animals received two injections of 5 × 109 infectious Ad
particles, which were administered at commencement of the experiment and 5 weeks after the
initial injection. Titers of VPEs were determined by real-time quantitative PCR. Results are
expressed as the mean (±SEM) from 8 mice. Statistically significant differences (* p<0.05; **
p<0.01) between PEG-modified and unmodified shRNA 6-expressing vectors are indicated and
were determined according to the Student’s 2 tailed paired t-test.
57
PEG s
hRNA 6
HD
PEG s
hRNA 6
MD
PEG s
hRNA 6
LD
PEG s
hRNA 1
0 HD
0
5
10
15
20 * H
BV
su
rface m
RN
A /
eG
FP
mR
NA
(re
lati
ve)
Figure 2.6: Effects of Ad dose on hepatic HBV mRNA. Animals were killed 1 week after
intravenous administration of PEG-modified vectors at doses of 5 × 108 (LD), 1 × 10
9 (MD)
and 5 × 109 (HD), vector particles. Mean ratios of HBV surface mRNA (±SEM) were
measured relative to eGFP mRNA, using Q-PCR. Statistically significant differences (*
p<0.05) between vectors is indicated and were determined according to the Student’s 2 tailed
paired t-test.
58
2.3.3 Serum cytokine concentrations after injection of PEGylated
and unmodified Ad vectors
The improved anti-HBV efficacy of PEGylated vectors is likely to result from an attenuated
immune response to the polymer-coated Ads [180, 218, 219]. Innate and adaptive immune
responses against recombinant Ads are the major contributors to toxicity. The initial response
caused by Ad capsid interaction with macrophages, Kupffer and dendritic cells occurs within
one hour of vector administration and peaks at approximately 6 hours and may persist for 4
days depending on vector dose [203]. This response is characterised by a release of pro-
inflammatory cytokines and chemokines to recruit effector cells resulting in neutrophil-
dependent liver injury. A secondary but self-limiting inflammatory process of the liver occurs
5 to 7 days after vector administration where activated lymphocytes remove Ad infected
cells. The humoral immune response develops after a week and is characterised by the
production of NAbs which target Ad vectors upon re-administration. To assess the effects of
PEGylated and unmodified Ad HBV shRNA 6 on the release of inflammatory cytokines,
serum concentrations of a selection of cytokines and chemokines were determined. Initially,
blood was collected 6 and 24 hr after the first injection of mice with recombinant vectors and
the cytokines were measured by a CBA assay. The panel of cytokines, comprising TNF-,
IL-12, MCP-1, IL-10, IL-6, and IFN-, included markers that give a broad indication of
innate and adaptive immune response activation.
At the time point of 6 hr after injection of the first dose of Ad HBV shRNA 6, MCP-1 was
elevated in mice receiving the unPEGylated vector but not in the serum of animals receiving
PEG-modified recombinant virus (Figure 2.7). By 24 hr after injection, the serum MCP-1
concentration reverted to baseline control levels (data not shown). MCP-1 is produced from a
59
A
B
0 6 24 0 6 240
200
400
600
800
Hours post inj.
UnPEG PEG
p<0.01
ns
MC
P-1
(pg
/ml)
Figure 2.7: Serum cytokine concentrations after first administration of Ads to HBV
transgenic mice. A. Representative flow cytometry data from CBA assay for TNF-γ, IL-12,
MCP-1, IL-10, IL-6, and IFN- at baseline and 6 hrs after adenovirus injection. Elevated
levels of MCP-1 were shown in mice receiving unPEGylated Ad shRNA 6. B. Mean
concentrations of MCP-1 levels are shown in mice at baseline, 6 and 24 hours. Levels
returned to normal 24 hours after administration of PEG-modified and native adenoviral
vectors. Statistically significant differences (p<0.001) between time points is indicated and were
determined according to the Student’s 2 tailed paired t-test.
60
A
B C D E
Figure 2.8: Serum cytokine concentrations after second administration of Ads to HBV
transgenic mice. A. Representative flow cytometry data from CBA assay for TNF-, IL-12,
MCP-1, IL-10, IL-6, and IFN-γ 6 and 24 hr after adenovirus injection. Shown are mean
concentrations (±SEM) of MCP-1 (B), IFN-γ (C), IL-6 (D), and TNF- (E) in mice at
baseline and 6 and 24 hr after administration of PEG-modified and native adenoviral vectors.
Statistically significant differences (*** p<0.005) between PEG-modified and unmodified
shRNA6-expressing vectors are indicated and were determined according to the Student’s 2
tailed paired t-test.
61
variety of cells and functions as a monocyte chemoattractant [223, 224] and mediator of
inflammation [225, 226]. Although other studies have reported stimulation of secretion of
additional proinflammatory cytokines after Ad administration, our observations may be
specific to the line of HBV transgenic mice studied here and also the low dose of Ad that
these animals received.
Serum concentrations of cytokines were again measured in animals that received a second
dose of native and PEG-modified Ad. PEG-modified vectors caused modest elevation of only
MCP-1 at 6 hr, and the concentration of this chemokine reverted to baseline 24 hr after
injection (Figure 2.8). Because a raised serum MCP-1 concentration was also the only marker
of immunostimulation after initial administration of native Ad, secretion of this chemokine
may be the most sensitive indicator of Ad-induced immunostimulation under the
experimental conditions described here. CBA analysis revealed that concentrations of TNF-
, IFN-, MCP-1, and IL-6 were markedly elevated in mice 6 hr after receiving the
unmodified vector. By 24 hr, the concentrations had returned to normal baseline levels. This
observation contrasts with the modest acute elevation in serum MCP-1 concentration after
injection of PEGylated Ads and indicates that this modification diminishes
immunostimulatory properties of the anti-HBV vectors.
2.3.4 Assay of anti-Ad vector immunoglobulin titres and markers
of hepatocyte toxicity
To measure the concentrations of humoral immune response to Ad vectors, enzyme-linked
immunosorbent assays (ELISAs) were performed to detect antibodies interacting with Ad
hexon proteins and also complete Ad particles. Comparison of the relative optical density
(OD) readings indicated that there was a significant difference in immunoglobulin titres in
62
animals 5 weeks after receiving either unmodified and PEGylated vectors (Figure 2.9). Lower
values observed after administration of PEGylated vectors confirm that the humoral immune
response is attenuated and correlates with diminished cytokine release, as well as data
reported by others [180, 218, 219]. Hepatotoxic effects of the Ad administration were
determined by measurement of ALT and AST activities in mouse serum 1 day and 1 week
after receiving a second dose of the PEG-modified or unmodified Ad vectors (Figure 2.10).
Compared with mice receiving the PEGylated Ads, the serum concentrations of both
transaminases were significantly increased at 24 hr in animals receiving unmodified vectors.
Taken together, our data support the interpretation that PEG modification improves anti-HBV
efficacy, attenuates immunostimulatory properties, and improves the safety profile of
recombinant Ad vectors in a stringent model of HBV infection.
2.4 Discussion
Recombinant adenovirus vectors have several properties that make them useful for
therapeutic transfer of anti-HBV sequences [216]. These include efficient infection of non-
dividing cells, hepatocyte targeting after systemic administration in vivo, and transient
transgene expression that is sustained for weeks without integrating into host DNA. However,
immunostimulatory effects of Ads may be toxic and also diminish the efficiency of transgene
expression. In addition to modification with synthetic polymers, as was used here, a number
of approaches has been employed to diminish activation of host immune responses. These
include immunosuppression [227, 228], silencing mediators of hepatocyte injury [229],
serotype switching [162], genetic manipulation of capsid-encoding sequences [191], and use
of high-dose vectors [126]. Although these strategies have had success, there are limitations
63
1 2 1 2 1 2 1 20.00
0.25
0.50
0.75
1.00
1.25
UnPEG PEG
Total anti-Ad Ig Anti-hexon Ig
Injection No.
p<0.05 p<0.005
UnPEG PEG
Re
lati
ve
OD
49
0n
m (
no
rma
lis
ed
)
Figure 2.9: Relative serum anti-Ad immunoglobulin concentrations after vector
administration to mice. Total anti-Ad and anti-hexon protein-specific antibodies were
measured by ELISA. Mean relative optical density readings (±SEM) are given. Statistically
significant differences are indicated and were determined according to the Student’s 2 tailed
paired t-test.
64
UnP
EG, 2
4hr
UnP
EG, 1
wk
PEG, 2
4hr
PEG, 1
wk
UnP
EG, 2
4hr
UnP
EG,1
wk
PEG, 2
4hr
PEG, 1
wk
0
100
200
300
400
500
600
p<0.001 p<0.001
ALT AST
IU/l
Figure 2.10: Serum transaminase activities after vector administration to mice.
Transaminase (ALT and AST) activities were measured 24 hrs and 1 week after the second
injection of PEGylated or unmodified adenoviral vectors. Mean (±SEM) enzyme activities
are shown. Statistically significant differences are indicated and were determined according to
the Student’s 2 tailed paired t-test.
65
to their general applicability. For example, immunosuppression has side effects that would
not be desirable in a clinical setting of HBV treatment. Importantly, Ad immunostimulation is
largely mediated by viral capsid proteins, and is not dependent on viral gene expression or
transduction [149]. Modification of viral capsid proteins with PEG is therefore an attractive
method to control Ad immunostimulatory properties. PEG has been widely used in various
therapeutic applications and has well-characterised pharmacologic properties. The polymer
has low immunogenicity, is nontoxic, and improves the water solubility of PEG complexes
(reviewed in [177]). In addition, PEG has other advantageous properties such as simultaneous
modification of many surface proteins without the need for genetic manipulation,
improvement of vector stability, and diminishment of nonspecific interactions. PEGylation of
Ads can be carried out under mild reaction conditions to preserve vector bioactivity. The
modification employed in this study entailed use of the covalent attachment of PEG to the Ad
surface. This occurs when monomethoxypolyethylene glycol activated by succinimidyl
propionate (MPEG-SPA), reacts preferentially with the ε-amino terminal of lysine residues,
the most abundant functional group on the Ad hexon, fiber, and penton proteins [188].
Although we were able to demonstrate decreased immunostimmulation with our PEGylated
vectors the attachment of mPEG-SPA moieties is random, which may lead to a heterogenous
sample of PEGylated Ad [203].
There has recently been a shift to use second generation PEG derivatives which have been
developed to preferentially bind thiol groups on cysteine residues. The immunostimulatory
hexon protein on the Ad capsid (720 monomers per virion) has hypervariable regions (HVRs)
protruding from the capsid which are the main target of NAbs and Kupffer cell receptors
[230]. It is thought that the scavenger receptors of the Kupffer cells interact with the HVRs
thus making it an ideal site for PEG modification [145]. The genetic modification of this
66
HVR by the introduction of a single point-mutation converts an alanine residue into a
cysteine residue which is then efficiently targeted by maleimide PEG in a site specific
manner [173, 190]. This site directed PEGylation results in improved stability of the modified
Ad and more reproducible experimental results.
The bolus of 5 × 109
Ad infectious particles administered systemically to mice in this study
represents a low dose compared with that used in other studies. Ad activation of dendritic
cells and macrophages with resultant release of IL-6 and IL-12 was observed in mice treated
with 0.3–5 × 1011
particles per animal [144]. In primates, intraportal administration of up to 5
× 1012
particles/kg led to a self-limiting hepatitis, but higher doses caused massive hepatic
necrosis and coagulopathy within days of vector administration [149]. This dose-dependent
effect has also been reported on re-administration of Ad vectors [231]. The significantly
lower dose that was used in this study (approximately 2 × 1010
particles/kg) is likely to
contribute to our observation of attenuated immunostimulation and improved safety.
However, it appears that efficacy of RNAi-activating Ads is dose dependent, as
administration of lower amounts of Ads did not cause significant HBV gene silencing.
Although complete silencing of HBV replication was not observed in this study, a higher Ad
dose may well silence HBV replication more effectively. However, higher doses have lethal
toxic effects (data not shown), which are likely to result from Ad immunostimulation and
saturation of the endogenous miR pathway [232]. The low dose of vector that was required to
be effective as well as the favourable effects of PEG modification of Ad vectors are
important means of improving the safety profile of RNAi-activating recombinant Ads for
potential therapeutic application. The therapeutic effects of our RNAi effectors targeting
HBV are likely to be further enhanced by the use of HD Ads as they have more sustained
transgene expression and are less immunogenic.
67
3 SUSTAINED HEPATITIS B VIRUS INHIBITION IN
VIVO USING HELPER-DEPENDENT ADENOVIRUS
VECTORS TO DELIVER ANTIVIRAL RNA
INTERFERENCE EXPRESSION CASSETTES
3.1 Introduction
Safe and efficient introduction of RNAi activators into target hepatocytes to achieve
sustained inhibition of HBV replication is important before therapeutic application of gene
silencing technology is realised. Recombinant Ads have valuable properties as vectors for
HBV-silencing (reviewed in [233]). We and others previously demonstrated that FG Ads that
express HBV-silencing sequences were successful in inhibiting viral replication in HBV
transgenic mice [56, 204, 234]. Nevertheless, the transient nature of the silencing and
potentially toxic immunostimulation, are problematic. Modification of anti-HBV FG Ads
with PEG improved their efficacy by diminishing immunostimulation, toxicity and
augmenting target silencing after repeat administration [234]. Use of HD Ads, which have all
of the Ad protein coding sequences removed from the vectors, may present an added
advantage for the delivery of HBV-silencing expression cassettes. Attenuated adaptive
immunity improves long term expression of transgenes delivered with these vectors.
However, induction of the innate immune response which does not depend on viral gene
expression and is caused by Ad particles in a dose-dependent manner [133, 149, 235, 236],
68
may occur following administration of HD Ads. The one study to date that reported on use of
HD Ads against HBV demonstrated modest silencing [209]. Poor antiviral action of the
RNAi expression cassettes may be the reason for the inadequate anti-HBV efficacy. To
investigate the utility of HD Ads more comprehensively, we generated recombinant HD Ads
that express a Pol III U6 anti-HBV cassette that has previously been shown to be highly
effective against HBV [56]. Testing was carried out using HBV transgenic mice [221], which
stringently simulate the human condition of chronic HBV infection. Our results show that
anti-HBV U6 shRNA expression cassettes, delivered with native or PEGylated vectors, are
processed according to intended design and safely suppress HBV replication.
3.2 Methods and materials
3.2.1 First generation adenoviral vectors
Preparation of the FG Ad HBV shRNA 6 vector expressing anti-HBV sequences from a U6
Pol III promoter [56] and the eGFP reporter from a cytomegalovirus immediate early
promoter/enhancer (CMV) were previously propagated in our laboratory according to the
AdEasy system from Stratagene as described in Section 2.2.1 [220].
3.2.2 Helper-dependent adenoviral vectors
Vectors used for experimentation were HD Ad 28, which lacked an RNAi expression
construct, HD Ad HBV shRNA 6 and HD Ad HBV shRNA 10 (control, ineffective at HBV
knockdown). To generate shuttle plasmids required to form anti-HBV HD Ads, U6 shRNA 6
and U6 shRNA 10 cassettes were initially excised from pG-U6 shRNA 6 and pG-U6 shRNA
69
10 [56] using AscI and MluI restriction enzymes. Thereafter, the fragments were inserted into
the AscI site of a cytomegalovirus (CMV) promoter driven plasmid, p28E4LacZ
(Appendix A1-3) [131] to generate pHD Ad HBV shRNA 6 and pHD Ad HBV shRNA 10.
HD Ad genomic DNA template required to initiate recombinant virus propagation was
prepared and then amplified using published protocols [131] . Briefly, the plasmid form of
the HD Ad was digested with PmeI restriction endonuclease to release the HD Ad genome. A
HEK 293 producer cell line (116 cells) that expresses bacteriophage P1 site specific Cre
recombinase was propagated as detailed in Appendix A1-1. The producer cells were
transfected with the HD Ad together the helper virus AdNG163. The helper virus has a
packaging signal (Ψ) flanked by loxP sites which is excised in the presence of Cre
recombinase rendering it unpackageable but still able to replicate and provide the necessary
viral proteins in trans for the successful packaging of HD Ads. The HD Ads were amplified
by performing serial coinfections of 116 cells until a maximum HD Ad titre was obtained.
The lysate from the passage having the highest titre was then added to a 150 mm dish of 116
cells and 48 hours later these cells were harvested and used for large-scale production of the
HD Ad vector. The mass produced HD Ad vectors were purified from the cell lysate using
CsCl gradient centrifugation and dialysis and then stored in a potassium buffer (KPBS) (10
mM K2PO4; 150 mM NaCl; 1 mM MgCl2; pH 7.8) supplemented with 5% sucrose.
3.2.3 Titration of adenoviral vectors
Infectious viral particle titre of the FG Ad vector was determined using a method based on
the Adeno-X rapid titer kit (Clontech, Mountain View, CA) as detailed in Section 2.2.3. As
HD Ads have a LacZ expression cassette it was possible to determine infectious titre by
performing staining for -galactosidase (X-gal) on titrated virus. HEK 293 cells were plated
70
at 5 × 105 cells/ml with 0.5 ml per well in a 24-well plate. The HD Ad was serial diluted (10
-2
10-3
, 10-4
, 10-5
, 10-6
dilutions) and l of diluent was added to triplicate wells at the time of
plating. The cells were incubated at 37 ºC, 5% CO2 for 48 hours after which the medium was
aspirated from the cells and the plate was allowed to air dry for 5 minutes. The cells were
fixed to the plate by gently adding 500 l fixative (1% formaldehyde; 0.5% glutaraldehyde in
PBS) to each well and incubated at room temperature for 5 minutes. The fixative was
removed and fixed cells washed twice with PBS. The staining solution (4 mM potassium
ferricyanide; 4 mM potassium ferrocyanide; 2 mM MgCl2; 0.4 mg/ml X-gal) was added to the
wells and incubated at 37 ºC overnight. The stain was then washed off with dH2O and the
cells observed under a microscope. The X-gal positive cells stained blue and were counted
using a light microscope and the ifu/ml calculated using the formula detailed in Section 2.2.3.
3.2.4 Physical titre
The physical titre is the concentration of viral particles in a vector preparation and was
calculated by measuring absorbance at 260 nm (OD260) following lysis of the virions, and
correcting for vector genome size. Virion lysis buffer (TE; 0.1% SDS) was added to an
aliquot of purified vector to a total volume of 100 l. A blank sample was prepared by adding
the same volume of lysis buffer to the buffer. The samples were vortexed briefly and
incubated at 56 ºC for 10 minutes. Samples were vortexed vigorously for 1 minute before
measuring absorbance on a Nanodrop® ND-1000 (Thermo Fisher Scientific, USA). The
physical titre was calculated from absorbance reading at 260 nm (OD260), where vp/ml =
(OD260) (dilution factor) (1.1 × 1012
) (36/size of vector in kb).
71
3.2.5 Quantitative PCR to determine helper virus contamination
Quantitative PCR was used to determine the level of HV contamination in the HD Ad
preparations. Absolute quantitation of HD Ad and HV levels was necessary so standards were
generated for both Ad types. Using conventional PCR, HV sequences were amplified using
primer set: AdNg163 forward 5′ - TGGGCGTGGTGCCTAAAA - 3′ and AdNg163 reverse:
5′ - GCCTGCCCCTGGCAAT- 3′; and HD Ad sequences were amplified with primer set:
pΔ28LacZ forward: 5′ - GAAAAAACACACTGGCTTGAAACA - 3′ and pΔ28LacZ
reverse: 5′ - TGCCACCTCGTATTTCACCTCTA - 3′. The PCR amplicons were run on a 2%
agarose gel, excised, gel purified and ligated into the TA cloning vector pTZ57R/T
(Fermentas, USA). The plasmids were prepared using the High Pure Plasmid Isolation kit
(Roche, GmbH, Germany) according to manufacturer’s instructions and subjected to
restriction enzyme digestion with PvuII to screen for correct sized inserts. Plasmids
containing the correct sequence were prepared in bulk using the Plasmid Midi Kit (Qiagen,
GmbH, Germany) and a serial dilution of the linearised plasmid DNA was used to generate a
standard curve (Appendix A1-5 and A1-6).
Viral DNA was isolated from 50 l of Ad vector preparations using the QIAamp DNA Mini
Kit (Qiagen, GmbH, Germany) according to manufacturer’s protocol. Sensimix capillary kit
SYBR® green (Bioline, London, UK) was used to perform Q-PCR on 5 l of viral DNA
using the relevant primer set. Dilutions of known copy number of the previously generated
standards were also included in the run which was done using the following cycling
parameters: a hotstart at 95 ºC for 10 minutes and 50 cycles of annealing at 59
ºC for 10
seconds, extension at 72 ºC for 10 seconds and denaturation at 95 ºC for 10 seconds on the
Roche Lightcycler v.2. Absolute copy numbers of HD Ad and HV were calculated and the
72
relative ratio of contaminating HV within a sample was determined. A representative result is
shown in (Appendix A1-5 and A1-6).
3.2.6 PEGylation of helper dependent adenoviral vectors
Helper dependent Ad vectors were PEGylated according to a previously published protocol
(Mok et al, 2005). The HD Ad was re-suspended in 0.1 mM KPBS (pH 8.2) following
dialysis to remove TRIS contained in the buffers used to produce the HD Ads.
Approximately 1 × 1012
Ad particles were incubated with 1 ml mPEG-SPA 5000 at a
concentration of 2 mg/ml for 1 hour at room temperature with constant mixing. Ten fold
excess L-Lysine, Free Base, Monohydrate (Calbiochem, CA, USA) was then added to quench
the reaction, for one hour at room temperature with constant mixing. The PEGylated HD Ad
sample was transferred to a Slide-A-Lyzer dialysis cassette (Pierce, Thermo Fisher Scientific,
IL, USA) and dialysed overnight in 0.1 mM KPBS (pH 8.2) to remove unreacted mPEG-SPA
5000. The PEG-conjugated HD Ad was then concentrated to the original volume by placing the
Slide-A-Lyzer containing the PEGylated HD Ad on solid 20 000 Da PEG (PEG 20 000) for
approx- imately two hours. When the desired volume was reached the Ad PEGylated virus
was removed from the dialysis cassette, sucrose was added to a final concentration of 0.5 M
and then aliquoted and stored at -80 ºC. Microchip electrophoresis as previously described in
Section 2.2.2, was used to show that polymer modification of PEG HD Ad HBV shRNA 6
occurred on approximately 40% of vector hexon proteins.
73
3.2.7 Quantitative PCR to detect HD Ad genomes in liver
To determine intrahepatic HD Ad 28 genome copy numbers, freshly resected liver sections
were homogenized with equal volumes of saline. DNA was extracted from 200 l of the
homogenate using the QIAMP Mini extraction kit (Qiagen, GmbH, Germany) according to
the manufacturer’s instructions. SYBR green-based quantitative PCR was performed as
detailed in section 3.2.5 using 50 ng of DNA and HDAd28 specific primers on the Roche
Lightcycler v.2. Absolute copy numbers of HDAd28 were calculated from the standard
curve generated in Section 3.2.5.
3.2.8 Cell culture and northern blot analysis
Culture, transfection and infection of Huh7 and HEK 293 lines were carried out as has been
described in Section 2.2.4.
3.2.9 Adenoviral vector administration and measurement of HBV
silencing
HBV transgenic mice [221] were used as a model to determine the effects of RNAi-activating
Ads on markers of HBV replication in vivo. These experiments were carried out in
accordance with protocols approved by the University of the Witwatersrand Animal Ethics
Screening Committee. A dose of 5 × 109 infectious Ad particles was injected as a bolus via
the tail vein and groups of mice comprised 8 animals each. Circulating VPEs were measured
using Q-PCR as detailed in Section 2.2.6.
74
Mouse serum HBsAg levels were quantified using the MONOLISA® HBs Ag Assay kit
(Bio-Rad, CA, USA). The mouse serum was diluted 20-fold with saline and 100 l of diluent
was added per well of an ELISA plate coated with mouse monoclonal anti-HBs antibodies.
Conjugate solution which contains monoclonal and polyclonal anti-HBV antibodies bound to
peroxidase, was added to each well (50 l) in the plate, the plate was sealed and then
incubated at 37 ºC for 90 minutes. Unbound antibodies were then removed by performing
five washes with Washing Solution (Tris NaCl buffer, pH 7.4; 0.004% ProClin™ 300).
Development Solution containing the chromagenic substrate tetramethylbenzidine (TMB)
was added to each well (100 l) and the plate was incubated in the dark at room temperature
for 30 minutes. The enzymatic reaction was stopped by adding 100 l of Stopping Solution
(1 N H2SO4) to each well and the optical density of the samples was measured at 420/690 nm
on a Bio-Rad Microplate Reader, Model 680 (Bio-Rad, CA, USA).
Similarly HBcAg was detected in formalin fixed paraffin-embedded liver sections according
to previously described standard immunohistochemical techniques [56]. Briefly, sections
were rehydrated by the following series of washes: two xylene washes of 5 minutes each,
followed by two 100% ethanol washes (5 minutes each), followed by 95% ethanol, 70%
ethanol, 50% ethanol, 30% ethanol and finally dH2O washes (5 minutes each). Endogenous
peroxidase activity was quenched by incubating the sections in 0.3% hydrogen peroxide
(H2O2) for 30 minutes. The sections were then washed in PBS for 20 minutes and then
processed further using the Ultra-Sensitive ABC Peroxidase Staining Kit (Pierce, Thermo
Scientific, IL, USA). All incubations were performed flat with the sections covered by a glass
coverslip. Three drops of diluted protein Blocker Buffer were added onto the sections and
covered with glass coverslips and incubated for 20 minutes at room temperature. The glass
coverslips were carefully removed and the sections washed once with PBS and the cells were
75
then permeabilised by adding 200 l of PBS + 0.5% BSA + 0.25% Triton-X onto each
section and incubated at room temperature for 10 minutes. The sections were then washed
with PBS before applying rabbit polyclonal Ab against HBcAg (Signet Laboratories Inc.,
MA, USA) (diluted 1/1000 in Blocking Buffer) which was incubated with the sections at
room temperature for 1 hour. The primary Ab was aspirated and the sections washed once
with PBS. The buffer was removed and 3 drops of Biotinylated Secondary Antibody was
added to each section and incubated for 30 minutes at room temperature. The secondary Ab
was aspirated and the sections washed, before adding 3 drops of ABC Reagent (biotinylated
horseradish peroxidise (HRP) complexed with avidin) per section which was incubated for 30
minutes at room temperature. The sections were then washed with PBS followed by a dH2O
wash before staining tissue sections with DAB substrate at room temperature until suitable
staining developed (2-5 minutes). The sections were rinsed with water, counterstained with
haematoxylin, rinsed in water and finally dehydrated by using two rinses of 100% ethanol
followed by 2 rinses of xylene before mounting coverslips using Permount (Thermo Fisher
Scientific, USA).
3.2.10 β-Galactosidase staining of liver sections
To determine efficiency of HD Ad delivery to hepatocytes, livers were harvested from
separate groups of animals 7 days after Ad administration and frozen tissue sections were
stained for -galactosidase activity. The frozen sections were fixed to the glass slides by
incubating them in fixative (1% formaldehyde; 0.5% glutaraldehyde in PBS) at room
temperature for 5 minutes. The fixative was removed and fixed sections washed twice with
PBS at room temperature for 5 minutes each. The sections were then incubated in the staining
solution (4 mM potassium ferricyanide; 4 mM potassium ferrocyanide; 2 mM MgCl2; 0.4
76
mg/ml X-gal) at 37 ºC overnight. The stain was washed off with dH20 and the sections
analysed using a light microscope.
3.2.11 In vivo shRNA processing
To detect processed anti-HBV sequences, total hepatic RNA was extracted using Tri
Reagent® at day 7 after Ad administration. Thereafter, 25 g RNA was resolved on a 15%
denaturing polyacrylamide gel. The gel was stained in 0.5× Tris-Borate EDTA (TBE)
containing ethidium bromide at a final concentration of 4 g/ml for 5 minutes and visualised
on a UV transilluminator to confirm equal loading and RNA integrity. Decade RNA
molecular weight markers (Ambion, TX, USA) were labelled and run alongside the cellular
RNA. The RNA was then transferred and blotted onto positively charged nylon membranes
(Hybond-N+, Amersham, NJ, USA). Electroblotting was done at 3.3 mA/cm2 for an hour at 4
ºC in 0.5× TBE using the Semi-Dry Electroblotting Unit Z34.050-2 (Sigma-Aldrich, MO,
USA). RNA was immobilised on the nylon membrane by UV crosslinking at 200 000 µJ/cm2
of energy using a crosslinker (UVP Inc., CA, USA).
The membranes were prehybridised in Rapid-Hyb (Amersham, NJ, USA) at 42 ºC for 15
minutes. Probes specific to shRNA 6 and shRNA 10 guide sequences were labelled at their 5′
ends with 20 μCi of [γ-32
P] ATP and T4 polynucleotide kinase (Fermenras, MD, USA) and
the probes were purified using standard protocols. The relevant probe was hybridised at a
final concentration of 10 ng/ml overnight at 42 ºC and then subjected to a low stringency
wash with 5× SSC, 0.1% SDS at room temperature. This was followed by 2 high stringency
washes with 1× SSC, 0.1% SDS solution at 42 ºC. The probed membrane was exposed to X-
77
ray film and then stripped and reprobed with 32
P labeled oligonucleotide to detect U6 small
nuclear RNA which was used as a control to verify equal loading of the cellular RNA. The
probe oligonucleotide sequences were as follows: probe shRNA 6: 5′- TGC ACT TCG CTT
CAC CTC - 3′; probe sh10: 5′- GTT CAA GCC TCC AAG CTG - 3′and U6 small nuclear
RNA probe: 5′- TAG TAT ATG TGC TGC CGA AGC GAG - 3′.
3.2.12 Cytometric bead array assay
To measure murine TNF-, IL-6, IL-12p70, MCP-1, IL-10, and IFN- the CBA Mouse
Inflammation Kit (BD Biosciences, CA, USA) was employed as detailed in Section 2.2.9.
3.2.13 Serum transaminase assay
Serum enzyme activities of AST and ALT activities were measured using a kinetic assay with
an automated photometric analyzer (Roche Diagnostics, Rotkreuz, Switzerland) and were
carried out by the South African National Health Laboratory Services.
3.2.14 Statistical Analysis
Data are expressed as the mean ± SEM. Statistical differences were considered significant
when P<0.05 and were determined according to the Mann Whitney or Student 2 tailed t-tests.
Calculations were performed with the GraphPad Prism software package (GraphPad Software
Inc., CA, USA).
78
3.3 Results
3.3.1 Structure of HD Ads containing anti-HBV RNAi expression
cassettes
Previously described HBV targets of expressed RNAi activators were used in this study as
detailed in Section 2.3.1. Expression cassettes were incorporated into the HD Ads according
to the schematic illustrations shown in Figure 3.1. All vectors, including the HD Ad 28
control, contained ITRs, packaging sequence (Ψ) and a LacZ expression cassette. Inclusion of
the -galactosidase reporter was useful for convenient tracking of cells infected with the
vectors. In our hands, after CsCl gradient purification, helper virus contamination was
routinely less than 0.1%. Expression cassettes comprised a typical arrangement with U6 Pol
III promoter, downstream shRNA-encoding DNA and transcription termination signal. To
verify that the HD Ad-delivered HBV shRNA6 expression cassette was capable of repro-
gramming the RNAi pathway according to intended design, Huh7 cells were infected with the
recombinant viruses. Extracted RNA was subjected to Northern blot hybridisation using a
probe that was complementary to the anticipated anti-HBV guide (Figure 3.2). Results show
presence of a band of approximately 21 nt in length, which is also the size of a mature guide,
and confirms that shRNAs expressed from HD Ads are processed by the RNAi pathway in
cultured liver-derived cells.
79
A
B
Figure 3.1: Schematic illustration of anti-HBV Ad vectors. A. HD Ad Δ28 contains the
CMV LacZ-expressing reporter cassette, but no HBV-targeting cassettes. Apart from ITRs
and viral packaging signal (Ψ) the remainder of the vector DNA comprises stuffer sequence
with all Ad ORFs removed. B. Anti HBV HD Ad shRNA 6 and HD Ad shRNA 10 contain
active and inactive Pol III U6 shRNA sequences respectively, as well as the CMV LacZ-
expressing reporter.
80
3.3.2 HD Ad-mediated inhibition of markers of HBV replication
in vivo
To assess efficiency of liver cell transduction by HD Ads, HBV transgenic mice were treated
by intravenous administration of a single bolus dose of 5 × 109 infectious vector particles.
Approximately 80-95% of hepatocytes were positive for -galactosidase activity (HD Ads) or
eGFP expression (FG Ads) when livers were subjected to analysis at day 7 (Figure 3.3). To
measure efficacy of HD Ad HBV shRNA6 and PEG HD Ad HBV shRNA6, groups of HBV
transgenic mice received 5 × 109 infectious vector particles. Control groups were either
injected with FG Ad HBV shRNA 6, Ads lacking antiviral sequences (HD Ad 28) or
containing the ineffective U6 Pol III HBV shRNA 10 expression cassette [56]. Blood samples
were collected at regular time intervals to measure serum HBsAg (Figure 3.4) and circulating
VPEs (Figure 3.5). We and others have reported that these measurements correlate with other
markers of HBV replication, such as the intrahepatic concentrations of the viral nucleic acid
[56, 204, 234]. Ad vectors that incorporated HBV shRNA 6 expression cassettes (FG Ad
HBV shRNA 6, HD Ad HBV shRNA 6 and PEG HD Ad HBV shRNA 6) achieved
suppression of HBsAg concentrations (Figure 3.4). The concentration of circulating Hepatitis
B VPEs followed a similar trend after mice received the HD Ad HBV shRNA 6 vector
(Figure 3.5). Effects on markers of HBV replication were initially observed at 1 week after
vector injection when knockdown efficiency of approximately 95% was observed. This
markedly decreased HBsAg concentration was sustained for a period of 5 weeks after which
the concentration of HBsAg gradually increased to reach a level at 12 weeks that was not
statistically significant from the baseline. Results from measurement of serum markers of
HBV replication were corroborated by immunohistochemical detection of HBV core antigen
(HBcAg) in liver sections of mice that had been treated with the Ad vectors (Figure 3.6.A).
81
Figure 3.2: Processing of anti-HBV shRNA in infected cultured hepatic cells. RNA
extracted from HD Ad-transduced liver-derived Huh7 cells was subjected to Northern blot
hybridisation using a probe that was complementary to the intended shRNA 6-derived guide
strand. DNA oligonucleotides were used as markers to determine approximate molecular
weights of guide strands. Prior to blotting, the gel was stained with ethidium bromide to confirm
equal loading of the lanes.
82
HD Ad HBV shRNA 6 Saline
FG Ad HBV shRNA 6
Figure 3.3: HD Ad transduction efficiency in mice. β-galactosidase (positively stained
blue cells in the top panel) and eGFP (positively stained green cells in the bottom panel)
reporter gene expression was detected in frozen sections of livers 7 days after vector
administration.
83
Figure 3.4: Effects of intravenously administered first generation and HD Ads on
circulating HBV surface antigen levels in HBV transgenic mice. Animals received a
single administration of
infectious Ad particles at commencement of the experiment. Control
animals were either injected with FG Ad shRNA 6, backbone HD Ads lacking RNAi
expression cassettes or a previously described ineffective anti-HBV sequence (shRNA 10).
Titres of HBsAg were determined using ELISA. Results are expressed as the mean (±SEM)
from 8 mice. Statistically significant differences (* p<0.05) between shRNA 6-expressing
vectors and controls are indicated and were determined according to the Student’s 2 tailed paired
t-test.
84
Figure 3.5: Effects of intravenous administration of FG Ad and HD Ads on circulating
HBV VPEs. Following administration of Ads, titres of VPEs at the indicated time points
were measured using Q-PCR. Representative results are expressed as the mean (±SEM) from 8
mice. Statistically significant differences (* p<0.05) between shRNA 6 expressing vectors are
indicated and were determined according to the Student’s 2 tailed paired t-test.
85
Representative stained low power fields from sections prepared from animals that had been
injected with the Ad vectors one week previously showed that HBcAg was barely detectable
in animals that received HD Ad HBV shRNA 6. However, cells staining positive for HBcAg
were abundant in mice that received the HD Ad HBV shRNA 10 control vector.
To assess concentrations of HD Ad genome equivalents in the livers of mice during the time
course of the experiments, Q-PCR was carried out on DNA extracts from livers at various
time points after the vector injection. The results show that for mice treated with either the
control (HD Ad 28) or HD Ad HBV shRNA6 vectors, concentrations of HD Ad genome
equivalents in the livers rapidly decreased at time points beyond 1 week after injection
(Figure 3.6.B). These data suggest that immunostimulatory effects of the LacZ reporter gene
[237] may account for the elimination of the Ad genomes. In accordance with this, others
have reported more sustained transgene expression following HD Ad-mediated delivery with
vectors lacking a reporter gene [185, 238]. Thus, although presence of the reporter gene is
convenient for tracking infection of hepatocytes in vivo, durability of the silencing effect may
be diminished by presence of the LacZ cassette and further studies need to be done to clarify
this issue.
Northern blot hybridisation analysis of RNA, which had been extracted from mouse livers
seven days after injection, was performed to assess processing of anti-HBV shRNAs in vivo
(Figure 3.7). Hybridisation was carried out using radiolabeled probes complementary to
HBV-targeting U6 shRNA 6- or U6 shRNA 10- derived mature guides. The expected 21 nt
fragment was detectable in the livers of animals that had been infected with HD Ad HBV
shRNA 6, PEG HD Ad HBV shRNA 6 and FG Ad HBV shRNA 6 (Figure 3.7, left panel).
86
A
B
Figure 3.6: Anti-HBV efficacy of first generation and HD Ads. A. Representative low
power fields of liver sections following immunohistochemical staining for HBcAg. B.
Quantitative-PCR was carried out on DNA extracted from livers of mice that had been
sacrificed at the indicated time points after vector administration. Hepatic concentrations of
Ad genome equivalents per ng of liver DNA are indicated.
87
There was no evidence of incompletely processed higher molecular weight shRNA
intermediates. Also, absence of a signal in the lanes loaded with RNA extracted from HD Ad
HBV shRNA 10 and HD Ad 28 LacZ indicated that the band was specific to livers
transduced with U6 shRNA 6 cassettes. Similar analysis carried out with a probe
complementary to the shRNA 10-derived guide revealed a low concentration of the 21 nt
fragment (Figure 3.7, right panel). Some higher molecular weight bands were also detectable,
which are likely to represent incompletely processed shRNA10 sequences. HBV silencing
that is achievable with shRNA6-containing Ads correlates with the efficient processing of
this cassette in vivo. In contrast, the poor maturation of shRNA 10 reflects poor functional
efficacy of HD Ad HBV shRNA 10.
3.3.3 Hepatotoxicity and cytokine secretion following intravenous
injection of HD Ad HBV shRNA 6
As a general indicator of toxicity, HBV transgenic mice receiving HD Ad HBV shRNA 6 and
saline as a control were weighed regularly during the time course of the investigation. All
mice tolerated administration of the vectors well. There were no observable adverse effects,
and animals receiving the Ads gradually gained weight in a manner that was similar to that of
the control mice receiving saline (Figure 3.8 A). Activity of ALT, a more sensitive indicator
of Ad-mediated hepatotoxicity, was measured 48 hours after vector administration (Figure
3.8 B). The results showed that ALT activity was significantly higher in animals that had
received the FG Ad shRNA 6 vector when compared to the mice receiving the HD Ad panel
of vectors or saline.
88
Figure 3.7: Northern blot hybridization analysis of RNA extracted from mice livers that
had been injected with indicated Ad vectors 7 days previously. The probe used for the
blot shown on the left panel was complementary to the predicted guide sequence derived
from the shRNA 6 antiviral sequence, and that on the right for the shRNA 10 sequence. Equal
loading of the lanes was verified by stripping and reprobing the blot with a labeled
oligonucleotide complementary to U6 small nuclear RNA.
89
A
B
Figure 3.8: Weight of mice and markers of hepatic inflammation following Ad
administration. A. Average mass (±SEM) of groups of mice receiving HD Ad HBV shRNA
6 or saline during the period of the experimental investigation. B. Serum activities of ALT
were measured 2 days following injection with saline, indicated HD Ads or FG Ad
preparations. Mean values are represented together with ±SEM.
90
Since activation of the innate immune response is primarily responsible for Ad-mediated
toxicity (reviewed in [163, 233, 239] ), we set out to measure markers of innate immune-
stimulation following HD Ad administration. Innate immunostimulation is triggered by both
infectious and non-infectious Ad capsids particles, and there is no requirement for transgene
expression [149, 155]. Ideally Ad vector preparations compared in a study should have an
equal number of infectious particles and total viral particles which is technically very
challenging. Theoretically, preparations of Ads that are enriched with intact gene transducing
infectious particles should achieve the intended therapeutic effect with less
immunostimulation than formulations containing the same number of infectious particles, but
a higher number of viral particles. To assess this and determine the safety of the anti-HBV
HD Ads described here, release of proinflammatory cytokines triggered by similar numbers
of anti-HBV Ad infectious particles but different titers of total Ad particles were compared.
Innate immunostimulatory effects of the HD Ad shRNA 6 injections containing 5 × 109
infectious and 8.44 × 1010
total particles, were compared to immunostimulation by FG Ad
shRNA 6 preparations containing 5 × 109 infectious and 6.23 × 10
11 total particles.
Importantly, the dose of infectious particles was the same as that used to inhibit viral
replication and express anti-HBV sequences in the transgenic model (Figures 3.4 to 3.6).
Serum concentrations of a selection of cytokines and chemokines were determined at baseline
and at time points of 6 hours and 48 hours after vector administration. The panel of cytokines,
comprising TNF-, IL-6, IL-12p70, MCP-1, IL-10, IFN-were measured using a CBA assay
(Figures 3.9 and 3.10). Six hours after injection of the FG Ad preparation containing an
excess of total Ad particles, IFN-, IL-12p70, IL-6 and MCP-1 were significantly elevated.
Administration of the HD Ad vector preparations resulted in attenuated release of IFN-, IL-
12p70, IL-6 and MCP-1. By 48 hours after injection, serum IFN-, IL-12p70, IL-6 and
91
Figure 3.9: Effects of HD Ads on serum cytokine concentrations following vector
administration to HBV transgenic mice. Mean concentrations of TNF-, IL-12, MCP-1,
IL-10, IL-6 and IFN-γ in groups of mice at baseline (time 0), 6 and 48 hours following
administration of unmodified HD Ads. FG Ad preparations, which contained similar numbers
of infectious particles (5 × 109) but an approximately ten-fold excess of viral particles, were
used as a positive control to induce an innate immune response. Results are expressed as the
mean (±SEM) from 8 mice. Statistical significance was determined according to the Mann
Whitney paired t-test.
92
Figure 3.10: Flow cytometry plots showing effects of Ads on serum cytokine
concentrations following vector administration to HBV transgenic mice. Representative
data from CBA assay of TNF-, IL-12p70, MCP-1, IL-10, IL-6 and IFN- concentrations
following HD Ad and FG Ad injections.
93
MCP-1 concentrations reverted to baseline control levels in animals receiving the FG vectors.
Results from analysis of PEG HD Ad HBV shRNA 6 were similar to those of the unmodified
vector (not shown). The cytokines that were elevated following FG Ad administration
contribute to innate immune response activation that potentially results in toxicity caused by
Ads (reviewed in [239]), and this corresponds to the release of transaminase markers of
hepatotoxicity (Figure 3.8 B). Although our observations may reflect specific characteristics
of the HBV transgenic mice studied here, and other analyses have demonstrated Ad-mediated
activation of additional proinflammatory cytokines [92, 240, 241], the data support the notion
that administration of a dose of total HD Ad particles containing sufficient infectious
particles to exert a therapeutic effect, but with a lower concentration of total Ad particles,
results in an attenuated effect on innate stimulation.
3.4. Discussion
Currently available treatment for HBV infection is capable of suppressing viral replication in
chronic carriers, but rarely eliminates the virus completely [25]. A requirement for sustained
inhibition of HBV replication poses significant challenges and alternative more effective
methods of countering the virus remain a priority. Demonstration that HBV replication is
susceptible to silencing by reprogramming the RNAi pathway (reviewed in [45, 101, 242-
244] has prompted exploration of the use of exogenous anti-HBV RNAi activators for
therapeutic effect. Both expressed and synthetic RNAi activators have been used successfully
to inhibit HBV replication. Although synthetic siRNAs have advantages of easier dose
control, these RNAi effectors have a requirement for repeated administration to achieve
sustained silencing. This is potentially problematic for the treatment of the chronic infection
caused by HBV. When transcribed from a DNA template, expressed RNAi activators are
94
generated in a manner that may be longer lasting and better suited to inhibition of pathology-
causing genes of chronic diseases. Nevertheless, achieving efficient and safe delivery of
expression cassettes remains challenging. In this study, we have explored the utility of HD
Ads for delivery of an anti-HBV Pol III expression cassette that efficiently silences viral
replication in a stringent murine model of the human condition. The efficient hepatotropism
of these vectors is useful for delivery of HBV silencers to the liver. After infection of liver-
derived cells, the shRNA was expressed and processed according to the intended design.
Transgene delivery to liver cells in vivo by HD Ads was highly efficient, and markers of
HBV replication were safely silenced. Although silencing of HBV replication was sustained
for a period of eight weeks, more durable expression has been achieved when using HD Ads
to deliver a transgene to hepatic tissue in vivo [184, 185, 245]. Elimination of the vector
genome sequences mediated by an immune response to the -galactosidase reporter may have
contributed to shortening the period of expression of antiviral sequences in this study. Utility
of liver specific anti-HBV expression cassettes in HD Ads that lack reporter cassettes are
therefore currently being investigated.
A previous study, also aiming to assess inhibition of HBV replication using U6 Pol III RNAi-
activating expression cassettes in HD Ads, reported unimpressive silencing of HBV
replication [209]. A reason for the inadequate efficacy may have been that the anti-HBV
sequences were not potent and emphasises the importance of selecting optimal antiviral
sequences for therapeutic application. A further concern of using RNAi expression cassettes
is their potential for disruption of the endogenous microRNA pathway. This was shown to
cause lethal toxic effects in livers of mice that received recombinant AAVs that transduced
hepatocytes with U6 Pol III shRNA expression cassettes [232]. We observed that HD Ad-
mediated transduction of hepatocytes with similar cassettes was well tolerated and the
95
dramatic toxic effects reported by Grimm and colleagues could not be discerned. A factor
contributing to this may have been the low dose of HD Ad infectious particles that was
required to effect HBV silencing reported here.
The strong innate immunostimulatory effects of Ads [92, 149, 229, 240, 241, 246, 247] are a
significant concern, and this has impeded development of these vectors for therapeutic
application. Negative consequences of immunostimulation include toxicity, limited duration
of transgene expression and reduced efficacy after repeated vector administration. Although
FG Ad and HD Ad particles are capable of inducing an innate immune response [149, 240,
241], removal of ORFs to form HD Ad vectors is useful to diminish longer term humoral and
cell mediated adaptive immunity [239]. Compared to preparations containing an excess of
total Ad particles, we found that markers of hepatotoxicity and release of proinflammatory
cytokines were diminished following administration of the HD Ad preparations. This result
may have been enhanced by the reduced number of total viral particles in the HD Ad
preparations. Results also showed that release of proinflammatory cytokines and the duration
of silencing efficacy were not influenced by PEGylation. Although PEGylation of Ads by the
covalent attachment of mPEG-SPA did not reveal obvious advantages in this study, the
variability in the PEGylation efficiency may be the cause and this needs to be clarified in
future studies. The production of HD Ad vectors involves the use of TRIS-containing buffers
which are not ideal as they contains primary amines which reacts with the N-
hydroxysuccinimide groups of the PEGylation reagents and decrease the reaction efficiency.
The use of maleimides which readily react with the thiol groups on cysteine can eliminate
this problem. Site directed PEGylation of genetically manipulated HVR sequences having
cysteines inserted in hexon capsid proteins may yield modified Ad vectors that are more
stable with predictable PEGylation. HD Ad vectors having cysteine residues which are
96
amenable to maleimide PEG modification are presently been investigated. Polymer
modification is also potentially important to evade interaction with Coxsackie Adenovirus
receptors (CARs) and complement 1 receptors on human erythrocytes [248].
The high capacity of HD Ads for incorporation of transgenes is a useful property. In addition
to RNAi activating cassettes, other antiviral or immunomodulatory cassettes may be utilised
to generate multifunctional vectors for HBV therapy. Recent advances in the use of
transcription activator like effector nucleases (TALENs) and Zinc finger nucleases have been
impressive [249]. These engineered gene-modifying enzymes may be particularly useful in
combination with HBV-targeting RNAi activators to disable the stable HBV cccDNA
minichromosome. Ability of HD Ads to accommodate additional antiviral sequences is
potentially an advantage over other vectors that have a limited capacity for insert size.
Although refinements in vectorology are needed before the full potential of RNAi-based
HBV therapy is realised, our data show that HD Ads potentially have utility for hepatotropic
delivery of gene silencers.
Conclusions 97
4 CONCLUSIONS
The limited success of existing HBV treatment and the demonstration that HBV replication is
susceptible to RNA interference prompted investigations aimed at utilising this pathway for
therapeutic application in HBV-infected individuals. Success of this therapy will ultimately
be determined by a vector’s ability to deliver the RNAi effectors safely to the liver. The use
of viral vectors and in particular Ad vectors are proving to be promising vehicles for
delivering the RNAi effectors to HBV infected livers. In recent years a deeper understanding
of Ad-host interaction has emerged, enabling the development of strategies to overcome Ad
vector immunogenicity and toxicity. Employing the strategy of PEG modification of the Ad
vector in combination with the use of third generation HD Ad vectors we were able to
demonstrate safe and efficient delivery of anti-HBV RNAi effectors in vivo, in a murine
transgenic model of HBV replication.
Chemical modification of Ads by the covalent attachment of PEG to immunostimulatory
capsid proteins has become a common approach to improve efficacy of therapeutic drugs. In
this study, monofunctional PEG was employed which reacts with the ε-amino terminal of
lysine residues on Ad capsids. Conjugation of Ads with 5 kDa PEG does not compromise
hepatic transduction in mice and does not interfere with Ad’s ability to interact with blood
factors, such as clotting factor X, which are essential for efficient liver delivery (reviewed in
[203]). The PEG modified FG Ads described here successfully transduced mouse livers, had
attenuated innate and adaptive immune responses and efficiently expressed RNAi effectors.
The benefits of PEGylating Ads carrying RNAi effectors targeting HBV in an in vivo mouse
model has not been previously described.
Conclusions 98
The random attachment of PEG to the lysine amino acid residues on the Ad capsid has the
disadvantage of yielding heterogeneous conjugates, which may cause inconsistencies
between production lots. There is also an abundance of lysines on capsid proteins so if an
excessive number of these moieties are PEG-modified, crosslinking occurs between PEG
molecules and aggregates may form which can inhibit Ad function (reviewed in [134, 250]).
In recent years a more targeted and controlled approach to PEGylation has been adopted
whereby specific immunogenic sites are modified. Thiol groups are introduced by inserting
cysteine residues within immunogenic sites of the Ad capsid [190, 251, 252]. The use of
maleimide-PEG which reacts with the thiol groups on the inserted cysteines, does not
compromise the Ad vector function and improved in vivo liver delivery is achieved.
Difficulty was experienced in achieving consistently PEGylated HD Ads which might be
attributed to the heterogeneous covalent attachment of PEG to lysine residues on Ads. Future
work will include the generation of HD Ad vectors where the HVR of the hexon protein has
cysteine residues inserted, which will make them amenable to the more efficient maleimide-
PEGylation.
Data from small animal models makes it difficult to predict the outcome in human trials as a
result of some fundamental species differences. Mice do not express CAR on their red blood
cells (RBCs), however human RBCs express high levels of this receptor [182, 183, 253]
which plays a significant role in Ad5 sequestration and reduced liver transduction. Several
groups have shown that PEGylation can disrupt Ad5 interacting with CAR (reviewed in
[177]) so future work will investigate whether PEG modification of our Ad vectors will
inhibit interaction and subsequent sequestration of the Ads by human RBCs in an in vitro
model [182].
Conclusions 99
HD Ad vectors have a distinct advantage over FG Ad vectors as they induce a limited
cytotoxic T-cell response and may achieve prolonged transgene expression. HD Ad transgene
expression exceeding 2 years has been described in mouse and rat livers [168, 205]. In the
study presented here, HBV inhibition resulting from shRNA 6 expression was sustained for 8
weeks with a low dose of HD Ad administration as compared to 3 weeks when the same
RNAi effectors were delivered with FG Ads. The HD vector utilized in the study has a β-
galactosidase reporter sequence included which has been documented to be immunogenic
[254] and this might account for the shorter duration of the anti-HBV effects. Work presently
being conducted in our lab involves testing HD Ad vectors lacking the β-galactosidase
reporter sequence to assess whether more sustained inhibition of HBV can be achieved using
these vectors. Recent preliminary data would suggest that the HD Ad vectors -galactosidase
is immunostimulatory as mice injected with these vectors produced Abs against -
galactosidase in an ELISA assay (see Appendix A1-7).
Strategies other than the manipulation of capsid proteins have been used to avoid Ad
sequestration and interaction with the host immune system. Clinically relevant approaches
include the administration of anti-inflammatory drugs such as methylprednisolone or
dexamethasone ([176]. A strategy that has been successfully employed in non-human
primates is the use of balloon occlusion catheters for non-systemic delivery of HD Ads. A
catheter is inserted into the inferior vena cava and then inflated thereby preventing outflow of
blood from the hepatic vein which increases intrahepatic pressure allowing for improved HD
Ad transduction. The HD Ad is administered locally to the hepatic artery resulting in highly
efficient liver delivery enabling the use of lower, less toxic doses of HD Ad vector and long-
term expression of the transgene [185]. This technique however, is invasive and technically
difficult. Importantly, we were able to demonstrate that by using low doses of HD Ad
Conclusions 100
expressing anti- HBV shRNA 6, sustained knockdown of HBV was achieved with minimal
hepatic toxicity. Although host immunostimulation by recombinant Ads still remains an
obstacle in the clinical use of these vectors, the future success of Ad vectors in gene therapy
will be governed by the optimisation of immune evading strategies such as those employed in
the in vivo studies described in this thesis.
An added advantage of developing safer HD Ad vectors is their large transgene carrying
capacity as compared to other viral vectors. Multifunctional cassettes for HBV therapy could
be incorporated which carry the RNAi effector together with expressed immunomodulating
elements. Anti-HBV therapies are largely ineffective as they target the replicating virus and
not the ‘latent’ episomal cccDNA. Transcription activator like effector nucleases (TALENs)
and Zinc finger nucleases which effectively cleave the cccDNA have recently been developed
[249, 255]. These enzymes are generated from large expression cassettes which could be
accommodated by HD Ad vectors. As techniques improve and relevant human models
become available, the utility of Ad vectors in delivering RNAi effectors that target HBV
could become a clinical reality.
101
5 APPENDIX A
A1 Standard laboratory techniques
A1-1 Tissue culture
Reagents
RPMI medium (RPMI)
One litre of RPMI was made as follows: 10.4 g RPMI-1640 (Life Technologies,
Paisley, UK) and 2 g NaHCO2 were dissolved in ddH20, the pH was adjusted to 7.2
and the media was then sterilised by filtration.
Dulbecco’s modified Eagle media (DMEM)
One litre of DMEM was made as follows: 13.38 g DMEM (Life Technologies,
Paisley, UK) and 3.7 g NaHCO2 were dissolved in ddH20, the pH was adjusted to 7.2
and the media was then sterilised by filtration.
Eagle’s minimum essential medium (EMEM) (without CaCl2)
One litre of EMEM was made as follows: 11 g EMEM (Sigma-Aldrich, MO, USA)
was dissolved in ddH20, the pH was adjusted to 7.2 and the media was then sterilised
by filtration.
Minimal essential medium (MEM) (with Earle’s salts)
One litre of MEM was made as follows: 9.53 g MEM (Life Technologies, UK) and
2.2 g NaHCO2 were dissolved in ddH20, the pH was adjusted to 7.2 and the media was
then sterilised by filtration.
1000× Pen/Strep
One gram Streptomycin and 0.61g Penicillin (both Sigma-Aldrich, MO, USA)
were dissolved in 10 ml dH20 and the solution was sterilised by filtration.
102
Hygromycin B (Sigma-Aldrich, MO, USA)
Foetal bovine serum (FBS), heat-inactivated (Life technologies, Paisley, UK;
Biochrom, Berlin, Germany)
Trypsin/EDTA (Life Technologies, Paisley, UK)
Protocol for routine propagation of cells
Huh7 and HEK 293 cells were maintained in RPMI and DMEM growth media
respectively, supplemented with 5-10% FBS and antibiotics. The cells were
maintained in a humidified incubator at 37 ºC and 5% CO2 and sub-cultured upon
reaching a density of 90-100%. Huh7 cells were washed with saline and subsequently
incubated for 5 minutes at 37 ºC in saline containing 0.01% EDTA. The saline/EDTA
solution was removed and an appropriate volume (depending on culture surface) of
0.5× trypsin was added and the cells were incubated for an additional 5 minutes.
Trypsinisation was not necessary for HEK 293 cells and the cells were gently tapped
off the culture surface. Dislodged cells were aspirated from the flask and a third of the
volume was transferred to a sterile flask of the same size containing fresh culture
media. The flasks were returned to the incubator and the media was replenished every
48 hours until the cells needed to be passaged.
The 116 cell line was maintained in 150 cm2 flasks supplemented with 10% FBS, 0.1
mg/ml hygromycin B, 100 units/ml penicillin/streptomycin, and 2 mM L-glutamine.
Cells were passaged twice a week by detaching the cells from the culture surface by
gentle tapping, followed by dividing the aspirated cells between three sterile flasks.
The cells were incubated at 37 ºC in 5% CO2.
103
Adenoviral infection of cells
For Northern blot experiments 2 × 106 Huh7 cells were plated into 25 cm
2 flasks in
antibiotic-free RPMI media supplemented with 5% FBS. The cells were immediately
infected with Ad at a moi of100 pfu/ml and transferred to a 37 °C, 5% CO2 incubator
for 48 hours. The media was then aspirated from the cells and RNA extracted.
104
A1-2 Experion microchip electrophoresis analysis
Figure A.1: Experion microchip electrophoresis. Representative result from capillary
electrophoresis analysis performed on PEGylated and unPEGylated Ad shRNA 6 samples.
An estimated 93.3% of Ad virus was PEGylated in this sample.
105
A1-3 p28ΔE4LacZ
Figure A.2: Plasmid map of p28ΔE4LacZ used for cloning of RNAi effector sequences
to generate HD Ads. The 32133 bp plasmid is kanamycin resistant for selection and has a
LacZ marker sequence inserted.
pdelta28E4LacZ
32133 bp
ITR
AI
AII
AIII
AIV
AV
AVI
AVII
LacZ
ITR
MGB probe A
Kanamycin resistance
MCMV
A feI (11056)
A geI (18635)
A scI (28773)
B siWI (11992)
FspAI (15921)
PacI (8901)
PshAI (9148)
R srI I (31509)
SacI I (358)
SalI (12324)
SgrAI (188)
SnaBI (28237)
SrfI (15835)
Aat II (8933)
Aat II (9844)
Acl I (912)
Acl I (30503)
Bss HII (10719)
Bss HII (28773)
Bst EII (16809)
Bst EII (17155)
Eag I (17620)
Eag I (30899)
Nae I (31495)
Nae I (31959)
Ngo MIV (31493)
Ngo MIV (31957)
Pme I (29182)
Pme I (32131)
Sse 8647I (16721)
Sse 8647I (21955)
ZraI (8931)
ZraI (9842)
106
A1-4 HBV Q-PCR standard curve
Figure A.3: HBV Q-PCR standard curve. Representative data of Q-PCR standard curve
generated from a commercial HBV standard obtained from the National Institute of
Biological standards and Controls (NIBSC, Hertfordshire, UK). Absolute VPEs in mouse
serum samples could be calculated from the curve.
107
A1-5 Helper virus Q-PCR standard curve
Figure A.4: HV Q-PCR standard curve. The curve was generated from HV of known
concentration. The absolute amount of contaminating HV in viral preparations could be
calculated using the standard curve.
108
A1-6 HD Ad Q-PCR standard curve
Figure A.5: HD Ad Q-PCR standard curve. The curve was generated from HD Ad of
known concentration. The absolute amount of HD Ad in viral preparations could be
calculated using the standard curve.
109
A1-7 -galactosidase ELISA
HD
L
ac
Z
HD
Ad
sh
RN
A 6
Sa
lin
e
HD
L
ac
Z
HD
Ad
sh
RN
A 6
Sa
lin
e
0.00
0.05
0.10
0.15
0.20
Day 35 (1st ) Day 9 (2nd)
**
***
Rela
tive O
D496n
m
Figure A.6: Relative serum anti--galactosidase immunoglobulin concentrations after
vector administration to mice. Total anti--galactodidase protein-specific antibodies were
measured by ELISA 35 days after first administration (left) and 9 days after the second
administration (right) of vectors. Mean relative optical density readings (±SEM) are given.
Statistically significant differences (* p< 0.05, ** p< 0.005) are indicated and were determined
using the Student’s 2 tailed paired t-test.
110
A2 Animal ethics clearance certificate
111
A3 Publications
A3-1 Selected research publications derived from work presented in this
thesis
Effective Inhibition of HBV Replication in Vivo by Anti-HBxShort Hairpin RNAs
Sergio Carmona,1 Abdullah Ely,1 Carol Crowther,1 Naazneen Moolla,1 Felix H. Salazar,2,3
Patricia L. Marion,3 Nicolas Ferry,4 Marc S. Weinberg,1 and Patrick Arbuthnot1,*
1Hepatitis B Virus Research Unit, Department of Molecular Medicine and Haematology,
University of the Witwatersrand Medical School, Private Bag 3, Wits 2050, South Africa2Stanford University, Stanford, CA 94305, USA
3Hepadnavirus Testing, Inc., Mountain View, CA, USA4INSERM CIC-04, CHU Hotel-Dieu, Nantes, France
*To whom correspondence and reprint requests should be addressed. Fax: +27 11 717 2395. E-mail: [email protected].
Available online 5 December 2005
Exploiting the RNA interference pathway has shown promise for developing novel and effectivetreatment of hepatitis B virus (HBV) infection. To advance this approach, we analyzed the antiviralefficacy of a panel of 10 Pol III U6 promoter-encoded short hairpin RNAs (shRNAs) that targetconserved sequences of the oncogenic HBx open reading frame. To facilitate intracellularprocessing, the shRNAs included mismatches in the 25-bp stem region and a terminal loop ofmiRNA-23. Two shRNAs (shRNA 5 and shRNA 6) showed knockdown of HBV markers by 80–100% intransfected hepatocytes and also in a murine hydrodynamic injection model of HBV replication.Intracellular processing of hairpin RNA with the intended strand bias correlated with antiviralefficacy. Moreover, markers of HBV replication were inhibited without inducing genes associatedwith the nonspecific interferon response. To assess the antiviral efficacy of the shRNAs in a contextthat is similar to natural HBV infection, shRNA-encoding cassettes were tested against the virus in aHBV transgenic murine model. When delivered using recombinant adenovirus vectors, U6 shRNA 5and U6 shRNA 6 mediated significant HBV knockdown. Collectively, these observations indicate thatU6 shRNA 5 and U6 shRNA 6 are promising candidates for therapy of chronic HBV infection.
Key Words: RNAi, short hairpin RNA, HBV, hydrodynamic injection, HBV transgenic mice,recombinant adenovirus, interferon response
INTRODUCTION
Persistent hepatitis B virus (HBV) infection remains animportant global public health problem with an esti-mated 6% of the worldTs population chronically infectedwith the virus [1–3]. The clinical course of HBV infectionis not constant and may be influenced by properties ofindividual viral variants [4,5]. For example, chronicinfection with HBV subgenotype A1, which is hyper-endemic to South Africa, is associated with a particularlyhigh risk of hepatocellular carcinoma [6]. Licensed treat-ments for HBV infection, which include interferon-a andnucleoside (lamivudine) and nucleotide (adefovir) ana-logues, produce a long-term response in only a minorityof chronic carriers [7,8]. The continued search for aneffective therapy to prevent life-threatening complica-tions thus remains a priority. HBV has a compact genome(Fig. 1) that makes it well suited to developing antiviraltherapies that are based on nucleic acid hybridization.Overlapping open reading frames (ORFs) cover the entire
viral genome [9] and conserved regions may encode morethan one protein as well as HBV cis elements required forviral replication. HBx is an example of a multifunctionalHBV sequence. It encodes the HBx protein, which hasbeen implicated in HBV-mediated hepatocarcinogenesis(reviewed in [1]) and is required for HBV replication[10,11]. HBx also overlaps with the 3V end of thepolymerase ORF, direct repeats that are required duringvirus reverse transcription, and regions important fortranscription control (basic core promoter and negativeregulatory elements). HBV transcripts are usuallyunspliced and have a common 3V end that includes HBx(Fig. 1). The key role of HBx in viral replication andhepatocarcinogenesis, together with the presence of theconserved HBx sequence in all of the HBV transcripts,makes it a good target to develop nucleic acid hybrid-ization-based therapy.
Exploiting the RNA interference (RNAi) pathway hasshown exciting promise for the development of novel
DTD 5
ARTICLEdoi:10.1016/j.ymthe.2005.10.013
MOLECULAR THERAPY Vol. 13, No. 2, February 2006 411Copyright C The American Society of Gene Therapy
1525-0016/$30.00
antiviral therapy. Naturally, the mechanism involvesprocessing of larger dsRNA by Dicer to form shortinterfering RNA (siRNA) duplexes [12–14]. One of thestrands of the siRNA is incorporated into the RNA-induced silencing complex (RISC) and acts as a guide totarget degradation of complementary cytoplasmic RNA.Exogenous silencing is typically induced by syntheticRNA or transcripts produced from Pol III cassettes [12,15–17]. A number of studies have demonstrated that activa-tion of RNAi has potential for the development of noveltreatments of HBV infection [18–27]. As the pathway ofRNAi becomes better understood, more rationalapproaches to the design and characterization of poten-tially therapeutic RNAi inducers are being sought. Avoid-ance of the interferon response, efficacy at a lowconcentration of RNAi-inducing sequences, specificityfor the viral cognate, and processing of the duplexes withappropriate strand bias are important considerations. Inthis study, we report that anti-subgenotype A1 shorthairpins RNAs (shRNAs) targeted to HBx, which havefeatures of endogenous micro RNA (miRNA) that allow forinfluencing strand bias, are powerful and specific inhib-itors of HBV replication. Inhibition of HBV replication
was observed in vitro in transfected cells, in vivo after genetransfer using hydrodynamic DNA injection, and in HBVtransgenic models. Sequences found to be most effectivealso have homology to other HBV genotypes and poten-tially have broad therapeutic applications.
RESULTS AND DISCUSSION
HBV Targets and Design of DNA Encoding AntiviralshRNA SequencesWe generated a panel of 10 U6 shRNA cassettes, whichtarget the most conserved sites of the HBx sequencefrom South African genotype A1 isolates of the virus[28]. We designed hairpins to comprise a 25-bp stemwith four GU or CA mismatches in the shRNA strand ofHBV sense polarity, and the HBx antisense sequencewas perfectly complementary to the viral target (Fig. 1and Table 1). The 10-nt loop sequence was common toall of the hairpins and was derived from miRNA-23[29]. These features were incorporated to facilitateintracellular processing and may also diminish non-specific effects of activating the interferon response[30,31].
FIG. 1. HBV target sites and shRNA-encoding vectors. (A) Organization of the hepatitis B virus genome showing sites targeted by shRNA sequences. Coordinates
of the genome are given relative to the single EcoRI restriction site. Partially double-stranded HBV DNA comprises + and � strands with cohesive complementary
5V ends. The cis elements that regulate HBV transcription are represented by the circular and rectangular symbols. Immediately surrounding arrows indicate the
viral open reading frames (with initiation codons) that encompass the entire genome. Four outer arrows indicate the HBV transcripts, which have common 3V
ends that include HBx. (B) (Top) Schematic illustration of anti-HBV shRNA indicating mismatches in the sense strand, miRNA 23 loop, and sequence of two U
residues that are derived from the transcription termination signal. The DNA cassette with U6 promoter, sense, miRNA 23 loop (L), and antisense-encoding
sequences is indicated below.
ARTICLE doi:10.1016/j.ymthe.2005.10.013
MOLECULAR THERAPY Vol. 13, No. 2, February 2006412Copyright C The American Society of Gene Therapy
Effects of shRNA on HBsAg Secretion from TransfectedCells and Assessment of Efficacy in SituInitially, to assess efficacy against HBV, we cotransfectedHuh7 cells with hairpin-encoding sequences and the pCH-9/3091 HBV target plasmid [32]. Variable efficacy ofknockdown of viral antigen secretion was achieved byeach of the sequences (Fig. 2A). U6 shRNA 5 and U6 shRNA6 were most effective and plasmids encoding these hair-pins decreased HBsAg concentration in the culture super-natant to less than 5% of the mock-treated cellsT level.Transfection of the vector encoding U6 shRNA 10 hadlittle if any effect on HBsAg secretion. We corroboratedthese data using a reporter gene plasmid (pCH-eGFP) tomeasure knockdown in situ (Fig. 2B) [33]. In pCH-eGFP,the preS2/S sequence of pCH-9/3091 was replaced with theenhanced green fluorescent protein (eGFP) ORF, with thetargeted HBx ORF remaining intact. Cotransfection ofpCH-eGFP with shRNA-encoding vectors allows for theconvenient measurement of anti-HBV shRNA efficaciesusing flow cytometry and fluorescence microscopy. Anal-ysis showed that the number of cells expressing eGFP wasdiminished significantly by U6 shRNA 5 and U6 shRNA 6,while U6 shRNA 10 was least effective (Fig. 2C). The sitestargeted by these shRNAs 5 and 6 overlap each other,which suggests that this region of HBx is particularlysusceptible to RNAi-mediated knockdown. Activators ofthe RNAi pathway can potentially stimulate nonspecificinflammatory effects by activating the interferonresponse, which in turn is capable of inducing cell deathby apoptosis [34,35]. To exclude this effect, we measuredmRNA from three genes that are key components of the
interferon response: IFN-h, OAS1, and MxA (SupplementalFig. 1). Expression of interferon response genes was notincreased in Huh7 and HEK293 cells that were transfectedwith shRNA-expressing plasmids. These observationsindicate that the knockdown of HBsAg secretion and eGFPmarker expression was specific to activation of RNAi andnot a result of causing interferon response-mediatedprogrammed cell death.
Effects of shRNAs on HBV RNA ConcentrationsWe extracted total cellular RNA from Huh7 cells that hadbeen transiently transfected with shRNA-encoding plas-mids together with HBV target DNA. Analysis usingNorthern blot hybridization confirmed that shRNA 5efficiently reduced the concentration of HBV RNA (Fig.3A). When normalized for loading differences using theGAPDH mRNA band intensity, U6 shRNA 5 diminishedHBV transcript concentration to approximately 35% ofthe control value. Concentrations of HBV transcripts incells cotransfected with the U6 shRNA 10 vector were 90–100% of the controls. Cotransfection of Huh7 cells withU6 shRNA 9 had an intermediate knockdown effect onHBV RNA and diminished concentrations by approxi-mately 40%. These data correlate with the observations onthe shRNA effects on HBsAg secretion and in situ markergene expression.
shRNA ProcessingTo assess processing of expressed shRNA sequences, wecarried out primer extension analysis on total RNA thatwas extracted from the transfected Huh7 liver cell line.
TABLE 1: Nucleotide sequences of PCR reverse primers used to generate HBV U6 shRNA cassettes
HBV targeta Name Primer sequence
1168–1192 U6 shRNA 1.1 5V-TGACGTGACAGGAAGCGTT--AGCAG––
ACACTTGGCAT--AGG––
CCCGGTGTTTCGTCCTTTCCACA-3VU6 shRNA 1.2 5V-CCCAGATCTACGCGTAAAAAAGGTCTGTGCCAAGTGTTTGCTGACGTGACAGGAAGCGTTA-3V
1432–1456 U6 shRNA 2.1 5V-GGACGTGACAGGAAGCGTT--CGT
--GGGATTCAGCGT
--CGAT
--GGCGGTGTTTCGTCCTTTCCACA-3V
U6 shRNA 2.2 5V-CCCAGATCTACGCGTAAAAAACCGTCGGCGCTGAATCCCGCGGACGTGACAGGAAGCGTTC-3V1514–1538 U6 shRNA 3.1 5V-CTTTATGACAGGAAGCAAAG––
AGAGA––TGCGCCCCA––
TGGC––CGCGGTGTTTCGTCCTTTCCACA-3V
U6 shRNA 3.2 5V-CCCAGATCTACGCGTAAAAAACGACCACGGGGCGCACCTCTCTTTATGACAGGAAGTAAAG-3V1518–1542 U6 shRNA 4.1 5V-ACGCGTGACAGGAAGCGT
--GTG––
AAGAGAGGTGT--GCCCT
--GTGCGGTGTTTCGTCCTTTCCACA-3V
U6 shRNA 4.2 5V-CCCAGATCTACGCGTAAAAAACACGGGGCGCACCTCTCTTTACGCGTGACAGGAAGCGTGT-3V1575–1599 U6 shRNA 5.1 5V-CTCTGTGACAGGAAGCAGAGGC––
GAAGCA––AAGC––
GCACACGA––CGGTGTTTCGTCCTTTCCACA-3V
U6 shRNA 5.2 5V-CCCAGATCTACGCGTAAAAAACCGTGTGCACTTCGCTTCACCTCTGTGACAGGAAGCAGAG-3V1580–1604 U6 shRNA 6.1 5V-CACGTTGACAGGAAGAT
--GTGT
--AGAGGTGAAGCGAG––
GTGT--ACGGTGTTTCGTCCTTTCCACA-3V
U6 shRNA 6.2 5V-CCCAGATCTACGCGTAAAAAATGCACTTCGCTTCACCTCTGCACGTTGACAGGAAGATGTG-3V1640–1664 U6 shRNA 7.1 5V-GGACTTGACAGGAAGAGTT
--CTT
--TTATGTAG––
GACT--TTGGGCCGGTGTTTCGTCCTTTCCACA-3V
U6 shRNA 7.2 5V-CCCAGATCTACGCGTAAAAAAGCCCAAGGTCTTACATAAGAGGACTTGACAGGAAGAGTTC-3V1678–1702 U6 shRNA 8.1 5V-GAGGCTGACAGGAAGGCT
--TCAAGGTT
--GGTT
--GTTGACG––
TTGCGGTGTTTCGTCCTTTCCACA-3VU6 shRNA 8.2 5V-CCCAGATCTACGCGTAAAAAACAATGTCAACGACCGACCTTGAGGCTGACAGGAAGGCTTC-3V
1774–1798 U6 shRNA 9.1 5V-TTGGTTGACAGGAAGACT--AATTTG––
TGCCTACAGCT--TCT
--TACGGTGTTTCGTCCTTTCCACA-3V
U6 shRNA 9.2 5V-CCCAGATCTACGCGTAAAAAATAGGAGGCTGTAGGCATAAATTGGTTGACAGGAAGACTAA-3V1863–1887 U6 shRNA 10.1 5V-CTTGGTGACAGGAAGCCAAA––
GCACAA––CTC––
GGAGGCTC––GAACGGTGTTTCGTCCTTTCCACA-3V
U6 shRNA 10.2 5V-CCCAGATCTACGCGTAAAAAATTCAAGCCTCCAAGCTGTGCCTTGGTGACAGGAAGCCAAG-3V
Overlapping sequences are underlined. Mismatches incorporated into the sense strand of the hairpin stems are indicated with a double underline. The region complementary to the U6
promoter is italicized. Sequences encoding HBx antisense RNA are bold.a HBV coordinates are relative to the single EcoRI site as indicated in Fig. 1.
ARTICLEdoi:10.1016/j.ymthe.2005.10.013
MOLECULAR THERAPY Vol. 13, No. 2, February 2006 413Copyright C The American Society of Gene Therapy
FIG. 2. shRNA-mediated inhibition of HBsAg secretion
and HBV–eGFP fusion marker protein expression in
transfected cells. (A) Measurement of HBsAg secretion
from Huh7 cells cotransfected with indicated shRNA-
encoding plasmids together with HBV target plasmid.
HBsAg measurements from quantitative ELISA are given
as a normalized mean relative to the mock-treated cells.
Results are from four independent transfections and the
bars indicate the standard error of the mean (SEM). (B)
Schematic illustration of plasmid construct pCH-eGFP
showing open reading frames, respective transcripts,
and sites targeted by shRNAs. The disrupted polymerase
ORF is not indicated. Representative fluorescence micro-
scopy fields of Huh7 cells transfected with pCH-eGFP
and indicated shRNA-expressing construct are also
shown. (C) Quantitative comparison of the percentage
of eGFP-positive Huh7 cells detected using flow cytom-
etry after transfection with indicated shRNA-encoding
expression vectors. Number of eGFP-positive cells is
given as a normalized mean relative to the mock-treated
cells, which represents approximately 45% eGFP-pos-
itive cells in the total population. Results are depicted as
means from four independent transfections (each
counting 100,000 events) with the SEM indicated.
ARTICLE doi:10.1016/j.ymthe.2005.10.013
MOLECULAR THERAPY Vol. 13, No. 2, February 2006414Copyright C The American Society of Gene Therapy
We radiolabeled oligonucleotide primers that were com-plementary to the HBV sense or antisense sequence of thehairpin RNA encoded by U6 shRNA 5 or U6 shRNA 10 attheir 5V end, hybridized them to complementary cellular
RNA from transfected cells, and then extended themusing reverse transcriptase. Extension of end-labeledprimers complementary to the U6 shRNA 5 antisensestrand generated a 21-nt product that corresponds to the
FIG. 3. RNA analysis. (A) Huh7 hepatocytes were transfected with the indicated shRNA-encoding plasmids. Two days after transfection, total RNA was extracted
from the cells and analyzed by Northern blot hybridization. The control lane represents analysis of RNA extracted from cells that had been transfected with a
plasmid encoding shRNA 5 sequences under transcriptional regulation of the Pol II CMV immediate early promoter/enhancer. Blots were probed for HBV RNA
and also GAPDH as a loading control. (B and C) Either radiolabeled HBV� or radiolabeled HBV+ oligonucleotides targeting the relevant sequences of shRNA 5 or
shRNA 10 were hybridized to total RNA extracted from transfected Huh7 cells and then subjected to primer extension analysis using reverse transcriptase. Sizes of
extended fragments were then detected using autoradiography after resolution with denaturing PAGE. The amount of template cellular RNA subjected to reverse
transcription is indicated above the lanes and RNA molecular weight marker sizes (nt) are indicated on the left of the autoradiographs.
ARTICLEdoi:10.1016/j.ymthe.2005.10.013
MOLECULAR THERAPY Vol. 13, No. 2, February 2006 415Copyright C The American Society of Gene Therapy
putative guide sequence that effects HBV gene silencing(Fig. 3B). A similar primer extension to detect a shRNA-derived HBx sense sequence did not generate a signal,and this was confirmed in an overexposed autoradio-graph from the same gel. Conversely, when we subjectedRNA extracted from U6 shRNA 10-transfected cells toprimer extension analysis, both sense and antisenselabeled oligonucleotides generated extended products21 nt in length (Fig. 3C). Moreover, the U6 shRNA 10-encoded sense strand sequence is present at a slightlyhigher concentration compared to the intended anti-sense guide. Thus, intracellular processing of the hairpinencoded by U6 shRNA 10 has a slight bias for thenonhybridizing sequence with the same polarity as itsviral target. Conversely, the only single-stranded RNAsequence that is detectable from U6 shRNA 5-transfectedcells is that which corresponds to the intended antisenseguide RNA. Several factors that affect processing andfunctionality of RNAi effectors have been identified.Included among these is a GC content of 30–52% thatis thought to be optimal for efficient unwinding of theduplex while at the same time retaining sufficientstability of interaction of the siRNA guide strand withits target [36–38]. Based on primer extension analysis ofshRNA 5, the siRNA derived from this hairpin has 47%GC pairs (9 of 19 pairs in the duplex region). However,the proportion of GC pairs between the shRNA 5-derivedguide sequence and the HBV target is higher (62%), andthis is a result of the GU mismatch pairs of the shRNAstem that are not present in the hybrid with the HBVtarget. Thus, it is likely that the relatively lower GCcontent of the Dicer-processed product facilitatesunwinding of the duplex, while the higher GC contentof the guide and target pair stabilizes this interaction.Another important factor that determines the processingof RNA duplex is the stability at the 5V end of theintended guide sequence within the double-strandedRNA [36–38]. With shRNA 5, there is a 5V GU mismatchedbase pair at the 5V end of the antisense strand, and this islikely to facilitate the intended strand bias. Together,these factors are likely to improve processing of shRNA 5and advance our understanding of the properties ofeffective anti-HBV RNA sequences.
Efficacy of shRNA-Encoding Plasmids in Vivo Usingthe Murine Hydrodynamic Injection ProcedureTo determine anti-HBV efficacy of shRNA in vivo, weinitially used the hydrodynamic injection procedure todeliver target and shRNA-encoding DNA simultaneously.Using this approach, shRNA 5-encoding plasmid DNAcontinuously knocked down HBsAg in the serum of miceto a background level over a period of 4 days (Fig. 4A).We also observed an inhibitory effect when we measuredHBV core antigen (HBcAg) using immunohistochemicalstaining in liver sections from mice that had beensubjected to hydrodynamic injections (Fig. 4B). The
control for DNA delivery efficiency showed that uptakeand expression of the lacZ marker gene were similar intreated and untreated mice. Comparing efficacies of U6shRNAs 5, 6, and 10 on day 4 after injection, theproduction of HBsAg was suppressed completely in micetreated with shRNA 5- or shRNA 6-encoding plasmids(Fig. 4C). However, as was observed in transfected cells,HBsAg concentrations in the serum of mice that wereinjected with shRNA 10-encoding DNA were not signifi-cantly diminished. Similarly, on day 4 HBV viral loadswere knocked down to background levels in the micetreated with DNA encoding shRNA 5 or shRNA 6 (Fig.4D). Again U6 shRNA 10 was less effective, indicatingthat the knockdown is a sequence-specific phenomenonand is unrelated to generic features of the anti-HBxhairpin cassettes. Efficient inhibition of viral replicationmarkers was confirmed when we administered shRNA 5-encoding DNA at a fifth of the molar concentration ofHBV target DNA (not shown). Simultaneous injection of25 Ag of synthetic siRNA 5, which has a sequenceequivalent to that encoded by U6 shRNA 5, inhibitedsecretion of HBsAg and viral particle concentration inthe serum significantly (P b 0.05) (Figs. 4C and 4D).However, the synthetic RNA was also significantly lesseffective against markers of viral replication than U6shRNA 5 and U6 shRNA 6 (P b 0.05). Sustainedproduction of shRNA from a constitutively active DNAcassette as well as the shorter half-life of RNA comparedto plasmid DNA is likely to account for this. Moreover,improved silencing by coupled Dicer processing prior toloading of guide sequences onto the RISC has beenreported [39] and may contribute to the enhancedsilencing effected by DNA-encoded shRNA compared tosynthetic siRNA.
Efficacy of shRNA-Encoding Recombinant AdenovirusVectors in Vivo in HBV Transgenic MiceWe assessed the efficacy of shRNAs against HBV in thecontext of established constitutive replication of the virusin HBV transgenic mice [40], which mimic naturalinfection more closely than does the hydrodynamicmurine injection model. We incorporated U6 shRNA 5,6, and 10 expression cassettes into recombinant adeno-virus vectors to produce ADV shRNA 5, ADV shRNA 6,and ADV shRNA 10, respectively. Control adenovirusesincluded a U6 shRNA cassette targeted to the h-galacto-sidase marker (ADV shRNA LacZ) or no U6 shRNAsequence (ADV eGFP). The recombinant vectors coex-pressing eGFP and fluorescence microscopy revealed thatapproximately 60–80% of hepatocytes expressed adeno-virus DNA after tail vein injection with 5 � 109 infectiousparticles (not shown). Higher doses of adenovirus vectorscaused significant hepatic toxicity. Compared to controlsand ADV shRNA 10, a single dose of ADV shRNA 5 andADV shRNA 6 significantly diminished the concentrationof HBsAg concentration in the serum over a period of 12
ARTICLE doi:10.1016/j.ymthe.2005.10.013
MOLECULAR THERAPY Vol. 13, No. 2, February 2006416Copyright C The American Society of Gene Therapy
days (P b 0.05) (Fig. 5A). Preliminary data also indicatethat the inhibition of HBsAg secretion persists for at least28 days (not shown). This is comparable to a recentlyreported observation that adenovirus vectors expressingshRNA sequences effected a sustained inhibition ofmarkers of HBV replication [25]. Similarly, compared tocontrol adenovirus vectors, serum HBeAg concentrationswere significantly diminished by both ADV shRNA 5 andADV shRNA 6 at day 12 after administration of the viralvectors ( P b 0.05) (Fig. 5B). Interestingly, the effects ofADV shRNA 5 and ADV shRNA 6 on HBeAg secretionwere less marked than those on HBsAg (approx 2-foldcompared to 10-fold inhibition, compare Figs. 5A and5B). This correlates with the previously reported obser-vation that suggests the 3.5-kb HBV transcript encodingHBeAg is relatively more resistant to RNAi-mediated
knockdown [25]. Circulating virion counts were dimin-ished in animals treated with ADV shRNA 5 and ADVshRNA 6, although the effect was less significant than onserum HBeAg and HBsAg concentrations (Fig. 5C).Although target sites of shRNA 5 and shRNA 6 areconserved in the transgenic mice, silencing is less markedthan that observed in the hydrodynamic model. Thereare two possible explanations for this observation. First,levels of HBV in the transgenic mice greatly exceed thoseof the hydrodynamic injection model (compare viralloads of Figs. 4D and 5C) and complete silencing may bemore difficult to achieve when HBV replication is high.Second, under experimental conditions described here,the adenovirus vectors infected 60–80% of hepatocytes.Incomplete delivery of the shRNA-encoding cassettes toall of the HBV-producing cells is likely to account for
FIG. 4. Effects of shRNA sequences on HBV antigen production in the hydrodynamic injection model of HBV replication. (A) Time course of relative serum HBsAg
concentrations, measured using quantitative ELISA, in mice treated with hydrodynamic injection. Graphical depictions of individual measurements of the viral
antigen are given on a log scale for four mock- and four U6 shRNA 5-treated animals. (B) Mice subjected to the hydrodynamic injection procedure were sacrificed
after 4 days and the livers analyzed using immunohistochemistry to detect the HBcAg. Representative low- and high-power fields are shown for livers from mock-
and U6 shRNA 5-treated animals. Frozen sections from the same animals were stained for LacZ activity to confirm similar delivery of DNA to hepatocytes. (C)
Serum HBsAg concentrations and (D) viral loads on day 4 after injection of mice using the hydrodynamic injection procedure. Mice were injected with the
indicated shRNA-encoding plasmids or synthetic RNA duplex equivalent to shRNA 5 (siRNA 5) together with pCH/9-3091 HBV target DNA. Mock-treated
animals received backbone plasmid (pGEM-T Easy) without shRNA-encoding sequences. Viral loads were determined using real-time quantitative PCR and
included EuroHep standards to calibrate the virion copy numbers. Groups comprised six to eight animals and the graphs indicate the mean and SEM for each
group.
ARTICLEdoi:10.1016/j.ymthe.2005.10.013
MOLECULAR THERAPY Vol. 13, No. 2, February 2006 417Copyright C The American Society of Gene Therapy
lower silencing efficiency. Taken together, these dataindicate that recombinant adenoviruses incorporating U6shRNA 5 and U6 shRNA 6 are capable of sustainedinhibition of gene expression in vivo during constitutivereplication of HBV. Moreover, HBV RNA is susceptible toRNAi-mediated silencing and is not protected fromsilencing by viral proteins.
The demonstration that the anti-HBx shRNAs used inthis study can successfully inhibit HBV replicationindicates that this target sequence is potentially usefulfor therapeutic application. Effective inhibition of HBVantigen production by U6 shRNA 5 and U6 shRNA 6 is animportant advantage over available inhibitors of HBVreverse transcription, which do not reduce viral antigensecretion directly. HBV antigenemia may attenuate thehost immune response and compromise eradication ofthe virus by these drugs [41]. RNAi-based inhibition ofviral antigenemia may thus induce a more vigorous anti-HBV immune response to eliminate HBV during chronicinfection. Unlike many other viruses, plasticity of theHBV genome is restricted because of its compact arrange-
ment. Target sites of shRNA 5 and shRNA 6 are conservedin most genotypes, suggesting that these RNAi effectorsmay have broad applicability against different HBVgenotypes. Although the results reported here and else-where augur well, there are concerns that need to beaddressed before effective RNAi-based therapy of HBVinfection will be realized. In particular, off-target effectsof anti-HBV RNA sequences, which include activation ofthe interferon response and nonspecific interactionsbetween guide sequences and alternative cellular targets,remain a concern. These effects require further character-ization, and optimal therapeutic concentrations need tobe defined. An important technical hurdle related todeveloping RNAi-based antiviral therapy is the efficientdelivery of nucleic acid sequences to infected cells in theliver. Although DNA expression cassettes have beenshown to be effective in the context of recombinantadenoviruses tested in this study and by others [25], thesevectors are unlikely to be suitable for clinical application.Potential toxicity and the limited number of adminis-trations caused by adenovirus immunity are of concern.
FIG. 5. Effects of recombinant adenovirus-mediated
shRNA delivery on viral replication markers in the HBV
transgenic mouse model. (A) Time course of relative
mouse serum HBsAg concentrations, measured using
quantitative ELISA, after tail vein injection of indicated
recombinant adenovirus vectors. Relative serum
HBsAg concentrations over a period of 12 days are
shown. Comparison of (B) serum HBeAg and (C) viral
loads at day 12 after injection of animals with saline or
indicated recombinant adenovirus.
ARTICLE doi:10.1016/j.ymthe.2005.10.013
MOLECULAR THERAPY Vol. 13, No. 2, February 2006418Copyright C The American Society of Gene Therapy
Incorporation of U6 shRNA 5 and U6 shRNA 6 intohepatotropic nonviral vectors with limited immunoge-nicity is an objective of current work.
MATERIALS AND METHODS
shRNA expression cassettes and synthetic siRNA. Conserved target
sequences within the HBx open reading frame of the HBV A1 subgenotype
were identified by aligning sequences of 27 viral isolates of South African
origin. To generate the panel of 10 shRNA expression constructs,
oligonucleotides were designed to produce Pol III U6 shRNA cassettes
from a U6 DNA template [42] in a two-step amplification reaction. The
reverse oligonucleotide sequences used during PCR are indicated in Table
1. U6 shRNA X.1 primers were complementary to part of the U6 promoter
and included the mismatched HBx sense sequences of the short hairpin,
together with the hairpin loop. U6 shRNA X.2 primers included the
overlapping loop, HBx antisense sequence, and transcription termination
sequence. Each PCR step was performed with a U6 universal forward
primer (5V-CTAACTAGTGGCGCGCCAAGGTCGGGCAGGAAGAGGG-3V).
The PCR products from the final amplification step were purified and
ligated to a PCR cloning vector (pGEM-T Easy, Promega, WI, USA) to
generate pG-U6shRNA plasmids (e.g., pG-U6shRNA 5 and pG-U6shRNA
6). The sequences were confirmed by standard manual or automated
sequencing procedures involving dideoxy chain termination. siRNA 5,
which has a sequence equivalent to that of the duplex stem of shRNA 5,
was synthesized using 2V-O-ACE-RNA phosphoramidites (Dharmacon,
CO, USA). The sequences of the oligoribonucleotides were 5V-UCGU-
GUGCGCUUUGCUUCGCCUCUG-3V (sense) and 5V-CAGAGGUGAAGC-
GAAGUGCACACGG-3V (antisense).
Target vectors. pCH-9/3091 has been described previously [32]. It
contains a greater than genome length HBV sequence, which is similar
to the HBV A1 subgenotype consensus. pCH-eGFP is derived from pCH-9/
3091 and has the eGFP sequence substituting for the preS2/S ORF [33].
Cell culture. Huh7 cells were maintained in RPMI medium supplemented
with 2.5% fetal calf serum (FCS), penicillin (50 IU/ml), and streptomycin
(50 Ag/ml) (Gibco BRL, UK). HEK293 cells were propagated in DMEM
supplemented with 10% FCS, penicillin (50 IU/ml), and streptomycin (50
Ag/ml) (Gibco BRL). On the day prior to transfection, 250,000 HEK293
cells or 150,000 Huh7 cells were seeded in wells 2 cm in diameter.
Transfection was carried out using Lipofectamine (Invitrogen, CA, USA)
according to the manufacturerTs instructions. To determine the effects of
shRNA-encoding plasmids, Huh7 cells were transfected with a combina-
tion of 6 Ag of pCH-9/3091 and 2 Ag of hairpin-encoding pGEM-derived
plasmid or control plasmid lacking the shRNA cassette. HBsAg secretion
into the culture supernatants was measured daily using the Monolisa
(ELISA) immunoassay kit (Bio-Rad, CA, USA). To determine in situ effects
of the pG-U6 shRNA series of plasmids, Huh7 cells were cotransfected
with 6 Ag pCH-eGFP instead of pCH-9/3091. Cells labeled with eGFP were
detected using flow cytometry and confirmatory fluorescence microscopy
48 h after transfection. The mean number of fluorescent cells as well as
the standard error of the mean was calculated from four independent
experiments. A plasmid vector that constitutively produces h-galactosi-
dase [43] was included in each cotransfection and equivalent transfection
efficiencies were verified by staining for activity of this marker gene [44].
Northern blot hybridization. Huh7 cells were harvested 4 days after
transfection and total RNA was extracted using Tri Reagent (Sigma, MI,
USA) according to the manufacturerTs instructions. The RNA was resolved
using formaldehyde agarose gel electrophoresis and blotted onto nylon
membranes. An HBV sequence from the surface region was radiolabeled
with [a-32P]dCTP using the multiprime technique (Megaprime kit;
Amersham, UK) and then hybridized to blotted RNA and detected using
autoradiography. As a control for equal loading, the same blot was
stripped and rehybridized to a radiolabeled GAPDH-specific probe.
Expression and processing of shRNA. DNA oligonucleotides, which were
complementary to 18 nucleotides of each of the strands of the U6-
encoded hairpins, were labeled at their 5V ends with [g-32P]ATP and T4
polynucleotide kinase. After purification using standard procedures,
labeled DNA oligonucleotides were hybridized to 2 to 8 Ag of total
Huh7 cellular RNA and then extended for 20 min at 428C with AMV
reverse transcriptase (Promega) according to the conditions recommen-
ded by the supplier. Products were analyzed by autoradiography after
resolution using 8 M urea denaturing 15% polyacrylamide gel electro-
phoresis. The oligonucleotides used in the primer extension assays were as
follows: shRNA 5 HBV+, 5V-CCGTGTGCACTTCGCTTC-3V; shRNA 5
HBV�, 5 V-CAGAGGCGAAGCAAAGCG-3 V; shRNA 6 HBV+, 5 V-
TGCACTTCGCTTCACCTC-3V; shRNA 6 HBV�, 5V-ATGTGTAGAGGT-
GAAGCG-3V; shRNA 10 HBV+, 5V-TTCAAGCCTCCAAGCTGT-3V; shRNA
10 HBV�, 5V-CCAAAGCACAACTCGGAG-3V.
Quantitative PCR. To measure the effects of shRNA sequences on
circulating virion DNA (see below), total DNA was isolated from 50 Al of
mouse serum using the Total Nucleic Acid Isolation Kit and MagNApure
instrument from Roche Diagnostics. Controls included water blanks and
HBV-negative serum. DNA extracted from the equivalent of 8 Al of mouse
serum was amplified using SYBR Green Taq Readymix (Sigma, MO, USA).
Crossing-point analysis was used to measure virion DNA concentrations
and standard curves were generated using EuroHep calibrators [45]. The
HBV surface primer set was HBV surface forward, 5V-TGCACCTGTATTC-
CATC-3V, and HBV surface reverse, 5V-CTGAAAGCCAAACAGTGG-3V. PCR
was carried out using the Roche Lightcycler v.2. Capillary reaction volume
was 20 Al and thermal cycling parameters consisted of a hot start for 30 s
at 958C followed by 50 cycles of 578C for 10 s, 728C for 7 s, and then 958Cfor 5 s. Specificity of the PCR products was verified by melting curve
analysis and agarose gel electrophoresis.
Assessment of in vivo efficacy of anti-HBV shRNA constructs. The
murine hydrodynamic tail vein injection method was initially employed
to determine the effects of shRNA plasmid vectors on the expression of
HBV genes in vivo. Experiments on animals were carried out in accordance
with protocols approved by the University of the Witwatersrand Animal
Ethics Screening Committee. A saline solution comprising 10% of the
mouseTs body mass was injected via the tail vein over 5–10 s. The saline
solution included a combination of three plasmid vectors: 10 Ag target
DNA (pCH-9/3091) or 10 Ag pCI-neo plasmid DNA (Promega), which lacks
HBV sequences; 10 Ag anti HBV sequence (shRNA-encoding plasmid) or
mock (pGEM backbone); and 10 Ag pLTR h-gal [43] (a control for hepatic
DNA delivery, which encodes the h-galactosidase marker gene under
control of an LTR promoter). In some investigations, the amount of
shRNA-encoding plasmid was reduced to 5 and 1 Ag. To test the efficacy of
synthetic siRNA 5 against HBV, 25 Ag of this duplex was coinjected via the
tail vein. Blood was collected daily from the tail vein over a period of 5
days and HBsAg was measured using the electrochemiluminescence assay
(ECLIA) from Roche Diagnostics (Mannheim, Germany) according to the
manufacturerTs instructions. Animals were sacrificed after 4 days. Fixed
and unfixed frozen liver sections were processed respectively for immu-
nohistochemical HBcAg detection or for h-galactosidase staining [44]. A
rabbit polyclonal antibody against HBcAg (Signet Laboratories, Inc., MA,
USA) and horseradish peroxidase-conjugated secondary antibody (Dako,
Denmark) were used to detect the viral antigen in paraffin-embedded
sections according to standard procedures.
Adenovirus vectors. The procedure described by He et al. [46] was
followed for the preparation of the ADV shRNA 5, ADV shRNA 6, ADV
shRNA 10, ADV eGFP, and ADV shRNA LacZ adenovirus vectors. ADV
shRNA LacZ is a control adenovirus that includes a U6 shRNA cassette
with hairpin that targets the h-galactosidase reporter gene. ADV eGFP is
another control that includes the backbone sequence without U6 hairpin
cassette. The pG shLacZ vector was propagated using the two-step PCR
procedure described above. The U6 universal forward primer, with
5V-CTGTTTGACAGGAAGAACAAGTATCCGCTAGTCACTTCGACGG-
TGTTTCGTCCTTTCCACA-3V and 5V-CCCAGATCTACGCGTAAAAAATC-
GAAGTGACCAGCGAATACCTGTTTGACAGGAAGAACAA-3V as reverse
primers, was used in sequential amplifications. To generate adenovirus
shuttle vectors containing the shRNA cassettes, pG-U6shRNA vectors were
ARTICLEdoi:10.1016/j.ymthe.2005.10.013
MOLECULAR THERAPY Vol. 13, No. 2, February 2006 419Copyright C The American Society of Gene Therapy
digested with NotI and HindIII. The U6 shRNA-containing fragment was
purified and ligated to equivalent sites of pAdTrack to generate pAd-Track
U6 shRNA. After verifying the sequence of the inserts, pAdTrack U6 shRNAs
were digested with PmeI and homologous recombination with the
pAdEasy-1 adenoviral backbone plasmid was carried out in Escherichia coli
BJ55183 cells. Propagation of the adenovirus in HEK293 cells was then
done according to the described procedures [46]. Absence of E1A sequences
from each adenovirus was confirmed using PCR. Failure to observe a
cytopathic effect in A549 cells, which support adenovirus replication, but
which do not provide E1 sequences in trans, verified that wild-type
revertants were not present in any of the adenovirus preparations.
HBV transgenic mice. HBV transgenic mice with greater than genome
length HBV sequence stably integrated into their genomes, which
constitutively generates HBV particles [40], were used to assess the
antiviral efficacy of shRNA-encoding adenoviral vectors. All procedures
were approved by the Animal Care Committee at Stanford University. A
dose of 5 � 109 adenovirus infectious particles was injected via the tail
vein. Serum HBsAg was measured using a quantitative sandwich ELISA
from Abbott Laboratories, and HBeAg was determined using the ECLIA
from Roche Diagnostics (Mannheim, Germany) according to the man-
ufacturerTs instructions. Viral loads were determined using real-time PCR
according to procedures described above. Adenovirus gene transduction,
assessed by detection of eGFP, was determined using fluorescence micro-
scopy of liver sections.
Statistical analysis. Data are expressed as the mean F standard error of
the mean. Statistical difference was considered significant when P b 0.05
and was determined according to the Dunnett multiple comparison test
and calculated with the GraphPad Prism software package (GraphPad
Software, Inc., CA, USA).
ACKNOWLEDGMENTS
This work was supported by grants from the South African Innovation Fund, the
National Research Foundation, the South African Poliomyelitis Research
Foundation, Mellon Trust, and les Ministeres Francais des Affaires Etrangeres
et de lTEducation Nationale et de la Recherche. We thank the vector core facility
of the University Hospital of Nantes supported by the Association Francaise
contre les Myopathies for providing the adenovirus vectors. The pCH-9/3091
plasmid was generously provided by Michael Nassal. We are also grateful to
Gladys Gagliardi for providing technical support, to Marjorie Robbins for
assistance with the design of primers for the interferon response, and to Anna
Kramvis for HBV subgenotype A1 sequence alignments.
RECEIVED FOR PUBLICATION AUGUST 19, 2005; REVISED OCTOBER 8, 2005;
ACCEPTED OCTOBER 27, 2005.
APPENDIX A. SUPPLEMENTARY DATA
Supplementary data associated with this article can befound in the online version at doi:10.1016/j.ymthe.2005.10.013.
REFERENCES1. Arbuthnot, P., Capovilla, A., and Kew, M. (2000). Putative role of hepatitis B virus X
protein in hepatocarcinogenesis: effects on apoptosis, DNA repair, mitogen-activated
protein kinase and JAK/STAT pathways. J. Gastroenterol. Hepatol. 15: 357 – 368.
2. Beasley, R. P., and Hwang, L. Y. (1984). Hepatocellular carcinoma and hepatitis B virus.
Semin. Liver Dis. 4: 113 – 121.
3. Szmuness, W., Neurath, A. R., Stevens, C. E., Strick, N., and Harley, E. J. (1981).
Prevalence of hepatitis B beQ antigen and its antibody in various HBsAg carrier
populations. Am. J. Epidemiol. 113: 113 – 121.
4. Kramvis, A., Kew, M., and Francois, G. (2005). Hepatitis B virus genotypes. Vaccine 23:
2409 – 2423.
5. Schaefer, S. (2005). Hepatitis B virus: significance of genotypes. J. Viral Hepatitis 12:
111 – 124.
6. Kew, M. C., Kramvis, A., Yu, M. C., Arakawa, K., and Hodkinson, J. (2005). Increased
hepatocarcinogenic potential of hepatitis B virus genotype A in Bantu-speaking sub-
Saharan Africans. J. Med. Virol. 75: 513 – 521.
7. Hanazaki, K. (2004). Antiviral therapy for chronic hepatitis B: a review. Curr. Drug
Targets Inflammation Allergy 3: 63 – 70.
8. van Nunen, A. B., Janssen, H. L., Wolters, L. M., Niesters, H. G., de Man, R. A., and
Schalm, S. W. (2001). Is combination therapy with lamivudine and interferon-alpha
superior to monotherapy with either drug? Antiviral Res. 52: 139 – 146.
9. Tiollais, P., Pourcel, C., and Dejean, A. (1985). The hepatitis B virus. Nature 317:
489 – 495.
10. Chen, H. S., et al. (1993). The woodchuck hepatitis virus X gene is important for
establishment of virus infection in woodchucks. J. Virol. 67: 1218 – 1226.
11. Zoulim, F., Saputelli, J., and Seeger, C. (1994). Woodchuck hepatitis virus X protein is
required for viral infection in vivo. J. Virol. 68: 2026 – 2030.
12. Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. (2001).
Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian
cells. Nature 411: 494 – 498.
13. Hammond, S. M., Bernstein, E., Beach, D., and Hannon, G. J. (2000). An RNA-directed
nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 404:
293 – 296.
14. Sharp, P. A. (2001). RNA interference—2001. Genes Dev. 15: 485 – 490.
15. Brummelkamp, T. R., Bernards, R., and Agami, R. (2002). A system for stable expression
of short interfering RNAs in mammalian cells. Science 296: 550 – 553.
16. Elbashir, S. M., Lendeckel, W., and Tuschl, T. (2001). RNA interference is mediated by
21- and 22-nucleotide RNAs. Genes Dev. 15: 188 – 200.
17. Miyagishi, M., and Taira, K. (2002). U6 promoter driven siRNAs with four uridine 3V
overhangs efficiently suppress targeted gene expression in mammalian cells. Nat.
Biotechnol. 20: 497 – 500.
18. Chen, Y., et al. (2003). Inhibition of hepatitis B virus replication by stably expressed
shRNA. Biochem. Biophys. Res. Commun. 311: 398 – 404.
19. Giladi, H., Ketzinel-Gilad, M., Rivkin, L., Felig, Y., Nussbaum, O., and Galun, E. (2003).
Small interfering RNA inhibits hepatitis B virus replication in mice. Mol. Ther. 8: 769 – 776.
20. Hamasaki, K., Nakao, K., Matsumoto, K., Ichikawa, T., Ishikawa, H., and Eguchi, K.
(2003). Short interfering RNA-directed inhibition of hepatitis B virus replication. FEBS
Lett. 543: 51 – 54.
21. Klein, C., et al. (2003). Inhibition of hepatitis B virus replication in vivo by nucleoside
analogues and siRNA. Gastroenterology 125: 9 – 18.
22. Konishi, M., Wu, C. H., and Wu, G. Y. (2003). Inhibition of HBV replication by siRNA in
a stable HBV-producing cell line. Hepatology 38: 842 – 850.
23. McCaffrey, A. P., et al. (2003). Inhibition of hepatitis B virus in mice by RNA
interference. Nat. Biotechnol. 21: 639 – 644.
24. Shlomai, A., and Shaul, Y. (2003). Inhibition of hepatitis B virus expression and
replication by RNA interference. Hepatology 37: 764 – 770.
25. Uprichard, S. L., Boyd, B., Althage, A., and Chisari, F. V. (2005). Clearance of hepatitis B
virus from the liver of transgenic mice by short hairpin RNAs. Proc. Natl. Acad. Sci. USA
102: 773 – 778.
26. Wu, H. L., et al. (2005). RNA interference-mediated control of hepatitis B virus and
emergence of resistant mutant. Gastroenterology 128: 708 – 716.
27. Ying, C., De Clercq, E., and Neyts, J. (2003). Selective inhibition of hepatitis B virus
replication by RNA interference. Biochem. Biophys. Res. Commun. 309: 482 – 484.
28. Kimbi, G. C., Kramvis, A., and Kew, M. C. (2004). Distinctive sequence characteristics
of subgenotype A1 isolates of hepatitis B virus from South Africa. J. Gen. Virol. 85:
1211 – 1220.
29. Kawasaki, H., and Taira, K. (2003). Short hairpin type of dsRNAs that are controlled by
tRNA(Val) promoter significantly induce RNAi-mediated gene silencing in the
cytoplasm of human cells. Nucleic Acids Res. 31: 700 – 707.
30. Akashi, H., Matsumoto, S., and Taira, K. (2005). Gene discovery by ribozyme and siRNA
libraries. Nat. Rev. Mol. Cell Biol. 6: 413 – 422.
31. Matsumoto, S., Miyagishi, M., Akashi, H., Nagai, R., and Taira, K. (2005). Analysis of
double-stranded RNA-induced apoptosis pathways using interferon-response nonindu-
cible small interfering RNA expression vector library. J. Biol. Chem. 280: 25687 – 25696.
32. Nassal, M. (1992). The arginine-rich domain of the hepatitis B virus core protein is
required for pregenome encapsidation and productive viral positive-strand DNA
synthesis but not for virus assembly. J. Virol. 66: 4107 – 4116.
33. Passman, M., Weinberg, M., Kew, M., and Arbuthnot, P. (2000). In situ demonstration
of inhibitory effects of hammerhead ribozymes that are targeted to the hepatitis Bx
sequence in cultured cells. Biochem. Biophys. Res. Commun. 268: 728 – 733.
34. Bridge, A. J., Pebernard, S., Ducraux, A., Nicoulaz, A. L., and Iggo, R. (2003). Induction of
an interferon response by RNAi vectors in mammalian cells. Nat. Genet. 34: 263 – 264.
35. Sledz, C. A., Holko, M., de Veer, M. J., Silverman, R. H., and Williams, B. R. (2003).
Activation of the interferon system by short-interfering RNAs. Nat. Cell Biol. 5: 834 – 839.
36. Khvorova, A., Reynolds, A., and Jayasena, S. D. (2003). Functional siRNAs and miRNAs
exhibit strand bias. Cell 115: 209 – 216.
37. Reynolds, A., Leake, D., Boese, Q., Scaringe, S., Marshall, W. S., and Khvorova, A.
(2004). Rational siRNA design for RNA interference. Nat. Biotechnol. 22: 326 – 330.
38. Schwarz, D. S., Hutvagner, G., Du, T., Xu, Z., Aronin, N., and Zamore, P. D. (2003).
Asymmetry in the assembly of the RNAi enzyme complex. Cell 115: 199 – 208.
39. Kim, D. H., Behlke, M. A., Rose, S. D., Chang, M. S., Choi, S., and Rossi, J. J. (2005).
Synthetic dsRNA Dicer substrates enhance RNAi potency and efficacy. Nat. Biotechnol.
23: 222 – 226.
ARTICLE doi:10.1016/j.ymthe.2005.10.013
MOLECULAR THERAPY Vol. 13, No. 2, February 2006420Copyright C The American Society of Gene Therapy
40. Marion, P. L., et al. (2003). A transgenic mouse lineage useful for testing antivirals tar-
geting hepatitis B virus. In Frontiers in Viral Hepatitis, pp. 197–202. Elsevier, Amsterdam.
41. Rehermann, B., and Chisari, F. V. (1995). The immunology of chronic hepatitis B. In
Hepatitis B Virus: Molecular Mechanisms in Disease and Novel Strategies for Therapy
(R. Koshy, W. Caselmann Eds.), pp. 85 – 117. Imperial College Press, London.
42. Castanotto, D., Li, H., and Rossi, J. J. (2002). Functional siRNA expression from
transfected PCR products. RNA 8: 1454 – 1460.
43. Wang, C., and Stiles, C. D. (1994). Platelet-derived growth factor alpha receptor gene
expression: isolation and characterization of the promoter and upstream regulatory
elements. Proc. Natl. Acad. Sci. USA 91: 7061 – 7065.
44. Sanes, J. R., Rubenstein, J. L., and Nicolas, J. F. (1986). Use of a recombinant
retrovirus to study post-implantation cell lineage in mouse embryos. EMBO J. 5:
3133 – 3142.
45. Heermann, K. H., Gerlich, W. H., Chudy, M., Schaefer, S., and Thomssen, R.
(1999). Quantitative detection of hepatitis B virus DNA in two international
reference plasma preparations. Eurohep Pathobiology Group. J. Clin. Microbiol. 37:
68 – 73.
46. He, T. C., Zhou, S., da Costa, L. T., Yu, J., Kinzler, K. W., and Vogelstein, B. (1998). A
simplified system for generating recombinant adenoviruses. Proc. Natl. Acad. Sci. USA
95: 2509 – 2514.
ARTICLEdoi:10.1016/j.ymthe.2005.10.013
MOLECULAR THERAPY Vol. 13, No. 2, February 2006 421Copyright C The American Society of Gene Therapy
HUMAN GENE THERAPY 19:1325–1331 (November 2008)© Mary Ann Liebert, Inc.DOI: 10.1089/hum.2008.066
Brief Report
Efficient Inhibition of Hepatitis B Virus Replication In Vivo,Using Polyethylene Glycol-Modified Adenovirus Vectors
Carol Crowther,1 Abdullah Ely,1 Judith Hornby,1 Steven Mufamadi,1 Felix Salazar,2
Patricia Marion,3 and Patrick Arbuthnot1
Abstract
Achieving safe delivery of anti-hepatitis B virus (HBV) RNA interference (RNAi) effectors is an important ob-jective of this gene-silencing technology. Adenoviruses (Ads) have a natural tropism for the liver after systemicadministration, and are useful for delivery of expressed anti-HBV RNAi sequences. However, a drawback ofAd vectors is diminished efficacy and toxicity that results from stimulation of innate and adaptive immunity.To attenuate these effects we used monomethoxy polyethylene glycol-succinimidyl propionate (mPEG-SPA) tomodify first-generation vectors that express an anti-HBV RNAi effector. Efficient hepatocyte transduction andknockdown of HBV replication were achieved after intravenous administration of 5 � 109 PEGylated or nativerecombinant Ads to HBV transgenic mice. After the first injection, circulating HBV viral particle equivalents(VPEs) remained low for 3 weeks and began to increase after 5 weeks. A second dose of PEGylated anti-HBVAd caused a less sustained decrease in circulating VPEs, but no silencing after a second dose was observed inanimals treated with unmodified vector. Release of inflammatory cytokines, including monocyte chemoattrac-tant protein-1 (MCP-1), interferon-�, interleukin-6, and tumor necrosis factor-�, was elevated in animals re-ceiving unmodified vectors. However, only a modest increase in MCP-1 was observed in mice that received asecond dose of PEG Ads. Also, polymer-conjugated vectors induced a weaker adaptive immune response andwere less hepatotoxic than their unmodified counterparts. Collectively, these observations show that PEG mod-ification of Ads expressing RNAi effectors improves their potential for therapeutic application against HBV in-fection.
1325
Introduction
IT IS ESTIMATED that globally there are 387 million carriersof hepatitis B virus (HBV) and persistent infection with the
virus places individuals at high risk for the life-threateningcomplications of cirrhosis and hepatocellular carcinoma(HCC) (Arbuthnot and Kew, 2001; El-Serag and Rudolph,2007). Licensed anti-HBV agents, which include interferon(IFN)-�, nucleoside (lamivudine), and nucleotide (adefovir)analogs, are only partially effective (Hanazaki, 2004). Seri-ous complications of infection with HBV are thus likely toremain significant global medical problems and the devel-opment of new effective therapy continues to be an impor-tant objective. The demonstration that HBV replication is
susceptible to RNA interference (RNAi)-mediated silencing(Giladi et al., 2003; Klein et al., 2003; McCaffrey et al., 2003;Shlomai and Shaul, 2003; Uprichard et al., 2005; Carmona etal., 2006) has prompted investigations aimed at harnessingthis pathway for therapeutic application. Exogenous activa-tors of RNAi are typically expressed primary or precursormicroRNA (miR) mimics or synthetic small interfering RNAs(siRNAs). Both classes of RNAi effector have been used tosilence HBV replication and each has distinct advantages.Although the dose and delivery of synthetic siRNAs are rel-atively easy to achieve, DNA expression cassettes have bet-ter stability, sustained silencing effects, and are compatiblewith incorporation into highly efficient viral vectors. To date,the most promising viral vectors that have been used to de-
1Antiviral Gene Therapy Research Unit, Department of Molecular Medicine and Hematology, University of the Witwatersrand, Johan-nesburg, South Africa.
2Stanford University, Stanford, CA 94035.3Hepadnavirus Testing, Mountain View, CA 94043.
liver anti-HBV sequences are recombinant adenoviruses(Ads) (Uprichard et al., 2005; Carmona et al., 2006) and adeno-associated viruses (AAVs) (Moore et al., 2005). Ads have theuseful properties of efficient targeting of hepatocytes in vivoafter systemic administration, lack of integration into host ge-nome sequences, stability, and ease of preparation (reviewedin Bangari and Mittal, 2006). However, widespread use ofthese vectors has been limited by preexisting immunity andtheir powerful induction of innate and adaptive immune re-sponses. After intravenous administration, adenoviruses arereadily taken up by Kupffer cells in the liver. Ad capsid pro-teins mediate signal transduction via mitogen-activated pro-tein kinases (MAPKs), which leads to activation of an innateimmune response. Associated release of cytokines, for exam-ple, interleukin (IL)-6 and IL-12 (Zhang et al., 2001), causeslocal inflammation and toxicity (Guidotti and Chisari, 2001;Schnell et al., 2001; Taniguchi et al., 2003; Chen et al., 2008).Resulting damage to healthy tissues with decreased trans-gene expression is thus a significant concern for therapeuticuse of recombinant Ads. Given the importance of Ad capsidproteins in mediating immune responses, methods have beendevised to attenuate immunostimulation by modifying Adcapsid proteins with polymers such as polyethylene glycol(PEG) and poly-N-(2-hydroxypropyl)methacrylamide (Krep-pel and Kochanek, 2008). Although decreased immunostim-ulation has been shown by this approach (Croyle et al., 2000,2002, 2005; Eto et al., 2004; Mok et al., 2005), there have beenfew studies that measured the efficiency of polymer-modi-fied Ad vectors in vivo in disease models. In this study, weassessed PEG-modified first-generation vectors that expressan RNAi activator that we have previously shown to silenceHBV replication efficiently (Carmona et al., 2006). We ob-served that PEGylation improved silencing of HBV in vivo ina murine transgenic model of HBV replication. This chemi-cal modification also significantly suppressed immunostim-ulation and hepatotoxicity.
Materials and Methods
Adenoviral vectors
First-generation adenoviral vectors expressing enhancedgreen fluorescent protein (eGFP) together with anti-HBVshort hairpin RNA 6 (shRNA 6) or shRNA 10 (Carmona etal., 2006) were generated according to the AdEasy procedure(He et al., 1998). The methods used to modify the viral vec-tors with monomethoxy polyethylene glycol-succinimidylpropionate (mPEG-SPA) were based on previously de-scribed protocols (Croyle et al., 2000; Eto et al., 2004). Achange in molecular weight of the hexon protein from 105to approximately 140 kDa, determined by polyacrylamidegel electrophoresis (PAGE) or microchip analysis, was usedto verify PEGylation. Determination of the number of infec-tious particles in PEGylated or unPEGylated preparationswas carried out with the Adeno-X rapid titer kit (Clontech,Mountain View, CA) with minor modifications.
Cell culture and Northern blot analysis
Culture and transfection of Huh7 and HEK293 lines wascarried out as described (Carmona et al., 2006). For Northernblot hybridization (Ely et al., 2008), liver-derived Huh7 cellswere infected with an approximate multiplicity of infection
of 100 recombinant adenovirus vectors per cell and harvested2 days thereafter, before extracting total RNA with TRIreagent (Sigma-Aldrich, St. Louis, MO). Blots were hy-bridized to digoxigenin (DIG)-labeled oligonucleotides, us-ing methods that were recommended by the suppliers (RocheApplied Science, Mannheim, Germany). An oligonucleotidesequence complementary to U6 small nuclear RNA (snRNA)was used as a control for equal loading of the cellular RNA(Ely et al., 2008). The oligonucleotide sequence of the shRNA6 probe was 5�-TGCACTTCGCTTCACCTC-3�.
Adenoviral vector administration to HBV transgenic mice
HBV transgenic mice (Marion et al., 2003) were used to de-termine the effects of RNAi-activating adenoviral vectors onmarkers of HBV replication in vivo. These experiments werecarried out in accordance with protocols approved by theUniversity of the Witwatersrand Animal Ethics ScreeningCommittee. A dose of 5 � 109, 1 � 109, or 5 � 108 adenovi-rus infectious particles was injected as a bolus via the tailvein and blood was collected by retroorbital puncture. In allexperiments, groups of mice comprised eight animals each.Circulating viral particle equivalents (VPEs) and hepaticHBV mRNA were determined by real-time polymerase chainreaction (PCR) according to previously described methods(Carmona et al., 2006; Ely et al., 2008). Adenovirus gene trans-duction was assessed by detecting eGFP microscopically infrozen liver sections taken 48 hr after initial adenovirus in-jection of separate animals.
Cytokine assays
A cytometric bead array (CBA) mouse inflammation kit (BD Biosciences, San Jose, CA) was employed to measure IL-6, IL-10, monocyte chemoattractant protein-1 (MCP-1), IFN-�, tumor necrosis factor-� (TNF-�), and IL-12p70. Recombinantstandards were also included to calibrate the assay.
Anti-adenovirus immunoglobulin assay
To measure mouse antibodies against complete Ad virions,a previously described protocol was followed (Jiang et al.,2004). The anti-Ad mouse antibodies were detected with a per-oxidase-conjugated secondary anti-mouse immunoglobulin(Dako, Carpinteria, CA) with o-phenylenediamine dihy-drochloride as the chromogenic substrate. To detect mouse an-tibodies to the Ad hexon protein, the RIDASCREEN kit (R-Bio-pharm Rhône, Pfungstadt, Germany) was used. The protocolwas done according to the manufacturer’s instructions exceptthat a 1:10,000 dilution of mouse serum was used and the kitsecondary antibody was substituted with peroxidase-conju-gated anti-mouse immunoglobulin (Dako).
Serum transaminase assay
Aspartate transaminase (AST) and alanine transaminase(ALT) activities were measured by a kinetic assay with anautomated photometric analyzer (Roche Diagnostics,Rotkreuz, Switzerland).
Statistical analysis
Means � standard error of the mean (SEM) were calcu-lated and a statistical difference was considered significant
CROWTHER ET AL.1326
when p � 0.05 and was determined according to the Stu-dent two-tailed t test. Calculations were done with theGraphPad Prism software package (GraphPad Software,San Diego, CA).
Results
HBV target sequence
The HBV genome has a compact arrangement with over-lapping open reading frames (ORFs) and cis elements em-bedded within protein-coding sequences. There is a singletranscription termination signal, which results in all HBVtranscripts having a common 3� end that includes HBx. Thisarrangement limits sequence flexibility of the virus andmakes HBx a particularly good target for nucleic acid hy-bridization-based gene silencing. Previous work from ourlaboratory demonstrated that Ads expressing hairpin se-quences targeting HBx (HBV coordinates 1580–1604) are ef-ficient silencers of HBV gene expression and replication (Car-mona et al., 2006). To assess potential improvement bypolymer modification, we selected the recombinant adeno-virus vector that expresses HBV shRNA 6 (Ad HBV shRNA6) and subjected this to analysis after PEG conjugation. Af-ter infection of Huh7 cells in culture with Ad HBV shRNA6, the intended anti-HBV guide sequence was detected (Fig.1A), which verified that transcripts of the expression cassettewere indeed processed by the RNAi pathway.
Anti-HBV efficacy of PEG-modified Ad vectors
Ad HBV shRNA 6 vectors were modified with mPEG-SPA, and efficient addition of PEG to the Ad hexon proteinwas verified by microchip electrophoretic analysis (data notshown). Titration of PEG-modified vectors did not result inan appreciable decrease in infectivity, and suitable concen-trations for in vivo application were routinely achieved. He-patic delivery of transgenes was assessed after injection ofmice with 5 � 109 infectious recombinant virus particles. Flu-orescence microscopy of frozen liver sections showed thatapproximately 80% of liver cells were transduced 48 hr af-ter injection, and that this was achieved with both native andmodified vectors (Fig. 1B and C). eGFP was also not de-tectable in any significant amounts in nonhepatic tissue (datanot shown). Our PEG modification procedure therefore didnot compromise delivery efficiency and liver targeting ofthese vectors after systemic administration.
HBV transgenic mice were then injected with PEGylatedand native Ads expressing HBV shRNA 6 and anti-HBV ef-ficacy was measured by determining the number of circu-lating VPEs (Fig. 1D). Initial effects of PEGylated and un-modified vectors on circulating VPEs were similar in micetreated with both vectors. There was a significant drop in thecirculating VPEs in each of the groups of animals 1 week af-ter administration of the virus. This effect persisted for ap-proximately 4 weeks, and at week 5 the VPE titer had in-creased to approach baseline levels. At week 5, a second dose
RNAi PEG ADENOVIRUS VECTORS AGAINST HBV 1327
FIG. 1. Anti-HBV efficacy of recombinantAds. (A) Northern hybridization analysis of ex-pressed anti-HBV sequences. RNA was ex-tracted from Huh7 cells after infection with re-combinant viruses expressing the indicatedshRNA cassettes or from uninfected cells. Blotswere hybridized to a probe complementary tothe intended shRNA 6 guide strand and thenstripped and rehybridized to an endogenousU6 snRNA probe to confirm equal loading ofcellular RNA (bottom). Shown is a representa-tive fluorescence microscopy analysis of frozensections from mouse liver that was processed48 hr after administration of 5 � 109 native (B)and PEG-modified (C) Ad vectors. The locationof the portal vein (PV) is indicated. (D) Circu-lating VPEs in HBV transgenic mice after ad-ministration of PEG-modified and native Ads.Animals received two injections of 5 � 109 in-fectious Ad particles, which were administeredat commencement of the experiment and 5weeks after the initial injection. Titers of VPEswere determined by real-time quantitativePCR. (E) Effects of Ad dose on hepatic HBVmRNA. Animals were killed 1 week after in-travenous administration of PEG-modified vec-tors at doses of 5 � 109 (HD), 1 � 109 (MD), and5 � 108 (LD) vector particles. Mean ratios ofHBV surface mRNA (�SEM) were measuredrelative to eGFP mRNA, using quantitativereal-time PCR. *p � 0.05; **p � 0.01.
of Ad vectors was administered to the mice via the tail vein.At week 7, the PEG-modified vectors effected a decrease inVPEs, which was not observed after treatment with the un-modified Ads. By 3 weeks after the second PEG Ad vectorinjection the number of circulating VPEs had returned tobaseline concentrations, which indicates that silencing effi-cacy after the second Ad injection is less sustained than af-ter the initial vector administration. Knockdown of intra-hepatic HBV mRNA was also measured 1 week afteradministration of various doses of Ad HBV shRNA 6 or con-trol Ad HBV shRNA 10 (Fig. 1E). Quantitative reverse tran-scription PCR, using primers that target the HBV surfaceORF, showed that intrahepatic HBV mRNA was diminishedin animals that had been treated with 5 � 109 Ad HBVshRNA 6 particles. This effect was not observed when micereceived lower doses of the PEG-modified recombinant vec-tor. Moreover, PEGylated Ad HBV shRNA 10 did not di-minish intrahepatic HBV mRNA concentration, which is inkeeping with the previously reported observations showingthat this unmodified Ad vector had no effect against HBVreplication (Carmona et al., 2006).
Serum cytokine concentrations after injection ofPEGylated and unmodified Ad vectors
The improved anti-HBV efficacy of PEGylated vectors islikely to result from an attenuated immune response to thepolymer-coated Ads (Croyle et al., 2002, 2005; Eto et al., 2004;Mok et al., 2005). To assess the effects of PEGylated and un-modified Ad HBV shRNA 6 on the release of inflammatory
cytokines, serum concentrations of a selection of cytokinesand chemokines were determined. Initially, blood was col-lected 6 and 24 hr after the first injection of mice with re-combinant vectors and the cytokines were measured by aCBA assay. The panel of cytokines, comprising TNF-�, IL-12, MCP-1, IL-10, IL-6, and IFN-�, included markers thatgive a broad indication of innate and adaptive immune re-sponse activation. At the time point of 6 hr after injection ofthe first dose of Ad HBV shRNA 6, MCP-1 was elevated inmice receiving the unPEGylated vector but not in the serumof animals receiving PEG-modified recombinant virus. By 24hr after injection, the serum MCP-1 concentration revertedto baseline control levels (data not shown). MCP-1 is pro-duced from a variety of cells and functions as a monocytechemoattractant (Furutani et al., 1989; Yoshimura et al., 1989)and mediator of inflammation (Jones et al., 1992; Koch et al.,1992). Although other studies have reported stimulation ofsecretion of additional proinflammatory cytokines after Adadministration, our observations may be specific to the lineof HBV transgenic mice studied here and also the low doseof Ad that these animals received.
Serum concentrations of cytokines were again measuredin animals that received a second dose of native and PEG-modified Ad. PEG-modified vectors caused modest eleva-tion of only MCP-1 at 6 hr, and the concentration of thischemokine reverted to baseline 24 hr after injection (Fig. 2).Because a raised serum MCP-1 concentration was also theonly marker of immunostimulation after initial administra-tion of native Ad, secretion of this chemokine may be themost sensitive indicator of Ad-induced immunostimulation
CROWTHER ET AL.1328
FIG. 2. Serum cytokine concentrations after second administration of Ads to HBV transgenic mice. (A) Representativeflow cytometry data from CBA assay for TNF-�, IL-12, MCP-1, IL-10, IL-6, and IFN-� 6 and 24 hr after adenovirus injec-tion. Shown are mean concentrations of MCP-1 (B), IFN-� (C), IL-6 (D), and TNF-� (E) in mice at baseline and 6 and 24 hrafter administration of PEG-modified and native adenoviral vectors. ***p � 0.005.
under the experimental conditions described here. CBA anal-ysis revealed that concentrations of TNF-�, IFN-�, MCP-1,and IL-6 were markedly elevated in mice 6 hr after receiv-ing the unmodified vector. By 24 hr, the concentrations hadreturned to normal baseline levels. These cytokines are in-volved in crucial steps of humoral and cell-mediated im-munity and their elevation indicates potent activation of botharms of the adaptive immune response after administrationof unmodified vectors. This observation contrasts with themodest acute elevation in serum MCP-1 concentration afterinjection of PEGylated Ads and indicates that this modifica-tion diminishes immunostimulatory properties of the anti-HBV vectors.
Assay of anti-Ad vector immunoglobulin titers and markers of hepatocyte toxicity
To measure the concentrations of humoral immune re-sponse to Ad vectors, enzyme-linked immunosorbent assays(ELISAs) were performed to detect antibodies interactingwith Ad hexon proteins and also complete Ad particles.Comparison of the relative optical density (OD) readings in-dicated that there was a significant difference in im-munoglobulin titers in animals 5 weeks after receiving eitherunmodified and PEGylated vectors (Fig. 3A). Lower valuesobserved after administration of PEGylated vectors confirmthat the humoral immune response is attenuated and corre-lates with diminished cytokine release, as well as data re-ported by others (Croyle et al., 2002, 2005; Eto et al., 2004;Mok et al., 2005). Hepatotoxic effects of the Ad administra-tion were determined by measurement of ALT and AST ac-tivities in the serum of mice 1 day and 1 week after receiv-ing a second dose of the PEG-modified or unmodified Advectors (Fig. 3B). Compared with mice receiving the PEGy-lated Ads, the serum concentrations of both transaminaseswere significantly increased at 24 hr in animals receiving un-modified vectors. Taken together, our data support the interpretation that PEG modification improves anti-HBV efficacy, attenuates immunostimulatory properties, and im-proves the safety profile of recombinant Ad vectors in a strin-gent model of HBV infection.
Discussion
Recombinant adenovirus vectors have several propertiesthat make them useful for therapeutic transfer of anti-HBVsequences (Bangari and Mittal, 2006). These include efficientinfection of nondividing cells, hepatocyte targeting after sys-temic administration in vivo, and transient transgene ex-pression that is sustained for weeks without integrating intohost DNA. However, immunostimulatory effects of Ads maybe toxic and also diminish the efficiency of transgene ex-pression. In addition to modification with synthetic poly-mers, as was used here, a number of approaches have beenemployed to diminish activation of host immune responses.These include immunosuppression (Smith et al., 1996; Ye etal., 2000), silencing mediators of hepatocyte injury (Chen etal., 2008), serotype switching (Vogels et al., 2003), genetic ma-nipulation of capsid-encoding sequences (Roberts et al.,2006), and use of high-dose vectors (Parks et al., 1996). Al-though these strategies have had success, there are limita-tions to their general applicability. For example, immuno-suppression has side effects that would not be desirable in
a clinical setting of HBV treatment. Importantly, Ad im-munostimulation is largely mediated by viral capsid pro-teins, and is not dependent on viral gene expression or trans-duction (Schnell et al., 2001). Modification of viral capsidproteins with PEG is therefore an attractive method to con-trol Ad immunostimulatory properties.
PEG has been widely used in various therapeutic appli-cations and has well-characterized pharmacologic proper-ties. The polymer has low immunogenicity, is nontoxic, andimproves the water solubility of PEG complexes (reviewedin Kreppel and Kochanek, 2008). In addition, PEG has otheradvantageous properties such as simultaneous modificationof many surface proteins without the need for genetic ma-nipulation, improvement of vector stability, and diminish-ment of nonspecific interactions. Covalent attachment ofPEG to Ads can be carried out under mild reaction condi-tions to preserve vector bioactivity. The modification em-ployed in this study entailed use of a semitelechelic mPEG-SPA, which reacts with lysine residues of the vector hexon,fiber, and penton proteins (O’Riordan et al., 1999). These are
RNAi PEG ADENOVIRUS VECTORS AGAINST HBV 1329
FIG. 3. Relative serum anti-Ad immunoglobulin concen-trations and transaminase activities after vector administra-tion to mice. (A) Total anti-Ad and anti-hexon protein-spe-cific antibodies were measured by ELISA. (B) Transaminase(ALT and AST) activities were measured 24 hr and 1 weekafter the second injection of PEGylated or unmodified ade-noviral vectors. Mean relative optical density readings(�SEM) and enzyme activities are given.
also the main targets of host neutralizing antibodies and PEGconjugation is therefore ideal to counter Ad interaction withhost antibodies.
The bolus of 5 � 109 Ad infectious particles administeredsystemically to mice in this study represents a low dose com-pared with that used in other studies. Ad activation of den-dritic cells and macrophages with resultant release of IL-6and IL-12 was observed in mice treated with 0.3–5 � 1011
particles per animal (Zhang et al., 2001). In primates, intra-portal administration of up to 5 � 1012 particles/kg led to aself-limiting hepatitis, but higher doses caused massive he-patic necrosis and coagulopathy within days of vector ad-ministration (Schnell et al., 2001). This dose-dependent effecthas also been reported on readministration of Ad vectors(Nunes et al., 1999). The significantly lower dose that wasused in this study (approximately 2 � 1010 particles/kg) islikely to contribute to our observation of attenuated im-munostimulation and improved safety. However, it appearsthat efficacy of RNAi-activating Ads is dose dependent, asadministration of lower amounts of Ads did not cause sig-nificant HBV gene silencing. Although complete silencing ofHBV replication was not observed in this study, a higher Addose may well silence HBV replication more effectively.However, higher doses have lethal toxic effects (data notshown), which are likely to result from Ad immunostimula-tion and saturation of the endogenous miR pathway (Grimmet al., 2006). The low dose of vector that was required to beeffective as well as the favorable effects of PEG modificationof Ad vectors are important means of improving the safetyprofile of RNAi-activating recombinant Ads for potentialtherapeutic application. To enhance the sustained efficiencyof RNAi-inducing anti-HBV vectors, our current research isaimed at investigating PEG-modified HD RNAi-activatingvectors and their long-term use in conjunction with existinglicensed anti-HBV agents (e.g., lamivudine).
Acknowledgments
This work was supported by funding under the Sixth Re-search Framework Programme of the European Union, Proj-ect RIGHT (LSHB-CT-2004-005276), from the South AfricanNational Research Foundation, ESASTAP, CANSA, and theSouth African Poliomyelitis Research Foundation. The authorsthank Gladys Gagliardi for technical assistance and AdrianPuren for critical reading of the manuscript. The vector corefacility of the University Hospital of Nantes, supported by theAssociation Française contre les Myopathies (AFM), assistedwith preparation of the unmodified adenovirus vectors.
Author Disclosure Statement
The authors declare no conflicting interests.
References
Arbuthnot, P., and Kew, M. (2001). Hepatitis B virus and hepa-tocellular carcinoma. Int. J. Exp. Pathol. 82, 77–100.
Bangari, D.S., and Mittal, S.K. (2006). Current strategies and fu-ture directions for eluding adenoviral vector immunity. Curr.Gene Ther. 6, 215–226.
Carmona, S., Ely, A., Crowther, C., Moolla, N., Salazar, F.H.,Marion, P.L., Ferry, N., Weinberg, M.S., and Arbuthnot, P.(2006). Effective inhibition of HBV replication in vivo by Anti-HBx short hairpin RNAs. Mol. Ther. 13, 411–421.
Chen, Q., Wei, H., Sun, R., Zhang, J., and Tian, Z. (2008). Ther-apeutic RNA silencing of Cys-X3-Cys chemokine ligand 1 geneprevents mice from adenovirus vector-induced acute liver in-jury. Hepatology 47, 648–658.
Croyle, M.A., Yu, Q.C., and Wilson, J.M. (2000). Developmentof a rapid method for the PEGylation of adenoviruses withenhanced transduction and improved stability under harshstorage conditions. Hum. Gene Ther. 11, 1713–1722.
Croyle, M.A., Chirmule, N., Zhang, Y., and Wilson, J.M. (2002).PEGylation of E1-deleted adenovirus vectors allows signifi-cant gene expression on readministration to liver. Hum. GeneTher. 13, 1887–1900.
Croyle, M.A., Le, H.T., Linse, K.D., Cerullo, V., Toietta, G.,Beaudet, A., and Pastore, L. (2005). PEGylated helper-depen-dent adenoviral vectors: Highly efficient vectors with an en-hanced safety profile. Gene Ther. 12, 579–587.
El-Serag, H.B., and Rudolph, K.L. (2007). Hepatocellular carci-noma: Epidemiology and molecular carcinogenesis. Gas-troenterology 132, 2557–2576.
Ely, A., Naidoo, T., Mufamadi, S., Crowther, C., and Arbuthnot,P. (2008). Expressed anti-HBV primary microRNA shuttles in-hibit viral replication efficiently in vitro and in vivo. Mol. Ther.16, 1105–1112.
Eto, Y., Gao, J.Q., Sekiguchi, F., Kurachi, S., Katayama, K.,Mizuguchi, H., Hayakawa, T., Tsutsumi, Y., Mayumi, T., andNakagawa, S. (2004). Neutralizing antibody evasion ability ofadenovirus vector induced by the bioconjugation of methoxy-polyethylene glycol succinimidyl propionate (MPEG-SPA).Biol. Pharm. Bull. 27, 936–938.
Furutani, Y., Nomura, H., Notake, M., Oyamada, Y., Fukui, T.,Yamada, M., Larsen, C.G., Oppenheim, J.J., and Matsushima,K. (1989). Cloning and sequencing of the cDNA for humanmonocyte chemotactic and activating factor (MCAF).Biochem. Biophys. Res. Commun. 159, 249–255.
Giladi, H., Ketzinel-Gilad, M., Rivkin, L., Felig, Y., Nussbaum,O., and Galun, E. (2003). Small interfering RNA inhibits he-patitis B virus replication in mice. Mol. Ther. 8, 769–776.
Grimm, D., Streetz, K.L., Jopling, C.L., Storm, T.A., Pandey, K.,Davis, C.R., Marion, P., Salazar, F., and Kay, M.A. (2006). Fatality in mice due to oversaturation of cellular mi-croRNA/short hairpin RNA pathways. Nature 441, 537–541.
Guidotti, L.G., and Chisari, F.V. (2001). Noncytolytic control ofviral infections by the innate and adaptive immune response.Annu. Rev. Immunol. 19, 65–91.
Hanazaki, K. (2004). Antiviral therapy for chronic hepatitis B: Areview. Curr. Drug Targets Inflamm. Allergy 3, 63–70.
He, T.C., Zhou, S., Da Costa, L.T., Yu, J., Kinzler, K.W., and Vo-gelstein, B. (1998). A simplified system for generating recom-binant adenoviruses. Proc. Natl. Acad. Sci. U.S.A. 95,2509–2514.
Jiang, H., Wang, Z., Serra, D., Frank, M.M., and Amalfitano, A.(2004). Recombinant adenovirus vectors activate the alterna-tive complement pathway, leading to the binding of humancomplement protein C3 independent of anti-ad antibodies.Mol. Ther. 10, 1140–1142.
Jones, M.L., Mulligan, M.S., Flory, C.M., Ward, P.A., and War-ren, J.S. (1992). Potential role of monocyte chemoattractantprotein 1/JE in monocyte/macrophage-dependent IgA im-mune complex alveolitis in the rat. J. Immunol. 149, 2147–2154.
Klein, C., Bock, C.T., Wedemeyer, H., Wustefeld, T., Locarnini,S., Dienes, H.P., Kubicka, S., Manns, M.P., and Trautwein, C.(2003). Inhibition of hepatitis B virus replication in vivo by nu-cleoside analogues and siRNA. Gastroenterology 125, 9–18.
Koch, A.E., Kunkel, S.L., Harlow, L.A., Johnson, B., Evanoff,H.L., Haines, G.K., Burdick, M.D., Pope, R.M., and Strieter,
CROWTHER ET AL.1330
R.M. (1992). Enhanced production of monocyte chemoattractantprotein-1 in rheumatoid arthritis. J. Clin. Invest. 90, 772–779.
Kreppel, F., and Kochanek, S. (2008). Modification of adenovi-rus gene transfer vectors with synthetic polymers: A scientificreview and technical guide. Mol. Ther. 16, 16–29.
Marion, P.L., Salazar, F.H., Liittschwager, K., Bordier, B.B.,Seegers, C., Winters, M.A., Cooper, A.D., and Cullen, J.M.(2003). A transgenic mouse lineage useful for testing antivi-rals targeting hepatitis B virus. In Frontiers in Viral Hepatitis.(Elsevier Science, Amsterdam) pp. 197–202.
McCaffrey, A.P., Nakai, H., Pandey, K., Huang, Z., Salazar, F.H.,Xu, H., Wieland, S.F., Marion, P.L., and Kay, M.A. (2003). In-hibition of hepatitis B virus in mice by RNA interference. Nat.Biotechnol. 21, 639–644.
Mok, H., Palmer, D.J., Ng, P., and Barry, M.A. (2005). Evalua-tion of polyethylene glycol modification of first-generationand helper-dependent adenoviral vectors to reduce innate im-mune responses. Mol. Ther. 11, 66–79.
Moore, M.D., McGarvey, M.J., Russell, R.A., Cullen, B.R., andMcClure, M.O. (2005). Stable inhibition of hepatitis B virusproteins by small interfering RNA expressed from viral vec-tors. J. Gene Med 7, 918–925.
Nunes, F.A., Furth, E.E., Wilson, J.M., and Raper, S.E. (1999).Gene transfer into the liver of nonhuman primates with E1-deleted recombinant adenoviral vectors: Safety of readminis-tration. Hum. Gene Ther. 10, 2515–2526.
O’Riordan, C.R., Lachapelle, A., Delgado, C., Parkes, V.,Wadsworth, S.C., Smith, A.E., and Francis, G.E. (1999). PEGylation of adenovirus with retention of infectivity andprotection from neutralizing antibody in vitro and in vivo.Hum. Gene Ther. 10, 1349–1358.
Parks, R.J., Chen, L., Anton, M., Sankar, U., Rudnicki, M.A., andGraham, F.L. (1996). A helper-dependent adenovirus vectorsystem: Removal of helper virus by Cre-mediated excision ofthe viral packaging signal. Proc. Natl. Acad. Sci. U.S.A. 93,13565–13570.
Roberts, D.M., Nanda, A., Havenga, M.J., Abbink, P., Lynch,D.M., Ewald, B.A., Liu, J., Thorner, A.R., Swanson, P.E., Gor-gone, D.A., Lifton, M.A., Lemckert, A.A., Holterman, L., Chen,B., Dilraj, A., Carville, A., Mansfield, K.G., Goudsmit, J., andBarouch, D.H. (2006). Hexon-chimaeric adenovirus serotype5 vectors circumvent pre-existing anti-vector immunity. Na-ture 441, 239–243.
Schnell, M.A., Zhang, Y., Tazelaar, J., Gao, G.P., Yu, Q.C., Qian,R., Chen, S.J., Varnavski, A.N., Leclair, C., Raper, S.E., andWilson, J.M. (2001). Activation of innate immunity in nonhu-man primates following intraportal administration of adeno-viral vectors. Mol. Ther. 3, 708–722.
Shlomai, A., and Shaul, Y. (2003). Inhibition of hepatitis B virusexpression and replication by RNA interference. Hepatology37, 764–770.
Smith, T.A., White, B.D., Gardner, J.M., Kaleko, M., and Mc-Clelland, A. (1996). Transient immunosuppression permitssuccessful repetitive intravenous administration of an adeno-virus vector. Gene Ther. 3, 496–502.
Taniguchi, M., Seino, K., and Nakayama, T. (2003). The NKT cellsystem: Bridging innate and acquired immunity. Nat. Im-munol. 4, 1164–1165.
Uprichard, S.L., Boyd, B., Althage, A., and Chisari, F.V. (2005).Clearance of hepatitis B virus from the liver of transgenic miceby short hairpin RNAs. Proc. Natl. Acad. Sci. U.S.A. 102,773–778.
Vogels, R., Zuijdgeest, D., Van Rijnsoever, R., Hartkoorn, E.,Damen, I., De Bethune, M.P., Kostense, S., Penders, G., Hel-mus, N., Koudstaal, W., Cecchini, M., Wetterwald, A.,Sprangers, M., Lemckert, A., Ophorst, O., Koel, B., VanMeerendonk, M., Quax, P., Panitti, L., Grimbergen, J., Bout,A., Goudsmit, J., and Havenga, M. (2003). Replication-defi-cient human adenovirus type 35 vectors for gene transfer andvaccination: Efficient human cell infection and bypass of pre-existing adenovirus immunity. J. Virol. 77, 8263–8271.
Ye, X., Robinson, M.B., Pabin, C., Batshaw, M.L., and Wilson,J.M. (2000). Transient depletion of CD4 lymphocyte improvesefficacy of repeated administration of recombinant adenovi-rus in the ornithine transcarbamylase deficient sparse furmouse. Gene Ther. 7, 1761–1767.
Yoshimura, T., Robinson, E.A., Tanaka, S., Appella, E., Kuratsu,J., and Leonard, E.J. (1989). Purification and amino acid anal-ysis of two human glioma-derived monocyte chemoattrac-tants. J. Exp. Med. 169, 1449–1459.
Zhang, Y., Chirmule, N., Gao, G.P., Qian, R., Croyle, M., Joshi,B., Tazelaar, J., and Wilson, J.M. (2001). Acute cytokine re-sponse to systemic adenoviral vectors in mice is mediated bydendritic cells and macrophages. Mol. Ther. 3, 697–707.
Address reprint requests to:Dr. Patrick Arbuthnot
Antiviral Gene Therapy Research UnitDepartment of Molecular Medicine and Hematology
University of the Witwatersrand Medical SchoolPrivate Bag 3
WITS, 2050 South Africa
E-mail: [email protected]
Received for publication May 20, 2008; accepted afterrevision August 21, 2008.
Published online: October 28, 2008.
RNAi PEG ADENOVIRUS VECTORS AGAINST HBV 1331
This article has been cited by:
1. A. Ely, T. Naidoo, P. Arbuthnot. 2009. Efficient silencing of gene expression with modular trimeric Pol II expression cassettescomprising microRNA shuttles. Nucleic Acids Research 37:13, e91-e91. [CrossRef]
MicroRNA 2012, 1, 000-000 1
2211-5366/12 $58.00+.00 © 2012 Bentham Science Publishers
Efficient Silencing of Hepatitis B Virus by Helper-dependent Adenovirus Vector-mediated Delivery of Artificial Antiviral Primary Micro RNAs
Mohube Betty Mowa, Carol Crowther, Abdullah Ely and Patrick Arbuthnot*
Antiviral Gene Therapy Research Unit, School of Pathology, Health Sciences Faculty, University of the Witwatersrand, Private Bag 3, WITS 2050, Johannesburg, South Africa
Abstract: Hepatitis B virus (HBV) infection is endemic to southern Africa and parts of Asia where approximately 350 million individuals are chronically infected. Persistent infection increases risk for the serious complications of cirrhosis and hepatocellular carcinoma. Licensed HBV treatments rarely eradicate the virus, which makes developing new strate-gies for the treatment of chronic HBV a priority. Pol II-transcribed mono- and trimeric primary micro RNAs (pri-miRNAs) have previously been used to activate RNA interference (RNAi) and inhibit HBV gene expression, indicating that this approach holds promise for HBV therapy. Nevertheless, achieving safe and efficient delivery of anti-HBV RNAi expression cassettes remains an important objective before therapeutic application of this gene silencing technology is re-alized. Recombinant adenoviruses (Ads) are amongst the most efficient hepatotropic gene delivery vehicles, but a draw-back of their use is transient transgene expression and toxicity that results from induction of host immune responses. To diminish immunostimulation of anti-HBV RNAi-activating vectors, helper-dependent (HD) Ads with all viral protein-encoding sequences removed from their genomes, were generated. A CMV Pol II promoter element was used to transcribe antiviral pri-miRNAs that target HBV. Processing of the anti-HBV pri-miRNA RNAi activators occurred according to in-tended design. Assessment in cultured cells and in a HBV transgenic model of the infection demonstrated that HD Ads delivered the silencing sequences efficiently and replication of the virus was inhibited without causing overt toxic effects. Collectively these data augur well for clinical use of HD Ads to deliver Pol II HBV-silencing cassettes to counter the per-sistent infection.
Keywords: HBV, Helper dependent adenovirus, Micro RNA, Pol II, RNAi.
INTRODUCTION
Approximately 6% of the world’s population are chronic carriers of the hepatitis B virus (HBV) and at risk for com-plicating hepatocellular carcinoma and cirrhosis [1]. Persis-tent infection with the virus is endemic to sub Saharan Af-rica, east and southeast Asia where it is a significant cause of public health problems. Currently available therapies are capable of suppressing HBV replication but rarely eliminate the virus [2]. Improved HBV treatment is therefore impor-tant to limit carriers’ risk for the associated life-threatening complications. Dependence of HBV on a RNA pregenomic replication intermediate, as well as compact genome ar-rangement, make the virus susceptible to potentially thera-peutic RNA interference- (RNAi-) based gene silencing. Several studies have demonstrated successful inhibition of HBV replication by harnessing this gene knock down tech-nology (reviewed in [3-6]).
Although synthetic short interfering RNAs (siRNAs) have been widely used as exogenous RNAi activators, ex-pressed intermediates of the pathway potentially have greater utility for treatment of chronic infections such as are caused by HBV. Antiviral expression cassettes typically comprise a Pol II or Pol III transcription regulatory element, down
*Address corresponding to this author at the Antiviral Gene Therapy Re-search Unit, School of Pathology, Health Sciences Faculty, University of the Witwatersrand, Private Bag 3, WITS 2050, South Africa; Tel: +27 (0)11 717 2365; Fax: +27 (0)11 717 2395; E-mail: [email protected]
stream sequence encoding mimics of precursor micro RNA (pre-miRNA) [7] or primary miRNA (pri-miRNA) [8] hair-pin-containing elements, and a transcription termination sig-nal. To date, the most commonly used RNAi expression cas-settes have incorporated Pol III regulatory elements, e.g. U6 and H1. These promoters have advantages of small size, ability to transcribe defined short transcripts constitutively and presence of most of the regulatory elements upstream of the transcription termination site. However, a disadvantage is their limited range of transcriptional control. Although regu-latable U6 promoter activity has been achieved with tetracy-cline responsive elements [9], toxicity resulting from satura-tion of the endogenous RNAi pathway remains a concern [10]. To address this problem, previous work has entailed the use of Pol II promoters to express antiviral pri-miRNAs [11-15]. Pol II elements have better transcription capabilities to enable tissue specific and precisely controlled expression of silencing sequences. Artificial pri-miRNAs are also com-patible with a polycistronic configuration to enable simulta-neous targeting of multiple viral sites. This should improve silencing efficacy and also limit the emergence of viral es-cape. Moreover, use of RNAi activators that enter the path-way at a proximal step, may improve efficacy of silencing. This is based on the concept that steps of the RNAi pathway may be functionally linked.
Previous work from our laboratory demonstrated highly efficient silencing of HBV replication by monomeric and tri-meric anti-HBV pri-miRNAs [12, 13]. The cassettes were propagated using backbone sequences from natural pri-miR-
2 MicroRNA 2012, Vol. 1 No. 1 Mowa et al.
31, pri-miR-122 and pri-miR-30a. Although these results are promising, safe and efficient hepatotropic delivery of ex-pressed antiviral miRNAs following systemic administration in vivo remains challenging. To date, recombinant adenovi-ruses (Ads) [16-18], adeno associated viruses [10] and lenti-viruses [19] have been used to deliver RNAi cassettes to the liver. The natural tropism of Ads is a very useful property, but toxic immunostimulation is problematic (reviewed in [20]). Third generation helper dependent (HD) Ads, which have viral protein coding sequences stripped from their ge-nomes, are less immunostimulatory and therefore safer. Also, the durable transgene expression that may be achieved with HD Ads is well-suited to treatment of a chronic infec-tion such as is caused by HBV. To date only one study has reported on use of HD Ads to deliver anti-HBV RNAi acti-vators [18]. Modest HBV silencing was reported and is likely to have been the result of poor efficacy of the U6 Pol III anti-HBV expression cassette. To explore the utility of HD Ads using known effective anti-HBV RNAi activators, we have characterized anti-HBV efficacy in cell culture and a murine transgenic model. Results demonstrate that anti-HBV pri-miRNAs are expressed and processed according to the intended design. Efficient silencing of viral replication was achieved in vivo without obvious evidence of toxicity.
METHODS AND MATERIALS
Generating Anti-HBV HD Ad Genomic DNA
Previously described cytomegalovirus (CMV) promoter-containing anti-HBV mono- or trimeric pri-miRNA mimics [13] (pri-miR-122/5, pri-miR-31/5 and pri-miR-31/5-8-9) were initially amplified using forward (5’GATCGG CGC GCCCTATGGAAAAACGCCAGCAA 3’) and reverse (5’G-ATCGG CGC GCCGAAAGGAAGGGAAGAAAG-CGA3’) primers that incorporated Asc I restriction digestion sites (underlined). Amplicons were then inserted into the PCR cloning vector, pTZ57R/T (InsTAclone™ PCR cloning Kit, Fermentas, MD, USA) to generate pTZ pri-miR-31/5HD, pTZ pri-miR-122/5HD and pTZ pri-miR-31/5-8-9HD. After confirming correct sequences of the inserts, they were excised using Asc I and inserted at the equivalent re-striction site of p28E4LacZ [21]. Resulting plasmids, named p28E4 HBVpri-miR-31/5,p28E4 HBVpri-miR-122/5 and p28E4 HBVpri-miR-31/5-8-9, were then digested with Pme I to release the HD Ad viral genome as linear DNA.
Preparation of Anti-HBV HD Ads
HEK293-derived 116 HD Ad packaging cells [22] were propagated in Eagle’s or Joklik’s minimum essential me-dium (MEM). Production, amplification and purification of anti-HBV HD Ads were carried out according to published methods with minor modifications [22]. Briefly, 116 cells were transfected with linear HD Ad genome DNA. Trans-fected cells were then infected with helper virus (AdNG163), and incubated for 48 hours to initiate production of anti-HBV HD Ads. To amplify anti-HBV HDAds, freeze-thawed transfected cell suspensions, together with helper virus, were used repeatedly to co-infect increasing numbers of 116 cells. For large scale preparation of anti-HBV HDAds, 116 cells were cultured in 2 L suspensions in 3 L Spinner flasks. Har-
vested cells were concentrated using centrifugation then lysed. Anti-HBV HDAds were purified using CsCl gradient centrifugation. Yield of total viral particles and helper virus contamination were assayed using quantitative PCR. HD Ad infectious units were determined using dilutions of virus preparations to infect HEK293 cells followed by staining for beta galactosidase activity [22]. Aliquots of pure anti-HBVHDAds particles were stored in 10% glycerol at -80oC. Vectors used in the experiments were a control HD Ad 28, which lacked a RNAi expression construct, HD Ad HBV pri-miR-31/5, HD Ad HBV pri-miR-122/5 and HD Ad HBV pri-miR-31/5-8-9.
Maintenance, Transfection and HD Ad Infection of Cells in Culture
Huh7 and HEK293 lines weremaintained as has been described [16]. To assess anti-HBV effects in cell culture, Huh7 cells wereinitially transfected with an HBV replication competent plasmid (pCH-9/3091 [23]) , which contains a greater than genome length HBV sequence. A plasmidthat constitutively expresses eGFP [24] was included as a trans-fection control. Five hours after transfection, cells were washed with fresh medium and infected with anti-HBV HD Ads at varying multiplicities of infection (MOIs). Knock-down of HBV replication was assessed by measuring the secretion of HBV surface antigen (HBsAg) into the culture supernatants. This was carried out 48 hours after HD Ad infection and performed using the MONOLISA® HBs Ag Assay kit (Bio-Rad, CA, USA).
Northern Blot Hybridization
Liver-derived Huh7 cells were infected with HD Ads at an approximate MOI of 100 HD Ads per cell. The cells were harvested 2 days thereafter before extracting total RNA us-ing Tri Reagent (Sigma, MI, USA). RNA was analyzed us-ing Northern blot hybridization according to procedures that have previously been described [12]. Sequences of the probes used to detectmature 5, 8 and 9 guides were 5’ CCG TGT GCA CTT CGC TTC 3’, 5’ CAA TGT CAA CGA CCG ACC 3’ and 5’ TAG GAG GCT GTA GGC ATA 3’ respectively. To confirm equal loading of lanes with RNA, blots were stripped and probed with a labelled a U6 snRNA oligonucleotide (5’ TAGTATATGTGCTGCCGAAG-CGAGCA 3’).
Assessment of In Vivo Efficacy of Anti-HBV HD Ads
Experiments using HBV transgenic mice [25] as a model of HBV infection were carried out in accordance with proto-cols approved by the University of the Witwatersrand Ani-mal Ethics Screening Committee. A dose of 5 × 109 infec-tious HD Ads was injected as a bolus via the tail vein. Groups of mice comprised 4 animals each and blood was collected by retroorbital puncture. ELISA for HBsAg levels was performed on serum samples using the MONOLISA® HBs Ag ULTRA kit from Bio-Rad. Circulating viral particle equivalents (VPEs) were determined using real time PCR according to previously described methods [16]. Using sepa-rate groups of animals, adenovirus gene transduction was assessed by detecting LacZ expression macro- and micro-
HD Ads Expressing Anti-HBV PrimiRNAs MicroRNA 2012, Vol. 1 No. 1 3
scopically in frozen liver sections taken at 48 hours after initial adenovirus injection.
Statistical Analysis
Data are expressed as the mean ± standard error of the mean (SEM). Statistical difference was considered signifi-cant when P<0.05 and was determined according to the Stu-dent’s 2 tailed t-test. Calculations were done with the GraphPad Prism software package (GraphPad Software Inc., CA, USA).
RESULTS
Mono- and Trimeric pri-miRNA expression Cassettes Targeting HBV and Structure of HD Ads
The HBV targets of the mono- and trimeric pri-miRNA expression cassettes are located in the X open reading frame of HBV (HBx) (Fig. 1A). HBx is conserved in HBV geno-types and is also present in all of the viral transcripts, which makes it a suitable target for therapeutic gene silencing. HD Ads containing anti-HBV pri-miRNA expression cassettes were propagated from a genomic vector sequence using standard techniques [21]. In summary, vector DNA was used to transfect 116 packaging cells and helper Ads provided viral sequences in trans. LoxP sites flanking the packaging sequence of the helper virus, and vector propagation in Cre recombinase-expressing 116 cells, facilitated purification of HD Ads. Using this procedure and after CsCl gradient puri-fication, helper virus contamination was routinely less than 0.1%.
The anti-HBV cassettes incorporated into the HD Ads comprised a CMV Pol II promoter and previously described downstream sequences encoding monomeric or trimeric pri-
miR-31s or pri-miR-122s (Fig. 1B) [12,13]. HD Ad HBV pri-miR-31/5 and HD Ad HBV pri-miR-122/5 vectors had monomeric pri-miR-31 or pri-miR-122 backbones, respec-tively. The intended guide targeted the same HBV site 5 and has previously been shown to be effective against the virus [16] (Fig. 1A). The HD Ad HBV pri-miR-31/5-8-9 vector included two additional previously described antiviral se-quences [16] in a trimeric cassette. This polycistronic se-quence was designed to generate three guides simultane-ously. In addition to the antiviral sequences, HD Ad vectors included a -galactosidase cassette (Fig. 1B). This reporter sequence enabled tracking of HD Ad infection of cells.
Processing of Mono- and Trimeric anti-HBV Expression Cassettes
The scheme that illustrates design and intended process-ing of anti-HBV pri-miRNA expression cassettes is shown in Figs 2A and 2B. The CMV Pol II promoter-generated pri-miRNA sequences should be processed by Drosha/DGCR8 to form pre-miRNA intermediates. After export form the nucleus, pre-miRNA sequences are cleaved by Dicer and an antiviral guide is selected for action against viral targets. Pri-miR-31/5 and pri-miR-122/5 cassettes generate the same antiviral guide 5 sequence. The trimeric cassette from pri-miR-31/5-8-9 results in formation of three different mature antiviral guides that are intended to target HBV sequences simultaneously.
To assess the processing of anti-HBV pri-miRNAs, Huh7 liver-derived cells were infected with the recombinant HD Ads. RNA was extracted from these cells after 48 hours and then subjected to Northern blot hybridization analysis (Fig. 2C). Blots probed with a labeled oligonucleotide that was complementary to intended guide 5 showed presence of
Fig. (1). HBV target sites and antiviral HD Ad vectors. A. Hepatitis B virus genome showing sites targeted by pri-miR-31/5, pri-miR-122/5 and pri-miR-31/5-8-9 cassettes. Co-ordinates of the viral genome are given relative to the unique EcoRI restriction site. The surface, core, polymerase and HBx viral open reading frames (ORFs) (with initiation codons), encompassing the entire genome, are indicated by arrows. Four outer arrows represent the HBV transcripts with common 3 ends. Specific nucleotide coordinates of the target 5, 8 and 9 sites within the genome are shown. B. HD Ads containing the CMV Pol II pri-miR-31/5, pri-miR-122/5 and pri-miR-31/5-8-9 cassettes with CMV -galactosidase-expressing reporter cassette are illustrated schematically. Apart from ITRs and viral packaging signal () the remainder of the vector DNA comprises stuffer sequence with all Ad ORFs removed.
4 MicroRNA 2012, Vol. 1 No. 1 Mowa et al.
Fig. (2). Processing of anti-HBV pri-miR-31/5, pri-miR-122/5 and pri-miR-31/5-8-9. Schematic illustration of the trimeric (A) and mono-meric (B) pri-miRNAs, derived pre-miRNA and mature guides. The guide strands are indicated as black lines and the remaining pri-miRNA components are in grey. Mature guides targeting sites 5, 8 and 9 are generated from the trimeric cassette, while guides complementary to the target site 5 are formed from pri-miR-31/5, pri-miR-122/5. C. RNA extracted from HD Ad-transduced liver-derived Huh7 cells was sub-jected to Northern blot hybridization using a probe that was complementary to the intended guide 5, 8 or 9 strands. Viral vectors contained the indicated cassettes (pri-miR-31/5, pri-miR-122/5 or pri-miR-31/5-8-9) or no anti-HBV sequence (empty, 28). Putative guide (G), pre-cursor (P) and non specific (NS) bands are indicated. A decade RNA molecular weight marker (MW), with size of bands (nt) indicated, was used to determine approximate length of guide strands. After hybridization, blots were stripped and reprobed with an oligonucleotide com-plementary to U6 snRNA to confirm equal loading of the lanes.
Fig. (3). Efficacy in cell culture of HD Ad HBV pri-miR-31/5, HD Ad HBV pri-miR-122/5 and HD Ad HBV pri-miR-31/5-8-9 against HBV. Huh7 liver derived cells were transfected with the pCH9/3091 HBV replication competent plasmid. Five hours there-after, the cells were infected with HD Ads containing no insert (HD 28) or the indicated anti-HBV cassettes. The cells were infected with HD Ads at MOIs of 100, 250, 500 or 1000. HBsAg was then measured in the culture supernatants 48 hours after Ad infection and the concentrations determined relative to the control values obtained for cells infected with the empty HD Ad. Results are ex-pressed as the mean (±SEM) of 3 or 4 replicates. Statistically sig-nificant differences (* p<0.05, ** p<0.01) between HBV pri-miR-expressing vectors and controls are indicated and were determined according to the Student’s 2 tailed paired t-test.
a band of approximately 21 nt in length. This was evident in RNA extracted from cells that had been infected with HD Ad HBV pri-miR-31/5, HD Ad HBV pri-miR-122/5 and Ad HBV pri-miR-31/5-8-9, but not in cells that were uninfected or treated with the empty HD Ad vector (HD Ad 28). Hy-bridization to probes for guide 8 and guide 9 demonstrated presence of a band of approximately 21 nt in the RNA from cells that had been infected with Ad HBV pri-miR-31/5-8-9. Again bands corresponding to the mature guide sequences were not evident in cells infected with the empty vector. As had previously been demonstrated when using the trimeric pri-miR-31/5-8-9 cassette in the context of a plasmid [13], the intensity of the band corresponding to the guide 9 se-quence was less intense. This suggests that processing of the guide targeting sequence 9 was less efficient than that of HBV guide sequences 5 or 8. Compared to the concentration of mature miRNA sequences, pri- or pre-miRNAprecursor species were present in low concentrations in HD Ad-infected cells. Collectively these data demonstrate that the anti-HBV pri-miRNA expression cassettes are processed efficiently and according to intended design when delivered to liver-derived cells by HD Ad vectors.
Silencing of HBV Replication in Cultured Cells by Pri-miRNA Expressing HD Ads
As an initial assessment of anti-HBV efficacy of HD Ads, a cell culture model of HBV replication was utilized. Liver-derived Huh7 cells were transfected with the pCH-9/3091 HBV replication competent plasmid and then in-fected with HD Ads 5 hours thereafter (Fig. 3). Ads were
HD Ads Expressing Anti-HBV PrimiRNAs MicroRNA 2012, Vol. 1 No. 1 5
added to the cultured cells at a range of MOIs from 100 to 1000. When HBsAg was measured in the culture super-natants 48 hours after infection, all vectors caused a decrease in this marker of replication at MOIs of 500 and 1000. How-ever, only HD Ad HBV pri-miR-31/5 and HD Ad HBV pri-miR-31/5-8-9 caused a significant decrease in HBsAg con-centrations in the culture supernatants at MOIs of 100 and 250. These results indicate that HD Ads expressing pri-miRNAs, albeit at high MOIs, are capable of inhibiting HBV replication in liver-derived cells. This evidence supports the notion that the HD Ads, which typically have utility as hepa-totropic vectors in vivo, may be capable of countering HBV replication in transgenic mice.
Efficient HD Ad Transduction of Hepatocytes and HBV Replication Silencing In Vivo
To determine the efficacy in vivo of HD Ads expressing anti-HBV Pol II pri-miRNAs, a HBV transgenic mouse model was employed [25]. Stable and constitutive replication of HBV occurs in these animals in a manner that simulates aspects of the virus chronic carrier state that occurs in hu-mans. There are however differences between the human HBV chronic carrier state and the transgenic mouse model. HBV infection of murine hepatocytes does not occur and the virus is only propagated from the greater than genome length integrant. Also as transgenic animals, the HBV sequences are recognized as ‘self’. Consequently an inflammatory cyto-toxic immune response, which is a characteristic precursor of cirrhosis and HCC in HBV carriers, is not induced. More-over, HBV per se is not directly cytotoxic and the mice do not develop cirrhosis and liver cancer as it occurs in humans.
Injection of HD Ads resulted in highly efficient transduc-tion of hepatocytes (Fig. 4). Mice demonstrated no obvious adverse effects of HD Ad administration. When compared to first generation Ads, histological examination of stained liver sections, measurement of serum transaminases and release of
pro-inflammatory cytokines revealed that use of HD Ads had a significantly improved the safety profile (Crowther et al, manuscripts under review and in preparation).Analysis of microscopy sections stained for -galactosidase activity showed that more than 90% of hepatocytes were transduced, which was evaluated to be sufficient to achieve a therapeutic effect by the antiviral sequences.
To assess the inhibition of HBV replication in HBV transgenic mice, the animals received an intravenous dose of 5 × 109 HD Ad infectious particles. The concentrations of HBsAg and circulating VPEs were determined in the serum at the time of HD Ad administration and weekly thereafter for 14 days (Fig. 5 A&B). Analysis was carried out by com-paring the normalized values relative to the animals that re-ceived the empty HD Ad vector (HD Ad 28). In our hands, a characteristic of the HBV transgenic model used here is that variation in markers of viral replication occurs naturally, and this may influence analysis of antiviral efficacy. Never-
Fig. (5). Anti-HBV efficacy of HD Ads. Effects of intravenous administration of HD Ads on circulating HBV surface antigen (A) and VPEs (B) in HBV transgenic mice. Each animal received a single bolus injection of 5 × 109 infectious Ad particles at com-mencement of the experiment. Controls animals were either in-jected with saline or HD Ad 28, which lacked the HBV-targeting sequences. Titers of HBsAg were determined using ELISA and circulating VPEs were measured using real time quantitative PCR. Results are expressed as the mean (±SEM) from groups comprising 4 mice. Statistically significant differences (* p<0.05, ** p<0.01) between HBV pri-miRNA expressing vectors and controls are indi-cated and were determined according to the Student’s 2 tailed paired t-test.
Fig. (4). Efficient HD Ad-mediated reporter gene delivery to the liver. Adult HBV transgenic mice were injected intravenously with saline or 5 × 109 HD Ad particles. Forty eight hours thereafter they were killed and the livers removed. Representative macroscopic samples (A) or frozen sections (B) of hepatic tissue were subjected to staining for -galactosidase reporter gene activity.
6 MicroRNA 2012, Vol. 1 No. 1 Mowa et al.
theless, all three anti-HBV HD Ads tested, HD Ad HBV pri-miR-31/5, HD Ad HBV pri-miR-122/5 and Ad HBV pri-miR-31/5-8-9, caused statistically significant decreases in markers of viral replication. Comparison of the HBsAg con-centrations indicated that the trimeric HD Ad was most ef-fective against HBV replication in vivo. This observation suggests that a combination of three anti-HBV sequences improves silencing efficacy. Collectively, our results indicate that delivery of pri-miRNAs using HD Ads effectively si-lences HBV replication in vivo and therefore has potential clinical utility.
DISCUSSION
Complications that arise from the chronic carrier state of infection with HBV remain an important global public health problem [1]. Although several drugs have been licensed to treat the infection, elimination of HBV from carriers of the virus remains difficult to achieve [2]. As a result, persistently infected individuals continue to be at risk for complicating cirrhosis and hepatocellular carcinoma. Available therapies effectively suppress HBV replication. However daily long term drug administration is typically required to achieve a sustained therapeutic effect and implementation of such treatment regimens is difficult in resource-poor settings. Demonstration that harnessing the RNAi pathway to inhibit HBV replication potentially has therapeutic benefit may of-fer a useful approach to improve available HBV therapy. Despite the promising results from preclinical studies, sig-nificant hurdles remain before RNAi-based therapy for HBV infection is realized [6]. Obstacles that need to be overcome include the identification of optimal RNAi activators that effect gene silencing at low concentrations, and also delivery of antiviral RNAi activators in a manner that enables sus-tained silencing of viral replication in vivo. Availability of such an HBV therapy that results in a functional cure after single administration would be of considerable benefit.
The artificial pri-miRNAs used in this study have several advantages for countering HBV replication. The notion that each step of the natural miRNA pathway is functionally cou-pled implies that use of pri-miRNA mimics, which enter the pathway at a proximal stage, should achieve more effective target gene silencing. As expression cassettes, sustained pro-duction of viral gene silencers from a DNA template may be utilized more effectively against chronic HBV infection than repeated administration of synthetic siRNAs. Also, the mim-ics of naturally occurring pri-miRNA sequences may be con-figured in Pol II cassettes as polycistronic multimers. Mul-timerization of HBV gene silencers has the benefit of simul-taneous targeting of several HBV sites to improve efficacy and limit the chances of viral escape. Evidence indicates that trimeric pri-miRNA sequences produced in this manner have little if any effect on the endogenous miRNA pathway [12,13]. Use of Pol II promoters to generate antiviral se-quences provides the means for achieving better regulated and safe control of transcription of RNAi activators. The constitutive high rate of transcription that is characteristic of Pol III promoters, such as U6, is potentially problematic as the endogenous miRNA pathway may be disrupted leading to toxic side effects [10]. Pol II promoters have greater flexi
bility and tissue-specific or inducible regulatory elements may be employed to control the dose of therapeutic effecters. In this study, the constitutively active CMV promoter was used successfully to regulate transcription of anti-HBV gene silencers. Efficient production of antiviral sequences was demonstrated in liver-derived cells and delivery of these se-quences to the liver resulted in silencing of HBV replication in vivo. Although these results are encouraging, use of the CMV promoter may not be ideal for therapeutic application. Reasons include the high level of activity of the transcrip-tional element in non-hepatic tissues, and also the variable long term transgene expression in transduced cells [26]. To improve control of HBV RNAi activators, current research is aimed at using liver specific and inducible promoters that are capable of long term transgene production.
Efficient and safe delivery of RNAi activators remains an important challenge for advancing RNAi-based HBV ther-apy. Use of recombinant viral vectors such as Ads [16-18], AAVs [10] and lentiviruses [19] have been used. Delivery of transgenes to a high number of hepatocytes without caus-ing unwanted side effects and achieving long term expres-sion are critically important requirements of anti-HBV RNAi vectors. The HD Ads that were used in this study meet some of these requirements. The highly efficient in vivo liver tro-pism is particularly useful for delivery of sequences that si-lence HBV replication in the liver. Our demonstration that more than 90% of hepatocytes are transduced, together with effective silencing of HBV replication in a stringent murine model of the disease, confirm that these vectors may be used to counter HBV in vivo. As the wild type Ad sequences have been removed from the HD Ads, immunostimulation is markedly attenuated. This has benefit for limiting immune-mediated toxic effects as well as improving the duration of transgene expression. Although the length of transgene ex-pression was not fully characterized in this study, evidence from other reports indicates that transgene expression of more than 2 years may be achieved in rats [27].
The demonstration that HBV replication may be silenced in vivo using recombinant HD Ads that express single and multimeric HBV gene silencers is potentially very useful for therapeutic application. Although promising, further refine-ments in the technology will be required for it to advance to a stage of clinical use. Duration of expression of HBV gene silencers, polymer modification or pretreatment with immu-nosuppressive glucocorticoids to attenuate innate immu-nostimulation, and incorporation of additional therapeutic cassettes are being investigated. Nevertheless, these data augur well for the clinical utility of using RNAi activators to counter HBV persistent infection.
ACKNOWLEDGEMENTS
Assistance from Philip Ng and Donna Palmer with prepa-ration of the HD Ads is gratefully acknowledged. HBV transgenic mice used in this study were bred from a gift of animals provided by Patricia Marion and Felix Salazar. Fi-nancial support from the South African National Research Foundation, Poliomyelitis Research Foundation and Medical Research Council, which enabled this work to be carried out, is appreciated.
HD Ads Expressing Anti-HBV PrimiRNAs MicroRNA 2012, Vol. 1 No. 1 7
MBM is a Claude Leon Harris Foundation Postdoctoral Fellow
REFERENCES
[1] WHO. Immunization surveillance, assessment and monitoring: Hepatitis B. 2010; Available from: http://www.who.int/immuni-zation_monitoring/diseases/hepatitis/en/index.html.
[2] Ayoub WS, Keeffe EB. Review article: current antiviral therapy of chronic hepatitis B. Aliment Pharmacol Ther 2011, 34(10):1145-58.
[3] Arbuthnot P. Harnessing RNA interference for the treatment of viral infections. Drug News Perspect 2010; 23(6):341-50.
[4] Arbuthnot P, Longshaw V, Naidoo T, Weinberg MS. Opportunities for treating chronic hepatitis B and C virus infection using RNA interference. J Viral Hepat 2007;14(7):447-59.
[5] Chen Y, Cheng G, Mahato RI. RNAi for treating hepatitis B viral infection. Pharm Res 2008; 25(1):72-86.
[6] Ivacik D, Ely A, Arbuthnot P. Countering hepatitis B virus infection using RNAi: how far are we from the clinic? Rev Med Virol 2011; 21(6):383-96.
[7] Brummelkamp TR, Bernards R, Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science 2002; 296(5567):550-3.
[8] Zeng Y, Wagner EJ, Cullen BR. Both natural and designed micro RNAs can inhibit the expression of cognate mRNAs when expressed in human cells. Mol Cell 2002; 9(6):1327-33.
[9] Czauderna F, Santel A, Hinz M, et al. Inducible shRNA expression for application in a prostate cancer mouse model. Nucleic Acids Res 2003; 31(21):e127.
[10] Grimm D, Streetz KL, Jopling CL, et al. Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Nature 2006; 441(7092):537-41.
[11] Chung KH, Hart CC, Al-Bassam S, et al. Polycistronic RNA polymerase II expression vectors for RNA interference based on BIC/miR-155. Nucleic Acids Res 2006; 34(7):e53.
[12] Ely A, Naidoo T, Mufamadi S, Crowther C, Arbuthnot P. Expressed anti-HBV primary microRNA shuttles inhibit viral replication efficiently in vitro and in vivo. Mol Ther 2008; 16(6):1105-12.
[13] Ely A, Naidoo T, Arbuthnot P. Efficient silencing of gene expression with modular trimeric Pol II expression cassettes comprising microRNA shuttles. Nucleic Acids Res 2009; 37(13):e91.
[14] Aagaard LA, Zhang J, von Eije KJ, et al. Engineering and optimization of the miR-106b cluster for ectopic expression of multiplexed anti-HIV RNAs. Gene Ther 2008; 15(23):1536-49.
[15] Boudreau RL, Martins I, Davidson BL. Artificial microRNAs as siRNA shuttles: improved safety as compared to shRNAs in vitro and in vivo. Mol Ther 2009; 17(1):169-75.
[16] Carmona S, Ely A, Crowther C, et al. Effective Inhibition of HBV Replication in Vivo by Anti-HBx Short Hairpin RNAs. Mol Ther 2006; 13(2):411-21.
[17] Uprichard SL, Boyd B, Althage A, Chisari FV. Clearance of hepatitis B virus from the liver of transgenic mice by short hairpin RNAs. Proc Natl Acad Sci U S A 2005 18; 102(3):773-8.
[18] Rauschhuber C, Xu H, Salazar FH, Marion PL, Ehrhardt A. Exploring gene-deleted adenoviral vectors for delivery of short hairpin RNAs and reduction of hepatitis B virus infection in mice. J Gene Med 2008; 10(8):878-89.
[19] Deng L, Li G, Xi L, et al. Hepatitis B virus inhibition in mice by lentiviral vector mediated short hairpin RNA. BMC Gastroenterol 2009; 9:73.
[20] Mowa MB, Crowther C, Arbuthnot P. Therapeutic potential of adenoviral vectors for delivery of expressed RNAi activators. Expert Opin Drug Deliv 2010; 7(12):1373-85.
[21] Palmer DJ, Ng P. Methods for the production of first generation adenoviral vectors. Methods Mol Biol 2008; 433:55-78.
[22] Palmer D, Ng P. Improved system for helper-dependent adenoviral vector production. Mol Ther 2003; 8(5):846-52.
[23] Nassal, M. The arginine-rich domain of the hepatitis B virus core protein is required for pregenome encapsidation and productive viral positive-strand DNA synthesis but not for virus assembly. J Virol 1992; 66(7):4107-16.
[24] Passman M, Weinberg M, Kew M, Arbuthnot P. In situ demonstration of inhibitory effects of hammerhead ribozymes that are targeted to the hepatitis Bx sequence in cultured cells. Biochem Biophys Res Commun 2000; 268(3):728-33.
[25] Marion PL, Salazar FH, Liittschwager K, Bordier BB, Seegers C, Winters MA, et al. A transgenic mouse lineage useful for testing antivirals targeting hepatitis B virus. Frontiers in Viral Hepatitis: Elsevier Science Amsterdam; 2003; p. 197-202.
[26] Magnusson T, Haase R, Schleef M, Wagner E, Ogris M. Sustained, high transgene expression in liver with plasmid vectors using optimized promoter-enhancer combinations. J Gene Med 2011; 13(7-8):382-91.
[27] Toietta G, Mane VP, Norona WS, et al. Lifelong elimination of hyperbilirubinemia in the Gunn rat with a single injection of helper-dependent adenoviral vector. Proc Natl Acad Sci U S A 2005; 102(11):3930-5.
Received: ???????????? ??, ???? Revised: ???????????? ??, ???? Accepted: ?????????? ??, ????
1. Introduction
2. Activating RNAi for
therapeutic application
3. Principles underlying methods
of propagating adenovirus
vectors
4. HD adenovirus vectors are
attractive for achieving
sustained
RNAi-based therapeutic gene
silencing
5. Viral infections as targets for
adenovirus vector-based RNAi
therapy
6. Conclusion
7. Expert opinion
Review
Therapeutic potential ofadenoviral vectors for deliveryof expressed RNAi activatorsMohube Betty Mowa, Carol Crowther & Patrick Arbuthnot†
University of the Witwatersrand, School of Pathology, Antiviral Gene Therapy Research Unit,
Health Sciences Faculty, Private Bag 3, WITS 2050, South Africa
Importance of the field: Harnessing RNA interference (RNAi) to silence
pathology-causing genes has shown promise as a mode of therapy. The sus-
tained gene inhibition that may be achieved with expressed sequences is
potentially useful for treatment of chronic viral infections, but efficient and
safe delivery of these sequences remains a challenge. It is generally recog-
nized that there is no ideal vector for all therapeutic RNAi applications, but
recombinant adenovirus vectors are well suited to hepatic delivery of
expressed RNAi activators.
Areas covered in this review: Adenoviruses are hepatotropic after systemic
administration, and this is useful for delivering expressed RNAi activators
that silence pathology-causing genes in the liver. However, drawbacks of
adenoviruses are toxicity and diminished efficacy, which result from induction
of innate and adaptive immune responses. In this review, the advantages and
hurdles facing therapeutic application of adenoviral vectors for liver delivery
of RNAi effectors are covered.
What the reader will gain: Insights into adenovirus vectorology and the meth-
ods that have been used to make these vectors safer for advancing clinical
application of RNAi-based therapy.
Take homemessage: Adenoviruses are very powerful hepatotropic vectors. To
make adenoviruses more effective for clinical use, polymer conjugation and
deletion of viral vector sequences have been used successfully. However, fur-
ther modifications to attenuate immunostimulation as well as improvements
in large-scale production are necessary before the therapeutic potential of
adenovirus-mediated delivery of RNAi activators is realized.
Keywords: adenovirus, helper-dependent adenovirus, hepatitis B virus, hepatitis C virus,
RNA interference
Expert Opin. Drug Deliv. (2010) 7(12):1373-1385
1. Introduction
Demonstration that RNA interference (RNAi) may be activated with exogenouseffectors to silence pathology-causing genes has generated considerable interest inusing this approach for therapy [1,2]. Harnessing RNAi to counter gene expressionhas been a particularly active field of research, and many diseases, especially thosecaused by virus infections and cancer, have been shown to be susceptible toRNAi-mediated inhibition. However, one of the major obstacles to realizing thetherapeutic potential of RNAi has been the difficulty with which safe and efficientdelivery of gene silencing sequences to intended target cells may be accomplished.A variety of methods has been used to achieve this [1]. These include use of non-viral vectors for delivery of synthetic RNAi activators and viral vectors for transferof antiviral RNAi expression cassettes. The sustained silencing that may be achievedwith expressed sequences makes viral vectors attractive for treatment of chronic
10.1517/17425247.2010.533655 © 2010 Informa UK, Ltd. ISSN 1742-5247 1373All rights reserved: reproduction in whole or in part not permitted
Exp
ert O
pin.
Dru
g D
eliv
. Dow
nloa
ded
from
info
rmah
ealth
care
.com
by
Uni
vers
ity o
f W
itwat
ersr
and
on 0
2/20
/13
For
pers
onal
use
onl
y.
diseases. Viral vectors that are under development includerecombinant adeno-associated viruses (AAVs), lentivirusesand adenoviruses. The ability of lentiviral vectors to integrateproviral sequences that stably produce antiviral RNAi activa-tors has been particularly useful for ex vivo approaches totreating viral diseases that result from chronic infections, forexample, AIDS caused by HIV persistence. This is not suit-able for all RNAi-based antiviral approaches, and utility oflentiviral vectors is specific to certain clinical conditions.A further potential complication of using lentiviral vectors isthat promoters that are responsible for control of expressionof RNAi activators may interfere with transcription requiredfor vector propagation [3]. The lack of pathology that is causedby infection with wild-type AAVs and attenuated inductionof immunostimulatory pathways have made these vectors par-ticularly appealing [4]. However, induction of an immuneresponse by AAVs does occur and their lower transgene capa-city would compromise ability to incorporate large RNAiexpression sequences [5]. Recombinant adenoviruses havefeatures that make them suited to delivering potentially ther-apeutic RNAi activators to the liver. These include efficienthepatic expression of inserted cassettes, well-establishedmethods of propagating the vector, episomal location of theadenovirus genome in infected cells, compatibility withchemical modification to alter biological properties, abilityto infect non-dividing cells, and transient or sustained expres-sion of transgenes. A shortcoming of adenoviruses is theirpowerful stimulation of the innate and adaptive immuneresponses, which may result in toxicity and attenuation ofefficiency of transgene delivery. The death of a patient in aclinical trial who developed complications arising from
immunostimulatory effects of adenoviruses provided animportant and hard lesson for researchers in the field [6]. Inthis review, recent advances that are relevant to the potentialtherapeutic utility of incorporating expressed antiviral RNAiactivators into adenoviruses are discussed. Modificationsto reduce vector immunostimulation, and improve stability,specificity, control of vector tropism and expression of trans-genes are discussed. An opinion on the existing importantchallenges in the field is provided.
2. Activating RNAi for therapeutic application
RNAi, which was first described in 1998 [7], is a highly con-served pathway in metazoan cells and is essential for regula-tion of genes involved in a variety of cellular processes [8].Transcription of duplex-containing RNA molecules initiatesthe pathway. These transcripts are processed in a stepwisemanner to form mature gene silencing sequences. The mam-malian micro-RNA (miR) pathway is a well-characterizedmechanism of RNAi. RNA Polymerase II (Pol II)-mediatedtranscription of long mono- or polycistronic primary miRs(pri-miRs) sets off the pathway (Figure 1). These sequencescontain hairpin-like RNA structures and are cleaved in thenucleus by Drosha, an RNase III enzyme, and its double-stranded RNA binding partner, DiGeorge Critical Region 8(DGCR8) [9]. The resulting precursor miRs (pre-miRs) arethen transported to the cytoplasm by exportin-5 and arethen processed further by Dicer to yield mature miR duplexescomprising 21 -- 23 bp RNA. One strand of the mature miRis selected as a guide for incorporation into the RNA inducingsilencing complex (RISC). The guide directs RISC to effectdegradation or translational suppression of target mRNA.
Silencing of target genes with exogenous RNAi activatorsmay be achieved with chemically synthesized short interferingRNAs (siRNA), which mimic mature endogenous miRs [10],or by expression of RNAi intermediates from exogenousDNA templates (Figure 1) [2]. Synthetic siRNAs have theadvantage of being compatible with chemical modificationto improve stability, specificity, cellular delivery andsafety [11,12]. Also, the smaller size of synthetic siRNAs andthe cytoplasmic, not nuclear, site of action make their dosecontrol and delivery with non-viral vectors easier to achieve.Exogenous expressed RNAi activators have the advantages ofprolonged efficacy from sustained intracellular supply ofsiRNAs, ease of propagation in plasmid DNA, and betterstability and compatibility with viral vectors such as recombi-nant adenoviruses. Typically, DNA expression cassettesencoding mimics of pri-miRs (pri-miR shuttles) or short hair-pin RNA (shRNA) analogues of pre-miR are used to activatethe RNAi pathway (Figure 1). RNA polymerase III promoters,for example U6 small nuclear RNA and human ribonucleaseP RNA component H1 promoters, are commonly used toregulate transcription of RNAi activators. However, overex-pression from Pol III promoters may be complicated bytoxicity that is attributed to saturation of the endogenous
Article highlights.
. Harnessing RNAi to silence pathology-causing genes hasenormous therapeutic potential.
. Expressed RNAi activators are compatible withrecombinant adenovirus vectors and have the usefulproperty of achieving sustained gene silencing.
. Adenovirus vectors have many features that make themuseful for delivery of potentially therapeuticRNAi activators.
. An important drawback of adenoviruses is theirstimulation of innate and adaptive immune responses,which is potentially toxic.
. Development of helper-dependent adenoviruses and alsopolymer conjugation of adenoviruses has contributed toovercoming problems of immunostimulation.
. The efficient delivery of transgenes to the liver shouldmake adenoviruses useful for treating liver diseases suchas those caused by HBV and HCV infection.
. The full potential of adenovirus-mediated delivery ofRNAi activators will depend largely on establishingtheir safety and developing convenient methods oflarge-scale production.
This box summarizes key points contained in the article.
Therapeutic potential of adenoviral vectors for delivery of expressed RNAi activators
1374 Expert Opin. Drug Deliv. (2010) 7(12)
Exp
ert O
pin.
Dru
g D
eliv
. Dow
nloa
ded
from
info
rmah
ealth
care
.com
by
Uni
vers
ity o
f W
itwat
ersr
and
on 0
2/20
/13
For
pers
onal
use
onl
y.
RNAi machinery [13-15] or activation of an interferonresponse [16]. Importantly, unlike the case with delivery ofsynthetic siRNAs, expressed RNAi activators do not traversethe endosomal compartment and therefore bypass much ofthe toll-like receptor (TLR)-mediated immunostimulation [17].Compatibility of pri-miR expression cassettes with versatilePol II promoters enables improved transcriptional regula-tion [18] and generation of multimeric RNAi activators [19].This is particularly useful to achieve tissue-specific expression,regulate the dose of RNAi activators and prevent viral escape.These properties have been utilized effectively to silence hep-atitis B virus (HBV) replication in vivo [18,19]. In developingRNAi-based antiviral therapy, the focus of research hasbeen on the identification of sequences that are effective atlow concentrations (potent), devoid of unintended off-target effects, have limited immunostimulatory effects andcan be easily delivered to target tissues in a dose-dependentmanner. When used in conjunction with adenoviruses, these
considerations are especially important to avoid exacerbatingpotential undesirable effects of the vectors.
Diseases caused by viral infections that are amenable toRNAi-based therapy are highly varied and this has a bearingon the approach to the development of RNAi-based therapy.Methods of delivery of sequences that silence virus replicationand the selection of appropriate RNAi activators need to betailored to the characteristics of individual infections. Impor-tant factors are the tropism of viruses, acute or chronic natureof the infection, whether a virus encodes RNA silencingsuppressors (RSSs) and genetic variability as a result of inaccu-racies of viral polymerases. Decisions about selection ofadenoviruses for delivery of RNAi-activating sequences areguided by these considerations. Adenoviruses have a broadtissue tropism, but are hepatotropic in vivo after systemicadministration. This means that delivery of anti-HBV orhepatitis C virus (HCV) sequences can be achieved efficientlyafter intravenous injection of recombinant adenoviruses. The
Mimics of miR precursorsthat may be expressedfrom recombinant adenoviruses
TRBP
RISC
Nucleus
Cytoplasm
Pri-miR
Pre-miR
miR duplex Synthetic siRNA
AAAA
Post-transcriptional genesilencing by target degradationor translational suppression
Pol II
Drosha
Exp 5
Dicer
DGCR8
Figure 1. Summarized illustration of miR processing that shows the essential nuclear and cytoplasmic steps of the RNAi
pathway. Exogenous expression cassettes that transcribe miR intermediates, which may be pri-miR or pre-miR sequences, are
typically incorporated into adenoviruses. Non-viral vectors are normally used to deliver synthetic siRNA analogues of mature
miR duplexes.Adapted from [93,94].
miR: Micro-RNA; pre-miR: Precursor miR; pri-miR: Primary miR; RNAi: RNA interference; siRNA: Short interfering RNA.
Mowa, Crowther & Arbuthnot
Expert Opin. Drug Deliv. (2010) 7(12) 1375
Exp
ert O
pin.
Dru
g D
eliv
. Dow
nloa
ded
from
info
rmah
ealth
care
.com
by
Uni
vers
ity o
f W
itwat
ersr
and
on 0
2/20
/13
For
pers
onal
use
onl
y.
duration of adenovirus-delivered transgene expressionvaries and is largely dependent on the host’s immune res-ponse to the vector. The development of methods to removeadenovirus sequences and chemical modification of vectorsto avoid immunodetection of vectors have therefore beenvery important. These adaptations improve persistence oftransgene expression, which is required for treatment ofchronic infections.
3. Principles underlying methods ofpropagating adenovirus vectors
Wild-type adenovirus virions are non-enveloped and have ico-sahedral symmetry with a diameter of 70 -- 90 nm (reviewedin [20]). They belong to the Adenoviridae family and thegenome comprises 26 -- 44 kb of linear double-strandedDNA. The capsid contains 240 homotrimeric proteins,12 pentameric penton proteins that are located at each ofthe apices of the icosahedral capsid, and homotrimeric fibermonomers that extend from the penton base. The fiberproteins are anchored at their N-terminal regions and the pro-truding C-terminal globular regions interact with cell surfacereceptors. Human adenovirus serotype 5 is the most compre-hensively studied adenovirus, and together with adenovirus 2has been used to develop the vectors that are widely usedfor gene transfer. The initiating event during natural adeno-virus infection is the interaction of the fiber knob with itscognate cellular receptor. Several adenovirus receptors havebeen identified (reviewed in [21]), of which the Coxsackievirusand adenovirus receptor (CAR) is the primary binding site.Subsequent to receptor binding, interaction of the pentonbase with cellular integrins (aVb3 and aVb5) mediates inter-nalization [22]. With the exception of hepatocytes (see below),the susceptibility of cells to adenovirus serotype 5 infectioncorrelates with their CAR expression and induction of expres-sion of the receptor on cells that normally are refractory toinfection show increased adenovirus serotype 5 transduc-tion [23]. In addition to CAR, other lower affinity cellularreceptors that are involved with adenovirus attachmentinclude heparin sulfate proteoglycans (HSPGs), intergrins,CD46, CD80/86, sialic acid, major histocompatabilitycomplex class I (MHC class I) and vascular cell adhesionmolecule 1 (VCAM-1) [21].Adenoviruses bind to blood cellular components such as
erythrocytes [24], macrophages [25] and neutrophils [26], aswell as plasma coagulation factors [27]. These interactionsmay sequester adenoviruses and prevent access to extravas-cular targets. Interestingly, the hepatotropism of adenovirusserotype 5 has recently been shown to result from interactionof blood clotting Factor X (FX) with the hexon, not fiber,protein of the virus [28]. The exact mechanism by which thisinteraction causes hepatotropism has not been established.However, it is thought that FX forms a mesh over the virioncapsid that sterically inhibits interaction of the fiber proteinwith other receptors.
The adenovirus serotype 5 genome is organized into regionsthat are transcribed early or late during the infection(Figure 2A) [29]. E1A and E1B are the first to be expressed.Their function is to interact with p53 and Rb to prevent cellcycle arrest, inhibit apoptosis and permit establishment ofviral replication. The attenuation of viral replication thatresults from deletion of E1 has been exploited for the genera-tion of replication-defective adenovirus vectors (discussedbelow). Replication-competent and conditionally replication-competent adenoviruses, which have direct toxic effects oncells, have been used for the treatment of cancer [30]. Althoughthese vectors show promise for the treatment of various malig-nancies, they are generally not suitable for delivery of RNAiactivators. An important consideration for using adenovirusesto deliver RNAi activators is that adenovirus VA RNAI andadenovirus VA RNAII, which are expressed during the latephase of replication, are capable of inhibiting RNAi [31,32].Adenovirus VA RNAI and adenovirus VA RNAII transcriptsare highly folded and contain hairpin motifs that resemblepri-miRs. They are produced in high amounts, act as sub-strates and competitive inhibitors of Dicer and are also capableof suppressing RISC function [31]. A further effect thatimpedes RNAi function is the inhibition of exportin-5-mediated export of shRNAs [32]. Of course, expression ofVA RNAs in adenoviruses that deliver RNAi activators wouldbe undesirable. However, as recombinant adenovirus vectorsare deficient in E1, they are replication-defective and do notexpress late genes. Production of late adenovirus VA RNAIand adenovirus VA RNAII transcripts is therefore significantlyattenuated and disruption of silencing by adenovirus-deliveredRNAi expression cassettes should not occur. This is supportedfurther by the demonstration that first-generation adenovirusvectors do not disrupt endogenous miR biogenesis [33].
First-generation adenoviruses have been in use for genetherapy application for several years. These vectors are defi-cient in the viral E1 gene, and the function of this sequenceis typically provided in trans by HEK293 packaging cellsthat stably produce E1 (Figure 2B). To propagate RNAi-activating adenoviruses, expression cassettes may be accommo-dated at sites of adenovirus genome deletions. Limitations offirst-generation vectors are that target cells are co-transducedwith virus protein encoding sequences together with the trans-genes. As a result, immunogenic expression of viral proteinsoccurs, which shortens the duration of transgene expressionand predisposes it to toxicity. Second-generation adenovirusesalso have the E2 and E4 sequence removed (Figure 2C), whichpartially diminishes immunostimulatory effects and providesextra transgene capacity. Helper-dependent (HD) or ‘gutless’vectors have been widely used for the delivery of transgenes.These third-generation adenoviruses have all of the viral pro-tein coding sequences stripped from the genome (Figure 2D).Only the packaging signal and inverted terminal repeat(ITR) elements at the ends of the genome are retained. Totalgene deletion in adenovirus vectors dramatically reducesimmune response stimulation, thereby enabling prolonged
Therapeutic potential of adenoviral vectors for delivery of expressed RNAi activators
1376 Expert Opin. Drug Deliv. (2010) 7(12)
Exp
ert O
pin.
Dru
g D
eliv
. Dow
nloa
ded
from
info
rmah
ealth
care
.com
by
Uni
vers
ity o
f W
itwat
ersr
and
on 0
2/20
/13
For
pers
onal
use
onl
y.
Clo
ne e
xpre
ssio
nca
sset
tes
into
ade
novi
ruse
s de
lete
dre
gion
s.T
rans
fect
pac
kagi
ng c
ells
.
Clo
ne e
xpre
ssio
n ca
sset
tes
into
aden
oviru
ses
dele
ted
regi
ons.
Tra
nsfe
ct C
RE
rec
ombi
nase
expr
essi
ng p
acka
ging
cel
ls.
Infe
ct c
ells
with
help
er v
irus
with
flank
ed b
y Lo
xP.
Pro
duct
ion
of r
ecom
bina
ntH
D a
deno
viru
ses
Pro
duct
ion
of fi
rst a
ndse
cond
gen
erat
ion
reco
mbi
nant
ade
novi
ruse
s
5′IT
Rψ E
1AE1B
E2B
L1L2
L3E
2AL4
E3
L5E
43′IT
R
Gen
ome
of w
ild-t
ype
aden
oviru
ses
A.
5′IT
RE
2BL1
L2L3
E2A
L4
ΔE3 L5
E4
3′IT
RΔE
1
Firs
t gen
erat
ion
B.
5′IT
RE
2BL1
L2L3
ΔE2A
L4
ΔE3 L5
ΔE4 3′IT
RΔE
1
Sec
ond
gene
ratio
nC
.
5′IT
R3′
ITR
All
vira
l pro
tein
cod
ing
gene
s de
lete
d
Thi
rd g
ener
atio
nD
.
ψψ
ψ
Figure
2.Sch
ematicoutlineofproductionoffirst-,seco
nd-andthird-generationreco
mbinantadenovirusvectors.A.Lineargenomeofwild-typ
eadenovirus.B.First-
generationve
ctors
have
E1and/orE3deleted.C.Se
cond-generationve
ctors
have
E1,E2,E4and/orE3deleted.Both
these
categoriesofreco
mbinantvirusescanbe
producedbyintroducingreco
mbinantadenovirusDNAco
ntainingRNAiexp
ressioncassettesinto
celllinesexp
ressingthemissingessentialgenes.D.Third-generationor
HD
adenoviruseshave
alltheviralsequencesdeleted,exceptfortheleft
andrightinve
rted
term
inalrepeats
(5¢IT
Rand
3¢IT
R)and
thepackaging
elements
(y).To
produce
HD
adenoviruses,ahelperviruswithitspackagingsignalflankedbyreco
mbinase
targets,forexa
mple
loxPsites,istypicallyusedto
complementfordeleted
adenoviralgenesin
reco
mbinase-exp
ressingpackagingcells.
RNAiexp
ressioncassettesmaybeinco
rporatedatsitesofAdgenedeletion(dashedlines).
HD:Helper-dependent;RNAi:RNA
interference.
Mowa, Crowther & Arbuthnot
Expert Opin. Drug Deliv. (2010) 7(12) 1377
Exp
ert O
pin.
Dru
g D
eliv
. Dow
nloa
ded
from
info
rmah
ealth
care
.com
by
Uni
vers
ity o
f W
itwat
ersr
and
on 0
2/20
/13
For
pers
onal
use
onl
y.
transgene expression with reduced vector toxicity [34,35]. Topropagate HD adenoviruses, complementing helper viruses(HVs) produce all of the protein components that are requiredfor the formation of the viral particles. Ingenious methods,particularly the incorporation of LoxP [36] and FRT [37] recom-binase recognition sites to flank the packaging signal in HVs,have been devised to remove the contaminating complement-ing virus. Derivatives of the HEK293 cells that stably expressCRE or FLPe recombinases remove the packaging signalfrom the helper virus, and HD adenovirus DNA is preferen-tially packaged in the recombinant vector. To overcome prob-lems of HV contamination that may result from homologousrecombination between the y sequences of helper virus andHD adenovirus, Palmer and Ng reversed the orientation ofy in the helper virus [38]. This approach successfully reducedHV contamination to 0.01 -- 0.1%. Availability of packagingcells that are capable of growing in suspension has also facili-tated large-scale production of adenoviruses. Nevertheless,generating adenoviruses in sufficient amounts and purity forclinical application remains difficult and costly. However, pro-tocols are continuously being refined to improve current HDadenovirus preparation methods [39].
3.1 Immunostimulation by adenovirusesAfter intravenous administration, adenoviruses are readilytaken up by antigen-presenting cells (APCs). Their activationof the innate immune response is mediated by mitogen-activated protein kinases (MAPK). Release of cytokines, suchas TNF-a, IL-6 and IL-12, causes local inflammation andtoxicity [40-43]. Resulting damage to healthy tissues withdecreased transgene expression is thus a significant concernfor therapeutic use of recombinant adenoviruses. Importantly,this rapidly occurring effect is not dependent on the expressionof viral genes, and unmodified HD adenoviruses also causestimulation of the innate immune response [40]. Nevertheless,this immunostimulatory effect of HD adenoviruses is moretransient than that caused by first-generation unmodifiedadenoviruses [44,45]. APCs also initiate an adaptive immuneresponse by MHC class I presentation of processed viralantigens to CD8+ T cells. This triggers CD8+ T cells’ differen-tiation into cytotoxic T lymphocytes (CTLs) and adenovirus-specific cytotoxic immunoclearance of transduced cells. Inaddition, presentation of viral antigens by MHC class IIactivates CD4+ T cells. This leads to cytokine-mediateddestruction of the adenovirus-infected cells as well as B-celldifferentiation to induce a humoral immune response. Anti-adenovirus immunity, induced by community-acquired infec-tion, is induced by similar mechanisms and may counterefficiency of adenovirus transgene delivery.Although essential aspects of the mechanism of adenovirus
immunostimulation are generic, vector-induced immuneresponses are complex, variable and influenced by severalfactors [46]. These include adenovirus dose, route of adminis-tration and tissues that are targeted. Overcoming problemsof immunostimulation may be achieved more easily in
situations where local and low dose adenovirus administrationis adequate for therapeutic benefit. Preventing immunostimu-lation in situations that require systemic administration ofhigh doses of adenoviruses is more complicated. In such cases,pre-administration of immunosuppressive drugs, such as ste-roids, has been found to be useful [47]. A major focus of ade-novirus vectorology has therefore been on the developmentof methods to diminish induction of immunostimulationand modification of vector tropism.
3.2 Adenovirus tissue tropismTargeting RNAi activators to specific tissues is essential tolimit unintended effects of adenoviruses. Benefits of specifictarget tissue tropism include: i) minimizing the requireddose of adenoviruses; ii) avoiding cells that mediate immunos-timulation; and iii) escape from pre-existing adenovirusimmunity [46]. A major focus of adenovirus vector develop-ment has therefore been to improve specificity of transductionof intended target cells. Adenovirus tropism is complexand varied. As new receptors are identified and newserotype-specific cellular transduction processes are eluci-dated, so the repertoire of adenoviruses will increase. Thisshould enable more specific vector targeting and also allowfor serotype switching to avoid vectors’ interaction withneutralizing antibodies [48].
Much of the knowledge on adenovirus transduction, par-ticularly the binding of CAR by adenovirus serotype 5, comesfrom studies carried out on cells in culture. Extrapolation touse in vivo has not been easy as adenoviruses display a strongliver tropism when injected systemically, despite low expres-sion of CAR in hepatocytes [49]. It was only recently thatthe central role of FX in liver targeting by adenoviruses wasidentified (discussed earlier) [28]. Direct binding of FX tothe adenovirus serotype 5 hexon is required for liver trans-duction. This is supported by the reduction in adenovirusserotype 5 liver transduction following inhibition of FX inter-action with hexon [28,50], which is not observed after CARdisruption [51].
So far three methods have been used to alter vector tro-pism [46]: i) genetic modification of the capsid; ii) chemicalconjugation of the vector particles with polymers such aspolyethylene glycol (PEG); and iii) introduction of a two-component modification that comprises a fiber knob bindingdomain at one end and a retargeting moiety at the other.Changing sequences of receptor-interacting capsid proteins,particularly the fiber knob domain, have been used success-fully to modify vector tropism [52]. However, this approachmay be complicated by defective fiber trimerization. PEGyla-tion of adenoviruses is a convenient approach that providesa hydrophilic coat to adenoviruses, which decreases the pro-teolytic degradation and shields vector epitopes [53]. PEGy-lated adenoviruses are less immunogenic and their bloodclearance rate is fourfold lower than unPEGylated adenovi-ruses. The increased circulation time in blood also facilitatestransduction of non-hepatic tissue [54]. Liver tropism can
Therapeutic potential of adenoviral vectors for delivery of expressed RNAi activators
1378 Expert Opin. Drug Deliv. (2010) 7(12)
Exp
ert O
pin.
Dru
g D
eliv
. Dow
nloa
ded
from
info
rmah
ealth
care
.com
by
Uni
vers
ity o
f W
itwat
ersr
and
on 0
2/20
/13
For
pers
onal
use
onl
y.
also be altered by using PEG of different molecular masses.Adenovirus serotype 5 conjugated to PEG5000 (PEG withmolecular mass of 5000 Da) maintains normal liver trans-duction, but PEG20000 and PEG35000 reduce hepatocytetransduction [55]. Attaching targeting ligands to the end ofthe PEG chain has also enabled tissue-specific targeting. Forexample, integrin-binding RGD (Arg-Gly-Asp) peptidesattached to a PEG chain (RGD-PEG-adenovirus) demon-strated a 200-fold increased transduction in both CAR+ andCAR- negative cells [56].
4. HD adenovirus vectors are attractive forachieving sustained RNAi-based therapeuticgene silencing
As indicated earlier, HD adenoviruses have the dual advan-tages of a high capacity (~ 36 kb) for accommodating trans-gene elements and a lack of sequences encoding viralproteins. Although typical RNAi expression sequences aresmall, inclusion of extra cassettes in HD adenoviruses maybe useful to make vectors more functional. The feasibility ofsuch an approach was demonstrated in a study that generatedan adenovirus vector that encoded both transforming growthfactor-b3 and a shRNA targeted to type I collagen [57]. Thisparticular application to treating articular cartilage degenera-tion facilitated both chondrocyte growth stimulation andinhibition of type I collagen production. The resulting for-mation of cartilage that contains type II collagen and proteo-glycans has greater mechanical strength. Extension of thismethod to incorporate immunomodulatory transgenic ele-ments may be useful to modulate toxicity of HD adenovirusvectors. Proof of principle of such an approach was providedby a study showing that silencing the Cys-X3-Cys chemokineligand could be used to prevent acute liver injury caused byadenoviruses [58]. In another impressive study showing theutility of HD adenoviruses for delivery of RNAi expressioncassettes, shRNAs targeting the insulin-responsive SREBP-1gene resulted in sustained 90% SREBP-1 knockdown [59].Therapeutic benefit in a type 2 diabetes mouse model wasmanifested as reduced body weight gain, which was observ-able at week 3 after HD adenovirus administration. Similarly,a recent study explored using HD adenoviruses to expressshRNA against mutated huntington protein (htt)-encodingmRNA as a possible Huntington’s disease therapeutic strat-egy [60]. This study reported 90% reduction in formation ofhtt aggregates at 4 weeks after vector administration. Thesesilencing effects of HD adenoviruses are typically more sus-tained than what can be achieved with first-generationadenoviruses [61-63]. Interestingly, unlike the disruption ofthe endogeneous RNAi pathway and liver or neuronal degen-eration caused by shRNAs overexpressed from an AAV [13,15],high levels of shRNA from HD adenoviruses did notappear to affect the exportin-5 pathway or to induce livertoxicity in mice [16]. Together, these observations showingprolonged transgene expression and good safety support
the notion that HD adenovirus vectors are useful forRNAi-based therapeutic application.
5. Viral infections as targets for adenovirusvector-based RNAi therapy
The natural targeting of hepatocytes by adenoviruses follow-ing systemic administration in vivo makes them well suitedto delivery of RNAi expression cassettes that target liver-specific virus infections. Globally, chronic infections witheither HCV or HBV are the chief causes of hepatocellular car-cinoma (HCC) and cirrhosis [1,64]. Despite the similarities inthe sequelae of chronic infection by these viruses, they differin genetic structure and life cycles, which necessitates differentapproaches to developing RNAi therapy.
Several studies have been carried out aimed at utilizingRNAi to treat HBV infection (reviewed in [65,66]). Approxi-mately 6% of the world’s population is chronically infectedwith HBV. Drugs available at present have limited efficacy,and carriers of the virus are at risk of HCC. Despite imple-mentation of vaccination programs in parts of the worldwhere HBV infection is endemic, persistent HBV infectionis likely to be a significant global problem for many years,and improved treatment of the infection remains a priority.The virus has a compact genome that comprises partlydouble-stranded relaxed circular DNA (rcDNA), which isconverted to covalently closed circular DNA (cccDNA) ininfected hepatocytes. This cccDNA then serves as a templatefor transcription of viral RNAs from which core, surface, poly-merase and X overlapping open reading frames (ORFs)are translated.
Several different target sites within all four HBV transcriptshave been found to be suitable for RNAi-mediated inhibitionof HBV replication [67-73]. As there is no convenient small ani-mal model of HBV infection, use has been made of HBVtransgenic mice to simulate the clinical condition. These ani-mals have HBV DNA stably integrated into their genomes,and constitutively produce the virus in a manner that issimilar to the HBV carrier state in humans. Initial studiesdemonstrated that recombinant adenoviruses carrying U6promoter-driven anti-HBV shRNA cassettes efficiently inhib-ited HBV replication in transgenic mice [61,74]. Comparisonwith the efficacy that was achieved after injection of similarmice with siRNA-containing lipoplexes [75] reveals that inhi-bition of HBV replication was considerably better withrecombinant adenoviruses. To address concerns about theimmunostimulatory effects, polyethylene glycol modificationof anti-HBV shRNA-expressing adenoviruses was tested [62].Successful attenuation of mouse immune responses to the vec-tor, a better safety profile and improved anti-HBV effectsafter repeat adenovirus administration were demonstrated.Although adenoviruses encode VA RNAI and RNAII, whichact as RSSs [31], these sequences do not appear to compromisesilencing efficacy of adenovirus-delivered RNAi activators [33].This is likely to be a result of VA RNA production during late
Mowa, Crowther & Arbuthnot
Expert Opin. Drug Deliv. (2010) 7(12) 1379
Exp
ert O
pin.
Dru
g D
eliv
. Dow
nloa
ded
from
info
rmah
ealth
care
.com
by
Uni
vers
ity o
f W
itwat
ersr
and
on 0
2/20
/13
For
pers
onal
use
onl
y.
adenovirus infection, which does not occur after replication-defective adenovirus vector infection of cells. Assessment ofanti-HBV HD adenoviruses has been carried out in one studyreported so far [76]. Modest silencing was observed, and islikely to have resulted from poor antiviral efficacy of theRNAi expression cassette used in this study. Nevertheless,proof of principle of the utility of HD adenoviruses for thetreatment of HBV infection was demonstrated in animmunotherapy-based approach. A mifepristone-inducibleexpression cassette was used to produce IFN-a and IL-12 inmurine and woodchuck models of HBV infection. In thesestudies, prolonged and specific intrahepatic expression oftransgenes with sustained antiviral effects was observed [34,77].Most importantly, when compared with first-generationadenoviruses carrying the same IFN-a cassette, HD adenovi-ruses resulted in superior liver damage protection in acuteinfection [77].The liver tropism of HCV should make infection with
this virus amenable to RNAi-based therapy using adeno-viruses. As with HBV, HCV infection is a significant causeof global health problems. Approximately 170 millionpeople are chronically infected with HCV [78]. The virus istypically transmitted percutaneously and infection persists in60 -- 80% of cases, which places individuals at high risk ofcirrhosis and HCC. Efficacy of licensed HCV therapies,which include PEG IFN-a and ribovirin, is variable andranges from 45 to 80% [79].HCV is a member of the Flaviviridae family and has a sin-
gle sense strand uncapped RNA genome of 9.6 kb [80]. Aninternal ribosomal entry site (IRES) located within the 5¢non-translated region (5¢NTR) is responsible for initiatingtranslation of the one HCV ORF. The large precursor poly-protein is cleaved by host cellular and viral proteases toform individual viral proteins. The entirely cytoplasmic lifecycle of this RNA virus makes it a good candidate forRNAi-based treatment. A difficulty with the development ofRNAi-based anti-HCV treatment has been the paucity ofsuitable animal models of the infection. Subgenomic repli-cons have been used commonly to study efficacy of antiviraltherapeutic agents in cell culture, and assessment of antiviralefficacy with HCV-infected cells in culture has not been pos-sible until recently. Available models of HCV infection in vivoare limited to chimpanzees [81] and chimeric immunodeficientmice that are grafted with human hepatocytes [82]. The com-plex nature of these models makes convenient comprehensivelong-term studies difficult to undertake. As a result of itsimportant function as an IRES, evolution of this 5¢NTRsequence is constrained [80], and despite being highly struc-tured, the IRES is a favored target of RNAi activators [83-87].As with HIV-1, HCV has a plastic genome and over-coming HCV escape by using combinatorial RNAiapproaches has been an active area of research [88,89]. Silencingof host dependency factors [90,91], including endogenousmiR-122 [92], may also be useful to counter the emergenceof resistant HCV strains. So far, there have been few if any
studies that have utilized adenoviruses to deliver HCV silenc-ing sequences. Given the dearth of available models to testanti-HCV efficacy in vivo, the slow progress in developinganti-HCV adenoviruses is perhaps not surprising. Neverthe-less, lessons learned from studying HBV silencing willno doubt be useful and directly applicable to advancinganti-HCV RNAi-based therapy.
6. Conclusion
Adenoviruses have been used widely in the development ofgene therapy and according to current information they arethe most commonly used vector in gene therapy trials. Appli-cations have been varied and include use for treatment of can-cer and infectious diseases. As expected, adenoviruses are wellsuited to incorporation of RNAi-activating expres-sion cassettes. Useful properties of adenoviruses that havecontributed to the popularity for gene therapy includethe following.
. The molecular biology of adenoviruses is understoodwell, and this has facilitated engineering of vectors toconfer specific intended biological properties.
. Adenoviruses are capable of infecting both dividing andnon-dividing cells in vivo.
. Lack of interference by viral transcriptional regulatorysequences enables rapid unimpeded transgene expression.
. Methods of propagating the vectors are continuallybeing improved.
. The vectors are typically stable and transduced DNA existsepisomally, with minimal risk of insertional mutagenesis.
. HD adenoviruses in particular have a high capacityfor incorporation of large transgene sequences or multi-ple cassettes, and are capable of prolonged transgeneexpression with reduced toxicity at high vector doses.
Successful propagation of HD adenoviruses was a signifi-cant step in the improvement of safety and efficacy of thisclass of viral vector. Lack of expression of viral proteins meansthat vector antigens are not presented by MHC class I/IIantigens and more sustained transgene expression can beachieved. Concomitant modification of HD adenoviruseswith polymers, such as PEG, may be used conveniently toattenuate innate immunostimulation. The very large capacityof HD adenoviruses allows for incorporation of up to 36 kbinto these vectors. Although this may not be particularlyimportant for propagation of vectors that contain smallRNAi expression cassettes, the extra capacity allows for incor-poration of more expression cassettes that could be used tomodify host immune responses to vectors.
Hepatotropism of adenovirus serotype 5-derived vectors isvery useful for treatment of viral infections that occur pri-marily in the liver. However, transduction of liver tissue is adisadvantage for the treatment of extrahepatic diseases, andcreative methods continue to be developed to redirect the
Therapeutic potential of adenoviral vectors for delivery of expressed RNAi activators
1380 Expert Opin. Drug Deliv. (2010) 7(12)
Exp
ert O
pin.
Dru
g D
eliv
. Dow
nloa
ded
from
info
rmah
ealth
care
.com
by
Uni
vers
ity o
f W
itwat
ersr
and
on 0
2/20
/13
For
pers
onal
use
onl
y.
tropism of adenoviruses. Despite these positive attributes, thepotential of adenoviruses for gene silencing applications hasnot been explored fully, and the reason is their powerful stim-ulation of host innate and adaptive immune responses. Thetoxic effects that result may be serious, and the cautiousapproach to using adenoviruses for systemic administrationis justified. Nevertheless, recent developments, particularlyin the field of modification of viral capsid proteins to evadecells of the immune system and efficient means of propagatingHD adenoviruses, have provided the field with the technologyfor producing safer vectors that may be applied successfully inthe future.
7. Expert opinion
Demonstration that adenovirus vectors are capable of highlyefficient gene transfer to cells in vivo led logically to theiruse for delivery of expressed RNAi activators. Using adenovi-ruses for delivery of RNAi effectors has benefited from thewealth of research on the topic of general applicability ofadenoviruses for gene therapy. There are many positive fea-tures of adenoviruses, summarized above, which make themappealing for delivery of expressed RNAi activators. For cer-tain applications the highly efficient delivery and expressionof transgenes is not surpassed by other vectors. However, har-nessing of this very important feature for clinical applicationhas been complicated. Enthusiasm for the use of adenoviruseshas been reduced by concerns about toxicity that may resultfrom their immunostimulatory effects, as well as costlinessof scalable synthesis of these vectors. Consequently, use ofnon-viral vectors for delivery of synthetic siRNAs and AAVsor lentiviral vectors to deliver RNAi expression cassettes hasbeen favored by researchers. Nevertheless, recent advances inmodifying adenoviruses have succeeded in moderating toxiceffects, and it is appropriate that their utility for therapeutictransfer of expressed RNAi activators should be revisited.
In summary, clinical application of adenoviruses toRNAi therapy will depend on improvements that achievethe following.
. Conclusive demonstration that the innate and adaptiveimmune responses to adenoviruses can be sufficientlyattenuated to avoid toxicity and achieve sustainedgene silencing.
. Improvement in methods for convenient large-scalepreparation of pure adenoviruses that are suitable for
clinical use is essential. Current procedures are costly,time-consuming and difficult to implement on a scalethat is large enough for human use.
. Development of methods to evade interaction withcells of the reticuloendothelial system and avoidanceof pre-existing immunity to wild-type adenoviruses.Infection with adenoviruses is common in general popu-lations, and immunity from community-acquiredinfections attenuates efficacy of the recombinantviral vectors.
. Comprehensive understanding of the clinical conditionsthat are best suited to adenovirus-mediated delivery ofRNAi activators. It is clear that one vector will not besuitable for all applications within the field of RNAitherapy, and identification of those diseases that arebest suited to adenovirus-mediated RNAi activatordelivery is important.
The field of RNAi-based treatment of diseases hasadvanced at a rapid pace over the past 10 years. There isnow substantial enthusiasm for the vast potential of thismethod of therapeutic silencing of gene expression. Limita-tions of the available delivery methods and lack of informa-tion on the long-term effects of RNAi activators’ expressionin vivo are the main obstacles to RNAi-based gene silencingrealizing its full potential. It is likely that the considerablemomentum that has been gained in the field of RNAi-based gene silencing will enable rapid progress to overcomecurrent difficulties with harnessing RNAi for treatment ofviral infections. Adenoviruses, and in particular availabilityof HD derivatives, have very useful features that shouldcontribute significantly to progress in the exciting field ofRNAi-based therapy. Overcoming the obstacles listed above,which is a reasonable expectation, should make adenovirusdelivery of anti-HBV and anti-HCV RNAi activators afeasible future therapeutic option.
Declaration of interest
Work in the authors’ laboratory has been supported byfunding under the Sixth Research Framework Programme ofthe European Union (Project RIGHT, LSHB-CT-2004 --005276), the South African National Research Foundation(NRF GUN 68339 and 65495), CANSA, PoliomyelitisResearch Foundation and the Medical Research Council.The authors state no other conflict of interest.
Mowa, Crowther & Arbuthnot
Expert Opin. Drug Deliv. (2010) 7(12) 1381
Exp
ert O
pin.
Dru
g D
eliv
. Dow
nloa
ded
from
info
rmah
ealth
care
.com
by
Uni
vers
ity o
f W
itwat
ersr
and
on 0
2/20
/13
For
pers
onal
use
onl
y.
BibliographyPapers of special note have been highlighted as
either of interest (�) or of considerable interest(��) to readers.
1. Grimm D, Kay MA. Therapeutic short
hairpin RNA expression in the liver: viral
targets and vectors. Gene Ther
2006;13(6):563-75
2. Dykxhoorn DM, Palliser D,
Lieberman J. The silent treatment:
siRNAs as small molecule drugs.
Gene Ther 2006;13(6):541-52
3. Liu YP, Vink MA, Westerink JT, et al.
Titers of lentiviral vectors encoding
shRNAs and miRNAs are reduced by
different mechanisms that require distinct
repair strategies. RNA
2010;16(7):1328-39
4. McCaffrey AP, Fawcett P, Nakai H,
et al. The host response to adenovirus,
helper-dependent adenovirus, and
adeno-associated virus in mouse liver.
Mol Ther 2008;16(5):931-41. Microarray gene analysis comparing
induction of innate immune response
genes by AAVs, adenoviruses and
HD adenoviruses.
5. Chen CC, Sun CP, Ma HI, et al.
Comparative study of anti-hepatitis B
virus RNA interference by
double-stranded adeno-associated virus
serotypes 7, 8, and 9. Mol Ther
2009;17(2):352-9
6. Raper SE, Chirmule N, Lee FS, et al.
Fatal systemic inflammatory response
syndrome in a ornithine transcarbamylase
deficient patient following adenoviral
gene transfer. Mol Genet Metab
2003;80(1-2):148-58.. An article that describes the death of a
patient following high dose
administration of adenoviruses.
7. Fire A, Xu S, Montgomery MK, et al.
Potent and specific genetic interference
by double-stranded RNA in
Caenorhabditis elegans. Nature
1998;391(6669):806-11.. Original article that described the
phenomenon of RNAi.
8. Kim VN, Han J, Siomi MC. Biogenesis
of small RNAs in animals. Nat Rev Mol
Cell Biol 2009;10(2):126-39
9. Zeng Y, Cullen BR. Efficient processing
of primary microRNA hairpins by
Drosha requires flanking nonstructured
RNA sequences. J Biol Chem
2005;280(30):27595-603
10. Elbashir SM, Harborth J, Lendeckel W,
et al. Duplexes of 21-nucleotide RNAs
mediate RNA interference in cultured
mammalian cells. Nature
2001;411(6836):494-8
11. Aigner A. Gene silencing through
RNA interference (RNAi) in vivo:
strategies based on the direct application
of siRNAs. J Biotechnol
2006;124(1):12-25
12. Corey DR. Chemical modification: the
key to clinical application of
RNA interference? J Clin Invest
2007;117(12):3615-22
13. Grimm D, Streetz KL, Jopling CL, et al.
Fatality in mice due to oversaturation of
cellular microRNA/short hairpin
RNA pathways. Nature
2006;441(7092):537-41. Paper emphasizing the importance of
controlled expression of RNAi
activators in vivo.
14. McBride JL, Boudreau RL, Harper SQ,
et al. Artificial miRNAs mitigate
shRNA-mediated toxicity in the brain:
implications for the therapeutic
development of RNAi. Proc Natl Acad
Sci USA 2008;105(15):5868-73
15. Ehlert EM, Eggers R, Niclou SP,
Verhaagen J. Cellular toxicity
following application of adeno-associated
viral vector-mediated RNA interference
in the nervous system. BMC Neurosci
2010;11:20 doi:10.1186/
1471-2202-11-20. Available at
http://www.ncbi.nlm.nih.gov/pmc/
articles/PMC2841193/pdf/
1471-2202-11-20.pdf
16. Witting SR, Brown M, Saxena R, et al.
Helper-dependent adenovirus-mediated
short hairpin RNA expression in the liver
activates the interferon response.
J Biol Chem 2008;283(4):2120-8
17. Robbins MA, Li M, Leung I, et al.
Stable expression of shRNAs in human
CD34+ progenitor cells can avoid
induction of interferon responses to
siRNAs in vitro. Nat Biotechnol
2006;24(5):566-71
18. Ely A, Naidoo T, Mufamadi S, et al.
Expressed anti-HBV primary
microRNA shuttles inhibit viral
replication efficiently in vitro and
in vivo. Mol Ther 2008;16(6):1105-12
19. Ely A, Naidoo T, Arbuthnot P. Efficient
silencing of gene expression with
modular trimeric Pol II expression
cassettes comprising microRNA shuttles.
Nucleic Acids Res
2009;37(13):e91 doi:10.1093/nar/gkp446
Available at http://www.ncbi.nlm.nih.
gov/pmc/articles/PMC2715259/pdf/
gkp446.pdf
20. Wold WSM, Horwitz MS. Adenoviruses.
In: Fields BN, Knipe DM, Howley PM,
editors. Fields virology. Wolters Kluwer
Health/ Lippincott Williams and Wilkins,
Philadelphia; 2007. p. 2395-436
21. Sharma A, Li X, Bangari DS, Mittal SK.
Adenovirus receptors and their
implications in gene delivery. Virus Res
2009;143(2):184-94
22. Wickham TJ, Mathias P, Cheresh DA,
Nemerow GR. Integrins alpha v beta 3
and alpha v beta 5 promote adenovirus
internalization but not virus attachment.
Cell 1993;73(2):309-19
23. Nalbantoglu J, Larochelle N, Wolf E,
et al. Muscle-specific overexpression of
the adenovirus primary receptor CAR
overcomes low efficiency of gene transfer
to mature skeletal muscle. J Virol
2001;75(9):4276-82
24. Carlisle RC, Di Y, Cerny AM, et al.
Human erythrocytes bind and
inactivate type 5 adenovirus by presenting
Coxsackie virus-adenovirus receptor and
complement receptor 1. Blood
2009;113(9):1909-18
25. Wolff G, Worgall S, van Rooijen N,
et al. Enhancement of in vivo
adenovirus-mediated gene transfer and
expression by prior depletion of tissue
macrophages in the target organ. J Virol
1997;71(1):624-9
26. Cotter MJ, Zaiss AK, Muruve DA.
Neutrophils interact with adenovirus
vectors via Fc receptors and complement
receptor 1. J Virol
2005;79(23):14622-31
27. Shayakhmetov DM, Gaggar A, Ni S,
et al. Adenovirus binding to blood
factors results in liver cell infection and
hepatotoxicity. J Virol
2005;79(12):7478-91
28. Waddington SN, McVey JH, Bhella D,
et al. Adenovirus serotype 5 hexon
mediates liver gene transfer. Cell
2008;132(3):397-409.. The role of FX in adenovirus
liver tropism is elucidated in
this study.
Therapeutic potential of adenoviral vectors for delivery of expressed RNAi activators
1382 Expert Opin. Drug Deliv. (2010) 7(12)
Exp
ert O
pin.
Dru
g D
eliv
. Dow
nloa
ded
from
info
rmah
ealth
care
.com
by
Uni
vers
ity o
f W
itwat
ersr
and
on 0
2/20
/13
For
pers
onal
use
onl
y.
29. Arnold J, Janoska M, Kajon AE, et al.
Genomic characterization of human
adenovirus 36, a putative obesity agent.
Virus Res 2010;149(2):152-61
30. Alemany R, Balague C, Curiel DT.
Replicative adenoviruses for cancer
therapy. Nat Biotechnol
2000;18(7):723-7
31. Andersson MG, Haasnoot PC, Xu N,
et al. Suppression of RNA interference
by adenovirus virus-associated RNA.
J Virol 2005;79(15):9556-65
32. Lu S, Cullen BR. Adenovirus
VA1 noncoding RNA can inhibit small
interfering RNA and
MicroRNA biogenesis. J Virol
2004;78(23):12868-76
33. Narvaiza I, Aparicio O, Vera M, et al.
Effect of adenovirus-mediated
RNA interference on endogenous
microRNAs in a mouse model of
multidrug resistance protein 2 gene
silencing. J Virol 2006;80(24):12236-47
34. Crettaz J, Otano I, Ochoa L, et al.
Treatment of chronic viral hepatitis in
woodchucks by prolonged intrahepatic
expression of interleukin-12. J Virol
2009;83(6):2663-74. Article describing the utility of HD
adenoviruses for immunomodulatory
silencing of woodchuck hepatitis virus.
35. Maione D, Della Rocca C, Giannetti P,
et al. An improved helper-dependent
adenoviral vector allows persistent gene
expression after intramuscular delivery
and overcomes preexisting immunity to
adenovirus. Proc Natl Acad Sci USA
2001;98(11):5986-91
36. Parks RJ, Chen L, Anton M, et al.
A helper-dependent adenovirus vector
system: removal of helper virus by
Cre-mediated excision of the viral
packaging signal. Proc Natl Acad
Sci USA 1996;93(24):13565-70
37. Umana P, Gerdes CA, Stone D, et al.
Efficient FLPe recombinase enables
scalable production of helper-dependent
adenoviral vectors with negligible
helper-virus contamination.
Nat Biotechnol 2001;19(6):582-5
38. Palmer D, Ng P. Improved system for
helper-dependent adenoviral vector
production. Mol Ther 2003;8(5):846-52.. Article describing the generation of
HD adenoviruses. Other publications
from this group describe refinements
in the methodology of HD
adenovirus propagation.
39. Dormond E, Chahal P, Bernier A, et al.
An efficient process for the purification
of helper-dependent adenoviral vector
and removal of helper virus by iodixanol
ultracentrifugation. J Virol Methods
2010;165(1):83-9
40. Schnell MA, Zhang Y, Tazelaar J, et al.
Activation of innate immunity in
nonhuman primates following
intraportal administration of
adenoviral vectors. Mol Ther
2001;3(5 Pt 1):708-22
41. Taniguchi M, Seino K, Nakayama T.
The NKT cell system: bridging innate
and acquired immunity. Nat Immunol
2003;4(12):1164-5
42. Chen Q, Wei H, Sun R, et al.
Therapeutic RNA silencing of
Cys-X3-Cys chemokine ligand 1 gene
prevents mice from adenovirus
vector-induced acute liver injury.
Hepatology 2008;47(2):648-58
43. Guidotti LG, Chisari FV. Noncytolytic
control of viral infections by the innate
and adaptive immune response.
Annu Rev Immunol 2001;19:65-91
44. Morral N, Parks RJ, Zhou H, et al.
High doses of a helper-dependent
adenoviral vector yield supraphysiological
levels of alpha1-antitrypsin with
negligible toxicity. Hum Gene Ther
1998;9(18):2709-16
45. Muruve DA. The innate immune
response to adenovirus vectors.
Hum Gene Ther 2004;15(12):1157-66
46. St George JA. Gene therapy progress and
prospects: adenoviral vectors. Gene Ther
2003;10(14):1135-41
47. Kolb M, Inman M, Margetts PJ, et al.
Budesonide enhances repeated gene
transfer and expression in the lung with
adenoviral vectors. Am J Respir Crit
Care Med 2001;164(5):866-72
48. Arnberg N. Adenovirus receptors:
implications for tropism, treatment and
targeting. Rev Med Virol
2009;19(3):165-78
49. Alemany R, Curiel DT. CAR-binding
ablation does not change biodistribution
and toxicity of adenoviral vectors.
Gene Ther 2001;8:1347-53
50. Kalyuzhniy O, Di Paolo NC,
Silvestry M, et al. Adenovirus
serotype 5 hexon is critical for virus
infection of hepatocytes in vivo.
Proc Natl Acad Sci USA
2008;105(14):5483-8
51. Smith TA, Idamakanti N,
Marshall-Neff J, et al. Receptor
interactions involved in
adenoviral-mediated gene delivery after
systemic administration in non-human
primates. Hum Gene Ther
2003;14(17):1595-604
52. Magnusson MK, Hong SS, Boulanger P,
Lindholm L. Genetic retargetting of
adenoviruses: novel strategy employing
‘deknobbing’ of the fiber. J Virol
2001;75:7280-9
53. Kreppel F, Kochanek S. Modification of
adenovirus gene transfer vectors with
synthetic polymers: a scientific review
and technical guide. Mol Ther
2008;16(1):16-29
54. Eto Y, Yoshioka Y, Mukai Y, et al.
Development of PEGylated adenovirus
vector with targeting ligand. Int J Pharm
2008;354(1-2):3-8
55. Hofherr SE, Shashkova EV, Weaver EA,
et al. Modification of adenoviral vectors
with polyethylene glycol modulates
in vivo tissue tropism and gene
expression. Mol Ther
2008;16(7):1276-82
56. Eto Y, Gao JQ, Sekiguchi F, et al.
PEGylated adenovirus vectors
containing RGD peptides on the tip
of PEG show high transduction
efficiency and antibody evasion ability.
J Gene Med 2005;7(5):604-12
57. Zhang F, Yao Y, Hao J, et al.
A dual-functioning adenoviral
vector encoding both transforming
growth factor-b3 and shRNA
silencing type I collagen: construction
and controlled release for
chondrogenesis. J Control Release
2010;142:70-7. A demonstration of the potential for
incorporation of more than one
expression cassette into adenoviruses.
58. Chen Q, Wei H, Sun R, et al.
Therapeutic RNA silencing of
Cys-X3-Cys chemokine ligand 1 gene
prevents mice from adenovirus
vector-induced acute liver injury.
Hepatology 2008;47:648-58
59. Ruiz R, Witting SR, Saxena R,
Morral N. Robust hepatic gene
Mowa, Crowther & Arbuthnot
Expert Opin. Drug Deliv. (2010) 7(12) 1383
Exp
ert O
pin.
Dru
g D
eliv
. Dow
nloa
ded
from
info
rmah
ealth
care
.com
by
Uni
vers
ity o
f W
itwat
ersr
and
on 0
2/20
/13
For
pers
onal
use
onl
y.
silencing for functional studies
using helper-dependent adenoviral
vectors. Hum Gene Ther
2009;20(1):87-94
60. Huang B, Schiefer J, Sass C, et al.
High-capacity adenoviral vector-mediated
reduction of huntingtin aggregate load
in vitro and in vivo. Hum Gene Ther
2007;18(4):303-11
61. Carmona S, Ely A, Crowther C, et al.
Effective inhibition of HBV replication
in vivo by anti-HBx short hairpin RNAs.
Mol Ther 2006;13(2):411-21
62. Crowther C, Ely A, Hornby J, et al.
Efficient inhibition of hepatitis B virus
replication in vivo, using polyethylene
glycol-modified adenovirus vectors.
Hum Gene Ther 2008;19(11):1325-31.. PEG modification of adenoviruses
enhances the HBV silencing efficacy of
adenoviruses by attenuating innate and
adaptive immune responses to
the vector.
63. Uprichard SL. The therapeutic potential
of RNA interference. FEBS Lett
2005;579(26):5996-6007
64. McGlynn KA, London WT.
Epidemiology and natural history of
hepatocellular carcinoma. Best Pract Res
Clin Gastroenterol 2005;19(1):3-23
65. Arbuthnot P, Ely A. Advances in the use
of RNAi to treat chronic hepatitis B
virus infection. In: Martinez MA, editor.
RNA Interference and viruses. Caister
Academic Press, Norfolk, UK;
2010. p. 143-60
66. Arbuthnot P, Thompson LJ. Harnessing
the RNA interference pathway to
advance treatment and prevention of
hepatocellular carcinoma.
World J Gastroenterol
2008;14(11):1670-81
67. McCaffrey AP, Nakai H, Pandey K,
et al. Inhibition of hepatitis B virus in
mice by RNA interference.
Nat Biotechnol 2003;21(6):639-44
68. Weinberg MS, Ely A, Barichievy S, et al.
Specific inhibition of HBV replication
in vitro and in vivo with expressed long
hairpin RNA. Mol Ther
2007;15(3):534-41
69. Giladi H, Ketzinel-Gilad M, Rivkin L,
et al. Small interfering RNA inhibits
hepatitis B virus replication in mice.
Mol Ther 2003;8(5):769-76
70. Hamasaki K, Nakao K, Matsumoto K,
et al. Short interfering RNA-directed
inhibition of hepatitis B virus replication.
FEBS Lett 2003;543(1-3):51-4
71. Klein C, Bock CT, Wedemeyer H, et al.
Inhibition of hepatitis B virus replication
in vivo by nucleoside analogues and
siRNA. Gastroenterology
2003;125(1):9-18
72. Konishi M, Wu CH, Wu GY. Inhibition
of HBV replication by siRNA in a stable
HBV-producing cell line. Hepatology
2003;38(4):842-50
73. Carmona S, Jorgensen MR, Kolli S,
et al. Controlling HBV replication
in vivo by intravenous administration of
triggered PEGylated
siRNA-nanoparticles. Mol Pharm
2009;6(3):706-17
74. Uprichard SL, Boyd B, Althage A,
Chisari FV. Clearance of hepatitis B
virus from the liver of transgenic mice by
short hairpin RNAs. Proc Natl Acad
Sci USA 2005;102(3):773-8. Results presented in this study show
that effective silencing of HBV
replication can be achieved in vivo
using adenoviruses.
75. Carmona S, Jorgensen MR, Kolli S,
et al. Controlling HBV replication
in vivo by intravenous administration
of triggered PEGylated
siRNA-nanoparticles. Mol Pharm
2009;6(3):706-17. Results presented in this study show
that effective silencing of HBV
replication can be achieved in vivo
using adenoviruses.
76. Rauschhuber C, Xu H, Salazar FH, et al.
Exploring gene-deleted adenoviral vectors
for delivery of short hairpin RNAs and
reduction of hepatitis B virus infection in
mice. J Gene Med 2008;10(8):878-89
77. Aurisicchio L, Delmastro P, Salucci V,
et al. Liver-specific alpha 2 interferon
gene expression results in protection from
induced hepatitis. J Virol
2000;74(10):4816-23
78. Wasley A, Alter MJ. Epidemiology of
hepatitis C: geographic differences and
temporal trends. Semin Liver Dis
2000;20(1):1-16
79. Feld JJ, Hoofnagle JH. Mechanism of
action of interferon and ribavirin in
treatment of hepatitis C. Nature
2005;436(7053):967-72
80. Bartenschlager R, Frese M,
Pietschmann T. Novel insights into
hepatitis C virus replication and
persistence. Adv Virus Res
2004;63:71-180
81. Wieland SF, Chisari FV. Stealth and
cunning: hepatitis B and hepatitis C
viruses. J Virol 2005;79(15):9369-80
82. Mercer DF, Schiller DE, Elliott JF, et al.
Hepatitis C virus replication in mice
with chimeric human livers. Nat Med
2001;7(8):927-33
83. Kronke J, Kittler R, Buchholz F, et al.
Alternative approaches for efficient
inhibition of hepatitis C virus
RNA replication by small interfering
RNAs. J Virol 2004;78(7):3436-46
84. Randall G, Rice CM. Interfering with
hepatitis C virus RNA replication.
Virus Res 2004;102(1):19-25
85. Takigawa Y, Nagano-Fujii M, Deng L,
et al. Suppression of hepatitis C virus
replicon by RNA interference directed
against the NS3 and NS5B regions of
the viral genome. Microbiol Immunol
2004;48(8):591-8
86. Wang Q, Contag CH, Ilves H, et al.
Small hairpin RNAs efficiently inhibit
hepatitis C IRES-mediated gene
expression in human tissue culture cells
and a mouse model. Mol Ther
2005;12(3):562-8
87. Yokota T, Sakamoto N, Enomoto N,
et al. Inhibition of intracellular
hepatitis C virus replication by synthetic
and vector-derived small interfering
RNAs. EMBO Rep 2003;4(6):602-8
88. Akashi H, Miyagishi M, Yokota T, et al.
Escape from the interferon response
associated with RNA interference using
vectors that encode long modified
hairpin-RNA. Mol BioSyst
2005;1:382-90
89. Watanabe T, Sudoh M, Miyagishi M,
et al. Intracellular-diced dsRNA has
enhanced efficacy for silencing HCV
RNA and overcomes variation in the
viral genotype. Gene Ther
2006;13(11):883-92
90. Randall G, Panis M, Cooper JD, et al.
Cellular cofactors affecting hepatitis C
virus infection and replication. Proc Natl
Acad Sci USA 2007;104(31):12884-9
91. Tai AW, Benita Y, Peng LF, et al.
A functional genomic screen identifies
Therapeutic potential of adenoviral vectors for delivery of expressed RNAi activators
1384 Expert Opin. Drug Deliv. (2010) 7(12)
Exp
ert O
pin.
Dru
g D
eliv
. Dow
nloa
ded
from
info
rmah
ealth
care
.com
by
Uni
vers
ity o
f W
itwat
ersr
and
on 0
2/20
/13
For
pers
onal
use
onl
y.
cellular cofactors of hepatitis C virus
replication. Cell Host Microbe
2009;5(3):298-307
92. Lanford RE, Hildebrandt-Eriksen ES,
Petri A, et al. Therapeutic silencing of
microRNA-122 in primates with chronic
hepatitis C virus infection. Science
2009;327(5962):198-201
93. Arbuthnot P, Ely A, Weinberg MS.
Hepatic delivery of RNA interference
activators for therapeutic application.
Curr Gene Ther 2009;9(2):91-103
94. Cullen BR. Viruses and microRNAs.
Nat Genet 2006;38(Suppl):S25-30
AffiliationMohube Betty Mowa, Carol Crowther &
Patrick Arbuthnot†
†Author for correspondence
University of the Witwatersrand,
School of Pathology,
Antiviral Gene Therapy Research Unit,
Health Sciences Faculty,
Private Bag 3, WITS 2050,
South Africa
Tel: +27 0 11 717 2365; Fax: +27 0 11 717 2395;
E-mail: [email protected]
Mowa, Crowther & Arbuthnot
Expert Opin. Drug Deliv. (2010) 7(12) 1385
Exp
ert O
pin.
Dru
g D
eliv
. Dow
nloa
ded
from
info
rmah
ealth
care
.com
by
Uni
vers
ity o
f W
itwat
ersr
and
on 0
2/20
/13
For
pers
onal
use
onl
y.
CH16 01/26/2013 3:22:37 Page 367
16
Approaches to Delivering RNAiTherapeutics that Target
Hepatitis B Virus
Carol Crowther, Mohube Betty Mowa, Abdullah Ely and Patrick Arbuthnot
Antiviral Gene Therapy Research Unit, School of Pathology, Health Sciences Faculty,
University of the Witwatersrand, South Africa
16.1 Introduction
Despite hepatitis B virus (HBV) vaccination programmes causing a decline in the
global incidence of infections with the virus, HBV remains highly prevalent in sub-
Saharan Africa, East Asia and South East Asia. Worldwide it is estimated that there are
387 million chronic carriers of the virus [1]. Persistently infected individuals have an
increased risk of developing cirrhosis and hepatocellular carcinoma (HCC). Ideally, anti-
HBV therapy should stop HBV replication and thereby avert complicating cirrhosis and
HCC. Conventional treatments for chronic HBV infection include interferon-a (IFN-aand pegylated IFN-a), which functions as an immunomodulator, and nucleoside or nucle-
otide analogs (lamivudine, entecovir, adefovir and tenofovir), which inhibit HBV genome
replication by targeting the viral reverse transcriptase [2]. These therapies have only lim-
ited success and availability of effective new HBV therapeutics is an unmet medical need.
The HBV is the prototype member of the hepadnavirus family. The DNA genome has a
partly double stranded and relaxed circular structure (rcDNA). After infection of hepato-
cytes, rcDNA is converted to a 3.2 kb covalently closed circular DNA (cccDNA). The
cccDNA serves as a template for production of HBV transcripts with open reading frames
Advanced Delivery and Therapeutic Applications of RNAi, First Edition. Edited by Kun Cheng and Ram I. Mahato.� 2013 John Wiley & Sons, Ltd. Published 2013 by John Wiley & Sons, Ltd.
CH16 01/26/2013 3:22:37 Page 368
(ORFs) encoding the core, polymerase, surface and X proteins [3]. HBV pregenomic
RNA (pgRNA) is also formed from the cccDNA. HBV cccDNA is a stable replication
intermediate, which has proven difficult to eliminate with currently available therapies.
pgRNA is packaged into viral capsids then reverse transcribed to form virion rcDNA.
Encapsulation of the capsids within an envelope, which is derived from the endoplasmic
reticulum and has embedded surface proteins, results in formation of the intact hepatitis B
virion. The compact nature of the HBV genome restricts its plasticity and the virus has
limited ability to evade the silencing effects of hybridizing nucleic acids without compro-
mising its own fitness. This feature and the essential requirement for the pgRNA replica-
tion intermediate indicate that HBV should be a good target for RNAi-based gene therapy.
16.1.1 RNAi Therapeutics
There is compelling evidence that exogenous activators can be used to exploit the endog-
enous RNAi machinery and achieve specific and potent silencing of genes of interest. The
mechanism provides the means of studying gene function and has potential application to
silencing of pathology-causing genes. The RNAi pathway may be activated by synthetic
or expressed exogenous RNAi activators. Features of the expressed and synthetic RNAi
activators that have been used to counter HBV replication are described in Figure 16.1.
Chemically synthesized short interfering RNAs (siRNAs) typically resemble mature
Figure 16.1 Types of RNAi activators that have been used to silence HBV replication.
Expressed sequences, generated from either from Pol III (a) or Pol II (b) promoters, are compat-
ible with incorporation into viral vectors. (c). Synthetic anti-HBV siRNAs are used in NVV
formulations. Characteristics of the different types of RNAi activator are briefly summarized.
For each type of RNAi activator, the mature guide is illustrated in grey.
368 Advanced Delivery and Therapeutic Applications of RNAi
CH16 01/26/2013 3:22:38 Page 369
endogenous micro RNAs (miRNAs), and DNA expression templates encode artificial
mimics of upstream miRNA intermediates of the RNAi pathway. These exogenous
sequences reprogramme the RNAi pathway to silence intended gene targets. The negative
charge, sensitivity to nucleases, hydrophilicity and immunostimulatory effects of siRNAs
have led to investigating use of chemical modifications to confer better drug-like propert-
ies. Chemical modifications have been aimed at improving delivery efficiency, reducing
clearance, increasing stability, enhancing target specificity and minimizing immunostimu-
latory effects [4–6]. Synthetic siRNAs have a smaller size than RNAi-activating expres-
sion cassettes. This feature together with cytoplasmic site of action makes siRNA delivery
and dose control easier to achieve than it is with expressed RNAi activators.
The more sustained silencing that may be achieved with expression cassettes is useful
for the treatment of chronic infection caused by HBV [7,8]. These cassettes may be prop-
agated conveniently using standard techniques of molecular biology. They are also stable
and compatible with incorporation into highly efficient viral vectors (VVs). Expressed
short hairpin RNAs (shRNAs), which mimic pre-miRNAs, have been widely used to acti-
vate the RNAi pathway. Typically, their expression has been placed under control of RNA
polymerase (Pol) III promoters and the powerful and constitutively active U6 small
nuclear RNA promoter has been commonly used [9]. Although effective silencing is
achieved, saturation of the endogenous RNAi pathway may occur that can lead to fatal
toxicity [10]. To overcome these problems and improve transcriptional control of RNAi
activators, pri-miRNA mimics that are compatible with expression from Pol II promoters
have been developed [11–18]. These artificial expression cassettes are amenable to multi-
merization to simulate natural polycistronic miRNAs. Using such a combinatorial RNAi
approach enables simultaneous targeting of various regions of a viral sequence. This is a
useful strategy to improve silencing efficacy and prevent viral escape [11,12,17,19]. Pro-
duction of multiple antiviral siRNAs from long hairpin RNAs (lhRNAs) has also been
described, but the efficiency with which the individual siRNAs are generated from these
templates is variable [20–22].
16.1.2 Hepatitis B Virus as a Target for RNAi-based Gene Silencing
Although evidence exists that viruses have evolved mechanisms to evade cellular RNAi
silencing mechanisms [23,24], HBV-encoded factors that are capable of suppressing
RNAi have not been described. In support of this, several investigations carried out
in vitro and in vivo demonstrated that the virus is indeed susceptible to RNAi-based inhi-
bition of replication [25–30]. Synthetic and expressed RNAi activators have been used
successfully to target different sites of the viral genome. In addition to typical Pol III
expression cassettes, Pol II artificial mono- and polycistronic anti-HBV pri-miRNAs have
been used successfully to knockdown HBV replication [11,12,30].
16.2 Vectors Suitable for Hepatic Delivery of HBV Gene Silencers
Since HBV is hepatotropic, efficient delivery of RNAi activators to the liver hepatocytes
is critically important to have therapeutic utility. This is challenging as vectors should
ideally take antiviral sequences to their intended sites of action within hepatocytes after
Approaches to Delivering RNAi Therapeutics that Target Hepatitis B Virus 369
CH16 01/26/2013 3:22:38 Page 370
systemic administration. Optimally, only a single administration should need to be given
to achieve a sustained inhibition of viral replication. If this is not possible vectors should
then be amenable to readministration and retain efficiency of inhibition of HBV replica-
tion. To gain access to hepatocytes, vectors need to traverse the endothelial fenestrated
barrier between the blood and hepatocytes. VVs and nonviral vectors (NVVs) should
therefore ideally have a uniform size of approximately 100 nm to enable them to cross the
fenestrated barrier and come into contact with hepatocytes (reviewed in [12]). Nonviral
vectors have commonly been used to deliver synthetic siRNAs, and recombinant VVs
engineered to deliver artificial RNAi expression cassettes. Characteristics of the types of
vectors that have been used to silence HBV replication are summarized in Table 16.1. As
synthetic formulations, NVVs are amenable to large-scale preparation, which is important
for clinical application. These vectors are capable of efficient delivery of synthetic
siRNAs to their cytoplasmic site of action but are generally inadequate for delivery of
anti-HBV DNA expression cassettes to hepatocyte nuclei. Developments in use of VVs
and NVVs for delivery of HBV-targeting sequences, as well as for other hepatic therapeu-
tic applications, are discussed below.
16.2.1 Viral Vectors
Adenoviruses (Ads) and adeno-associated viruss (AAVs) are both capable of effective
hepatocyte transduction and are able to achieve long-term transgene expression in the
liver. Lentiviral vectors (LVs) transduce hepatocytes stably, but efficiency of transgene
delivery to these cells following systemic administration in adult animals is generally
inadequate for treating chronic HBV infection. Nevertheless, LVs have potential thera-
peutic utility using ex vivo approaches (discussed below).
16.2.1.1 Adeno-associated Virus Vectors
AAVs are nonenveloped viruses that belong to the Parvoviridae family. They are small
(� 20 nm) and have a single-stranded DNA genome of 4.8 kb. Recombinant AAVs can
carry an insert of up to 4.6 kb, which is adequate for accommodating typical RNAi
expression cassettes [31]. An important advance in AAV vector design was the develop-
ment of second-generation double-stranded or self-complementary AAV vectors
(scAAVs). Transgene expression from these vectors is more efficient and allows for
administration of lower vector doses [32]. There are 81 clinical trials in progress that use
AAVs (http://www.abedia.com/wiley/vectors.php, accessed 13 January 2013). These vec-
tors are suitable for use in humans because they are nonpathogenic, do not replicate with-
out Ad co-infection, have low immunogenicity and high titers of the vectors may be
produced conveniently [33]. Although AAV safety is an advantage, a recent study showed
that AAVs may cause liver inflammation by activating a TLR-2-mediated responses in
hepatocytes [34]. An additional concern is that there is a high prevalence of neutralizing
antibodies (NAb) to AAV-2 in human populations [35]. Some of the NAbs also cross-react
with other AAV serotypes, which may limit their use as vectors in a clinical setting.
Recombinant AAVs lack the viral Rep protein, which restricts integration into the host
genome, and contributes further to vector safety [36]. The first AAV gene therapy vectors
were based on AAV-2, which is capable of transducing many different cell types [37].
There are currently more than 100 known AAV serotypes and it is possible to package the
370 Advanced Delivery and Therapeutic Applications of RNAi
CH16 01/26/2013 3:22:38 Page 371
Tab
le16.1
Advantages,disadvantagesandsignificantarticlesdescribingvectorsusedfordelivery
ofnucleic
acidsto
theliver.
Ads
AAVs
Lentiviruses
NVVs
Advantages
Hepatotropic
Serotype-dependentliver
tropism
Broadcelltropism
Targetingmoietiesfacilitate
livertropism
(e.g.
galactose)
Efficienttransduction
ofRNAi-activating
RNAsequences
Efficienttransductionof
RNAi-activatingRNA
sequences
EfficienttransductionofRNAi-
activatingRNAsequences
Amenable
tochemical
modificationto
confer
biologicalproperties
Sustainedtherapeutic
effectusingHD
Ads
Lim
itedtoxicity
Lim
itedim
munogenicity
Feasible
scale
upof
synthesis
Sustainedtherapeutic
effectforupto
8weeks
Stable
integrationandlong-term
therapeuticeffectoffsetneed
forrepeatadministration
Suitable
fordelivery
of
syntheticRNAisequences
Repeatadministration
possible
Disadvantages
Large-scale
productioniscostly
andlabour
intensive
Labour-intensivelarge-
scale
production
Labourintensivelarge-scale
production
Poordelivery
ofexpressed
RNAiactivatorsin
vivo
Immunostim
ulatory
andpotentially
toxic
Immunostim
ulationlimits
repeatadministration
Poortransductionoflivercells
followingsystemic
administration
Variable
immunostim
ulation
Pre-existingim
munity
attenuatesvector
efficacy
Repeatedadministration
requiresserotype
switching
Low
hepatotropism
Transienttherapeuticeffect
Repeatadministration
maybenecessary
(continued)
Approaches to Delivering RNAi Therapeutics that Target Hepatitis B Virus 371
CH16 01/26/2013 3:22:38 Page 372
Tab
le16.1
(Continued
) Ads
AAVs
Lentiviruses
NVVs
Significant
publications
relevantto
HBV
therapeutics
Uprichard
etal.[72]
Grimm
etal.[7]
Morrisseyetal.[27]
Use
ofAdto
target
HBVin
transgenic
mouse
model
Utility
ofscAAV-8
vectors
fortargetingHBVin
transgenic
mouse
model
Successfullivertransductionof
LVsusingpartialhepatectomy
Liposomedelivery
of
siRNAsto
HBVmouse
model
Carm
onaetal.[28]
McCaffreyetal.[33]
Pichard
etal.[95]
Zim
merm
anetal.[101]
Use
ofAdto
target
HBVin
transgenic
mouse
model
Highlightedthesafety
of
AAVsforgenetherapy
Pharm
acologicalprimingof
hepatocytesto
improve
LV-m
ediatedtransduction
UsingSNALPsfor
hepatotropic
nucleic
acid
delivery
innonhuman
promates
Crowtheretal.[29]
Chenetal.[41]
Polymermodification
toim
proveanti-
HBVefficacyof
Ads
Repeatedadministrationof
AAVspossible
with
serotypesw
itching
Rauschhuberetal.
[75]
Use
ofHD
Adto
targetHBVin
transgenic
mouse
model
372 Advanced Delivery and Therapeutic Applications of RNAi
CH16 01/26/2013 3:22:38 Page 373
AAV-2 genome with the capsid of any of these serotypes (pseudotyping). This feature is
useful to change vector tropism and evade host immune responses. AAV-8 and AAV-9
have a high affinity for hepatocytes (3–4 times higher than AAV-2) and have conse-
quently been used for hepatotropic delivery of RNAi effecters targeting HBV [38,39].
Recently, DNA shuffling has been employed to generate libraries with variations in
the exposed loops of AAV capsid proteins [40]. Subsequent positive or negative selec-
tion enables purification of vectors with defined properties, such as specific tissue tro-
pism and attenuated NAb interaction. This method is likely to be very useful for future
application in AAV vectorology.
Grimm et al. were the first to demonstrate the utility of scAAV-8 vectors for RNAi-
mediated HBV silencing [10]. However, although HBV replication was efficiently
inhibited in the transgenic mice, there was an associated high mortality. This prompted
subsequent studies which established that high concentrations of exogenous shRNAs
compete with the natural miRNA machinery to prevent processing of essential endoge-
nous miRNAs. Compromised function of hepatocyte miRNAs resulted in the death of
the mice. Other studies have subsequently employed AAVs to deliver HBV-targeting
RNAi expression cassettes. A dsAAV-2/8 vector, a dsAAV-2 genome pseudotyped with
an AAV-8 capsid, was successfully used to inhibit HBV replication in a transgenic
mouse model [41,42]. Significant HBV inhibition was maintained for 22 weeks.
Reduction in appearance of complicating liver adenomas in HBV transgenic mice was
also demonstrated after AAV delivery of anti-HBV expression cassettes [43,44]. To
overcome problems of neutralizing antibodies to the AAV-8 capsid, a vector expressing
the same anti-HBV sequence, but pseudotyped with AAV-9, was then administered.
This dsAAV-2/9 vector silenced HBV effectively and evaded the AAV-8 NAbs. Thus,
for successful repeated administration of anti-HBV AAVs, the serotype of the capsid
protein may be changed for each administration to avoid neutralizing effects of anti-
bodies [45].
An important recent advance in AAV vectorology has been demonstration of clinical
utility of AAVs that effect hepatic blood clotting factor IX gene expression in livers of
haemophiliac patients [46]. This clinical study reported that peripheral vein infusion of
the vectors resulted in improvement in the bleeding phenotype, and four of the six treated
patients did not require further factor-IX prophylaxis. The authors suggest that concerns
about toxicity and immune-mediated elimination of the vector may be countered by treat-
ment with a short course of immunosuppressive glucocorticoids. This successful clinical
study represents a significant milestone and paves the way for use of AAVs for other
applications such as in RNAi-based HBV therapy.
16.2.1.2 Adenovirus Vectors
Ads belong to the Adenoviridae family and according to available data are used in 24% of
current gene therapy clinical trials, which makes them the most widely used vectors
(http://www.abedia.com/wiley/vectors.php, accessed 13 January 2013). Ads are nonen-
veloped and have a double-stranded linear DNA genome of approximately 35 kb. There
are 55 known Ad serotypes, with derivatives of human serotypes 5 (Ad5) and 2 (Ad2)
being most commonly used as gene therapy vectors [47]. Ad vectors have several advan-
tages: they (i) efficiently transduce a broad range of dividing and nondividing cell types;
(ii) can be produced in high titers relatively easily; (iii) are capable of carrying large
Approaches to Delivering RNAi Therapeutics that Target Hepatitis B Virus 373
CH16 01/26/2013 3:22:38 Page 374
transgene inserts; and (iv) their molecular biology is well understood [48]. A significant
advantage of Ads for use in the delivery of anti-HBV RNAi activators is that they are
efficiently hepatotropic. Ad particles have a diameter of approximately 120 nm and are
able to traverse fenestrations in liver sinusoidal endothelial cells. This gives them access
to the microvillus surface of hepatocytes to enable receptor-mediated internalization into
these cells [49,50]. Interestingly, binding of blood clotting factor X to the Ad hexon pro-
tein confers hepatoropism on the vectors [51].
Following systemic administration of Ads to mice, the vectors are efficiently trans-
ported to the liver. However, once they reach hepatic tissue, up to 98% of the virus parti-
cles are sequestrated by the reticuloendothelial system, and in particular the Kupffer cells
[52]. These antigen presenting macrophages express a scavenger receptor A (SR-A),
which binds negatively charged regions on the hypervariable region 1 (HVR1) of Ad5
hexon protein [53]. Ads are destroyed in the phagocytic Kupffer cells, which themselves
undergo dose-dependent necrosis within 10minutes of systemic delivery of the vector
[52,53]. Activation of the reticuloendothelial system by Ads also stimulates an innate
inflammatory response. This effect is characterized by a rapid release of inflammatory
cytokines and may result in acute toxicity. Overcoming unintended effects that result
from immunostimulation following Ad administration, as well as evading pre-existing
immunity, have therefore been a priority of research involving use of Ads for gene
therapy.
A study published in 2008 used microarray analysis to assess the murine host responses
to first generation Ad, HD Ad and AAV vectors [33]. Mice were injected with equivalent
amounts of the different VVs containing human factor IX (hIX) expression cassettes.
RNAwas extracted from livers at 1 hour, 6 hours, 72 hours and four weeks after injection.
The gene expression patterns following Ad and HD Ad administration were very similar.
Both profiles were compatible with expression of genes that are involved in the type I IFN
response observed six hours after infection. AAVs elicited a more modest immune
response and highlighted the better safety profile of AAV vectors.
Various methods have been employed to avoid Ad sequestration by Kupffer cells.
These include administering chemicals, such as clodronate liposomes [54], which are spe-
cifically toxic to Kupffer cells. Alternatively high doses of Ad5 have been used to cause
Kupffer cell death [55]. This approach has been employed in Ad5 ‘predosing’ regimens to
deplete the Kupffer cell populations. Administration of the therapeutic viral vector soon
thereafter results in greater efficiency of liver cell transduction [56]. Another commonly
used and more clinically relevant approach to evade detection by Kupffer cells is polymer
modification of Ads [57]. Conjugation of viral capsids with polyethylene glycol (PEG)
shields the negative charges on Ad5 hexon to diminish vector interaction with Kupffer
cells. Hepatocyte transduction has successfully been achieved using this approach
[58–60], but gene delivery to primate hepatocytes using PEG-modified vectors may be
less efficient [61–63].
Gene-deletion strategies have also been employed to improve safety, efficiency and
transgene capacity. Initially, E1 and E3 genes were removed to render first-generation Ad
vector replication deficient and able to accommodate transgenes. These vectors, however,
elicit a strong acute innate and later cell mediated and humeral adaptive immune
responses [64]. The resulting effects may cause toxicity and also reduce the duration of
transgene expression. To overcome immune-stimulatory effects, additional viral genes
374 Advanced Delivery and Therapeutic Applications of RNAi
CH16 01/26/2013 3:22:38 Page 375
have been removed from the Ads. As well as deleting E1 and E3 genes, E2 and E4 have
been removed to form second-generation vectors [48]. Immunostimulation has been fur-
ther attenuated by development of helper-dependent (HD) or gutless Ad vectors. These
third-generation Ads have all viral protein coding genes deleted. The only remaining
sequences that do not encode viral proteins are the packaging signal and flanking inverted
terminal repeat (ITR) sequences. Deletion of all of the viral genes in HDAds limits induc-
tion of a cytotoxic T-cell mediated response and has an additional advantage of prolong-
ing transgene expression [48,65].
The innate immune response occurs one to six hours after intravenous injection of Ads
and is dose-dependent [66]. In mice the innate response is followed by a secondary
release of pro-inflammatory cytokines and chemokines that occurs five to seven days after
infection. This effect is thought to result from an adaptive immune response to expressed
viral proteins [67]. Activation of the innate response causes release of various chemokines
and proinflammatory cytokines such as tumour necrosis factor-a, interleukins (IL-6 and
IL-1b) and interferon-g (IFN-g). Toll-like receptors (TLRs) and MyD88, which is a TLR
adaptor gene, have been implicated in mediating the response Ads in vivo [68]. IFN-a and
-b production, which also contributes to the toxic effects of Ads [66,69–71], occurs in
splenic cells (myeloid dendritic cells) by a mechanism that is independent of TLRs and
cytosolic receptors of RNA and DNA. The effect is however dependent on endosomal
viral escape which activates MAP kinase and SAPK/JNK-signalling pathways.
In 2005 Uprichard and colleagues showed that HBV replication was inhibited by a
recombinant first generation Ad vector that delivered a HBV-targeting shRNA expression
cassette [72]. The effect lasted for at least 26 days in a HBV transgenic mouse model
following systemic administration of the vector. In a similar study published in 2006, first
generation Ad vectors carrying an RNAi effecter targeting the X ORF of HBV resulted in
inhibition of HBV replication [28]. Following on from this study, the silencing efficacy of
the shRNA Ad vectors was improved by chemical modification with PEG [29]. Impor-
tantly, polymer modification enabled HBV inhibition after repeat administration of the
vector. This effect was associated with attenuated release of proinflammatory cytokines,
adaptive immunostimulation and hepatotoxicity, which was not observed after adminis-
tration of the unmodified Ads.
The sustained hepatic transgene expression and attenuated immune stimulation that
may be achieved with HD Ad vectors are useful for delivery of HBV-silencing RNAi ther-
apeutics [73,74]. Nevertheless, as the structure of the HD Ad virions is the same as that of
the first-generation vectors, HD Ads remain capable of inducing an acute, dose-dependent
innate immune response [9,33]. The usefulness of RNAi-activating anti-HBV HDAd vec-
tors has been assessed in one study reported to date [75]. Although potentially effective,
the specificity of the silencing effect could not be confirmed. In a recent study undertaken
by our group, intravenous administration of 5� 109 recombinant HD Ads to HBV trans-
genic mice transduced 80–90% of hepatocytes. HBV replication was decreased by
approximately 95% in animals receiving the HD Ads and this effect was sustained for
eight weeks without any apparent adverse effects. This inhibition of viral replication was
significantly more sustained than that achieved by first-generation Ad vectors targeting
the same region of the HBV genome (unpublished data).
Assessing efficacy of HD Ads for RNAi-based treatment of other diseases has provided
insights that are relevant to using these vectors for delivering HBV-silencing sequences.
Approaches to Delivering RNAi Therapeutics that Target Hepatitis B Virus 375
CH16 01/26/2013 3:22:38 Page 376
In a study aimed at inhibiting an endogenous hepatic gene, HD Ads successfully delivered
a shRNA expression cassette targeting the gene encoding the sterol regulatory element-
binding protein-1c (SREBP-1) [76]. This transcription factor is an important mediator of
insulin effects on lipid and carbohydrate metabolism in the liver. Following systemic
administration of 2� 1011 HD Ad particles to mice that model type 2 diabetes, 90%
knockdown of the target gene was observed in the liver after one week and the effect was
sustained for 21 days. An interesting observation was that there appeared to be a limit to
the level of gene silencing, and administration of higher vector doses did not augment
knockdown but increased immunostimulatory effects [76,77].
Although studies on the use of HD Ads in large animal models of HBV infection
have not yet been reported, results from investigations in other disease models are
relevant. Successful long term-expression of transgenes delivered with HD Ad vectors
has been achieved in non-human primates [78,79]. However, when administered in
high doses (>1� 1013 viral particles) acute and sometimes fatal toxicity was reported
to occur [9,74]. There is some preliminary data available from a study that used HD
Ads to deliver a blood-clotting factor VIII sequence to the liver of a patient with hae-
mophilia A. The patient apparently developed liver toxicity which lasted 19 days, and
factor VIII was, unfortunately, not expressed [80]. Some of the strategies that have
been used to attenuate Ad toxicity caused by immunostimulation have been discussed
above. As well as polymer modification of immunostimulatory epitopes, administra-
tion of dexamethasone, which is an anti-inflammatory glucocorticoid, and transient
pharmacological suppression of B and T cells have been used [29,57,61,81–84].
Another factor that diminishes efficiency of Ads in a clinical setting is vector seques-
tration by the Coxsackie Adenovirus Receptor (CAR) and Complement 1 receptor on
human erythrocytes [86]. These receptors are not present on mouse erythrocytes,
which emphasizes limitations of murine models in predicting clinical utility of Ad
vectors [85,86]. To overcome this sequestration problem it may be possible to modify
vectors with polymers or to isolate the liver circulation and deliver the Ad vector
directly to the liver by using an intravenous catheter [87,88].
16.2.1.3 Lentiviral Vectors
Lentiviral vectors comprise a subgroup of retroviruses that transduce both dividing and
nondividing cells. An important feature of the vectors is that stable integration of their
proviruses enables long-term and potentially indefinite expression of transgenes, which
may be up to 7.5 kb in length [45,89]. This is useful to achieve sustained expression of
anti-HBV sequences and render infected cells resistant to HBV. Although provirus inte-
gration into host genomes is potentially mutagenic, targeting to heterochromatin should
improve the vectors’ safety profile [90]. Interestingly, it has recently been demonstrated
that LVs were less likely to integrate into transcriptionally active sites in nondividing cells
than in dividing cells [91].
To date, LVs have been used in 40 clinical trials (http://www.abedia.com/wiley/vectors.
php, accessed 13 January 2013). Most trials involve ex vivomodification of hematopoietic
stem cells and T-lymphocytes for the treatment of HIV-1 and monogenic diseases.
Although ex vivo modification of hepatocytes to render them resistant to HBV infection
offers interesting therapeutic possibilities, the methods required to employ this approach
are yet to be established. Transduction of autologous hepatocytes derived from induced
376 Advanced Delivery and Therapeutic Applications of RNAi
CH16 01/26/2013 3:22:38 Page 377
pluripotent stem cells followed by hepatic infusion may become a feasible method of
populating the liver with HBV-resistant cells [92].
As for their utility for treating chronic HBV after systemic administration, a limitation
is that LVs transduce only a small proportion of adult murine hepatocytes. Liver cell
transduction can be improved if cell proliferation is occurring at the time of LV adminis-
tration. In support of this, injection of vectors into young and newborn animals [93] or
following partial hepatectomy in adults [94] achieves greater hepatocyte transduction effi-
ciency. Priming hepatocytes for LV infection by pretreating animals with cholic acid and
phenobarbital has recently been investigated as a clinically relevant alternative to improv-
ing LV transduction of hepatocytes [95]. Interestingly phenobarbital has a weak stimula-
tory effect on cell proliferation, but cholic acid has no direct effect on the cell cycle.
Without increasing markers of cell proliferation, both compounds were shown to improve
transduction of hepatocytes in vivo following systemic administered LVs by a factor of 6
to 9-fold. This priming strategy is easy to implement but may not enable transduction of
adequate numbers of adult hepatocytes to be of use in RNAi-based HBV therapy with LV
vectors.
16.2.2 Nonviral Vectors
As gene-delivery vehicles, NVVs offer a number of advantages over VVs. These include
low immunogenicity, ability to accommodate large nucleic acids, modular assembly and
potential for large-scale synthesis. The recent announcement by Alnylam Pharmaceuticals
Incorporated, together with Tekmira Pharmaceuticals Corporation, of a successful Phase I
clinical trial testing a siRNA formulated within a NVV has been an important milestone
in advancing these nucleic acid delivery vehicles (http://alturl.com/aadcn, accessed 13
January 2013). The data, presented at the International Symposium on Familial Amyloi-
dotic Polyneuropathy, demonstrated safety and tolerability of an antitransthyretin (TTR)
siRNA formulated within Tekmira’s lipid nanoparticle (LNP) vectors. Furthermore, a
rapid and dose-dependent decrease in serum TTR protein concentrations was observed in
patients with amyloidosis of TTR aetiology. Tekmira’s LNP technology is formulated to
target hepatocytes specifically, which is the major site of TTR synthesis. Although
appealing, the applicability of this technology to other diseases of the liver, such as
chronic HBV infection, remains to be tested.
Lipid nanoparticles may be categorized within the cationic liposome class of NVVs.
Lipid-mediated DNA-transfection (lipofection) was first described in 1987 [96]. The
methodology aims to form nucleic acid/lipid complexes to neutralize the inherent nega-
tive charge of nucleic acids and thereby facilitate transfer across lipid-rich and negatively
charged plasma membranes. In the first study aimed at testing this approach, Felgner and
colleagues assessed the utility of the synthetic cationic lipid DOTMA (N-[1-(2, 3-dioley-
loxy) propyl]-N, N, N-trimethyl ammonium chloride) as a DNA-binding cationic lipid
carrier. It was elegantly demonstrated that cationic lipids spontaneously form liposomes
and complex with DNA to form lipoplexes. Neutralization of the negative charge and
condensation of the nucleic acids to form lipoplex particles enabled DNA delivery to
cells. Since this first description of lipofection, numerous advances in the field have taken
place, and these vectors have emerged as being suitable for in vitro and in vivo application
(reviewed in [97]).
Approaches to Delivering RNAi Therapeutics that Target Hepatitis B Virus 377
CH16 01/26/2013 3:22:38 Page 378
An important development in advancing lipoplex vectors was the incorporation of neu-
tral lipids such as DOPE (dioleoylphosphatidylethanolamine) and DOPC (dioleoylphos-
phatidylcholine) into the formulations. DOPE improves lipofection by aiding release of
NVVs from endosomes [98]. The modular way in which liposome formulations may be
assembled has enabled evaluation of many combinations of cationic lipids, neutral lipids,
targeting and ‘stealth’ components. This has been particularly useful to adjust the compo-
sition of lipoplexes to influence biological properties. In one of the first studies aimed at
exploring therapeutic utility of anti-HBV siRNAs, Morrissey and colleagues demon-
strated efficient liposome-mediated delivery of siRNAs in a mouse model of HBV rep-
lication [99]. Potent silencing of viral gene expression was observed for up to seven
days after siRNA administration and the therapeutic effect was maintained after
administration of repeat doses. The vectors used in this study, termed stable nucleic
acid lipid nanoparticles or SNALPs, have since been used for other hepatic gene-
silencing applications. These include nonhuman primate studies that demonstrated
inhibition of Ebola virus replication [100] and silencing of endogenous ApoB expres-
sion [101]. Interestingly, SNALPs were the forerunners for Tekmira’s LNP technology,
which has been used in the Phase I clinical trial for the treatment of familial amyloido-
sis (discussed above).
Cationic polymers comprise the second major class of NVVs [102]. This group of
compounds, as with cationic lipids, binds nucleic acids to neutralize negative charges
through the formation of polyplexes. Condensation of nucleic acids enables generation
of highly compact nanoparticles, which may be taken up by cells through endocytosis
(reviewed in [103]). Bioconjugation of the 50 or 30 end of the sense or antisense strands
of siRNAs with lipids, proteins, peptides and inorganic molecules has also been
explored as a means of targeted delivery (reviewed in [104]). More recently, Zhu and
Mahato successfully conjugated galactose-bound PEG (Gal-PEG) to the 30 end of the
sense strand of siRNAs and demonstrated silencing of target sequences in hepatocytes
([105]). The silencing achieved with the siRNAs conjugated to Gal-PEG was, however,
improved when encapsulated within a cationic liposome. Further characterization of the
siRNA conjugates in vitro and in vivo should provide insights into the therapeutic utility
of the technology.
In addition to lipoplex and polyplex NVVs, several other nonviral delivery strate-
gies have been developed. Novel NVVs that have specifically been developed for
siRNA delivery include carbon nanotubes [106], lipidoids [107], membrane trans-
location peptides [108], universal base derivatives [109], and modified arginine pep-
tides [110].
Although NVVs can be complexed with both DNA and RNA, these delivery vehicles
have primarily been used in vivo to deliver siRNAs to target cells. An important reason for
this derives from the fact that delivery of siRNAs to their site of action faces fewer hurdles
than delivery of RNAi expression cassettes that comprise DNA. siRNAs function in the
cytoplasm and unlike DNA expression cassettes do not have to traverse the nuclear mem-
brane to be functional. Nevertheless, delivery of siRNAs to the cytoplasm of target cells in
sufficient quantities to have a desirable effect remains challenging. Difficulties include
ensuring NVV stability, specificity of cell targeting, facilitating cellular uptake and cyto-
plasmic release of siRNAs. As HBV infection occurs in hepatocytes, efficient delivery
of anti-HBV complexes to these cells should ideally be achievable after systemic
378 Advanced Delivery and Therapeutic Applications of RNAi
CH16 01/26/2013 3:22:38 Page 379
administration. To access hepatocytes and traverse hepatic fenestrations, the NVV formu-
lations should also be of uniform small size of approximately less than 120 nm in diame-
ter. Since HBV infection is chronic, repeated NVV administrations may be required and
formulations should not be toxic or immunogenic.
16.2.2.1 Using NVVs to Deliver anti-HBVsiRNAs to the Liver
Within the liver, HBV replicates exclusively in hepatocytes and as a consequence NVVs
designed to deliver antiviral siRNAs are targeted to these cells. Some sequelae related to
the viral infection, for example fibrosis, are associated with secondary effects on other
hepatic cells such as hepatic stellate cells. NVV-mediated delivery to these cells requires
different targeting strategies (reviewed in [111]). To achieve hepatocyte-specific delivery,
numerous cationic lipid formulations have been evaluated. Generally, vectors carry their
payloads to hepatocytes passively or by a receptor-mediated process. The various ligands
incorporated into NVVs and the cognate hepatocyte receptors they target have been
extensively reviewed elsewhere [111]. Examples of receptor and target pairings include
interaction of the hepatocyte asialogycoprotein receptor [112] with galactose-containing
NVVs and binding of apolipoprotein A-1 (Apo A-1) [113] in NVVs with the hepatocyte
high density lipoprotein (HDL) receptor. Hepatocytes exclusively and abundantly express
the asialoglycoprotein receptor, which interacts specifically with galactose moieties
[112]. This fact has often been exploited to direct NVVs to the liver [114]. A novel galac-
tose-modified DOPE derivative (1,2-dioleoyl-sn-glycerol-3-phosphatidyl-N-(1-deoxylac-
tito-1-yl)etanolamine or GDOPE) has been used to prepare liposome formulations that
achieve improved hepatocyte delivery of siRNAs [115]. In addition to the galactose-modi-
fied DOPE, the formulation also included a cationic lipid, a PEG-lipid, and a helper lipid.
The liposome-siRNA complex exhibited low toxicity in cell culture and efficiently deliv-
ered siRNAs to cells. Transmission electron microscopy indicated that the diameter of the
liposomes ranged between 100 and 140 nm and had a multilammelar structure. The lip-
oplexes delivered siRNAs to hepatocytes in vivo but delivery to other tissues was not com-
prehensively evaluated. Although promising as a hepatocyte-specific delivery vehicle, this
technology requires further refinement. Apo A-1 interaction with HDL receptors on liver
cells has also been exploited to confer hepatotropism on siRNA-carrying lipoplex formu-
lations [113]. Apo A-1 is a component of HDL and consequently is involved in the hepa-
tocyte uptake of cholesteryl esters. Apo A-1-conjugated liposomes were capable of
delivering anti-HBV siRNAs to the livers of mice in a transient HBV replication model.
Subsequent studies assessed efficacy of improved Apo A-1 conjugated liposomes carrying
siRNAs targeting the hepatitis C virus [116,117]. These NVVs demonstrated better liver-
specific targeting in vivo, more efficient target knockdown and minimal toxicity [117]. A
novel cationic lipid DODAG (N0,N0-dioctadecyl-N-4,8-diaza-10-aminodecanoylglycine
amide) was recently shown to encapsulate anti-HBV siRNAs and mediate efficient hepa-
tocyte delivery in a mouse model of virus replication [118]. DODAG-siRNAs, formulated
without a neutral helper lipid, efficiently knocked down viral DNA and antigen markers of
replication. Other lipoplex formulations have also been employed to deliver anti-HBV
siRNAs in vivo [119–121]. These included polyamine-conjugated cholesterol [121] or
aminoxy cholesterol lipids that facilitate ‘stealth’ polymer incorporations [119]. These
passively hepatotropic vectors were capable of silencing viral replication in HBV trans-
genic mice over a period of a few weeks.
Approaches to Delivering RNAi Therapeutics that Target Hepatitis B Virus 379
CH16 01/26/2013 3:22:38 Page 380
16.2.2.2 Off-target Effects
Studies that comprehensively characterize potential toxic side effects of many of the
reported NVVs are incomplete. Toxic induction of the innate immune response was
shown when using a formulation comprising the cationic lipid CLinDMA, cholesterol
and PEG-dimyristoylglycerol [122]. The siRNA within the liposome contributed to IFN
response induction but most of the effect was attributed to the lipids making up the lip-
oplex. In addition to causing unwanted side effects, the immune response may also reduce
the duration of siRNA silencing. By administering dexamethasone prior to lipoplex
administration, the innate immune response was effectively attenuated but did not have a
significant effect on silencing activity of the siRNA. Dexamethasone treatment therefore
offers a useful strategy for reducing undesired immune-mediated side effects. This drug
has similar utility for the reduction of immunostimulation by hepatotropic Ad vectors
(discussed above). Potential toxic side effects may also arise as a consequence of
unintended NVV-mediated delivery of siRNAs to untargeted cells. In general, there is a
paucity of comprehensive analysis of the biodistribution of siRNAs delivered with NVVs
[123–125]. Similarly, there is little information on the subcellular localization of siRNAs
after NVV-mediated delivery to target cells [125,126].
16.2.2.3 Recent Advances in Use of NVVs for Hepatotropic siRNA Delivery
Development of NVVs for delivery of nucleic acids is a very active field of research, which
has been the subject of excellent reviews [127–129]. Some selected recent studies using
synthetic vectors that target the liver, and which may be used for delivery of anti-HBV ther-
apeutics, are discussed below. In a recent study, use of protamine sulfate and sonication was
investigated as a means of facilitating production of nanosize (�100nm) lipoplexes [130].
siRNAs were complexed with protamine sulfate, then mixed with cholesterol and DOTAP
(1,2-dioleoyl-3-trimethylammonium-propane) and sonicated. Liposomes of approximately
100 nm in diameter were consistently obtained and shown to be effective NVVs for delivery
of siRNAs to liver cells. Importantly the study showed that siRNAs, upon entering the target
cell, were taken up by endosomes and efficiently released into the cytosol. Data from in vivo
analysis demonstrated that anti-GAPDH siRNAs delivered with these vectors were capable
of knocking down the target protein in livers of mice and there was little evidence of toxic-
ity. Intraperitoneal administration of lipoplex formulations also resulted in highly specific
delivery of siRNAs to the mouse liver. Using a novel approach, Adami et al. recently dem-
onstrated utility of an amino acid-based liposomal delivery system [131]. The study
described generation of dialkylated amino acid (DiLA2) compounds. These molecules com-
prise two hydrocarbon chains linked to the a-carbon and a-amino groups of arginine. This
effectively created a lipid-like compound with a hydrophilic head and a hydrophobic tail.
The guanidinium head group of arginine has two intended functions: (i) it binds negatively
charged proteoglycans to facilitate cellular uptake of this carrier molecule; and (ii) interac-
tion with phosphate groups of nucleic acids enables formation of the NVV complexes. To
facilitate liposome formation by the DiLA2 compounds, cholesteryl hemisuccinate
(CHEMS) was used as a helper lipid. Transmission electron microscopy indicated that diam-
eters of liposome formulations ranged from 100nm to 125 nm. The NVVs delivered siRNA
to the livers of mice specifically and expression of an endogenous gene, anti-ApoB, was
reduced by 80% within 2 days of administration. Thereafter, silencing diminished to 50% at
9 days and 20% at 14 days after administration of the formulations.
380 Advanced Delivery and Therapeutic Applications of RNAi
CH16 01/26/2013 3:22:38 Page 381
Although non lipid-based NVVs such as functionalized nanotubes [106] and lipidoids
[107] have shown promise as siRNA vectors, questions about the specificity of delivery,
biocompatibility of these compounds and mechanism of action remain to be answered.
Nevertheless NVVs in general show great potential as delivery vehicles of anti-HBV
siRNAs. The field is developing rapidly and with positive data from clinical trials provid-
ing impetus, NVVs are quickly gaining prominence as hepatotropic delivery vehicles for
therapeutic siRNA sequences.
16.3 Conclusions
Effective treatment of people chronically infected with HBV remains a major global chal-
lenge. Since 2000 we have witnessed significant advances that demonstrate the feasibility
of using RNAi to counter the infection. Studies have shown that powerful inhibition of
HBV can be achieved using either synthetic siRNAs or expressed shRNAs. The more sus-
tained silencing that is achieved with expressed shRNA activators makes them well suited
to treating chronic HBV infections. To advance gene silencing technology to a stage of
clinical applicability, emphasis in the field is now justifiably being placed on improving
vectors that deliver RNAi effecters to HBV-infected livers. Invaluable information on the
advantages and disadvantages of various VVs and NVVs has been gathered from studying
cell culture-based and murine models of HBV. However, refinements of existing vec-
torology technology are still needed. Investigations carried out on large animal mod-
els of HBV, which are currently limited, will be important for better understanding
of the properties of the various vectors in a more clinically relevant context. Whether
RNAi-based therapeutics eliminate HBV cccDNA remains unclear. It will be inter-
esting to assess whether engineered HBV-targeting sequence-specific nucleases, such
as Zinc finger nucleases or transcription activator like effector nucleases (TALENS),
are capable of disabling this stable HBV replication intermediate. Determining effi-
cacy of engineered nucleases and currently licensed therapies, when used in conjunc-
tion with RNAi-based therapeutics, will be important to determine and may well
reveal synergistic actions.
Some of the significant delivery hurdles that need to be overcome before RNAi-based
HBV therapy is realized have been highlighted in this review. Importantly, many of the
obstacles are also faced by researchers working on other topics within the broader fields
of gene therapy and RNAi-based therapeutics. Improvements in gene delivery in general
and for treating hepatic diseases specifically should be applicable to RNAi-based HBV
therapy. It is also likely that multidisciplinary approaches will be important for making
advances in vectorology that is applied to RNAi-based HBV therapy. Progress at the inter-
face between chemistry and molecular biology, for example relating to use of polymers
and lipids for nucleic acid delivery, is likely to be particularly significant. Also, improved
understanding of RNAi and HBV molecular biology will provide better understanding of
how the pathway can be harnessed to silence the virus. Although the disinvestment from
RNAi therapy programmes by some large pharmaceutical companies recently had a nega-
tive impact in the field [132], a high level of enthusiasm for the potential of the technol-
ogy remains. Advances in gene therapy, and how these will assist in achieving the goal of
RNAi-based HBV treatment, are awaited with interest.
Approaches to Delivering RNAi Therapeutics that Target Hepatitis B Virus 381
CH16 01/26/2013 3:22:38 Page 382
Acknowledgments
Work in the authors’ laboratory has been supported by funding from the South African
National Research Foundation (NRF GUN 68339 and 65495), CANSA, Poliomyelitis
Research Foundation and Medical Research Council. M.B.M. is a Claude Leon Founda-
tion Postdoctoral Fellow.
References
1. Arbuthnot, P. and Kew, M. (2001) Hepatitis B virus and hepatocellular carcinoma.
International Journal of Experimental Pathology, 82 (2), 77–100.
2. Lok, A.S. and McMahon, B.J. (2007) Chronic hepatitis B. Hepatology (Baltimore,
Md), 45 (2), 507–539.
3. Alexopoulou, A. et al. (1996) Whole genome analysis of hepatitis B virus from four
cases of fulminant hepatitis: genetic variability and its potential role in disease path-
ogenicity. Journal of Viral Hepatitis, 3 (4), 173–181.
4. Dominska, M. and Dykxhoorn, D.M. (2010) Breaking down the barriers: siRNA
delivery and endosome escape. Journal of Cell Science, 123 (Pt 8), 1183–1189.5. Salomon, W. et al. (2010) Modified dsRNAs that are not processed by Dicer main-
tain potency and are incorporated into the RISC. Nucleic Acids Research, 38 (11),
3771–3779.
6. Corey, D.R. (2007) Chemical modification: the key to clinical application of RNA
interference? The Journal of Clinical Investigation, 117 (12), 3615–3622.
7. Grimm, D. and Kay, M.A. (2006) Therapeutic short hairpin RNA expression in the
liver: viral targets and vectors. Gene Therapy, 13 (6), 563–575.
8. McAnuff, M.A. et al. (2007) Potency of siRNAversus shRNA mediated knockdown
in vivo. Journal of Pharmaceutical Sciences, 96 (11), 2922–2930.
9. Brunetti-Pierri, N. et al. (2004) Acute toxicity after high-dose systemic injection
of helper-dependent adenoviral vectors into nonhuman primates. Human Gene
Therapy, 15 (1), 35–46.
10. Grimm, D. et al. (2006) Fatality in mice due to oversaturation of cellular micro-
RNA/short hairpin RNA pathways. Nature, 441 (7092), 537–541.
11. Ely, A. et al. (2008) Expressed anti-HBV primary microRNA shuttles inhibit viral
replication efficiently in vitro and in vivo. Molecular Therapy: The Journal of the
American Society of Gene Therapy, 16 (6), 1105–1112.
12. Arbuthnot, P. et al. (2009) Hepatic delivery of RNA interference activators for
therapeutic application. Current Gene Therapy, 9 (2), 91–103.
13. Pan, J.S. et al. (2009) Long-term RNA interference and its application to hepatitis B
virus. Journal of Digestive Diseases, 10 (3), 165–171.
14. Boudreau, R.L. et al. (2009) Artificial microRNAs as siRNA shuttles: improved
safety as compared to shRNAs in vitro and in vivo.Molecular Therapy: The Journal
of the American Society of Gene Therapy, 17 (1), 169–175.15. McBride, J.L. et al. (2008) Artificial miRNAs mitigate shRNA-mediated toxicity in
the brain: implications for the therapeutic development of RNAi. Proceedings of the
National Academy of Sciences of the United States of America, 105 (15), 5868–5873.
382 Advanced Delivery and Therapeutic Applications of RNAi
CH16 01/26/2013 3:22:38 Page 383
16. McCaffrey, A.P. (2009) RNA interference inhibitors of hepatitis B virus. Annals of
the New York Academy of Sciences, 1175, 15–23.
17. Aagaard, L.A. et al. (2008) Engineering and optimization of the miR-106b cluster
for ectopic expression of multiplexed anti-HIV RNAs. Gene Therapy, 15 (23),
1536–1549.
18. Liu, Y.P. et al. (2009) RNAi-mediated inhibition of HIV-1 by targeting partially
complementary viral sequences. Nucleic Acids Research, 37 (18), 6194–6204.
19. Liu, Y.P. et al. (2008) Inhibition of HIV-1 by multiple siRNAs expressed from a
single microRNA polycistron. Nucleic Acids Research, 36 (9), 2811–2824.
20. Saayman, S. et al. (2010) Deriving four functional anti-HIV siRNAs from a single
Pol III-generated transcript comprising two adjacent long hairpin RNA precursors.
Nucleic Acids Research, 38 (19), 6652–6663.21. Saayman, S. et al. (2008) The efficacy of generating three independent anti-HIV-1
siRNAs from a single U6 RNA Pol III-expressed long hairpin RNA. PLoS One,
3 (7), e2602.
22. Weinberg, M.S. et al. (2007) Specific inhibition of HBV replication in vitro and in
vivo with expressed long hairpin RNA. Molecular Therapy: The Journal of the
American Society of Gene Therapy, 15 (3), 534–541.
23. Li, W.X. et al. (2004) Interferon antagonist proteins of influenza and vaccinia
viruses are suppressors of RNA silencing. Proceedings of the National Academy of
Sciences of the United States of America, 101 (5), 1350–1355.
24. Lu, S. and Cullen, B.R. (2004) Adenovirus VA1 noncoding RNA can inhibit small
interfering RNA and MicroRNA biogenesis. Journal of Virology, 78 (23), 12868–
12876.
25. Giladi, H. et al. (2003) Small interfering RNA inhibits hepatitis B virus replication
in mice. Molecular Therapy: The Journal of the American Society of Gene Therapy,
8 (5), 769–776.
26. McCaffrey, A.P. et al. (2003) Inhibition of hepatitis B virus in mice by RNA inter-
ference. Nature Biotechnology, 21 (6), 639–644.
27. Morrissey, D.V. et al. (2005) Activity of stabilized short interfering RNA in a mouse
model of hepatitis B virus replication. Hepatology (Baltimore, Md), 41 (6), 1349–
1356.
28. Carmona, S. et al. (2006) Effective inhibition of HBV replication in vivo by anti-
HBx short hairpin RNAs. Molecular Therapy: The Journal of the American Society
of Gene Therapy, 13 (2), 411–421.
29. Crowther, C. et al. (2008) Efficient inhibition of hepatitis B virus replication in vivo,
using polyethylene glycol-modified adenovirus vectors. Human Gene Therapy,
19 (11), 1325–1331.
30. Ely, A. et al. (2009) Efficient silencing of gene expression with modular trimeric
Pol II expression cassettes comprising microRNA shuttles. Nucleic Acids Research,
37 (13), e91.
31. Buning, H. et al. (2008) Recent developments in adeno-associated virus vector tech-
nology. The Journal of Gene Medicine, 10 (7), 717–733.
32. Ferrari, F.K. et al. (1996) Second-strand synthesis is a rate-limiting step for efficient
transduction by recombinant adeno-associated virus vectors. Journal of Virology,
70 (5), 3227–3234.
Approaches to Delivering RNAi Therapeutics that Target Hepatitis B Virus 383
CH16 01/26/2013 3:22:38 Page 384
33. McCaffrey, A.P. et al. (2008) The host response to adenovirus, helper-dependent
adenovirus, and adeno-associated virus in mouse liver. Molecular Therapy: The
Journal of the American Society of Gene Therapy, 16 (5), 931–941.
34. Hosel, M. et al. (2012) Toll-like receptor 2-mediated innate immune response in
human nonparenchymal liver cells toward adeno-associated viral vectors. Hepatol-
ogy (Baltimore, Md), 55 (1), 287–297.
35. Boutin, S. et al. (2010) Prevalence of serum IgG and neutralizing factors against
adeno-associated virus (AAV) types 1, 2, 5, 6, 8, and 9 in the healthy population:
implications for gene therapy using AAV vectors. Human Gene Therapy, 21 (6),
704–712.
36. Tenenbaum, L. et al. (2003) Evaluation of risks related to the use of adeno-associ-
ated virus-based vectors. Current Gene Therapy, 3 (6), 545–565.37. Sands, M.S. (2011) AAV-mediated liver-directed gene therapy. Methods in Molecu-
lar Biology (Clifton, NJ), 807, 141–157.
38. Nakai, H. et al. (2005) Unrestricted hepatocyte transduction with adeno-associated
virus serotype 8 vectors in mice. Journal of Virology, 79 (1), 214–224.
39. Sharland, A. et al. (2010) Liver-directed gene expression using recombinant AAV
2/8 vectors–a tolerogenic strategy for gene delivery? Discovery Medicine, 9 (49),
519–527.
40. Kienle, E. et al. (2012) Engineering and evolution of synthetic adeno-associated
virus (AAV) gene therapy vectors via DNA family shuffling. Journal of Visualized
Experiments, 62, 3819.
41. Chen, C.C. et al. (2009) Comparative study of anti-hepatitis B virus RNA interfer-
ence by double-stranded adeno-associated virus serotypes 7, 8, and 9. Molecular
Therapy: The Journal of the American Society of Gene Therapy, 17 (2), 352–359.
42. Chen, Y. et al. (2008) RNAi for treating hepatitis B viral infection. Pharmaceutical
Research, 25 (1), 72–86.
43. Chen, C.C. et al. (2011) Use of RNA interference to modulate liver adenoma devel-
opment in a murine model transgenic for hepatitis B virus. Gene Therapy, 19 (1),
25–33.
44. He, Y. et al. (2010) Knockdown of HBx by RNAi inhibits proliferation and enhan-
ces chemotherapy-induced apoptosis in hepatocellular carcinoma cells. Medical
Oncology (Northwood, London, England), 27 (4), 1227–1233.
45. Naldini, L. et al. (1996) In vivo gene delivery and stable transduction of nondividing
cells by a lentiviral vector. Science, 272 (5259), 263–267.
46. Nathwani, A.C. et al. (2011) Adenovirus-associated virus vector-mediated gene trans-
fer in hemophilia B. The New England Journal of Medicine, 365 (25), 2357–2365.
47. Shayakhmetov, D.M. et al. (2003) The interaction between the fiber knob domain
and the cellular attachment receptor determines the intracellular trafficking route of
adenoviruses. Journal of Virology, 77 (6), 3712–3723.
48. Volpers, C. and Kochanek, S. (2004) Adenoviral vectors for gene transfer and ther-
apy. The Journal of Gene Medicine, 6 (Suppl 1), S164–S171.
49. Khare, R. et al. (2011) Advances and future challenges in adenoviral vector pharma-
cology and targeting. Current Gene Therapy, 11 (4), 241–258.50. Jacobs, F. et al. (2010) The role of liver sinusoidal cells in hepatocyte-directed gene
transfer. The American Journal of Pathology, 176 (1), 14–21.
384 Advanced Delivery and Therapeutic Applications of RNAi
CH16 01/26/2013 3:22:39 Page 385
51. Waddington, S.N. et al. (2008) Adenovirus serotype 5 hexon mediates liver gene
transfer. Cell, 132 (3), 397–409.
52. Alemany, R. et al. (2000) Blood clearance rates of adenovirus type 5 in mice. The
Journal of General Virology, 81 (Pt 11), 2605–2609.53. Xu, Z. et al. (2008) Clearance of adenovirus by Kupffer cells is mediated by scav-
enger receptors, natural antibodies, and complement. Journal of Virology, 82 (23),
11705–11713.
54. Van Rooijen, N. and Sanders, A. (1994) Liposome mediated depletion of macro-
phages: mechanism of action, preparation of liposomes and applications. Journal of
Immunological Methods, 174 (1–2), 83–93.
55. Manickan, E. et al. (2006) Rapid Kupffer cell death after intravenous injection of
adenovirus vectors. Molecular Therapy: The Journal of the American Society of
Gene Therapy, 13 (1), 108–117.
56. Shashkova, E.V. et al. (2008) Macrophage depletion combined with anticoagulant
therapy increases therapeutic window of systemic treatment with oncolytic adeno-
virus. Cancer Research, 68 (14), 5896–5904.
57. Kreppel, F. and Kochanek, S. (2008) Modification of adenovirus gene transfer vec-
tors with synthetic polymers: a scientific review and technical guide. Molecular
Therapy: The Journal of the American Society of Gene Therapy, 16 (1), 16–29.
58. Hofherr, S.E. et al. (2008) Modification of adenoviral vectors with polyethylene
glycol modulates in vivo tissue tropism and gene expression. Molecular Therapy:
The Journal of the American Society of Gene Therapy, 16 (7), 1276–1282.
59. Doronin, K. et al. (2009) Chemical modification with high molecular weight
polyethylene glycol reduces transduction of hepatocytes and increases efficacy
of intravenously delivered oncolytic adenovirus. Human Gene Therapy, 20 (9),
975–988.
60. Prill, J.M. et al. (2011) Modifications of adenovirus hexon allow for either hepato-
cyte detargeting or targeting with potential evasion from Kupffer cells. Molecular
Therapy: The Journal of the American Society of Gene Therapy, 19 (1), 83–92.
61. Mok, H. et al. (2005) Evaluation of polyethylene glycol modification of first-gener-
ation and helper-dependent adenoviral vectors to reduce innate immune responses.
Molecular Therapy: The Journal of the American Society of Gene Therapy, 11 (1),
66–79.
62. Wonganan, P. et al. (2011) Species differences in the pharmacology and toxicology
of PEGylated helper-dependent adenovirus.Molecular Pharmacology, 8 (1), 78–92.
63. Wonganan, P. and Croyle, M.A. (2010) PEGylated Adenoviruses: From Mice to
Monkeys. Viruses, 2 (2), 468–502.
64. Gahery-Segard, H. et al. (1998) Immune response to recombinant capsid proteins of
adenovirus in humans: antifiber and anti-penton base antibodies have a synergistic
effect on neutralizing activity. Journal of Virology, 72 (3), 2388–2397.
65. Parks, R.J. et al. (1996) A helper-dependent adenovirus vector system: removal of
helper virus by Cre-mediated excision of the viral packaging signal. Proceedings
of the National Academy of Sciences of the United States of America, 93 (24),
13565–13570.
66. Liu, Q. and Muruve, D.A. (2003) Molecular basis of the inflammatory response to
adenovirus vectors. Gene Therapy, 10 (11), 935–940.
Approaches to Delivering RNAi Therapeutics that Target Hepatitis B Virus 385
CH16 01/26/2013 3:22:39 Page 386
67. Russell, W.C. (2000) Update on adenovirus and its vectors. The Journal of General
Virology, 81 (Pt 11), 2573–2604.
68. Hartman, Z.C. et al. (2007) Adenovirus infection triggers a rapid. MyD88-regulated
transcriptome response critical to acute-phase and adaptive immune responses in
vivo. Journal of Virology, 81 (4), 1796–1812.
69. Liu, Q. et al. (2003) The role of capsid-endothelial interactions in the innate
immune response to adenovirus vectors. Human Gene Therapy, 14 (7), 627–
643.
70. Lieber, A. et al. (1997) The role of Kupffer cell activation and viral gene expression
in early liver toxicity after infusion of recombinant adenovirus vectors. Journal of
Virology, 71 (11), 8798–8807.
71. Fejer, G. et al. (2008) Key role of splenic myeloid DCs in the IFN-alphabeta
response to adenoviruses in vivo. PLoS Pathogens, 4 (11), e1000208.
72. Uprichard, S.L. et al. (2005) Clearance of hepatitis B virus from the liver of trans-
genic mice by short hairpin RNAs. Proceedings of the National Academy of Sci-
ences of the United States of America, 102 (3), 773–778.
73. Toietta, G. et al. (2005) Lifelong elimination of hyperbilirubinemia in the Gunn rat
with a single injection of helper-dependent adenoviral vector. Proceedings of the
National Academy of Sciences of the United States of America, 102 (11), 3930–
3935.
74. Morral, N. et al. (2002) Adenovirus-mediated expression of glucokinase in the liver
as an adjuvant treatment for type 1 diabetes. Human Gene Therapy, 13 (13), 1561–
1570.
75. Rauschhuber, C. et al. (2008) Exploring gene-deleted adenoviral vectors for deliv-
ery of short hairpin RNAs and reduction of hepatitis B virus infection in mice. The
Journal of Gene Medicine, 10 (8), 878–889.
76. Ruiz, R. et al. (2009) Robust hepatic gene silencing for functional studies using
helper-dependent adenoviral vectors. Human Gene Therapy, 20 (1), 87–94.77. Witting, S.R. et al. (2008) Helper-dependent adenovirus-mediated short hairpin
RNA expression in the liver activates the interferon response. The Journal of
Biological Chemistry, 283 (4), 2120–2128.
78. Morral, N. et al. (1999) Administration of helper-dependent adenoviral vectors and
sequential delivery of different vector serotype for long-term liver-directed gene
transfer in baboons. Proceedings of the National Academy of Sciences of the United
States of America, 96 (22), 12816–12821.
79. Brunetti-Pierri, N. et al. (2007) Pseudo-hydrodynamic delivery of helper-dependent
adenoviral vectors into non-human primates for liver-directed gene therapy. Molec-
ular Therapy: The Journal of the American Society of Gene Therapy, 15 (4), 732–
740.
80. White, G.I. and Manohan, P.E. (2005) Gene therapy for hemophilia A, in Textbook
of Hemophilia (eds C. Lee, E. Berntrop and K. Hoots), Blackwell Publishing,
Oxford, UK, pp. 226–228.
81. Seregin, S.S. et al. (2009) Transient pretreatment with glucocorticoid ablates innate
toxicity of systemically delivered adenoviral vectors without reducing efficacy.
Molecular Therapy: The Journal of the American Society of Gene Therapy, 17 (4),
685–696.
386 Advanced Delivery and Therapeutic Applications of RNAi
CH16 01/26/2013 3:22:39 Page 387
82. Croyle, M.A. et al. (2000) Development of a rapid method for the PEGylation of
adenoviruses with enhanced transduction and improved stability under harsh storage
conditions. Human Gene Therapy, 11 (12), 1713–1722.
83. Croyle, M.A. et al. (2005) PEGylated helper-dependent adenoviral vectors:
highly efficient vectors with an enhanced safety profile. Gene Therapy, 12 (7),
579–587.
84. Fontanellas, A. et al. (2010) Intensive pharmacological immunosuppression allows
for repetitive liver gene transfer with recombinant adenovirus in nonhuman pri-
mates. Molecular Therapy: The Journal of the American Society of Gene Therapy,
18 (4), 754–765.
85. Carlisle, R.C. et al. (2009) Human erythrocytes bind and inactivate type 5 adeno-
virus by presenting Coxsackie virus-adenovirus receptor and complement receptor
1. Blood, 113 (9), 1909–1918.
86. Seiradake, E. et al. (2009) The cell adhesion molecule ‘CAR’ and sialic acid on
human erythrocytes influence adenovirus in vivo biodistribution. PLoS Pathogens,
5 (1), e1000277.
87. Brunetti-Pierri, N. et al. (2006) Improved hepatic transduction, reduced systemic
vector dissemination, and long-term transgene expression by delivering helper-
dependent adenoviral vectors into the surgically isolated liver of nonhuman pri-
mates. Human Gene Therapy, 17 (4), 391–404.88. Brunetti-Pierri, N. et al. (2009) Efficient, long-term hepatic gene transfer using clin-
ically relevant HDAd doses by balloon occlusion catheter delivery in nonhuman pri-
mates. Molecular Therapy: The Journal of the American Society of Gene Therapy,
17 (2), 327–333.
89. Manjunath, N. et al. (2009) Lentiviral delivery of short hairpin RNAs. Advanced
Drug Delivery Reviews, 61 (9), 732–745.
90. Gijsbers, R. et al. (2010) LEDGF hybrids efficiently retarget lentiviral integration
into heterochromatin. Molecular Therapy: The Journal of the American Society of
Gene Therapy, 18 (3), 552–560.
91. Bartholomae, C.C. et al. (2011) Lentiviral vector integration profiles differ in rodent
postmitotic tissues. Molecular Therapy: The Journal of the American Society of
Gene Therapy, 19 (4), 703–710.
92. Ivacik, D. et al. (2011) Countering hepatitis B virus infection using RNAi: how far
are we from the clinic? Reviews in Medical Virology, 21 (6), 383–396.
93. Park, F. et al. (2003) The effect of age on hepatic gene transfer with self-inactivating
lentiviral vectors in vivo. Molecular Therapy: The Journal of the American Society
of Gene Therapy, 8 (2), 314–323.
94. Park, F. et al. (2000) Therapeutic levels of human factor VIII and IX using HIV-1-
based lentiviral vectors in mouse liver. Blood, 96 (3), 1173–1176.
95. Pichard, V. et al. (2012) Priming of hepatocytes enhances in vivo liver transduction
with lentiviral vectors in adult mice. Human Gene Therapy, 23 (1), 8–17.
96. Felgner, P.L. et al. (1987) Lipofection: a highly efficient, lipid-mediated DNA-trans-
fection procedure. Proceedings of the National Academy of Sciences of the United
States of America, 84 (21), 7413–7417.97. Balazs, D.A. and Godbey, W. (2010) Liposomes for use in gene delivery. Journal of
Drug Delivery, 2011, 326497.
Approaches to Delivering RNAi Therapeutics that Target Hepatitis B Virus 387
CH16 01/26/2013 3:22:39 Page 388
98. Hattori, Y. et al. (2005) The role of dioleoylphosphatidylethanolamine (DOPE) in
targeted gene delivery with mannosylated cationic liposomes via intravenous route.
Journal of Controlled Release, 108 (2–3), 484–495.
99. Morrissey, D.V. et al. (2005) Potent and persistent in vivo anti-HBV activity of
chemically modified siRNAs. Nature Biotechnology, 23 (8), 1002–1007.
100. Geisbert, T.W. et al. (2010) Postexposure protection of non-human primates against
a lethal Ebola virus challenge with RNA interference: a proof-of-concept study.
Lancet, 375 (9729), 1896–1905.
101. Zimmermann, T.S. et al. (2006) RNAi-mediated gene silencing in non-human pri-
mates. Nature, 441 (7089), 111–114.
102. Gunther, M. et al. (2011) Polyethylenimines for RNAi-mediated gene targeting
in vivo and siRNA delivery to the lung. The European Journal of Pharmaceutics
and Biopharmaceutics, 77 (3), 438–449.
103. Midoux, P. et al. (2008) Polymer-based gene delivery: a current review on the
uptake and intracellular trafficking of polyplexes. Current Gene Therapy, 8 (5),
335–352.
104. Jeong, J.H. et al. (2009) siRNA conjugate delivery systems. Bioconjugate Chemis-
try, 20 (1), 5–14.
105. Zhu, L. and Mahato, R.I. (2010) Targeted delivery of siRNA to hepatocytes and
hepatic stellate cells by bioconjugation. Bioconjugate Chemistry, 21 (11), 2119–
2127.
106. McCarroll, J. et al. (2010) Nanotubes functionalized with lipids and natural amino
acid dendrimers: a new strategy to create nanomaterials for delivering systemic
RNAi. Bioconjugate Chemistry, 21 (1), 56–63.
107. Mahon, K.P. et al. (2010) Combinatorial approach to determine functional group
effects on lipidoid-mediated siRNA delivery. Bioconjugate Chemistry, 21 (8),
1448–1454.
108. Ifediba, M.A. et al. (2010) siRNA delivery to CNS cells using a membrane trans-
location peptide. Bioconjugate Chemistry, 21 (5), 803–806.
109. Ceballos, C. et al. (2010) Cationic nucleoside lipids derived from universal bases: A
rational approach for siRNA transfection. Bioconjugate Chemistry, 21 (6), 1062–
1069.
110. Kim, S.W. et al. (2010) RNA interference in vitro and in vivo using an arginine
peptide/siRNA complex system. Journal of Controlled Release, 143 (3), 335–343.
111. Li, L. et al. (2010) Polymer-and lipid-based nanoparticle therapeutics for the treat-
ment of liver diseases. Nano Today, 5 (4), 296–312.112. Wu, G.Y. and Wu, C.H. (1988) Receptor-mediated gene delivery and expression
in vivo. The Journal of Biological Chemistry, 263 (29), 14621–14624.
113. Kim, S.I. et al. (2007) Systemic and specific delivery of small interfering RNAs to
the liver mediated by apolipoprotein A-I. Molecular Therapy: The Journal of the
American Society of Gene Therapy, 15 (6), 1145–1152.
114. Kawakami, S. et al. (2008) Nonviral approaches for targeted delivery of plasmid
DNA and oligonucleotide. Journal of Pharmaceutical Sciences, 97 (2), 726–745.
115. Sonoke, S. et al. (2011) Galactose-modified cationic liposomes as a liver-targeting
delivery system for small interfering RNA. Biological and Pharmaceutical Bulletin,
34 (8), 1338–1342.
388 Advanced Delivery and Therapeutic Applications of RNAi
CH16 01/26/2013 3:22:39 Page 389
116. Kim, S.I. et al. (2009) Targeted delivery of siRNA against hepatitis C virus by apo-
lipoprotein A-I-bound cationic liposomes. Journal of Hepatology, 50 (3), 479–488.
117. Lee, H. et al. (2009) Hepatic siRNA delivery using recombinant human apo-
lipoprotein A-I in mice. Biochemical and Biophysical Research Communications,
378 (2), 192–196.
118. Mevel, M. et al. (2010) DODAG; a versatile new cationic lipid that mediates efficient
delivery of pDNA and siRNA. Journal of Controlled Release, 143 (2), 222–232.
119. Carmona, S. et al. (2009) Controlling HBV replication in vivo by intravenous
administration of triggered PEGylated siRNA-nanoparticles.Molecular Pharmacol-
ogy, 6 (3), 706–717.
120. Hean, J. et al. (2010) Inhibition of hepatitis B virus replication in vivo using lip-
oplexes containing altritol-modified antiviral siRNAs. Artificial DNA: PNA and
XNA, 1 (1), 17–26.
121. Islam, R.U. et al. (2009) Efficient nucleic acid transduction with lipoplexes contain-
ing novel piperazine- and polyamine-conjugated cholesterol derivatives. Bioorganic
and Medicinal Chemistry Letters, 19 (1), 100–103.
122. Abrams, M.T. et al. (2011) Evaluation of efficacy, biodistribution, and inflammation
for a potent siRNA nanoparticle: effect of dexamethasone co-treatment. Molecular
Therapy: The Journal of the American Society of Gene Therapy, 18 (1), 171–180.
123. Malek, A. et al. (2009) In vivo pharmacokinetics, tissue distribution and underlying
mechanisms of various PEI(-PEG)/siRNA complexes. Toxicology and Applied
Pharmacology, 236 (1), 97–108.
124. Tao, W. et al. (2010) Noninvasive imaging of lipid nanoparticle-mediated systemic
delivery of small-interfering RNA to the liver. Molecular Therapy: The Journal of
the American Society of Gene Therapy, 18 (9), 1657–1666.
125. Shi, B. et al. (2011) Biodistribution of small interfering RNA at the organ and cellu-
lar levels after lipid nanoparticle-mediated delivery. The Journal of Histochemistry
and Cytochemistry, 59 (8), 727–740.126. Singh, S. et al. (2011) Subcellular fate and off-target effects of siRNA, shRNA, and
miRNA. Pharmaceutical Research, 28 (12), 2996–3015.
127. Duan, Y. et al. (2009) The biological routes of gene delivery mediated by lipid-
based non-viral vectors. Expert Opinion on Drug Delivery, 6 (12), 1351–1361.
128. Ma, B. et al. (2007) Lipoplex morphologies and their influences on transfection effi-
ciency in gene delivery. Journal of Controlled Release, 123 (3), 184–194.
129. Li, S.D. and Huang, L. (2006) Gene therapy progress and prospects: non-viral gene
therapy by systemic delivery. Gene Therapy, 13 (18), 1313–1319.130. Kundu, A.K. et al. (2010) Development and optimization of nanosomal formula-
tions for siRNA delivery to the liver. The European Journal of Pharmaceutics and
Biopharmaceutics, 80 (2), 257–267.
131. Adami, R.C. et al. (2011) An amino acid-based amphoteric liposomal delivery sys-
tem for systemic administration of siRNA. Molecular Therapy: The Journal of the
American Society of Gene Therapy, 19 (6), 1141–1151.
132. Schmidt, C. (2012) RNAi momentum fizzles as pharma shifts priorities. Nature
Biotechnology, 29 (2), 93–94.
Approaches to Delivering RNAi Therapeutics that Target Hepatitis B Virus 389
CH16 01/26/2013 3:22:39 Page 390
References 173
REFERENCES
1. Arbuthnot, P. and M. Kew, Hepatitis B virus and hepatocellular carcinoma. Int J Exp
Pathol, 2001. 82(2): p. 77-100.
2. Ganem, D., Persistent infection of humans with hepatitis B virus: mechanisms and
consequences. Rev Infect Dis, 1982. 4(5): p. 1026-47.
3. Dandri, M. and S. Locarnini, New insight in the pathobiology of hepatitis B virus
infection. Gut, 2012. 61 Suppl 1: p. i6-17.
4. Ott, J.J., G.A. Stevens, and S.T. Wiersma, The risk of perinatal hepatitis B virus
transmission: hepatitis B e antigen (HBeAg) prevalence estimates for all world
regions. BMC Infect Dis, 2012. 12(1): p. 131.
5. Michailidis, E., et al., Antiviral therapies: Focus on hepatitis B reverse transcriptase.
Int J Biochem Cell Biol, 2012. 44(7): p. 1060-71.
6. Nebbia, G., D. Peppa, and M.K. Maini, Hepatitis B infection: current concepts and
future challenges. QJM, 2012. 105(2): p. 109-13.
7. Nassal, M. and H. Schaller, Hepatitis B virus replication--an update. J Viral Hepat,
1996. 3(5): p. 217-26.
8. Ayoub, W.S. and E.B. Keeffe, Review article: current antiviral therapy of chronic
hepatitis B. Aliment Pharmacol Ther, 2011. 34(10): p. 1145-58.
9. Feitelson, M., Hepatitis B virus infection and primary hepatocellular carcinoma. Clin
Microbiol Rev, 1992. 5(3): p. 275-301.
10. Seeger, C. and W.S. Mason, Hepatitis B virus biology. Microbiol Mol Biol Rev, 2000.
64(1): p. 51-68.
11. Cummings, I.W., et al., Isolation, characterization, and comparison of recombinant
DNAs derived from genomes of human hepatitis B virus and woodchuck hepatitis
virus. Proc Natl Acad Sci U S A, 1980. 77(4): p. 1842-6.
References 174
12. Nassal, M., Hepatitis B viruses: reverse transcription a different way. Virus Res,
2008. 134(1-2): p. 235-49.
13. Tuttleman, J.S., C. Pourcel, and J. Summers, Formation of the pool of covalently
closed circular viral DNA in hepadnavirus-infected cells. Cell, 1986. 47(3): p. 451-
60.
14. Nassal, M., M. Junker-Niepmann, and H. Schaller, Translational inactivation of RNA
function: discrimination against a subset of genomic transcripts during HBV
nucleocapsid assembly. Cell, 1990. 63(6): p. 1357-63.
15. Schulze, A., et al., Hepatocyte polarization is essential for the productive entry of the
hepatitis B virus. Hepatology, 2012. 55(2): p. 373-83.
16. Quasdorff, M. and U. Protzer, Control of hepatitis B virus at the level of transcription.
J Viral Hepat, 2010. 17(8): p. 527-36.
17. Beck, J. and M. Nassal, Hepatitis B virus replication. World J Gastroenterol, 2007.
13(1): p. 48-64.
18. Negro, F. and A. Alberti, The global health burden of hepatitis C virus infection.
Liver Int, 2011. 31 Suppl 2: p. 1-3.
19. Sumida, S.M., et al., Neutralizing antibodies to adenovirus serotype 5 vaccine vectors
are directed primarily against the adenovirus hexon protein. J Immunol, 2005.
174(11): p. 7179-85.
20. Lok, A.S. and B.J. McMahon, Chronic hepatitis B. Hepatology, 2007. 45(2): p. 507-
39.
21. Penna, A., et al., Cytotoxic T lymphocytes recognize an HLA-A2-restricted epitope
within the hepatitis B virus nucleocapsid antigen. J Exp Med, 1991. 174(6): p. 1565-
70.
References 175
22. Janssen, H.L., et al., Pegylated interferon alfa-2b alone or in combination with
lamivudine for HBeAg-positive chronic hepatitis B: a randomised trial. Lancet, 2005.
365(9454): p. 123-9.
23. Buster, E.H., et al., Early HBeAg loss during peginterferon alpha-2b therapy predicts
HBsAg loss: results of a long-term follow-up study in chronic hepatitis B patients. Am
J Gastroenterol, 2009. 104(10): p. 2449-57.
24. Ferir, G., et al., Antiviral treatment of chronic hepatitis B virus infections: the past,
the present and the future. Rev Med Virol, 2008. 18(1): p. 19-34.
25. Keeffe, E.B., et al., Chronic hepatitis B: preventing, detecting, and managing viral
resistance. Clin Gastroenterol Hepatol, 2008. 6(3): p. 268-74.
26. Delaney, W.E.t., et al., Intracellular metabolism and in vitro activity of tenofovir
against hepatitis B virus. Antimicrob Agents Chemother, 2006. 50(7): p. 2471-7.
27. Fire, A., et al., Potent and specific genetic interference by double-stranded RNA in
Caenorhabditis elegans. Nature, 1998. 391(6669): p. 806-11.
28. Dunoyer, P., et al., An endogenous, systemic RNAi pathway in plants. EMBO J, 2010.
29(10): p. 1699-712.
29. Obbard, D.J., et al., The evolution of RNAi as a defence against viruses and
transposable elements. Philos Trans R Soc Lond B Biol Sci, 2009. 364(1513): p. 99-
115.
30. Forstemann, K., et al., Drosophila microRNAs are sorted into functionally distinct
argonaute complexes after production by dicer-1. Cell, 2007. 130(2): p. 287-97.
31. Janowski, B.A., et al., Involvement of AGO1 and AGO2 in mammalian transcriptional
silencing. Nat Struct Mol Biol, 2006. 13(9): p. 787-92.
References 176
32. Zeng, Y. and B.R. Cullen, Efficient processing of primary microRNA hairpins by
Drosha requires flanking nonstructured RNA sequences. J Biol Chem, 2005. 280(30):
p. 27595-603.
33. Su, J., et al., Isolation and characterization of Argonaute 2: a key gene of the RNA
interference pathway in the rare minnow, Gobiocypris rarus. Fish Shellfish Immunol,
2009. 26(1): p. 164-70.
34. Dominska, M. and D.M. Dykxhoorn, Breaking down the barriers: siRNA delivery and
endosome escape. J Cell Sci, 2010. 123(Pt 8): p. 1183-9.
35. Salomon, W., et al., Modified dsRNAs that are not processed by Dicer maintain
potency and are incorporated into the RISC. Nucleic Acids Res, 2010. 38(11): p.
3771-9.
36. Corey, D.R., Chemical modification: the key to clinical application of RNA
interference? J Clin Invest, 2007. 117(12): p. 3615-22.
37. Grimm, D. and M.A. Kay, Therapeutic short hairpin RNA expression in the liver:
viral targets and vectors. Gene Ther, 2006. 13(6): p. 563-75.
38. McAnuff, M.A., G.R. Rettig, and K.G. Rice, Potency of siRNA versus shRNA
mediated knockdown in vivo. J Pharm Sci, 2007. 96(11): p. 2922-30.
39. Brunetti-Pierri, N., et al., Acute toxicity after high-dose systemic injection of helper-
dependent adenoviral vectors into nonhuman primates. Hum Gene Ther, 2004. 15(1):
p. 35-46.
40. Ely, A., et al., Expressed anti-HBV primary microRNA shuttles inhibit viral
replication efficiently in vitro and in vivo. Mol Ther, 2008. 16(6): p. 1105-12.
41. Arbuthnot, P., A. Ely, and M.S. Weinberg, Hepatic delivery of RNA interference
activators for therapeutic application. Curr Gene Ther, 2009. 9(2): p. 91-103.
References 177
42. Pan, J.S., X.Z. Wang, and J.L. Ren, Long-term RNA interference and its application
to hepatitis B virus. J Dig Dis, 2009. 10(3): p. 165-71.
43. Boudreau, R.L., I. Martins, and B.L. Davidson, Artificial microRNAs as siRNA
shuttles: improved safety as compared to shRNAs in vitro and in vivo. Mol Ther,
2009. 17(1): p. 169-75.
44. McBride, J.L., et al., Artificial miRNAs mitigate shRNA-mediated toxicity in the
brain: implications for the therapeutic development of RNAi. Proc Natl Acad Sci U S
A, 2008. 105(15): p. 5868-73.
45. McCaffrey, A.P., RNA interference inhibitors of hepatitis B virus. Ann N Y Acad Sci,
2009. 1175: p. 15-23.
46. Aagaard, L.A., et al., Engineering and optimization of the miR-106b cluster for
ectopic expression of multiplexed anti-HIV RNAs. Gene Ther, 2008. 15(23): p. 1536-
49.
47. Liu, Y.P., et al., RNAi-mediated inhibition of HIV-1 by targeting partially
complementary viral sequences. Nucleic Acids Res, 2009. 37(18): p. 6194-204.
48. Liu, Y.P., et al., Inhibition of HIV-1 by multiple siRNAs expressed from a single
microRNA polycistron. Nucleic Acids Res, 2008. 36(9): p. 2811-24.
49. Saayman, S., P. Arbuthnot, and M.S. Weinberg, Deriving four functional anti-HIV
siRNAs from a single Pol III-generated transcript comprising two adjacent long
hairpin RNA precursors. Nucleic Acids Res, 2010. 38(19): p. 6652-63.
50. Saayman, S., et al., The efficacy of generating three independent anti-HIV-1 siRNAs
from a single U6 RNA Pol III-expressed long hairpin RNA. PLoS One, 2008. 3(7): p.
e2602.
51. Weinberg, M.S., et al., Specific inhibition of HBV replication in vitro and in vivo with
expressed long hairpin RNA. Mol Ther, 2007. 15(3): p. 534-41.
References 178
52. Li, W.X., et al., Interferon antagonist proteins of influenza and vaccinia viruses are
suppressors of RNA silencing. Proc Natl Acad Sci U S A, 2004. 101(5): p. 1350-5.
53. Giladi, H., et al., Small interfering RNA inhibits hepatitis B virus replication in mice.
Mol Ther, 2003. 8(5): p. 769-76.
54. McCaffrey, A.P., et al., Inhibition of hepatitis B virus in mice by RNA interference.
Nat Biotechnol, 2003. 21(6): p. 639-44.
55. Morrissey, D.V., et al., Activity of stabilized short interfering RNA in a mouse model
of hepatitis B virus replication. Hepatology, 2005. 41(6): p. 1349-56.
56. Carmona, S., et al., Effective inhibition of HBV replication in vivo by anti-HBx short
hairpin RNAs. Mol Ther, 2006. 13(2): p. 411-21.
57. Ely, A., T. Naidoo, and P. Arbuthnot, Efficient silencing of gene expression with
modular trimeric Pol II expression cassettes comprising microRNA shuttles. Nucleic
Acids Res, 2009. 37(13): p. e91.
58. Snoeys, J., et al., Species differences in transgene DNA uptake in hepatocytes after
adenoviral transfer correlate with the size of endothelial fenestrae. Gene Ther, 2007.
14(7): p. 604-12.
59. Wisse, E., et al., The size of endothelial fenestrae in human liver sinusoids:
implications for hepatocyte-directed gene transfer. Gene Ther, 2008. 15(17): p. 1193-
9.
60. Midoux, P., et al., Polymer-based gene delivery: a current review on the uptake and
intracellular trafficking of polyplexes. Curr Gene Ther, 2008. 8(5): p. 335-52.
61. Barteau, B., et al., Physicochemical parameters of non-viral vectors that govern
transfection efficiency. Curr Gene Ther, 2008. 8(5): p. 313-23.
References 179
62. McCarroll, J., et al., Nanotubes functionalized with lipids and natural amino acid
dendrimers: a new strategy to create nanomaterials for delivering systemic RNAi.
Bioconjug Chem, 2010. 21(1): p. 56-63.
63. Mahon, K.P., et al., Combinatorial approach to determine functional group effects on
lipidoid-mediated siRNA delivery. Bioconjug Chem, 2010. 21(8): p. 1448-54.
64. Ifediba, M.A., et al., siRNA delivery to CNS cells using a membrane translocation
peptide. Bioconjug Chem, 2010. 21(5): p. 803-6.
65. Ceballos, C., et al., Cationic nucleoside lipids derived from universal bases: A
rational approach for siRNA transfection. Bioconjug Chem, 2010. 21(6): p. 1062-9.
66. Kim, S.W., et al., RNA interference in vitro and in vivo using an arginine
peptide/siRNA complex system. J Control Release, 2010. 143(3): p. 335-43.
67. Balazs, D.A. and W. Godbey, Liposomes for use in gene delivery. J Drug Deliv, 2011.
2011: p. 326497.
68. Hattori, Y., et al., The role of dioleoylphosphatidylethanolamine (DOPE) in targeted
gene delivery with mannosylated cationic liposomes via intravenous route. J Control
Release, 2005. 108(2-3): p. 484-95.
69. Morrissey, D.V., et al., Potent and persistent in vivo anti-HBV activity of chemically
modified siRNAs. Nat Biotechnol, 2005. 23(8): p. 1002-7.
70. Geisbert, T.W., et al., Postexposure protection of non-human primates against a
lethal Ebola virus challenge with RNA interference: a proof-of-concept study. Lancet,
2010. 375(9729): p. 1896-905.
71. Gunther, M., et al., Polyethylenimines for RNAi-mediated gene targeting in vivo and
siRNA delivery to the lung. Eur J Pharm Biopharm, 2011. 77(3): p. 438-49.
72. Jeong, J.H., et al., siRNA conjugate delivery systems. Bioconjug Chem, 2009. 20(1):
p. 5-14.
References 180
73. Zhu, L. and R.I. Mahato, Targeted delivery of siRNA to hepatocytes and hepatic
stellate cells by bioconjugation. Bioconjug Chem, 2010. 21(11): p. 2119-27.
74. Wu, G.Y. and C.H. Wu, Receptor-mediated gene delivery and expression in vivo. J
Biol Chem, 1988. 263(29): p. 14621-4.
75. Kim, S.I., et al., Systemic and specific delivery of small interfering RNAs to the liver
mediated by apolipoprotein A-I. Mol Ther, 2007. 15(6): p. 1145-52.
76. Kawakami, S., Y. Higuchi, and M. Hashida, Nonviral approaches for targeted
delivery of plasmid DNA and oligonucleotide. J Pharm Sci, 2008. 97(2): p. 726-45.
77. Sonoke, S., et al., Galactose-modified cationic liposomes as a liver-targeting delivery
system for small interfering RNA. Biol Pharm Bull, 2011. 34(8): p. 1338-42.
78. Kim, S.I., et al., Targeted delivery of siRNA against hepatitis C virus by
apolipoprotein A-I-bound cationic liposomes. J Hepatol, 2009. 50(3): p. 479-88.
79. Mevel, M., et al., DODAG; a versatile new cationic lipid that mediates efficient
delivery of pDNA and siRNA. J Control Release, 2010. 143(2): p. 222-32.
80. Carmona, S., et al., Controlling HBV replication in vivo by intravenous
administration of triggered PEGylated siRNA-nanoparticles. Mol Pharm, 2009. 6(3):
p. 706-17.
81. Hean, J., et al., Inhibition of hepatitis B virus replication in vivo using lipoplexes
containing altritol-modified antiviral siRNAs. Artif DNA PNA XNA, 2010. 1(1): p.
17-26.
82. Islam, R.U., et al., Efficient nucleic acid transduction with lipoplexes containing novel
piperazine- and polyamine-conjugated cholesterol derivatives. Bioorg Med Chem
Lett, 2009. 19(1): p. 100-3.
83. Zhang, S., Y. Zhao, and D. Zhi, Non-viral vectors for the mediation of RNAi. Bioorg
Chem, 2012. 40(1): p. 10-8.
References 181
84. Abrams, M.T., et al., Evaluation of efficacy, biodistribution, and inflammation for a
potent siRNA nanoparticle: effect of dexamethasone co-treatment. Mol Ther, 2011.
18(1): p. 171-80.
85. Abrams, M.T., et al., Evaluation of efficacy, biodistribution, and inflammation for a
potent siRNA nanoparticle: effect of dexamethasone co-treatment. Mol Ther, 2010.
18(1): p. 171-80.
86. Malek, A., et al., In vivo pharmacokinetics, tissue distribution and underlying
mechanisms of various PEI(-PEG)/siRNA complexes. Toxicol Appl Pharmacol, 2009.
236(1): p. 97-108.
87. Tao, W., et al., Noninvasive imaging of lipid nanoparticle-mediated systemic delivery
of small-interfering RNA to the liver. Mol Ther, 2010. 18(9): p. 1657-66.
88. Shi, B., et al., Biodistribution of small interfering RNA at the organ and cellular
levels after lipid nanoparticle-mediated delivery. J Histochem Cytochem, 2011. 59(8):
p. 727-40.
89. Singh, S., A.S. Narang, and R.I. Mahato, Subcellular fate and off-target effects of
siRNA, shRNA, and miRNA. Pharm Res, 2011. 28(12): p. 2996-3015.
90. Buning, H., et al., Recent developments in adeno-associated virus vector technology. J
Gene Med, 2008. 10(7): p. 717-33.
91. Ferrari, F.K., et al., Second-strand synthesis is a rate-limiting step for efficient
transduction by recombinant adeno-associated virus vectors. J Virol, 1996. 70(5): p.
3227-34.
92. McCaffrey, A.P., et al., The host response to adenovirus, helper-dependent
adenovirus, and adeno-associated virus in mouse liver. Mol Ther, 2008. 16(5): p.
931-41.
References 182
93. Hosel, M., et al., Toll-like receptor 2-mediated innate immune response in human
nonparenchymal liver cells toward adeno-associated viral vectors. Hepatology, 2012.
55(1): p. 287-97.
94. Boutin, S., et al., Prevalence of serum IgG and neutralizing factors against adeno-
associated virus (AAV) types 1, 2, 5, 6, 8, and 9 in the healthy population:
implications for gene therapy using AAV vectors. Hum Gene Ther, 2010. 21(6): p.
704-12.
95. Tenenbaum, L., E. Lehtonen, and P.E. Monahan, Evaluation of risks related to the use
of adeno-associated virus-based vectors. Curr Gene Ther, 2003. 3(6): p. 545-65.
96. Sands, M.S., AAV-mediated liver-directed gene therapy. Methods Mol Biol, 2011.
807: p. 141-57.
97. Nakai, H., et al., Unrestricted hepatocyte transduction with adeno-associated virus
serotype 8 vectors in mice. J Virol, 2005. 79(1): p. 214-24.
98. Sharland, A., et al., Liver-directed gene expression using recombinant AAV 2/8
vectors--a tolerogenic strategy for gene delivery? Discov Med, 2010. 9(49): p. 519-
27.
99. Kienle, E., et al., Engineering and evolution of synthetic adeno-associated virus
(AAV) gene therapy vectors via DNA family shuffling. J Vis Exp, 2012(62).
100. Chen, C.C., et al., Comparative study of anti-hepatitis B virus RNA interference by
double-stranded adeno-associated virus serotypes 7, 8, and 9. Mol Ther, 2009. 17(2):
p. 352-9.
101. Chen, Y., G. Cheng, and R.I. Mahato, RNAi for treating hepatitis B viral infection.
Pharm Res, 2008. 25(1): p. 72-86.
102. Chen, C.C., et al., Use of RNA interference to modulate liver adenoma development in
a murine model transgenic for hepatitis B virus. Gene Ther, 2011. 19(1): p. 25-33.
References 183
103. He, Y., et al., Knockdown of HBx by RNAi inhibits proliferation and enhances
chemotherapy-induced apoptosis in hepatocellular carcinoma cells. Med Oncol,
2010. 27(4): p. 1227-33.
104. Naldini, L., et al., In vivo gene delivery and stable transduction of nondividing cells
by a lentiviral vector. Science, 1996. 272(5259): p. 263-7.
105. Nathwani, A.C., et al., Adenovirus-associated virus vector-mediated gene transfer in
hemophilia B. N Engl J Med, 2011. 365(25): p. 2357-65.
106. Manjunath, N., et al., Lentiviral delivery of short hairpin RNAs. Adv Drug Deliv Rev,
2009. 61(9): p. 732-45.
107. Gijsbers, R., et al., LEDGF hybrids efficiently retarget lentiviral integration into
heterochromatin. Mol Ther, 2010. 18(3): p. 552-60.
108. Bartholomae, C.C., et al., Lentiviral vector integration profiles differ in rodent
postmitotic tissues. Mol Ther, 2011. 19(4): p. 703-10.
109. Ivacik, D., A. Ely, and P. Arbuthnot, Countering hepatitis B virus infection using
RNAi: how far are we from the clinic? Rev Med Virol, 2011. 21(6): p. 383-96.
110. Park, F., et al., Efficient lentiviral transduction of liver requires cell cycling in vivo.
Nat Genet, 2000. 24(1): p. 49-52.
111. Park, F., K. Ohashi, and M.A. Kay, The effect of age on hepatic gene transfer with
self-inactivating lentiviral vectors in vivo. Mol Ther, 2003. 8(2): p. 314-23.
112. Park, F., K. Ohashi, and M.A. Kay, Therapeutic levels of human factor VIII and IX
using HIV-1-based lentiviral vectors in mouse liver. Blood, 2000. 96(3): p. 1173-6.
113. Pichard, V., et al., Priming of Hepatocytes Enhances In Vivo Liver Transduction with
Lentiviral Vectors in Adult Mice. Hum Gene Ther, 2011.
References 184
114. Rowe, W.P., et al., Isolation of a cytopathogenic agent from human adenoids
undergoing spontaneous degeneration in tissue culture. Proc Soc Exp Biol Med,
1953. 84(3): p. 570-3.
115. Russell, W.C., Update on adenovirus and its vectors. J Gen Virol, 2000. 81(Pt 11): p.
2573-604.
116. Volpers, C. and S. Kochanek, Adenoviral vectors for gene transfer and therapy. J
Gene Med, 2004. 6 Suppl 1: p. S164-71.
117. Campos, S.K. and M.A. Barry, Current advances and future challenges in Adenoviral
vector biology and targeting. Curr Gene Ther, 2007. 7(3): p. 189-204.
118. Graham, F.L., et al., Characteristics of a human cell line transformed by DNA from
human adenovirus type 5. J Gen Virol, 1977. 36(1): p. 59-74.
119. Ilan, Y., et al., Insertion of the adenoviral E3 region into a recombinant viral vector
prevents antiviral humoral and cellular immune responses and permits long-term
gene expression. Proc Natl Acad Sci U S A, 1997. 94(6): p. 2587-92.
120. Hehir, K.M., et al., Molecular characterization of replication-competent variants of
adenovirus vectors and genome modifications to prevent their occurrence. J Virol,
1996. 70(12): p. 8459-67.
121. Yang, Y., et al., Inactivation of E2a in recombinant adenoviruses improves the
prospect for gene therapy in cystic fibrosis. Nat Genet, 1994. 7(3): p. 362-9.
122. Engelhardt, J.F., et al., Ablation of E2A in recombinant adenoviruses improves
transgene persistence and decreases inflammatory response in mouse liver. Proc Natl
Acad Sci U S A, 1994. 91(13): p. 6196-200.
123. Hardy, S., et al., Construction of adenovirus vectors through Cre-lox recombination. J
Virol, 1997. 71(3): p. 1842-9.
References 185
124. Lieber, A., et al., Integrating adenovirus-adeno-associated virus hybrid vectors
devoid of all viral genes. J Virol, 1999. 73(11): p. 9314-24.
125. Steinwaerder, D.S., C.A. Carlson, and A. Lieber, Generation of adenovirus vectors
devoid of all viral genes by recombination between inverted repeats. J Virol, 1999.
73(11): p. 9303-13.
126. Parks, R.J., et al., A helper-dependent adenovirus vector system: removal of helper
virus by Cre-mediated excision of the viral packaging signal. Proc Natl Acad Sci U S
A, 1996. 93(24): p. 13565-70.
127. Chen, L., M. Anton, and F.L. Graham, Production and characterization of human 293
cell lines expressing the site-specific recombinase Cre. Somat Cell Mol Genet, 1996.
22(6): p. 477-88.
128. Ng, P., et al., A high-efficiency Cre/loxP-based system for construction of adenoviral
vectors. Hum Gene Ther, 1999. 10(16): p. 2667-72.
129. Tashiro, F., H. Niwa, and J. Miyazaki, Constructing adenoviral vectors by using the
circular form of the adenoviral genome cloned in a cosmid and the Cre-loxP
recombination system. Hum Gene Ther, 1999. 10(11): p. 1845-52.
130. Parks, R.J. and F.L. Graham, A helper-dependent system for adenovirus vector
production helps define a lower limit for efficient DNA packaging. J Virol, 1997.
71(4): p. 3293-8.
131. Palmer, D. and P. Ng, Improved system for helper-dependent adenoviral vector
production. Mol Ther, 2003. 8(5): p. 846-52.
132. Huard, J., et al., The route of administration is a major determinant of the
transduction efficiency of rat tissues by adenoviral recombinants. Gene Ther, 1995.
2(2): p. 107-15.
References 186
133. Raper, S.E., et al., A pilot study of in vivo liver-directed gene transfer with an
adenoviral vector in partial ornithine transcarbamylase deficiency. Hum Gene Ther,
2002. 13(1): p. 163-75.
134. Khare, R., et al., Advances and future challenges in adenoviral vector pharmacology
and targeting. Curr Gene Ther, 2011. 11(4): p. 241-58.
135. Jacobs, F., E. Wisse, and B. De Geest, The role of liver sinusoidal cells in hepatocyte-
directed gene transfer. Am J Pathol, 2010. 176(1): p. 14-21.
136. Bergelson, J.M., et al., Isolation of a common receptor for Coxsackie B viruses and
adenoviruses 2 and 5. Science, 1997. 275(5304): p. 1320-3.
137. Tomko, R.P., R. Xu, and L. Philipson, HCAR and MCAR: the human and mouse
cellular receptors for subgroup C adenoviruses and group B coxsackieviruses. Proc
Natl Acad Sci U S A, 1997. 94(7): p. 3352-6.
138. Grubb, B.R., et al., Inefficient gene transfer by adenovirus vector to cystic fibrosis
airway epithelia of mice and humans. Nature, 1994. 371(6500): p. 802-6.
139. Alemany, R. and D.T. Curiel, CAR-binding ablation does not change biodistribution
and toxicity of adenoviral vectors. Gene Ther, 2001. 8(17): p. 1347-53.
140. Kalyuzhniy, O., et al., Adenovirus serotype 5 hexon is critical for virus infection of
hepatocytes in vivo. Proc Natl Acad Sci U S A, 2008. 105(14): p. 5483-8.
141. Waddington, S.N., et al., Adenovirus serotype 5 hexon mediates liver gene transfer.
Cell, 2008. 132(3): p. 397-409.
142. Parker, A.L., et al., Multiple vitamin K-dependent coagulation zymogens promote
adenovirus-mediated gene delivery to hepatocytes. Blood, 2006. 108(8): p. 2554-61.
143. Jacobs, F., et al., Species differences in hepatocyte-directed gene transfer:
implications for clinical translation. Curr Gene Ther, 2009. 9(2): p. 83-90.
References 187
144. Zhang, Y., et al., Acute cytokine response to systemic adenoviral vectors in mice is
mediated by dendritic cells and macrophages. Mol Ther, 2001. 3(5 Pt 1): p. 697-707.
145. Alemany, R., K. Suzuki, and D.T. Curiel, Blood clearance rates of adenovirus type 5
in mice. J Gen Virol, 2000. 81(Pt 11): p. 2605-9.
146. Xu, Z., et al., Clearance of adenovirus by Kupffer cells is mediated by scavenger
receptors, natural antibodies, and complement. J Virol, 2008. 82(23): p. 11705-13.
147. Lieber, A., et al., The role of Kupffer cell activation and viral gene expression in early
liver toxicity after infusion of recombinant adenovirus vectors. J Virol, 1997. 71(11):
p. 8798-807.
148. Muruve, D.A., et al., Adenoviral gene therapy leads to rapid induction of multiple
chemokines and acute neutrophil-dependent hepatic injury in vivo. Hum Gene Ther,
1999. 10(6): p. 965-76.
149. Schnell, M.A., et al., Activation of innate immunity in nonhuman primates following
intraportal administration of adenoviral vectors. Mol Ther, 2001. 3(5 Pt 1): p. 708-
22.
150. Raper, S.E., et al., Fatal systemic inflammatory response syndrome in a ornithine
transcarbamylase deficient patient following adenoviral gene transfer. Mol Genet
Metab, 2003. 80(1-2): p. 148-58.
151. Liu, Q. and D.A. Muruve, Molecular basis of the inflammatory response to
adenovirus vectors. Gene Ther, 2003. 10(11): p. 935-40.
152. Bruder, J.T. and I. Kovesdi, Adenovirus infection stimulates the Raf/MAPK signaling
pathway and induces interleukin-8 expression. J Virol, 1997. 71(1): p. 398-404.
153. Hartman, Z.C., et al., Adenovirus infection triggers a rapid, MyD88-regulated
transcriptome response critical to acute-phase and adaptive immune responses in
vivo. J Virol, 2007. 81(4): p. 1796-812.
References 188
154. Zhu, J., X. Huang, and Y. Yang, Innate immune response to adenoviral vectors is
mediated by both Toll-like receptor-dependent and -independent pathways. J Virol,
2007. 81(7): p. 3170-80.
155. Liu, Q., et al., The role of capsid-endothelial interactions in the innate immune
response to adenovirus vectors. Hum Gene Ther, 2003. 14(7): p. 627-43.
156. Fejer, G., et al., Key role of splenic myeloid DCs in the IFN-alphabeta response to
adenoviruses in vivo. PLoS Pathog, 2008. 4(11): p. e1000208.
157. Yang, Y., et al., Immune responses to viral antigens versus transgene product in the
elimination of recombinant adenovirus-infected hepatocytes in vivo. Gene Ther, 1996.
3(2): p. 137-44.
158. Yang, Y. and J.M. Wilson, Clearance of adenovirus-infected hepatocytes by MHC
class I-restricted CD4+ CTLs in vivo. J Immunol, 1995. 155(5): p. 2564-70.
159. Toogood, C.I., J. Crompton, and R.T. Hay, Antipeptide antisera define neutralizing
epitopes on the adenovirus hexon. J Gen Virol, 1992. 73 ( Pt 6): p. 1429-35.
160. Yang, Y., H.C. Ertl, and J.M. Wilson, MHC class I-restricted cytotoxic T lymphocytes
to viral antigens destroy hepatocytes in mice infected with E1-deleted recombinant
adenoviruses. Immunity, 1994. 1(5): p. 433-42.
161. Chirmule, N., et al., Immune responses to adenovirus and adeno-associated virus in
humans. Gene Ther, 1999. 6(9): p. 1574-83.
162. Vogels, R., et al., Replication-deficient human adenovirus type 35 vectors for gene
transfer and vaccination: efficient human cell infection and bypass of preexisting
adenovirus immunity. J Virol, 2003. 77(15): p. 8263-71.
163. Zaiss, A.K., H.B. Machado, and H.R. Herschman, The influence of innate and pre-
existing immunity on adenovirus therapy. J Cell Biochem, 2009. 108(4): p. 778-90.
References 189
164. Poller, W., et al., Stabilization of transgene expression by incorporation of E3 region
genes into an adenoviral factor IX vector and by transient anti-CD4 treatment of the
host. Gene Ther, 1996. 3(6): p. 521-30.
165. Fisher, K.J., et al., Recombinant adenovirus deleted of all viral genes for gene therapy
of cystic fibrosis. Virology, 1996. 217(1): p. 11-22.
166. Kochanek, S., et al., A new adenoviral vector: Replacement of all viral coding
sequences with 28 kb of DNA independently expressing both full-length dystrophin
and beta-galactosidase. Proc Natl Acad Sci U S A, 1996. 93(12): p. 5731-6.
167. Morsy, M.A., et al., An adenoviral vector deleted for all viral coding sequences
results in enhanced safety and extended expression of a leptin transgene. Proc Natl
Acad Sci U S A, 1998. 95(14): p. 7866-71.
168. Kim, I.H., et al., Lifetime correction of genetic deficiency in mice with a single
injection of helper-dependent adenoviral vector. Proc Natl Acad Sci U S A, 2001.
98(23): p. 13282-7.
169. Oka, K., et al., Long-term stable correction of low-density lipoprotein receptor-
deficient mice with a helper-dependent adenoviral vector expressing the very low-
density lipoprotein receptor. Circulation, 2001. 103(9): p. 1274-81.
170. Van Rooijen, N. and A. Sanders, Liposome mediated depletion of macrophages:
mechanism of action, preparation of liposomes and applications. J Immunol Methods,
1994. 174(1-2): p. 83-93.
171. Snoeys, J., et al., Lipid emulsions potently increase transgene expression in
hepatocytes after adenoviral transfer. Mol Ther, 2006. 13(1): p. 98-107.
172. Manickan, E., et al., Rapid Kupffer cell death after intravenous injection of
adenovirus vectors. Mol Ther, 2006. 13(1): p. 108-17.
References 190
173. Khare, R., et al., Identification of adenovirus serotype 5 hexon regions that interact
with scavenger receptors. J Virol, 2012. 86(4): p. 2293-301.
174. Tao, N., et al., Sequestration of adenoviral vector by Kupffer cells leads to a
nonlinear dose response of transduction in liver. Mol Ther, 2001. 3(1): p. 28-35.
175. Haisma, H.J., et al., Polyinosinic acid enhances delivery of adenovirus vectors in vivo
by preventing sequestration in liver macrophages. J Gen Virol, 2008. 89(Pt 5): p.
1097-105.
176. Seregin, S.S., et al., Transient pretreatment with glucocorticoid ablates innate toxicity
of systemically delivered adenoviral vectors without reducing efficacy. Mol Ther,
2009. 17(4): p. 685-96.
177. Kreppel, F. and S. Kochanek, Modification of adenovirus gene transfer vectors with
synthetic polymers: a scientific review and technical guide. Mol Ther, 2008. 16(1): p.
16-29.
178. Croyle, M.A., Q.C. Yu, and J.M. Wilson, Development of a rapid method for the
PEGylation of adenoviruses with enhanced transduction and improved stability under
harsh storage conditions. Hum Gene Ther, 2000. 11(12): p. 1713-22.
179. Croyle, M.A., et al., PEGylated helper-dependent adenoviral vectors: highly efficient
vectors with an enhanced safety profile. Gene Ther, 2005. 12(7): p. 579-87.
180. Mok, H., et al., Evaluation of polyethylene glycol modification of first-generation and
helper-dependent adenoviral vectors to reduce innate immune responses. Mol Ther,
2005. 11(1): p. 66-79.
181. Fontanellas, A., et al., Intensive pharmacological immunosuppression allows for
repetitive liver gene transfer with recombinant adenovirus in nonhuman primates.
Mol Ther, 2010. 18(4): p. 754-65.
References 191
182. Carlisle, R.C., et al., Human erythrocytes bind and inactivate type 5 adenovirus by
presenting Coxsackie virus-adenovirus receptor and complement receptor 1. Blood,
2009. 113(9): p. 1909-18.
183. Seiradake, E., et al., The cell adhesion molecule "CAR" and sialic acid on human
erythrocytes influence adenovirus in vivo biodistribution. PLoS Pathog, 2009. 5(1): p.
e1000277.
184. Brunetti-Pierri, N., et al., Improved hepatic transduction, reduced systemic vector
dissemination, and long-term transgene expression by delivering helper-dependent
adenoviral vectors into the surgically isolated liver of nonhuman primates. Hum Gene
Ther, 2006. 17(4): p. 391-404.
185. Brunetti-Pierri, N., et al., Efficient, long-term hepatic gene transfer using clinically
relevant HDAd doses by balloon occlusion catheter delivery in nonhuman primates.
Mol Ther, 2009. 17(2): p. 327-33.
186. Parks, R., C. Evelegh, and F. Graham, Use of helper-dependent adenoviral vectors of
alternative serotypes permits repeat vector administration. Gene Ther, 1999. 6(9): p.
1565-73.
187. Mastrangeli, A., et al., "Sero-switch" adenovirus-mediated in vivo gene transfer:
circumvention of anti-adenovirus humoral immune defenses against repeat
adenovirus vector administration by changing the adenovirus serotype. Hum Gene
Ther, 1996. 7(1): p. 79-87.
188. O'Riordan, C.R., et al., PEGylation of adenovirus with retention of infectivity and
protection from neutralizing antibody in vitro and in vivo. Hum Gene Ther, 1999.
10(8): p. 1349-58.
References 192
189. Danielsson, A., et al., An ex vivo loop system models the toxicity and efficacy of
PEGylated and unmodified adenovirus serotype 5 in whole human blood. Gene Ther,
2010. 17(6): p. 752-62.
190. Prill, J.M., et al., Modifications of adenovirus hexon allow for either hepatocyte
detargeting or targeting with potential evasion from Kupffer cells. Mol Ther, 2011.
19(1): p. 83-92.
191. Roberts, D.M., et al., Hexon-chimaeric adenovirus serotype 5 vectors circumvent pre-
existing anti-vector immunity. Nature, 2006. 441(7090): p. 239-43.
192. Abuchowski, A., et al., Effect of covalent attachment of polyethylene glycol on
immunogenicity and circulating life of bovine liver catalase. J Biol Chem, 1977.
252(11): p. 3582-6.
193. Veronese, F.M. and A. Mero, The impact of PEGylation on biological therapies.
BioDrugs, 2008. 22(5): p. 315-29.
194. Jain, A. and S.K. Jain, PEGylation: an approach for drug delivery. A review. Crit Rev
Ther Drug Carrier Syst, 2008. 25(5): p. 403-47.
195. Hofherr, S.E., et al., Modification of adenoviral vectors with polyethylene glycol
modulates in vivo tissue tropism and gene expression. Mol Ther, 2008. 16(7): p.
1276-82.
196. Doronin, K., et al., Chemical modification with high molecular weight polyethylene
glycol reduces transduction of hepatocytes and increases efficacy of intravenously
delivered oncolytic adenovirus. Hum Gene Ther, 2009. 20(9): p. 975-88.
197. Le, H.T., et al., Utility of PEGylated recombinant adeno-associated viruses for gene
transfer. J Control Release, 2005. 108(1): p. 161-77.
References 193
198. Weaver, E.A. and M.A. Barry, Effects of shielding adenoviral vectors with
polyethylene glycol on vector-specific and vaccine-mediated immune responses. Hum
Gene Ther, 2008. 19(12): p. 1369-82.
199. Croyle, M.A., et al., PEGylation of a vesicular stomatitis virus G pseudotyped
lentivirus vector prevents inactivation in serum. J Virol, 2004. 78(2): p. 912-21.
200. Lee, G.K., et al., PEG conjugation moderately protects adeno-associated viral vectors
against antibody neutralization. Biotechnol Bioeng, 2005. 92(1): p. 24-34.
201. Hofherr, S.E., et al., Polyethylene glycol modification of adenovirus reduces platelet
activation, endothelial cell activation, and thrombocytopenia. Hum Gene Ther, 2007.
18(9): p. 837-48.
202. Wonganan, P., et al., Species differences in the pharmacology and toxicology of
PEGylated helper-dependent adenovirus. Mol Pharm, 2011. 8(1): p. 78-92.
203. Wonganan, P. and M.A. Croyle, PEGylated Adenoviruses: From Mice to Monkeys.
Viruses, 2010. 2(2): p. 468-502.
204. Uprichard, S.L., et al., Clearance of hepatitis B virus from the liver of transgenic mice
by short hairpin RNAs. Proc Natl Acad Sci U S A, 2005. 102(3): p. 773-8.
205. Toietta, G., et al., Lifelong elimination of hyperbilirubinemia in the Gunn rat with a
single injection of helper-dependent adenoviral vector. Proc Natl Acad Sci U S A,
2005. 102(11): p. 3930-5.
206. Morral, N., et al., Adenovirus-mediated expression of glucokinase in the liver as an
adjuvant treatment for type 1 diabetes. Hum Gene Ther, 2002. 13(13): p. 1561-70.
207. Ruiz, R., et al., Robust hepatic gene silencing for functional studies using helper-
dependent adenoviral vectors. Hum Gene Ther, 2009. 20(1): p. 87-94.
References 194
208. Witting, S.R., et al., Helper-dependent adenovirus-mediated short hairpin RNA
expression in the liver activates the interferon response. J Biol Chem, 2008. 283(4):
p. 2120-8.
209. Rauschhuber, C., et al., Exploring gene-deleted adenoviral vectors for delivery of
short hairpin RNAs and reduction of hepatitis B virus infection in mice. J Gene Med,
2008. 10(8): p. 878-89.
210. Morral, N., et al., Administration of helper-dependent adenoviral vectors and
sequential delivery of different vector serotype for long-term liver-directed gene
transfer in baboons. Proc Natl Acad Sci U S A, 1999. 96(22): p. 12816-21.
211. Brunetti-Pierri, N., et al., Pseudo-hydrodynamic delivery of helper-dependent
adenoviral vectors into non-human primates for liver-directed gene therapy. Mol
Ther, 2007. 15(4): p. 732-40.
212. Brunetti-Pierri, N., et al., Balloon Catheter Delivery of Helper-dependent Adenoviral
Vector Results in Sustained, Therapeutic hFIX Expression in Rhesus Macaques. Mol
Ther, 2012. 20(10): p. 1863-70.
213. Hanazaki, K., Antiviral therapy for chronic hepatitis B: a review. Curr Drug Targets
Inflamm Allergy, 2004. 3(1): p. 63-70.
214. Klein, C., et al., Inhibition of hepatitis B virus replication in vivo by nucleoside
analogues and siRNA. Gastroenterology, 2003. 125(1): p. 9-18.
215. Shlomai, A. and Y. Shaul, Inhibition of hepatitis B virus expression and replication
by RNA interference. Hepatology, 2003. 37(4): p. 764-70.
216. Bangari, D.S. and S.K. Mittal, Current strategies and future directions for eluding
adenoviral vector immunity. Curr Gene Ther, 2006. 6(2): p. 215-26.
217. Moore, M.D., et al., Stable inhibition of hepatitis B virus proteins by small interfering
RNA expressed from viral vectors. J Gene Med, 2005. 7(7): p. 918-25.
References 195
218. Croyle, M.A., et al., PEGylation of E1-deleted adenovirus vectors allows significant
gene expression on readministration to liver. Hum Gene Ther, 2002. 13(15): p. 1887-
900.
219. Eto, Y., et al., Neutralizing antibody evasion ability of adenovirus vector induced by
the bioconjugation of methoxypolyethylene glycol succinimidyl propionate (MPEG-
SPA). Biol Pharm Bull, 2004. 27(6): p. 936-8.
220. He, T.C., et al., A simplified system for generating recombinant adenoviruses. Proc
Natl Acad Sci U S A, 1998. 95(5): p. 2509-14.
221. Marion, P.L., et al., A transgenic mouse lineage useful for testing antivirals targeting
hepatitis B virus, in Frontiers in Viral Hepatitis. 2003, Elsevier Science Amsterdam.
p. 197-202.
222. Jiang, H., et al., Recombinant adenovirus vectors activate the alternative complement
pathway, leading to the binding of human complement protein C3 independent of
anti-ad antibodies. Mol Ther, 2004. 10(6): p. 1140-2.
223. Furutani, Y., et al., Cloning and sequencing of the cDNA for human monocyte
chemotactic and activating factor (MCAF). Biochem Biophys Res Commun, 1989.
159(1): p. 249-55.
224. Yoshimura, T., et al., Purification and amino acid analysis of two human glioma-
derived monocyte chemoattractants. J Exp Med, 1989. 169(4): p. 1449-59.
225. Jones, M.L., et al., Potential role of monocyte chemoattractant protein 1/JE in
monocyte/macrophage-dependent IgA immune complex alveolitis in the rat. J
Immunol, 1992. 149(6): p. 2147-54.
226. Koch, A.E., et al., Enhanced production of monocyte chemoattractant protein-1 in
rheumatoid arthritis. J Clin Invest, 1992. 90(3): p. 772-9.
References 196
227. Smith, T.A., et al., Transient immunosuppression permits successful repetitive
intravenous administration of an adenovirus vector. Gene Ther, 1996. 3(6): p. 496-
502.
228. Ye, X., et al., Transient depletion of CD4 lymphocyte improves efficacy of repeated
administration of recombinant adenovirus in the ornithine transcarbamylase deficient
sparse fur mouse. Gene Ther, 2000. 7(20): p. 1761-7.
229. Chen, Q., et al., Therapeutic RNA silencing of Cys-X3-Cys chemokine ligand 1 gene
prevents mice from adenovirus vector-induced acute liver injury. Hepatology, 2008.
47(2): p. 648-58.
230. Mizuta, K., et al., Stability of the seven hexon hypervariable region sequences of
adenovirus types 1-6 isolated in Yamagata, Japan between 1988 and 2007. Virus Res,
2009. 140(1-2): p. 32-9.
231. Nunes, F.A., et al., Gene transfer into the liver of nonhuman primates with E1-deleted
recombinant adenoviral vectors: safety of readministration. Hum Gene Ther, 1999.
10(15): p. 2515-26.
232. Grimm, D., et al., Fatality in mice due to oversaturation of cellular microRNA/short
hairpin RNA pathways. Nature, 2006. 441(7092): p. 537-41.
233. Mowa, M.B., C. Crowther, and P. Arbuthnot, Therapeutic potential of adenoviral
vectors for delivery of expressed RNAi activators. Expert Opin Drug Deliv, 2010.
7(12): p. 1373-85.
234. Crowther, C., et al., Efficient inhibition of hepatitis B virus replication in vivo, using
polyethylene glycol-modified adenovirus vectors. Hum Gene Ther, 2008. 19(11): p.
1325-31.
235. McCoy, R.D., et al., Pulmonary inflammation induced by incomplete or inactivated
adenoviral particles. Hum Gene Ther, 1995. 6(12): p. 1553-60.
References 197
236. Yei, S., et al., In vivo evaluation of the safety of adenovirus-mediated transfer of the
human cystic fibrosis transmembrane conductance regulator cDNA to the lung. Hum
Gene Ther, 1994. 5(6): p. 731-44.
237. Jooss, K., et al., Transduction of dendritic cells by DNA viral vectors directs the
immune response to transgene products in muscle fibers. J Virol, 1998. 72(5): p.
4212-23.
238. Brunetti-Pierri, N., et al., Phenotypic correction of ornithine transcarbamylase
deficiency using low dose helper-dependent adenoviral vectors. J Gene Med, 2008.
10(8): p. 890-6.
239. Cotter, M.J. and D.A. Muruve, The induction of inflammation by adenovirus vectors
used for gene therapy. Front Biosci, 2005. 10: p. 1098-105.
240. Muruve, D.A., The innate immune response to adenovirus vectors. Hum Gene Ther,
2004. 15(12): p. 1157-66.
241. Muruve, D.A., et al., Helper-dependent adenovirus vectors elicit intact innate but
attenuated adaptive host immune responses in vivo. J Virol, 2004. 78(11): p. 5966-72.
242. Arbuthnot, P., Harnessing RNA interference for the treatment of viral infections. Drug
News Perspect, 2010. 23(6): p. 341-50.
243. Arbuthnot, P., et al., Opportunities for treating chronic hepatitis B and C virus
infection using RNA interference. J Viral Hepat, 2007. 14(7): p. 447-59.
244. Ivacik, D., A. Ely, and P. Arbuthnot, Countering hepatitis B virus infection using
RNAi: how far are we from the clinic? Rev Med Virol, 2011: p. In Press.
245. Brunetti-Pierri, N. and P. Ng, Helper-dependent adenoviral vectors for liver-directed
gene therapy. Hum Mol Genet, 2011. 20(R1): p. R7-13.
246. Taniguchi, M., K. Seino, and T. Nakayama, The NKT cell system: bridging innate and
acquired immunity. Nat Immunol, 2003. 4(12): p. 1164-5.
References 198
247. Guidotti, L.G. and F.V. Chisari, Noncytolytic control of viral infections by the innate
and adaptive immune response. Annu Rev Immunol, 2001. 19: p. 65-91.
248. Kreppel, F., Personal Communication. 2012.
249. Schiffer, J.T., et al., Targeted DNA mutagenesis for the cure of chronic viral
infections. J Virol, 2012. 86(17): p. 8920-36.
250. Pasut, G. and F.M. Veronese, State of the art in PEGylation: the great versatility
achieved after forty years of research. J Control Release, 2012. 161(2): p. 461-72.
251. Khare, R., et al., Generation of a Kupffer cell-evading adenovirus for systemic and
liver-directed gene transfer. Mol Ther, 2011. 19(7): p. 1254-62.
252. Kreppel, F., et al., Combined genetic and chemical capsid modifications enable
flexible and efficient de- and retargeting of adenovirus vectors. Mol Ther, 2005.
12(1): p. 107-17.
253. Lyons, M., et al., Adenovirus type 5 interactions with human blood cells may
compromise systemic delivery. Mol Ther, 2006. 14(1): p. 118-28.
254. Reichel, M.B., et al., An immune response after intraocular administration of an
adenoviral vector containing a beta galactosidase reporter gene slows retinal
degeneration in the rd mouse. Br J Ophthalmol, 2001. 85(3): p. 341-4.
255. Cradick, T.J., et al., Zinc-finger nucleases as a novel therapeutic strategy for
targeting hepatitis B virus DNAs. Mol Ther, 2010. 18(5): p. 947-54.
Top Related