Hysterangium mats and associated bacteria under Eucalyptus
gomphocephala in south-western Australia
By
Nguyen Quang Dung
BSc. Forestry (Vietnamese Forestry University)
Thesis submitted in fulfilment of the requirements for the degree
of Master of Philosophy in Biological Sciences
School of Biological Sciences and Biotechnology
Murdoch University
Perth, Western Australia
November 2012
i
Declaration
I hereby declare that the work in this thesis is of my own research, except where
reference is made, and has not previously been submitted for a degree at any
educational institution. Contributions including professional advice and other
help are detailed in the acknowledgements.
Nguyen Quang Dung
November 2012
ii
ABSTRACT
Eucalyptus gomphocephala (tuart) is an ecologically and culturally important woodland
and forest tree native to south-western Australia. Unfortunately, tuart has been markedly
declining in recent decades, and the mortality rate is as high as 90% in some
populations. The cause of tuart decline is still poorly understood and we know nothing
about how the decline changes populations of organisms such as ectomycorrhizal
(ECM) fungi and beneficial bacteria. Therefore, this study investigated aspects of
mycorrhizal fungal mats under healthy tuart, including effects on forest soil properties,
and presence of beneficial bacteria.
A common mat morphotype (grey, hydrophobic) was chosen for this research and the
ECM fungus was identified as a Hysterangium sp. based on fungal morphology, ECM
structure and ITS gene region analysis. The effect of the ECM mats on soil moisture,
nutrients, microbial biomass (ninhydrin-reactive N) and microbial community (Biolog
Ecoplate) was investigated. Potential PGPR with ability to solubilize phosphate
(hydroxylapatite-Ca5HO13P3), produce IAA and use ACC acid as the sole carbon source
were screened. Hysterangium mats significantly improved soil moisture, soil pH,
nutrient level and microbial biomass compared to non-mat soils, however, there was no
evidence of any difference in microbial diversity and activity between mat and non-mat
soils. Twenty eight IAA producing bacterial isolates, 7 phosphate solubilizing isolates
and 2 ACC deaminase producing isolates were screened from mat and non-mat soils.
Interactions among beneficial bacteria, ECM fungi and eucalypt seedlings were then
investigated. ECM synthesis was also conducted between Hysterangium MURU6276
and E. gomphocephala seedlings in vitro. The plant growth promoting ability of bacteria
to eucalypt seedlings was assessed through a bioassay using petri dishes containing
MMN medium overlaid with cellophane. Half plate petri dishes were used to screen for
iii
mycorrhiza helper bacteria. ECM association between Hysterangium MURU6275 and
E. gomphocephala seedlings was confirmed in vitro. Most bacterial isolates from under
tuart had stimulating or inhibiting effects on the root growth of E. gomphocephala
and/or E. grandis. The best 6 growth promoting isolates were T1M3, T1N2, T2N7,
T3N4, T4N4 and T4N6. However, there was no evidence of the presence of mycorrhiza
helper bacteria amongst the isolated bacteria.
These findings provide the basis for further detailed research on biochemical processes
and the diversity and functions of bacterial populations under Hysterangium mats
associated with tuart. Areas for further study are suggested.
iv
TABLE OF CONTENTS
ABSTRACT ……………………………………………………............................. ii
ACKNOWLEDGEMENTS vi
ABBREVIATIONS………………………………………………………………… vii
CHAPTER 1 ………………………………………………………………………
INTRODUCTION
1
1.1 Overview of the research program ………………………………………… 1
1.2 Background ……………………………………………………………….. 1
1.3 Thesis hypotheses and aims ……………………………………………….. 3
1.4 Thesis structure ……………………………………………………………. 4
CHAPTER 2 ………………………………………………………………………
LITERATURE REVIEW
5
2.1 Introduction ………………………………………………………………... 5
2.2 Plant growth promoting rhizobacteria …………………………………….. 5
2.2.1 Mechanisms of PGPR action ………………………………………… 5
2.2.2 Research and applications of PGPR in forestry ……………………… 9
2.3 Mycorrhiza helper bacteria ………………………………………………... 13
2.3.1Mechanisms of MHB action ………………………………………….. 14
2.3.2 Research and applications of MHB in forestry ………………………. 18
2.4 Mycorrhizal fungal mats …………………………………………………... 19
2.4.1 Abundance of ECM mats ……………………………………………. 19
2.4.2 Types of ECM mats ………………………………………………….. 24
2.4.3 Function of ECM fungal mats…………………………………………. 25
2.5 Soil microbial biomass……………………………………………………… 26
2.5.1 Techniques for measuring soil microbial biomass…………………… 27
2.5.2. Measuring soil microbial biomass by extracting ninhidryn reactive N 28
2.6 Soil microbial activity………………………………………………………. 30
2.7 Concluding remarks…………………………………………………………. 33
CHAPTER 3 ………………………………………………………………………
HYSTERANGIUM-EUCALYPTUS GOMPHOCEPHALA MATS AND
ASSOCIATED MICROORGANISMS
34
3.1 Introduction…………………………………………………………………. 34
3.2 Materials and methods ……………………………………………………… 36
3.2.1 Site selection…………………………………………………………… 36
3.2.2 Soil and mat sampling…………………………………………………. 38
3.2.3 Characterization of physiochemical and microbial properties………… 38
v
3.2.4 Characterization of fungal mat and mat-forming fungi……………..... 42
3.2.5 Characterization of bacteria………………………………………….. 45
3.3 Results………………………………………………………………………. 47
3.3.1 Characterization of fungal mat…………………………………………. 47
3.3.2 Soil properties…………………………………………………………... 50
3.3.3 Characterization of bacteria…………………………………………….. 58
3.4 Discussion…………………………………………………………………… 61
3.4.1 ECM mat and fungi…………………………………………………….. 61
3.4.2 Soil properties…………………………………………………………... 63
3.4.3 Plant growth promoting properties of bacteria ……………………… 68
CHAPTER 4………………………………………………………………………..
INTERACTION AMONG TUART-ASSOCIATED RHIZOBACTERIA,
ECTOMYCORRHIZAL FUNGI AND EUCALYPTUS SEEDLINGS
71
4.1 Introduction…………………………………………………………………. 71
4.2 Materials and methods………………………………………………………. 73
4.2.1 Effect of bacteria on eucalypt seedling growth……………………….. 73
4.2.2 In vitro ECM synthesis between Hysterangium MURU6276 and tuart 75
4.2.3 Effect of bacteria on the root growth of ECM mycelium……………… 76
4.2.4 Data analysis…………………………………………………………… 77
4.3 Results………………………………………………………………………. 77
4.3.1 Effect of bacteria on the growth of eucalypt seedlings………………… 77
4.3.2 ECM synthesis in vitro………………………………………………… 81
4.3.3 Effect of bacteria on fungal mycelium………………………………… 83
4.4 Discussion 86
4.4.1 Effect of bacteria on the growth of eucalypt seedlings 86
4.4.2 ECM synthesis 89
4.4.3 Effect of bacteria on ECM mycelia growth 90
CHAPTER 5………………………………………………………………………..
GENERAL DISCUSSION
92
5.1 Properties of fungal mats and associated organisms………………………... 92
5.2 Future research……………………………………………………………… 98
5.2.1 ECM fungi…………………………………………………………….. 98
5.2.2 Fungal mats……………………………………………………………. 99
5.2.3 Bacterial associated with fungal mats…………………………………. 99
EPPENDIX…………………………………………………………………………. 101
REFERENCES…………………………………………………………………….. 108
vi
ACKNOWLEDGMENTS
I would like to thank the Agricultural Science Technology Project, Ministry of
Agriculture and Rural Development, Vietnam for providing me with a scholarship
without which this Master of Philosophy would not have been possible.
I am grateful to Associate Professor Pham Quang Thu and Associate Professor Nguyen
Hoang Nghia, Forest Science Institute of Vietnam, for their support in doing research in
Australia and advice on research topics.
I wish to express my immense gratitude to my principal supervisor Professor Bernie
Dell for his conscientious supervision throughout. This MPhil would not have been
possible without his financial support. The good advice and assistance in soil microbial
skills of my second supervisor, Dr Lambert Brau, have been invaluable.
Much support was received by staff and fellow research students at Murdoch
University, for which I am indebted. I would like to thank Murdoch technical staff Ms
Rebecca Swift for her helpful advice and supply of plant growth promoting
rhizobacteria, Ms Diane White and Dr William Dunstan for their help in fungal
identification by DNA analysis, Dr Katinka Ruthof for providing tuart seed, and Mr
Gordon Thomson for his invaluable input into preparation of the histological specimens.
Furthermore, my deep thanks to fellow students, Mr Dang Thanh Tan for his help when
I first arrived at Murdoch University, Ms Lily Ishaq for her useful discussion
throughout, and Mr Harry Eslick for his help in measuring soil microbial biomass and
helpful statistical discussion.
I would like to thank my parents for their support. Lastly, I would particularly like to
thank my beloved wife, Hoa Hong who sacrificed a lot for my research and our lovely
daughter, Thao Nhi during my MPhil.
vii
LIST OF ABBREVIATIONS
ACC 1-aminocyclopropane-1-carboxylic acid
AHL N-acryl-L-hormonerine lactone
AM arbuscular mycorrhiza
AMR average metabolic response
ANOVA analysis of variance
ARDRA amplified ribosomal deoxyribonucleic acid restriction analysis
ATP adenosine triphosphate
BLAST Basic Local Aligement Search Tool
CFE chloroform fumigation extraction
CFI chloroform fumigation incubation
CLPP community-level physiological profiling
CMD community metabolic diversity
CNN competition for nutrients and niches
DF Dworkin and Foster
DGGE denaturing gradient gel electrophoresis
DNA deoxyribonucleic acid
DTPA diethylene-triamine-penta-acetic acid
ECM ectomycorrhiza
et al. et alia
Exc. exchangable
FAME fatty acid methyl ester
FISH fluorescent in situ hybridization
G+C guanine + cytosine
GPB glucose peptone broth
IAA indole-3-acetic acid
IAM indoleacetamine
ICP inductively coupled plasma
IPyA indolepyruvic acid
IR infrared reflectance
ISR induced systemic resistance
ITS internal transcribed spacer
LPS lipopolysaccharidses
viii
L-TRP L-tryptophan
MEA malt extract agar
MHB
ml
mycorrhiza helper bacteria
milliliter
MMN medium Modified Melin Norkrans medium
MPVK medium Modified Pikovskaya medium
MW microwave irradiation
NA nutrient agar
NB nutrient broth
NRC ninhydrin reactive compounds
PCA principal component analysis
PCR polymerase chain reaction
PDA potato dextrose agar
PGP plant growth promoting
PGPR plant growth promoting rhizobacteria
Phl 2,4-diacetyl phloroglucinol
PLFA phospholipid fatty acids
PLFA phospholipid fatty acid analysis
PPQ cofactor pyrrolquinoline quinine
rDNA ribosomal deoxyribonucleic acid
rRNA ribosomal ribonucleic acid
SA salicylic acid
SD standard deviation
SE standard error of the mean
SIR substrate induced respiration
SMB soil microbial biomass
SPSS Statistical Package for the Social Sciences
SSCP single strand conformation polymorphism
TGGE temperature gradient gel electrophoresis
T-RFLP terminal restriction fragment length polymorphism
1
CHAPTER 1
INTRODUCTION
1.1 Overview of the research program
This thesis is the documentation for a Master of Philosophy research program which
was undertaken at Murdoch University, Australia between 2010 and 2012. The study
site was located in a Eucalyptus gomphocephala (tuart) forest in Yalgorup National
Park, Western Australia. The purpose of the research was to investigate dense fungal
mats under E. gomphocephala, the effect of fungal mats on soil properties, whether
plant growth promoting rhizobacteria (PGPR) and mycorrhiza helper bacteria (MHB)
are associated with the mats, and to explore the efficacy of selected isolates.
1.2 Background
Eucalyptus gomphocephala is a forest and woodland tree native to the southwest of
Western Australia. It is an ecologically and culturally important species (Thies 2007).
Unfortunately, tuart has been undergoing a marked decline in Yalgorup National Park
and nearby areas since the early 1990s, and the mortality rate is as high as 90% in some
areas (Tuart Response Group 2002) (Figs 1.1, 1.2). The cause of tuart decline is still
poorly understood. Recently, Cai et al. (2010) have shown that there was a loss of some
soil microbial function under declining tuart. Currently, nothing is known about how the
decline changes populations of beneficial organisms. Before this can be studied we must
have some understanding of beneficial microorganisms that are associated with healthy
tuart.
Beneficial rhizobacteria are well known to promote the growth of many plants. Some
beneficial bacteria are known as plant growth promoting rhizobacteria (PGPR) or
mycorrhiza helper bacteria (MHB). Glick et al. (2002) reported that PGPR, through a
large number of different mechanisms, such as improvement of nutrient uptake,
B
2
phytohormone production, induction of pathogen resistance and decrease in pollutant
toxicity, can promote plant growth and development. A number of MHB are reported
(Burgess et al. 1994b) to be likely to enhance either arbuscular mycorrhiza (AM) or
ectomycorrhiza (ECM) symbioses, and thus, indirectly, plant growth (Barea 2002;
Garbaye 1994). The PGPR and MHB communities play an important role in plant
growth and survival in the majority of terrestrial ecosystems, and thus it is hypothesized
that they have a certain positive relationship with the health of tuart forests which is
worth considering.
Fig. 1.1. Dying tuart forest in
Yalgorup National Park
Fig. 1.2. Dead tuart tree in Yalgorup
National Park
Fungal mats, a vegetative body of ECM in many forests, are thought to provide a
special habitat for microorganisms. For example, ECM fungal mat soils under Douglas
fir provide a more favourable microenvironment for organic matter decomposition than
non-mat soils (Entry et al. 1991a). Recently, unpublished observations indicate that
ECM fungal mats are common in healthy tuart forests in Yalgorup National Park, and
that there are more visible ECM fruiting bodies in healthy sites than in declining sites.
No studies have been published on bacteria associated with ectomycorrhizal mats in
eucalypt forests. It is hypothesised that ECM mats play an important role in the bacterial
ecology of healthy tuart forests, and this needs to be researched.
3
From the above points, research on PGPR and MHB associated with ECM fungal
mats under healthy tuart was initiated in this study.
1.3 Thesis hypotheses and aims
This research was designed to test the following hypotheses:
ECM fungal mats enhance soil moisture and nutrient levels compared to
non-mat soils,
There is greater microbial biomass, diversity and activity in mat than in non-
mat soils,
There exist PGPR and MHB associated with ECM fungal mats of E.
gomphocephala, and
These PGPR and MHB can promote the growth of eucalypt seedlings.
The following specific aims were addressed:
1) to describe the composition of common Hysterangium-like mats, the
structure of mat ECM and to identify the main fungus by DNA analysis,
2) to describe the soil physicochemical and microbial properties of
Hysterangium mats associated with E. gomphocephala,
3) to isolate bacteria associated with Hysterangium mats and to characterize
their ability to produce indole-3-acetic acid (IAA), solubilize phosphate,
and use 1-aminocyclopropane-1-carboxylic acid (ACC) as a sole carbon
source in vitro,
4) to investigate whether any of the bacteria can promote the growth of ECM
mycelium in vitro, and
5) to investigate interactions among PGPR, MHB and the growth of E.
gomphocephala and E. grandis seedlings.
4
1.4 Thesis structure
The structure of the thesis is shown in Figure 1.3.
Figure 1.3. Diagram showing the linkages between chapters of the thesis
Introduction and background
(Chapter 1)
Literature review
(Chapter 2)
Effect of Hysterangium mats on soil properties
(Chapter 3)
Identification of Hysterangium fungus
(Chapter 3)
Isolation of potential PGPR and MHB
(Chapter 3)
Eucalypt seedling response to potential PGPR and MHB screening
(Chapter 4)
General discussion
(Chapter 5)
5
CHAPTER 2
LITERATURE REVIEW
2.1 Introduction
The previous chapter presented the background, and aims of this research. In this
chapter, emphasis is placed on plant growth promoting rhizobacteria, mycorrhiza helper
bacteria, ectomycorrhizal mats, soil microbial biomass and the soil microbial
community because these topics dominate the research presented in the body of this
thesis. The purpose of this chapter is to document the theoretical and practical bases of
the related subjects that underpin the aims and methodologies which are developed in
Chapters 3 and 4.
2.2 Plant growth promoting rhizobacteria
Non-pathogenic, rhizospheric colonising bacteria, which benefit plants by exerting
growth promoting effects, are designated as plant growth promoting rhizobacteria
(PGPR). The PGPR are a diverse group of bacteria and include species from a wide
range of genera. For example, Tilak et al. (2005) provided a list of genera including
Azospirillum, Alcaligenes, Arthrobacter, Acinetobacter, Bacillus, Burkholderia,
Enterobacter, Erwinia, Flavobactrium, Pseudomonas, Rhizobium and Serratia.
Although PGPR have mostly been studied on annual crops, research on PGPR in
forestry systems has been drawing interest from forest researchers. Growth promoting
abilities of rhizobacteria were well documented in some recent reviews (Lucy et al.
2004; Lugtenberg and Kamilova 2009; Saharan and Nehra 2011).
2.2.1 Mechanisms of PGPR action
The PGPR are likely to promote plant growth and development through a number of
different mechanisms. Although the mechanisms are not fully understood, they can be
6
divided into two groups, depending on their mode of action: direct or indirect. Some
rhizobacteria can promote plant growth directly through improvement in nutrient
uptake, production and concentration change of plant growth regulators, and
rhizoremediation; whereas others can indirectly enhance plant growth through
biological control of deleterious microorganisms. The main mechanisms are discussed
below in more detail.
Improvement in plant nutrient uptake
The PGPR can provide plants with nutrients, therefore, they are also regarded by some
workers as bio-fertilizers (Vessey 2003). For example, some PGPR are able to fix
atmospheric nitrogen (N2) which can then be used for plant growth. Nitrogen fixation by
rhizobacteria is globally important because many areas under cultivation are constrained
by limiting soil N supply. There are 2 groups of N2-fixing bacteria, symbiotic and
asymbiotic nitrogen fixers. Rhizobia and Frankia, two of the common symbiotic N2-
fixing bacteria which form nodules on plant roots, have been extensively studied, and
reviewed (Chaia 2010; Perret et al. 2002; Wang 2012). Some strains of asymbiotic N2-
fixing bacteria have been shown, under particular conditions, to improve the N status of
plant crops. For example, Dashti et al. (1998) showed that the total fixed N, as a
percentage of total plant N, and total N yield all increased following the application of
Serratia liquefaciens 2-68 and S. proteamaculans 1-102 to a soybean crop under field
conditions in McGill University, Canada. Azospirillum is another free-living N2-fixing
genus which has been applied as a bio-fertilizer to wheat and maize (Lugtenberg and
Kamilova 2009).
Also, PGPR can improve plant growth through phosphate solubilization. Phosphorus is
one of the most important macronutrients in plant growth and development (Illmer and
Schinner 1992). Unlike inorganic forms of N, phosphates are strongly adsorbed to
7
reactive surfaces in soils, and they are least available for plant uptake although both
organic and inorganic forms of phosphate occur in soil. Some soil bacteria can
solubilize P from both inorganic and organic sources in soils for plant growth and
development (Richardson 2001). Selvakumar et al. (2009) reported that Pseudomonas
fragi CS11RH1, isolated from garlic rhizosphere in the Indian Himalayas, could
solubilize P and improve wheat growth. The highest level of soluble P (515 µg/ml) was
recorded at pH 2.4 after 15 days of incubation. In addition, wheat seeds inoculated with
bacterial solution had higher germination compared to the un-inoculated control.
Moreover, the root and shoot length of inoculated seedlings were 16.2% and 20.3%
higher, respectively, than in the un-inoculated seedlings (Selvakumar et al. 2009).
Production and concentration change of phytohormones
Some PGPR are able to produce phytohormones and hormone-like substances which are
stimulants for plant growth. These substances generally include the auxin, indole acetic
acid which is best understood of the auxin group, various volatiles and the cofactor
pyrrolquinoline quinine (PPQ) (Lugtenberg and Kamilova 2009). There is increasing
evidence that besides auxins, PGPR can promote plant growth and development by
stimulating the production of gibberellins and cytokinins in plants (Saharan and Nehra
2011). Some PGPR, including strains of Bacillus amyloliquefaciens, B. subtilis and
Enterobacter cloacae enhance plant growth through the release of volatile chemicals
(Ryu et al. 2003).
Other PGPR can reduce plant stress by regulating the level of ethylene in plants. Over-
production of ethylene generally occurs under stressful conditions, such as flooding,
heavy metal contamination, presence of phytopathogens, drought and high salt
concentrations. This ethylene can inhibit plant growth, and can lead to plant death
(Saharan and Nehra 2011). A number of PGPR contain the enzyme 1-amino-
8
cyclopropane-1-carboxylate (ACC) deaminase. The deaminase can lower ethylene
levels in stressed plants because it can cleave the immediate precursor of ethylene
synthesis (Penrose and Glick 2003).
Bacterial remediation
The application of PGPR is becoming one of the promising approaches in solving
problems of heavy metal pollution. Those bacteria which are resistant to heavy metals
can be used as metal sequestering bio-inoculants for plant growth promotion in heavy
metal contaminated soils (Rajkumar and Freitas 2008). For example, a PGPR of
Kluyvera ascorbata SUCD165, capable of containing high levels of heavy metal, was
resistant to toxic effects of Ni2+
, Pb2+
, Zn2+
and CrO4- (Burd et al. 1998).
Biological control of plant deleterious microorganisms
Induction of pathogen resistance is another mechanism which supports plant growth and
health. PGPR can control soil-borne phytopathogens through 3 main mechanisms,
namely antagonism against phytopathogens, induced systemic resistance and
competition for nutrients and niches.
Some PGPR can colonize plant root systems, producing antibiotics around them which
can then prevent plants from infection by pathogens (Lugtenberg and Kamilova 2009).
The featured characteristics of these PGPR are synthesis and release of antibiotics,
successful competition with other microbes and colonization of plant roots and
production of antibiotics in the right microniche on the root surface (Lugtenberg and
Kamilova 2009). The antibiotics produced by PGPR include phytoalexins (Van Peer et
al. 1991), HCN (Haas and Keel 2003), phenazines (Chin-A-Woeng et al. 1998; Mavrodi
et al. 2006), and D-gluconic acid (Kaur et al. 2006).
9
Interactions of some PGPR with certain plant roots are likely to induce a resistance in
the whole plant against diseases caused by phytopathogens. This mechanism is
designated as induced systemic resistance (ISR) (Van Loon et al. 1998). These authors
reported that ISR has been shown against pathogenic fungi, bacteria, viruses, nematodes
and insects in a range of plant species including Arabidopsis, bean, carnation,
cucumber, radish, tobacco and tomato, and that bacterial components which induce the
resistance include siderophores, lipopolysaccharides (LPS) and salicylic acid (SA).
More recently, a large number of bacterial elicitors, which induce ISR, have been
reported including 2,4-diacetyl phloroglucinol (Phl) (Lavicoli et al. 2003), the volatile
components 2,3-butanediol and acetoin (Ryu et al. 2004), N-acyl-L-hormoserine lactone
(AHL) signal molecules (Schuhegger et al. 2006), and surfactin and fengycin
lipopeptides (Paquot et al. 2007).
Competition for nutrients and niches (CNN) by PGPR with phytopathogens is regarded
as a possible biocontrol mechanism. By this mechanism, PGPR colonize plant roots,
outcompete phytopathogens in search of root exudates on the root surface, and
eventually occupy plant roots and nearby areas (Lugtenberg and Kamilova 2009).
However, there are few studies focusing on this action mechanism (Bolwerk et al. 2005;
Kamilova et al. 2005; Lemanceau and Alabouvette 1991; Pliego 2008), and thus
evidence for this mechanism in the literature is still lacking.
2.2.2 Research and applications of PGPR in forestry
There is no doubt that applying PGPR as inoculants is a useful approach in the forestry
sector due to potential PGPR benefits for tree species. Although the research effort and
application of PGPR in forestry is much less widespread than in agricultural crops,
nevertheless there are studies spanning three decades (Table 2.1).
10
Table 2.1. Free-living PGPR experiments with different tree species
Bacteria Tree species Experimental
conditions
Reported PGPR effect Reference
Arthrobacter sp. Pinus
sylvestris
Laboratory Shoot length increased up to
69%
Pokojska-
Burdziej
(1982)
Azotobacter
chroococcum
Quercus
serrata
Potted plant
experiment
outdoors
Biomass increased up to 38% Pandey et al.
(1986)
Azotobacter
chroococcum,
Bacillus megaterium
Eucalyptus
camaldulensis
Potted plant
experiment
outdoors
Biomass increased up to 44% Mohammad
and Prasad
(1988)
Arthrobacter
citreus,
Pseudomonas
fluorescens,
Pseodomonas
putida
Picea
mariana,
Pinus
banksiana,
Picea glauca
Greenhouse Increased height and biomass Beall and
Tipping
(1989)
Agrobacterium
radiobacter
Fagus
sylvatica,
Pinus
sylvestris
Greenhouse F. sylvatica biomass increased
up to 235%, P. sylvestris
biomass increased by 15%
Leyval and
Berthelin
(1990)
Bacillus polymyxa Pseudotsuga
menziesii,
Pinus
contorta,
Picea glauca
Growth
chamber and
Greenhouse
For P. contorta, significantly
increased root dry weight (1.35
fold) and the number and
length of secondary roots (1.44
fold and 1.92 fold,
respectively); increased P.
contorta root growth,
emergence, height and weight,
root collar diameter shown for
plants grown in sterile versus
non-sterile media; seedling
emergence increased for P.
glauca
Chanway et
al. (1991)
Bacillus polymyxa
L6
Pinus
contorta
Growth
chamber
Significantly increased seedling
biomass at 6 weeks of growth;
mean shoot and root weight
increased up to 35%
Holl and
Chanway
(1992)
11
Bacillus polymyxa,
Staphylococcus
hominis
Picea glauca
x engelmannii
Greenhouse
(using field
soil)
Significant growth increase up
to 59%
O’Neili et al.
(1992)
Azospirillum
brasilense
Quercus
ithaburensis
Greenhouse Root growth increased up to
70%, these growth promotions
observed only with cells
cultured in malate and not
fructose
Zaady and
Perevolosky
(1995),
Zaady et al.
(1993)
Anthrobacter
oxydans,
Pseudomonas
aureofaciens
Pseudotsuga
menziesii
Greenhouse
and field
Height and biomass increased
up to 68%, increased branch
and root weights, some
variability in response of fir
ecotypes to inoculation
Chanway
and Holl
(1994)
Bacillus polymyxa Tsuga
heterophylla
Greenhouse Increased seedling height and
biomass up to 30%
Chanway
(1995)
Bacillus polymyxa,
Pseudomonas
fluorescens
Pinus taeda,
Pinus elliottii
Greenhouse Significantly increased speed of
seedling emergence and total
biomass; post-emergence
damping off reduced in Pinus
taeda; two bacterial strains
reduced biomass of both
species; Pinus taeda had
increased root length with some
strains.
(Enebak et
al. 1998)
Bacillus
licheniformis,
Phylobacterium sp.
Mangrove Greenhouse Doubling of N incorporation
into plant, increased leaf
development
Bashan and
Holguin
(2002),
Rojas et al.
(2001)
Bacillus
licheniformis CECT
5105, Bacillus
pumilis CECT 5160
Picea
engelmannii
Greenhouse Significantly increased aerial
plant growth, root system
development not affected,
increased plant N content
Probanza et
al. (2002)
12
Bacillus polymyxa,
Pseudomonas
fluorescens
Picea glauca
x engelmannii
Field Increased spruce seedling dry
weight up to 57% above un-
inoculated plants at five of nine
test sites; all test strains
increased dry weight of spruce
at four of the nine sites; some
plant growth inhibition detected
due to inoculation at some sites
Chanway
(2000)
Bacillus subtilis,
Paenibacillus
macerans
Pinus taeda Glasshouse
and field
Enhancement of Pinus taeda
growth and development under
ozone exposure when
inoculated
Chappelka et
al. (2004)
Stenotrophomonas
maltophilia isolates,
Panebacillis
polymyxa,
Rhizobium sp.
Pinus taeda,
Pinus elliottii,
Pinus
palustris
Glasshouse Increased rate of seedling
emergence for P. taeda, P.
elliottii compared to the
control, increased shoot
growth, root length, biomass
and surface area for P. taeda
versus untreated control,
increased seedling shoot length
of P elliottii, increased shoot
length and shoot and root
biomass of P. palustris
Enebak
(2005)
107 rhizobacterial
isolates
Eucalyptus
clones
In vitro Increased 110% in root
formation and 250% in root
biomass by ten isolates
Teixeira et
al. (2007a)
Bacillus firmus, B.
mycoides, B.
stearothermophilus,
B. subtilis, B.
subtilis, B.
circulans,
Brevibacillus brevis,
Paenibacillus
lautus,
Stenotrophomona
maltophilia
Eucaluptus
globulus, E.
nitens
Potted clones Increased rooting in vegetative
propagation and root biomass
from 69.4 to 191.4% compared
to the control.
Diaz et al.
(2009)
Pseudomonas
sp., Bacillus subtilis,
Pseudomonas fulva,
Pseudomonas sp.,
Stenotrophomonas
maltophilia
Eucalyptus
cloeziana, E.
grandis, E.
globulus, E.
urophylla
In vitro Increased the seed germination
and seedling growth of
different Eucalyptus species
Mafia et al.
(2009b)
Source: Lucy et al. (2004) with changes and supplementation
13
As can be seen in Table 2.1, it is well documented that PGPR promote the growth and
development of some tree species. However, the majority of this research on PGPR has
been undertaken in the laboratory and glasshouse, and tree species chosen were mostly
coniferous trees. Recently, research interest was placed on stimulating effects of PGPR
on the growth and development of Eucalyptus species (Díaz et al. 2009; Mafia et al.
2009b).
2.3 Mycorrhiza helper bacteria
In 1994, the term mycorrhiza helper bacteria (MHB) was used for the first time: “MHBs
are bacteria associated with mycorrhizal roots and mycorrhizal fungi which selectively
promote the establishment of mycorrhizal symbioses” (Garbaye 1994). Although
evidence of MHB have been observed in both ectomycorrhizal and arbuscular
symbiosis systems, studies of MHB have mainly been conducted in the former group
(Bending 2007). The MHB belong to various genera such as Bradyrhizobium (Xie et al.
1995), Bacillus (Dunstan et al. 1998), Burkholderia and Rhodococcus (Poole et al.
2001), Pseudomonas (Founoune et al. 2002a), Rastonia and Bacillus (Kataoka 2009).
Prior to the definition of MHB, there was evidence suggesting the existence of
beneficial bacteria in the mycorrhizosphere. For example, Garbaye and Bowen (1987)
assessed mycorrhizal infection of Pinus radiata by adding microflora. Their results
showed that mycorrhizal infection was strongly affected by microbial inoculation. They
predicted that beneficial bacteria will occur in close vicinity of mycorrhizal fungi, i.e. in
the mantle of ectomycorrhizas or within the fungal mats that make up the vegetative
body of ECM fungi. This postulation is supported by some research findings. Garbaye
and Bowen (1989) isolated a microbial population from the mantle of ECMs formed by
Rhizopogon luteolus and Pinus radiata. A majority of the isolates stimulated mycelium
growth and/or mycorrhizal establishment in both axenic and non-axenic conditions.
14
It has been shown that although some MHB are capable of stimulating mycorrhizal
formation by a range of mycorrhizal species (Aspray et al. 2006; Garbaye et al. 1992),
there seems to be some fungal selectivity of other MHB. One evidence of fungal
specificity was shown in the experiment of Garbaye and Bowen (1987) where three
soils were sterilized and inoculated or not with the total microflora of one of the three
soils and with one of 3 different ECM fungi. The ECM fungi reacted differently to each
microflora. The workers suggested that there were specific interactions of mycorrhizal
fungi over each added microflora. According to Garbaye and Duponnois (1993), some
MHB isolated from Pseudotsuga menziesii - Laccaria laccata ECMs consistently
stimulated ECM formation by Laccaria laccata with Pseudotsuga menziesii, but they
did not have a stimulating effect on fungal symbiosis by Laccaria proxima with the
same host species. Moreover, while Peudomonas fluorescens BBc6 was observed to
stimulate ECM formation by an American Laccaria laccata with Pseudotsuga menziesii
(Duponnois and Garbaye 1991b), the same MHB showed an inhibiting effect on ECM
formation by an Australian Laccaria laccata with Eucalyptus diversicolor (Dunstan et
al. 1998). Due to MHB specificity, it has been suggested that they can be employed
simultaneously for improving mycorrhizal formation and controlling phytopathogenic
fungi (Duponnois et al. 1993).
2.3.1 Mechanisms of MHB action
Only limited research has been conducted with the aim to identify the mechanisms
behind the MHB effect, and thus they remain poorly understood. However, five possible
mechanisms have been proposed, namely: (1) effect of MHB on plant root receptivity,
(2) effect of MHB on root-fungus recognition, (3) effect of MHB on the growth of
fungal mycelia, (4) effect of MHB on the modification of the rhizospheric soil, and (5)
promoted germination of fungal propagules (Garbaye 1994). More recently, evidence
15
has been provided for the occurrence of multiple mechanisms of the MHB effect
(Bending 2007; Frey Klett et al. 2007).
Effect of MHB on the receptivity of roots
According to Garbaye (1994), there are two hypotheses which can be used for
explaining the MHB effect on the enhancement of the receptivity of plant roots to
mycorrhizal fungi. One hypothesis is that MHB are capable of producing plant growth
regulators like IAA (Garbaye 1994) or nutrients such as N or P (Nylund 1988). These
plant regulators and nutrients were observed to either stimulate short root initiation or
increase the number of short roots of seedlings, thus providing mycorrhizal fungi with
enhanced opportunities to reach plant roots. A second hypothesis is associated with the
production of specific enzymes by MHB that can soften the cell wall of the root cortex
to support greater penetration of mycorrhizal fungi into plant roots. Duponnois (1992)
found two specific enzymes in pure culture of some MHB isolated from Laccaria
laccata-Pseudotsuga menziesii symbiosis (Garbaye 1994).
Effect of MHB on root-fungus recognition
According to this mechanism, MHB could interfere with either the plant or the
mycorrhizal fungus to improve plant-fungus symbiosis recognition. Elicitors produced
by either plants or fungi that might play an important role in plant-fungus recognition
include phenolic compounds, enzymes, lectins, polysaccharide or glycoprotein filbrils,
and phytohormones (Anderson 1988). Garbaye (1994) has showed that it is highly
possible that MHB can interfere with these substances by breaking down and
transforming them or producing some other specific compounds which are mediators
for plant-fungus recognition.
16
Effect on the mycelial growth of mycorrhizal fungi
It is hypothesized that MHB can improve mycorrhizal growth in its saprophytic and
presymbiotic stages in the rhizosphere (Garbaye 1994), and thereby possibly providing
ECM fungi with better conditions to approach plant roots. The stimulation of fungal
mycelium by MHB is thought to be the main mechanism which can explain the bacterial
effect on mycorrhizal symbiosis (Duponnois and Plenchette 2003). Because of the ease
of experimental conditions, research on this hypothesis has been more extensively
conducted than the two above mentioned possible mechanisms (Garbaye 1994). For
instance, Garbaye and Bowen (1989), in researching interactions between MHB and the
Rhizopogon luteolus-Pinus radiata symbiosis, showed that a majority of
microorganisms which were isolated from the mantle of ectomycorrhizas stimulated the
mycelial growth of R. luteolus and/or mycorrhiza formation. According to Garbaye
(1994), in research conducted by Duponnois (1992) into the relationship between
bacterial strains isolated from Pseudotsuga menziesii-Laccaria laccata ECMs and ECM
formation, a significant correlation was observed between the ability of bacteria to
stimulate or inhibit mycelia growth and their effect on mycorrhiza formation.
According to Garbaye (1994), this hypothesis could be explained in more detail in
involvement with the production of nutrients and plant growth regulators or
detoxification of the fungal environment by MHB. Some elicitors have been reported in
relation to this mechanism including organic acids, predominantly malic and citric acids
(Duponnois and Garbaye 1990), volatile compounds (Boasson and Shaw 1979), carbon
dioxide (Imolehin and Grogan 1980), ethylene (Imolehin and Grogan 1980), and
ammonia, amines, alcohols, sulphur compounds or low-molecular weight fatty acids
(Duponnois 1992). The ability of some MHB to fix N2 is also suggested to contribute to
this mechanism (Li and Hung 1987; Li et al. 1992). Moreover, some MHB are thought
17
to clean the fungal environment by using or breaking down fungal metabolites which
harm fungal growth and development (Duponnois and Garbaye 1990).
Modification of the mycorrhizosphere soil
It is well known that both plant roots and ectomycorrhizas are affected by the
rhizospheric soil. Any changes to the soil can have an effect on the growth and
development of mycorrhizal fungi and plants as well as the fungal-plant symbiosis.
According to this hypothesis, rhizospheric bacteria indirectly help mycorrhizal fungi by
providing them with the ideal rhizospheric soil environment which is beneficial to
fungal-plant symbiosis. According to Garbaye (1994), changes in pH or siderophore
production induced by fluorescent pseudomonads in soil with Corylus avellana-Tuber
melanosporum symbiosis have been observed by some researches (Mamoun and Olivier
1992). Mineral substances such as N and P, which can be mobilized by some
rhizospheric bacteria, also play an important role in stimulating mycorrhizal formation
(Nylund 1988).
Promoted germination of fungal propagules
According to this hypothesis, some soil bacteria are likely to stimulate the germination
of fungal propagules, and thus accelerate mycorrhiza formation. Experimental evidence
to support this mechanism is scarce, especially in research on ectomycorrhiza. Ali and
Jackson (1989) showed that a large number bacterial isolates associated with ECM
fungi stimulated the germination of spores of certain mycorrhizal fungi. For example,
Pseudomonas stutzeri, which was isolated from a sporophore of Hebeloma
crustuliniforme, actively stimulated spore germination of the fungus. The same
stimulating effect by isolates of Corynebacterium spp. from sporophores of Hebeloma
crustuliniforme was also recorded with this fungus and Paxillus involutus. Xavier and
Germida (2003) studied mycorrhizal activity influenced by soil bacteria associated with
18
Glomus clarum spores. They showed that some bacteria, isolated from decontaminated
spores, could stimulate or inhibit fungal spore germination and that where spore
germination was stimulated this only occurred when the bacteria were in contact with
the spores. The stimulating effect on spore germination has also been reported by other
researchers (Jackson 1989; Mayo et al. 1986). However, the chemicals involved in these
interactions have not been elucidated.
Multiple MHB mechanisms
According to Bending (2007), it appears that some rhizospheric bacteria are capable of
improving mycorrhizal establishment through multiple mechanisms. Riedlinger et al.
(2006) showed that the MHB Streptomyces AcH 505 enhanced ECM symbiosis
between Amanita muscaria and Picea abies by improving mycelial growth of A.
muscaria and inhibiting the growth of phytopathogenic fungi. Auxofuran, a substance
elicited by Streptomyces AcH 505, was reported to be responsible for the fungal growth
enhancement while the antifungal elicitors produced by the same bacterial strain were
identified as the antibiotics of WS-5995B and C.WS-5995B. Furthermore, Lehr et al.
(2007) investigated if MHB Streptomyces AcH 505 could act as a biocontrol agent
against Heterobasidion, and showed that AcH 505 had an inhibiting effect on a majority
of the strains of Heterobasidion tested. As a result, the authors concluded that MHB are
likely to express a combination of different mechanisms during mycorrhizal
establishment.
2.3.2 Research and applications of MHB in forestry
There is evidence that bacteria, associated with ECM fungi, are capable of promoting
ECM growth and ECM formation with tree species, and thus improving tree health.
Some MHB which were tested with ECM fungi and tree species over the past 20 years
have been presented earlier (Table 2.2). Species of Pseudomonas and Bacillus were
19
among the most extensively researched, while ECM fungi of Laccaria and Pisolithus
were mostly tested. A narrow range of tree species was tested to research associations,
mostly coniferous trees in North America and Europe, and there has been little research
on interaction between MHB and ECM fungi with eucalypts. Most studies on MHB
were conducted in the laboratory, a small number in the nursery, and there has been
little research on MHB carried out under field condition.
2.4 Mycorrhizal fungal mats
There is a special group of ECM fungi which forms dense fungal mats in some types of
forests (Dunham et al. 2007; Griffiths et al. 1991a; Juzwik and Meyer 1997; Kluber et
al. 2011). Surprisingly, little is known about the role of ECM mats on the forest
ecosystem and productivity. However, they are actively being studied, especially in the
United States of America and Europe. Abundance, types, and function of ECM mats in
forest ecology are emphasized below.
2.4.1 Abundance of ECM mats
The abundance of ECM mats has been documented in some forests. For example,
Cromack Jr (1979) showed that fungal mats of Hysterangium crassum ranged from 0.25
to 1 m in diameter and occupied an average of 9.6% of the upper 10 cm layer of soil in a
40-60 year old stand of Pseudotsuga menziesii. According to Ingham et al. (1991), there
were high numbers of rhizomorphs in fungal mats, and thus these rhizomorphs
accounted for as much as 50% of the dry weight of mat soils. Fungal mats were also
found to occupy up to 40% of the forest floor in some stands of Pseudotsuga menziesii
forests (Kluber 2010).
20
Table 2.2. MHB tested with different mycorrhizal fungi and tree species
MHB Mycorrhizae fungi Tree species Condition Reported MHB effects References
Fluorescent pseudomonad A IV, fluorescent
pseudomonad 279 and 9 microbial isolates
from the mantle of Rhizopogon luteolus-
Pinus radiata ectomycorrhizas
Rhizopogon luteolus Pinus radiata Laboratory and
Growth
chamber
A significant microbial population detected within the
mantle of mycorrhizas, a majority of these likely to
stimulate mycelial growth of R. luteolus and/or
mycorrhiza formation
Garbaye and
Bowen (1989)
Bacillus polymyxa L6 Wilcoxina mikolae isolate
R947
Pinus contorta Glasshouse Increased shoot biomass when seedlings were co-
inoculated with mycorrhizae and bacteria; no effect on
seedling biomass and foliar N content with Bacillus alone
Chanway and
Holl (1991)
Bacillus amyloliquefaciens (MB3),
Pseudomonas sp. (BBc1), Pseudomonas
fluorescens (BBc6), Pseudomonas sp.
(SBc5) and Bacillus sp. (SHB1)
Laccaria laccata isolate S-
238
Pseudotsuga menziesii Nursery Increased the percent of ECM short roots as inoculated
with the most efficient bacteria compared to the control
with no bacteria; this stimulation caused by inoculation
doses as low as 106 living cell per square metre
Duponnois and
Garbaye
(1991a)
Arthrobacter sp., Pseudomonas fluorescens,
Bacillius subtilis, and Frankia
Laccaria laccata (S-238);
Rhizopogon vinicolor
(7534)
Pinus sylvestris Growth
chamber
Significantly decreased the number of ECM roots by P.
fluorescens and B. subtilis in Pine seedlings inoculated
with Laccaria laccata; a stimulating effect by
Arthrobacter sp. on the number of ECM roots as
inoculated with both L. laccata and R. vinicolor
Roczycki et al.
(1994)
Pseudomonas fluorescens Bbc6, Bacillus
subtilis MB3, and seven Western Australian
bacteria isolates from Laccaria fraterna
sporocarps or ectomycorrhizas (Elf* and
Slf*)
Laccaria bicolor (S238),
Laccaria fraterna (E710),
Laccaria laccata (E766),
Laccaria masonii (E4998)
Eucalyptus
diversicolor
Glasshouse Increased ECM formation by L. fraterna (E710) up to
296% as inoculated with P. fluorescens Bbc6 or B.
subtilis MB3 or B. sp. Elf28 or a pseudomonad Elf29;
ECM development inhibition by L. laccata (E766) when
inoculated with P. fluorescens (Bbc6); increased the
mean shoot dry weight up to 49% compared to controls
as inoculated with Elf21.
Dunstan et al.
(1998)
21
Pseudomonas fluorescens strain BBc6R8 Laccaria bicolor strain
S238N
Pseudotsuga menziesii Nursery Significantly increased the percentage of ECM short roots
when inoculated with either low or high amounts of L.
bicolor; significantly increased the height of Pseudotsuga
menziesii by the lowest bacterial dose, 10-2 cfu g-1 (from
40.7 to 42.6 cm) after 2 years of inoculation; increased
the ECM colonization in the lowest bacterial dose more
than in highest bacterial dose
Frey-Krey et al.
(1999)
Pseudomonas fluorescens BBc6R8 Laccaria bicolor S238N Pseudotsuga menziesii Laboratory and
Glasshouse
The effect of P. fluorescens BBc6R8 on L. bicolor
biomass varied depending on the condition of the fungus,
with a significant stimulation in autoclaved soil compared
to a significant inhibition in the irradiated soil
Brule et al.
(2001)
Bacteria isolated from Pinus sylvestris-
Lactarius rufus mycorrhizas
Lactarius rufus Pinus sylvestris Laboratory Significantly increased the first order, second order and
ECM rates by two Paenibacillus isolates after 8 weeks;
no effect on numbers of first order ECM lateral roots, but
increased formation of secondary ECM lateral roots by
two Burkholderia isolates, and a Rhodococcus sp.; the
Burkholderia, but not the Paenibacillus or Rhodococcus
isolates preferentially associated with ECM roots
Poole et al.
(2001)
Fluorescent pseudomonad strains Pisolithus sp. strain IR 100 Acacia holosericea Laboratory Promotion of the symbiosis establishment of Pisolithus
sp. strain IR 100 with Acacia holosericea by 14 bacterial
strains isolated from the mycorrhizosphere soil, 3 strains
from roots and 4 from galls; shoot biomass of A.
holosericea seedlings stimulated by 8 bacterial isolates
from soil, 6 from galls and 7 from roots.
Founoune et al.
(2002b)
22
Fluorescent pseudomonad strains (HR13 and
HR26)
Pisolithus alba Acacia holosericea Laboratory and
potted plant
experiment
outdoors
Significant enhancement of the positive effect of P. alba
on the height and shoot biomass of Acacia holosericea
seedlings when inoculated with HR26 together with the
fungus; the same effect recorded with HR13 on shoot
biomass; significantly increased a number and biomass
of nodules as co-inoculated with HR13 and the fungus;
significantly increased ergosterol content by the addition
of HR13 compared to the treatment P. alba COI007 alone
Founoune et al.
(2002a)
Bacterial isolates from Suillus luteus ECMs Suillus luteus Pinus sylvestris Laboratory A stimulating effect on the growth of S. luteus by most
Bacillus isolates but inhibitory effect on root colonization
by the fungus when inoculated with isolates of
Pseudomonas and Serratia; an inhibitory effect on ECM
formation by Burkholderia and Serratia (97 versus 41%
respectively); increased the formation of first order ECM
roots by a single Bacillus isolate.
Bending et al.
(2002)
Pseudomonas monteilii strain HR13 Pisolithus sp. SL2, P. alba
IR100, P. alba COI007, P.
alba COI024, P. alba
COI032, P. tinctorius,
Scleroderma dictyosporum
pat. IR 109, S. verrucosum
IR500, one
endomycorrhizal fungus
Glomus intraradices
Acacia auriculiformis,
A. eriopoda, A.
holosericea, A.
mangium, and A.
platycarpa
Laboratory and
Glasshouse
Significantly increased ECM colonization of 48.5% to
70.3% for all Acacia species when inoculated with HR13;
ECM establishment induced by a stimulating effect of
HR13 recorded with all fungal isolates of Pisolithus and
Scleroderma; stimulating effect of bacteria on AMF
colonization of A. holosericea seedlings by G.
intraradices, no significant MHB effect on fungal growth
by Scleroderma but Pisoplithus under axenic conditions
Duponnois and
Plenchette
(2003)
23
Fluorescent pseudomonads Pisolithus albus Acacia mangium Glasshouse Occurrence of fluorescent Peudomonads in sporocarps of
P. albus, increased number of nodules, growth and dry
mass of Acacia mangium when inoculated by dry
sporocarp powder, increased the growth of P. albus by
volatile compounds from some Pseudomonad isolates
Robin and
Didier (2004)
Streptomyces nov. sp. 505 (AcH 505) and
Streptomyces anulatus 1003 (AcH 1003)
Amanita muscaria Picea abies Laboratory ECM formation enhanced with AcH 505 and AcH 1003. Schrey et al.
(2005)
Pseudomonas putida and Bacillus cereus Amanita
rubescens or Hebeloma sinapizans
Pinus sylvestris Laboratory The number of pine seedlings colonized by A. rubescens
was higher than by H. sinapizans when inoculated with
bacteria; root, shoot length and biomass were stimulated
by dual inoculation with the ECM and bacteria; growth
increase of pine seedlings was higher when co-inoculated
with the ECM and P. putida.
Kozdroj et al.
(2007)
Pseudomonas Scleroderma
citrinum, Amanita
muscaria, and Lactarius
rufus
Pinus sylvestris Laboratory Co-inoculation of pine roots with both the ECM and
bacteria resulted in higher accumulation of metals,
especially Zn (II) in the roots compared to the inoculation
with ECM alone.
Krupa and
Kozdroj (2007)
Ralstonia sp. and Bacillus subtilis Suillus granulatus Pinus thunbergii Laboratory and
growth chamber
Growth promotion of S. granulatus by Ralstonia sp.
recorded; S. granulatus-P. thunbergii symbiosis
significantly stimulated by Ralstonia sp. and B. subtilis
Kataoka and
Futai (2009)
Bacillus cereus HB12 or HB59 Boletus edulis Pinus thunbergii Glasshouse Inoculation with Bacillus cereus increased ECM
colonization; co-inoculation with MHB and ECM
increased the growth of P. thunbergii; co-inoculation the
MHB and the ECM increased the utilization of P and K.
Xio-Qin et al.
(2012)
24
2.4.2 Types of ECM mats
Fungal mats are divided into two groups: hydrophobic and hydrophilic based on their
wetting characteristics. Unestam (1991) showed that most ECM fungi collected from
forests were hydrophobic while there were two ECM species, Cenococcum geophylum and
Thelephora terrestris, that were strongly hydrophilic. The hydrophobic mycelium seems
only to be responsible for the property of water repellency as soil and plant debris adjacent
to mycelia were not affected, and remained hydrophilic (Unestam 1991). This author also
showed that mat formation was confirmed between hydrophobic ECM fungi with alder
litter leaves in a laboratory rhizoscope, however, it could not be formed when leaves
covered by water or fresh leaves were used. Furthermore, no mats formed in vitro with the
hydrophylic T. terrestris. Unestam and Sun (1995) characterized and compared the
structure of hydrophobic and hydrophilic ECM fungi both in the rhizoscope and in vitro.
The mycelia of hydrophobic mat-forming ECM fungi of Suillus bovinus, Rhizopogon
luteolus and R. vinicolor were characterized in comparison to 4 hydrophylic ECM fungi,
namely, Cenococum geophilum, Hebeloma crustuliniforme, Laccaria laccata and
Thelephora terrestris. The hydrophobic fungi formed linear structures, rhizomorph-like
cords in both the rhizoscope and in vitro while the hydrophilic fungi did not. Instead of
forming ECM cords, the hydrophilic fungi formed a sparse network of hyphae on agar or
other surfaces in vitro. Spherical water drops were formed on hydrophobic hyphae both in
the rhizoscope and in vitro, and they had a tendency to form a string of beads while water
drops were only sometimes seen on hydrophilic hyphae without any tendency to form
water bead strings.
More recently, a method of measuring angle contact, supposed to be effective for
measuring surface hydrophobicity of ECM mats, has been reported and used (Chau et al.
2009; Smits et al. 2003). According to this method, fungal cultures were grown on agar
25
slice media, water drops were placed on fungal mycelia and then contact angles of water
drops were measured using a microscope and digital camera setup. Imaging software was
used to determine contact angles. Smits et al. (2003) measured hydrophobic and
hydrophilic fungi using contact angle measurements. The contact angles ranged from < 30o
for hydrophilic fungi such as Fusarium oxysporum Fo47 GUS1 and Trichoderma
harzianum P1[pZEGA] to > 60o for hydrophobic species of Cladosporium sp. DSE48.1b,
Paxillus involutus WSL 37.7, Hebeloma crustiliniforme WSL 6.2, Suillus bovinus WSL
48.1 and Laccaria bicolor WSL 73.1.
2.4.3 Function of ECM fungal mats
Fungal mats are thought to have an important function in nutrient cycling in forests.
Cromack Jr et al. (1988) showed that microbial biomass in mat soil was greater than in
non-mat soil for fungal mats formed by ECM of Hysterangium setchellii and Pseudotsuga
menziesii in Oregon, USA. The concentration of soil C and N was also more abundant
within mat-colonized soil. In soil fauna, there was more abundance of mites, Collembola
and nematodes in mat-colonized soil than non-mat soil, and Protozoan groups such as
amoebae and ciliates were more abundant in mat than not-mat soils. Moreover, there was
greater soil respiration and enzyme activity rate in mat than non-mat soil. Entry et al.
(1991a) researched fungal mats formed by the same ECM fungus and host tree as Cromack
Jr et al. (1988), and showed that both microbial biomass and cellulose degradation rates
were 3-6 times higher within mat soils than non-mat soils. There were also higher lignin
degradation rates in mat-colonized soils than adjacent non-mat soils. In ECM mats formed
by the H. setchellii-P. menziesii association, microbial biomass and needle decomposition
were 4 and 1.1 times higher, respectively, in mat soils than in non-mat soils (Entry et al.
1991a). After one year of decomposition, the release of K and Mg were higher in mat soils
than in non-mat soils. There were also twice as much N and P released in mat soils than
26
non-mat soils. There were higher concentrations of NO3, Fe, Cu and B and lower
concentration of Ca and Mn in mat than in non-mat soils, however, there was no
significant difference in the concentrations of NH4, P, K, Mg and Zn between mat soil and
non-mat soils.
When investigating how ECM mat-forming fungi affect N in soils of different-age in P.
menziesii forests, Aguilera (1993) showed that the concentration of labile N was higher in
mat soils than in non-mat soils of all age classes, and especially significantly higher only
in old stands. Griffiths et al. (1994) characterized some chemical properties of ECM mats
formed by H. setchellii and Gautieria monticola on roots of P. menziesii. The findings
showed significantly higher average concentrations of dissolved organic carbon, oxalate,
PO4, SO4, H, Al, Fe, Cu, Mn and Zn in mat soil than in non-mat soil solutions in both mat
types, at sampling locations and on both sampling dates.
2.5 Soil microbial biomass
Soil microbial biomass (SMB) is defined as the living components of soil organic matter,
excluding plant roots and soil animals larger than 5 x 103 µm
3 (Jenkinson et al. 1981).
Although SMB only accounts for from 1 to 4% of total organic matter in soil (Brookes
2001), it has a variety of important functions in the soil environment. The SMB is
responsible for supplying soil with plant-available nutrients, e.g. N, P and S, by regulating
the decomposition of organic matter (Brookes 2001; Gonzalez-Quiñones et al. 2011).
Also, soil microorganisms form symbiotic associations with plant roots, work as biocontrol
agents against phytopathogens, degrade pesticides, and improve soil aggregation and
formation (Dalal 1998). The SMB therefore, have been considered as “the eye of the
needle through which all nutrients must pass” (Jenkinson 1977) and an indicator of soil
quality (Dalal 1998). Generally, while an increase in SMB is a positive indicator for soil
fertility, a decrease in this parameter can be detrimental if this causes a decline in soil
27
biological function (Gonzalez-Quiñones et al. 2011). Because SMB is of functional
importance, measuring techniques of this parameter have been drawing research interest.
2.5.1 Techniques for measuring soil microbial biomass
There are a variety of techniques which have been used to assess soil microbial biomass.
The main methods (Gonzalez-Quiñones et al. 2011) are presented in Table 2.3.
Table 2.3. Methods for measuring soil microbial biomass
Method Comments Reference
Plate counting Only assesses culturable microorganisms Waksman (1927)
Chloroform
fumigation
incubation (CFI)
An increase in the release of CO2 and NH4+ from
fumigated soil by chloroform is used to estimate
the size of SMB
Jenkinson and
Powlson (1976)
Chloroform
fumigation
extraction (CFE)
Microbial constitutes of fumigated samples are
extracted to estimate SMB.
Vance et al. (1987)
Substrate induced
respiration (SIR)
Respiration response of microorganisms is
determined using added substrates.
Anderson and
Domsch (1978)
Adenosine
triphosphate (ATP)
analysis
There is a consistent relationship between ATP
and SMB, and adenosine 5’- triphosphate (ATP)
is analyzed
Jenkinson and
Oades (1979)
Phospholipid fatty
acids (PLFA)
Total amount of phospholipid fatty acids (PLFA)
is used to estimate SMB because there was a
correlation between total amount of PLFA and
SMB determined by different methods
White et al. (1979)
Microwave
irradiation (MW)
Microwave energy is used to disrupt microbial
cells instead of chloroform as used in CFE. Net
flushes of C from microwaved samples are found
to correlate to SMB determined by CFI.
Islam and Weil
(1998)
Infrared reflectance
(IR)
Light reflectance of organic materials is used to
determine a range of soil biochemical properties
including SMB
Ludwig et al.
(2002); Zornoza et
al. (2008)
28
Each of the above techniques has its advantages, disadvantages and limitations. Because
plate counting can only assess organisms which account for only less than 5% of the total
soil microbial community, it is no longer widely used (Gonzalez-Quiñones et al. 2011).
The CFI is a basic method that has been used to develop other methods, however, it has
some limitations. For example, it is not suitable for acid soils and soils containing easily
degradable C sources (Martens 1995). The SIR and ATP analyses require expensive
equipment, and SIR may also be not suitable for amended C sources (Martens 1995).
Although the kEC factor for calculating SMB is still debated, CFE is the most commonly
used method for Australian soil research (Gonzalez-Quiñones et al. 2011). Sparling et al.
(1993) showed that CFE was suitable for estimating microbial biomass C and N in soils
from Western Australia because proper conversion factors were gained when compared to
other methods. Descriptions of current methods for the estimation of SMB in soil have
been reviewed in detail in the literature (Brookes 2001; Gonzalez-Quiñones et al. 2011;
Jenkinson 1988; Martens 1995). The CFE method which extracts ninhydrin-reactive N is
discussed further below because it was used in Chapter 3.
2.5.2 Measuring soil microbial biomass by extracting ninhydrin-reactive compounds
A sensitive assay for the estimation of SMB of CFE method is to measure ninhydrin-
reactive compounds (NRC) released in extracts in 2 M KCl of fumigated soils (Amato and
Ladd 1988b). These authors showed that there was an accumulation of NRC when
fumigating soils with chloroform and that accumulated NRC after 10 days of fumigation
could be used to estimate SMB. By calibrating against biomass C and biomass N,
estimated by the CFI method, they proposed relationships: microbial biomass C = 21 x
amount of ninhydrin-reactive N released and microbial biomass N = 3.1 x amount of NRC
released. Joergensen and Brookers (1990) developed and described a modified procedure
to measure NRC in 0.5 M K2SO4 instead of 2 M KCl as Amato (1988a) previously used.
29
This new procedure obtained a strong relationship (r = 0.99) between NRC extracted in 2
M KCl and 0.5 M K2SO4 extractants. There was also a strong linear correlation (r = 0.91 –
0.95) between microbial biomass C, microbial biomass N and microbial biomass NRC
which were extracted by 0.5 M K2SO4. Carter (1991) used two methods, CFI and CFE, to
estimate and compare SMB of 37 soil samples collected from three tillage systems and
pastures in Atlantic Canada. The results showed that NRC extracted by CFE was
correlated with both biomass C (r = 0.88) and the mineral N flush (r = 0.92) measured by
CFI. Sparling et al. (1993) investigated the release of NRC in soils in Western Australia
and New South Wales. They considered that measuring NRC was a useful and reliable
technique for estimating soil microbial biomass C and N in these soils. Mele and Carter
(1996) showed that using liquid chloroform to fumigate three Australian duplex soils
appeared to be a good technique for estimating SMB. This was because using liquid
chloroform allowed faster release of ninhydrin-reactive N. Can and Nonaka (2002)
investigated the relationships between biomass N and NPC after different fumigation
duration in Japanese Andosol soils. The results showed that the NPC accumulated after
240 h of CHCl3 fumigation was 1.9 times higher than that obtained after 24 h. They
proposed the relationships: Biomass N = 4.31 x NPC released (for 24 h of fumigation) and
Biomass N = 2.01 x NPC released (for 240 h of fumigation).
Joergensen (1996) used the CFE method to investigate the relationship between microbial
biomass C and ninhydrin-reactive N biomass in 110 soils. The results showed that the
content of NRC released was significantly correlated with biomass C extracted by the
same method (r = 0.94). However, as the NRC assay was applied to measure SMB in acid
soils (pH range from 4 to 6), the NRC extracted by CFE was much higher than the
microbial biomass C obtained from the CFI method, and the difference in the two assay
methods increased with soil acidity (Amato and Ladd 1994). Moreover, based on pH of
30
soils, Joergensen (1996) also proposed different factors for two groups of tested soils: soil
pH > 5: biomass C = 22 x ninhydrin-reactive N released and soil pH ≤ 5: biomass C = 35.3
x ninhydrin-reactive N released. As mentioned earlier, the Ninhydrin-reactive N method
was more suitable to estimate microbial biomass C and N in soils in Western Australia
than the CFI and SIR methods (Sparling and Zhu 1993).
2.6 Soil microbial community
Soils are complex and very heterogeneous. Their biological composition includes 10
billion or more of bacterial cells per gram of soil, a large number of other microorganisms
such as fungi and protozoa, and macroorganisms such as nematodes and mites (Bloem et
al. 2006). Many of them, such as PGPR, MHB and mycorrhizal fungi, are not only
beneficial for plant health but also essential for improving soil quality (Jeffries et al. 2003;
Johri et al. 2003). Therefore, answers to questions such as what microbial populations are
there, what is the relative abundance of different populations, what are the functions of
different populations, are they dormant or active, how strong is their activity, and how
dynamic are different populations with time or upon human impact, are needed for a better
understanding of the soil microbial community (Van Elsas and Rutgers 2006).
2.6.1 Methods for assessing soil microbial community
Traditional methods, based on a culturable approach, can make a limited contribution to
understanding the soil microbial community because only an estimated 1% of soil bacteria
are culturable by current methods (Leckie 2005a). Therefore, culture-dependent methods
are not widely used. Recent advances in research have brought about a number of effective
methods for assessing the soil microbial community (Leckie 2005b; Van Elsas and Rutgers
2006). Principal methods are presented in Table 2.4.
31
Table 2.4. Summary of common methods for assessing the soil microbial community
Type Method Description References
Phenotypic CLPP Community-level physiological
profiling
Garland and Mills
(1991)
Biochemical FAME Fatty acid methyl ester Buyer and
Drinkwater (1997);
Zelles (1999)
PLFA Phospholipid fatty acid analysis Frostegard et al.
(1993); Zelles
(1999)
Molecular or
genetic
Cloning/sequencing of
amplified 16S rRNA
genes
Sequence analysis of clone library,
resulting in overview of abundant
clone types
Akkermans (1995);
Kowalchuk (2004)
16S rDNA-based PCR
and fingerprintings
(DGGE/TGGE, SSCP,
ARDRA, and T-
RFLP)
PCR may be followed by any one
of the fingerprinting methods to
determine the diversity of the
community on the basis of the 16S
rRNA-based phylogenetic marker
Akkermans et al.
(1995); Kowalchuk
(2004); Van Elsas
et al. (2000)
Dot blot hybridization
of 16S rRNA genes
Hybridization using short 16S
rRNA gene-based fragments as
probes; probes generated from V6
region are highly specific per strain
Heuer et al. (1999)
Base composition
profiles
Mole percent guanine + cytosine
(% G + C)
Nüsslein and Tiedje
(1998); Torsvik et
al. (1990)
Direct PCR detection PCR amplification of target gene
followed by detection on gel, or
after hybridization
Van Elsas et al.
(1997)
FISH Fluorescent in situ hybridization of
16S rRNA
Akkermans et al.
(1995); Amann et
al. (1995)
DNA reassociation ‘C0t curves’: reassociation time is a
measure for the genetic diversity in
a sample
Torsvik et al.
(1990)
Source: (Van Elsas and Rutgers 2006)
32
In principle, analysis of the soil microbial community either involves the extraction of
marker compounds from microorganisms or the use of sole carbon sources in the Biolog
EcoPlate. Useful marker compounds should have specified features: e.g. they are present
in a relatively stable amount in a group of microorganism, are variable across different
groups, and degrade quickly after death of microorganisms (Leckie 2005a). Two marker
compounds, which meet the above requirements and are commonly used, are
deoxyribonucleic acid (DNA) and phospholipid fatty acids (PLFA). For community-level
physiological profiling, 96 well microplates containing 31 sole carbon sources and a
control without a carbon source, developed by Biolog Inc., are used to incubate soil
solutions. Each well of a plate contains the dye tetrazolium violet which develops a purple
colour under respiratory activity of soil microorganisms. Colour development over time is
measured using a spectrophotometer. Colour development intensity and a number of
colour development wells are used to compare microbial community activity and diversity
between soil samples.
A number of methods have been used to profile the microbial community in soils under
eucalypts. Silveira et al. (2006) reported that the microbial diversity from eucalypt nursery
soils in Brazil was higher than from tropical broadleaf semideciduous forest soils,
determined by 16S rDNA sequencing analysis. Cao et al. (2010) investigated soil
microbial composition in 3, 7, 10 and 13 year old Eucalyptus urophylla plantations in
subtropical China using phospholipid fatty acids (PLFA) analysis. They showed that the
number and abundance of PLFA and the amount of soil total N and soil organic C in 13
year old plantations were higher than in the younger plantations. They further concluded
that soil properties were not negatively affected by planting eucalypts. More recently, Wu
et al. (2011) used PLFA analysis to assess effects of understory removal and tree girdling
on soil microbial community in two eucalypt plantations in subtropical China. The results
33
showed that removing Eucalyptus understory shrubs significantly decreased the amount of
fungal PLFA and litter decomposition, did not affect the amount of bacterial PLFA and
total PLFA, and that there was no effect of tree girdling on the amount of soil microbial
community PLFA. They concluded that understory vegetation in eucalypt plantations
played an important role in maintaining the soil microbial community and litter
composition.
2.7 Concluding remarks
This chapter has emphasized the research on mechanisms of action and applications of
PGPR and MHB in the forestry sector. Information on ECM fungal mats, including
abundance, type and function of fungal mats, was also considered. The main reviews
dealing with soil microbial biomass and microbial communities were noted, and methods
for measuring soil microbial biomass and community were assessed. This background
information will be employed as a base for the research and methodology used in Chapters
3 and 4.
34
CHAPTER 3
HYSTERANGIUM – EUCALYPTUS GOMPHOCEPHALA MATS AND
ASSOCIATED MICROORGANISMS
3.1 Introduction
This chapter explores soil properties and beneficial microorganisms in relation to ECM
mats under Eucalyptus gomphocephala in south-western Australia. ECM fungi are well
known to form symbiotic associations with a wide range of eucalypt species (Brundrett
and Cairney 2004) and fungal mats are commonly observed under the litter in eucalypt
forests in Australia (Caldwell et al. 1991). In a recent observation, ECM mats were more
frequently observed in a healthy than in a declining E. gomphocephala woodland in
Yalgorup National Park, Western Australia (Dell et al. 2006). This is an interesting
observation worth considering further. There is a great diversity of epigeous and
hypogeous ECM fungi associated with eucalypts in natural habitats (Castellano and
Bougher 1994; Claridge et al. 2000) and many taxa are yet to be described. Although some
research on ECM formation in eucalypts in Western Australia (Dell et al. 1990; Glen et al.
2002; Malajczuk 1982; Malajczuk et al. 1987; Malajczuk et al. 1984) has been conducted,
there are no publications on the characterization and identification of the ECM fungi
forming dense mats in Yalgorup National Park. Therefore, in a part of this chapter,
characterization and identification of a common mat-forming ECM fungus was
undertaken.
What roles these ECM fungal mats play in tree and ecosystem health is still being
discovered. Research conducted mostly in the United States of America and northern
Europe provides an insight into the specialist environment of these mats. For example,
Kluber et al. (2010) surveyed ECM mats and non-mat soils from 8 forest stands of
35
Pseudotsuga menziesii in Western Oregon, USA and measured a variety of soil chemical
and biochemical properties. Their data showed that ECM mats created unique soil
microenvironments with distinct microbial activity compared to non-mat soils. Griffiths et
al. (1994) studied fungal mats formed between P. menziesii and two fungi, Hysterangium
setchellii and Gautieria monticola. They reported that the fungal mats altered soil chemical
properties and that concentrations of dissolved organic carbon, oxalate, PO4, SO4, H, Al,
Cu, Mn and Zn were significantly higher in the mat soil than in non-mat soil solutions in
both types of mats. This is of great interest as soil physicochemical and microbial
community properties may be closely related to the health of forests (Cai et al. 2010;
Schoenholtz et al. 2000). Hence, chemical and other properties of mat and non-mat soils
associated with E. gomphocephala were also explored in this chapter.
Furthermore, ECM fungal mats may provide a microenvironment for beneficial soil
bacteria. Bertaux et al. (2005a) reported on the occurrence and distribution of
endobacteria, both in dead and living cells of Laccaria bicolor S238N. More recently,
Kluber et al. (2011) examined the structure of fungal mats formed between Piloderma sp.
and Pseudotsuga menziesii and reported distinctive microbial communities associated with
the fungal mats. However, the role of bacteria associated with ECM mats remains to be
clarified. Therefore, bacteria were isolated from fungal mats of E. gomphocephala and
screened for some specific properties.
This chapter addressed the following specific objectives:
1) to describe the composition of common Hysterangium-like ECM mats and
structure of ECMs under tuart,
2) to describe the soil physicochemical and microbial properties of Hysterangium
mats associated with Eucalyptus gomphocephala in Yalgorup National Park, and
36
3) to isolate bacteria associated with ECM mats of E. gomphocephala forest and
characterize their ability to produce indole-3-acetic acid (IAA), solubilize phosphate, and
use 1-aminocyclopropane-1-carboxylic acid (ACC) as the sole carbon source.
The following hypotheses were examined:
The fungus which forms common gray mats under tuart belongs to the genus
Hysterangium,
ECM mats enhance soil moisture and nutrient levels compared to non-mat soils,
There is greater microbial biomass, diversity and activity in mat than in non-mat
soils, and
There exist potential PGPR in E. gomphocephala rhizosphere.
3.2 Materials and methods
3.2.1 Site selection
A typical patch of healthy E. gomphocephala woodland, without canopy decline, was
selected for this study in Yalgorup National Park (Fig. 3.1). The region has a
mediterranean-type climate. Details of rainfall and temperature for the period 2002 to
2011, for the nearest weather station (Mandurah station 9977), are presented below (Figs.
3.2, 3.3).
Fig. 3.1. Map showing the location of the study site in Yalgorup National Park
37
The mean maximum temperature was highest between November and mid March, and
ranged from 25 to 30oC, while the lowest monthly mean minimum temperature occurred
between June and September, around 10 to 12o C.
Fig 3.2 Mean monthly maximum and minimum temperatures for Mandurah (2002 – 2011)
(http://www.bom.gov.au/)
The rainfall graph shows a distinct wet season, June to August, and a long dry season,
December to March when rainfall averages <20 mm per month. Total mean annual rainfall
between 2002 and 2011 was 660.8 mm. Total annual evaporation exceeded the
precipitation by around 1000 mm.
Fig 3.3 Mean monthly rainfall for Mandurah (2002 – 2011) (http://www.bom.gov.au/)
0
5
10
15
20
25
30
35
Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec
Tem
pe
ratu
re (
o C
)
Month
Mean Maximum Temperature Mean Minimum Temperature
0
20
40
60
80
100
120
140
Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec
Pre
cip
itat
ion
To
tal (
mm
)
Month
38
3.2.2 Soil and mat sampling
Soil and mat sampling was undertaken in September 2010 for soil chemical analysis and
PGPR assays and in September 2011 for ECM histology, measuring microbial biomass,
and analyzing the soil microbial community.
Soil and mat samples were collected from under 4 randomly selected E. gomphocephala
trees: tree 1 (37o01’97
’’E, 63
o85’99.6’’ N), tree 2 (37
o01’96
’’E, 63
o85’99.7’’ N), tree 3
(37o01’76
’’E, 63
o85’97.4’’ N), and tree 4 (37
o02’05
’’E, 63
o85’97.5’’ N). At each tree, 2
fungal mat samples and 2 samples in adjacent non-mat soils were collected. To locate
fungal mats, the litter horizon was removed exposing the mat or soil surface. Mats that
were uniformly grey in colour were selected at random. This was the most common mat
type present at the site. The sampling depth was 1 - 4 cm. The samples, approximately 2
kg each, were taken using a hand trowel, labeled, placed in plastic bags, transferred into an
ice-box, and transported the same day to a laboratory cold room and stored at 4o C.
3.2.3 Characterization of physiochemical and microbial properties
Soil moisture
Soil moisture was measured by the gravimetric method (Deangenis 2007). Samples were
dried for 24 hours at 105oC using aluminum tins and weights were taken before and after
drying.
Soil chemical analysis
Soil samples of 0.5 kg were used for chemical analysis on the same day that soils were
sampled. Soil samples were combined for each tree to become one mat soil and one non-
mat soil per tree giving a total of eight soil samples. They were air-dried for 15 days,
39
sieved through a 2 mm mesh sieve, and 200 g subsamples were used for soil analysis
(CSBP Limited, Bibra Lake, Western Australia). Methods are given in Table 3.1.
Table 3.1. Methods used for soil chemical analysis by CSBP Limited, Bibra Lake,
Western Australia
Soil parameter Method
Sulphur (mg/kg)
Plant available S in soils was determined by extraction with a
0.25 M KCl solution for 3 hours at 40 C. The S content of
extracts was analyzed by Inductively Coupled Plasma (ICP)
Spectrometry. This method is known as the KCI-40 or
Blair/Lefroy Extractable S method (Blair et al. 1991).
Nitrate and ammonium
(mg/kg)
Soil NO3-N and NH4-N were extracted with a 1 M KCl
solution for 1 hour at 25 C. After dilution the resulting soil
solution was measured on a Lachat Flow Injection Analyzer.
NH4-N was measured colorimetrically at 420 nm using the
indo-phenol blue reaction. NO3-N was reduced to NO2
through a copperized-cadmium column and the NO2 was
measured colorimetrically at 520 nm (Searle 1984).
Organic carbon (%) In the Walkley Black (1934) method concentrated H2SO4 was
added to soil wetted with dichromate solution. The chromic
ions produced were proportional to oxidized organic C and
were measured colorimetrically at 600 nm on a Multiscan.
Unlike the method for total organic C where external heat is
applied, the heat of the acid-based reaction is used to induce
oxidation of soil organic matter (Walkley and Black 1934).
pH and Conductivity
(dS/M)
Using a soil to solution ratio of 1:5, soils were extracted in
deionised water for 1 hour. The water pH and electrical
conductivity of the extract were measured using a
combination pH electrode. After the water pH and EC had
been measured, CaCl2 solution was added to the soil solution
to the equivalent of 0.1 M and after thorough mixing the
CaCl2 pH was also measured (Rayment and Higginson 1992).
Colwell phosphorus and
potassium (mg/kg)
Plant available P and K were measured using the Colwell
method. Using a soil to solution ratio of 1:100, soils were
extracted with 0.5 M NaHCO3 solution adjusted to pH 8.5 for
40
16 hours. The acidified extract was treated with
(NH4)2MoO4/SbCl3 reagent and P measured colorimetrically
at 880 nm. The K in the extract was determined using a flame
atomic absorption spectrophotometer at 766.5 nm (Colwell
1965; Rayment and Higginson 1992).
Cu, Fe, Mn, Zn (mg/kg) Soils were extracted with diethylene-triamine-penta-acetic
acid (DTPA) solution, which has a high affinity for metal
ions at a ratio of 1:2, for 2 hours and the concentration of Cu,
Zn, Mn, and Fe measured by Atomic Absorption
Spectroscopy. This is the most common method for
determining plant available trace elements (Rayment and
Higginson 1992).
Exchangable cations (Al,
Ca, Mg, K, Na)
(meq/100g)
Soils were extracted with 0.1 M NH4Cl/0.1 M BaCl2 at a ratio
of 1:10 for 2 hours. Exchangeable cation concentrations of
the resulting extracts were determined by ICP Spectroscopy
(Rayment and Higginson 1992).
B (mg/kg) Soils were extracted in a ratio of 1:4 with 0.01 M CaCl2,
heated to 90 oC for 15 minutes. The B content of the resulting
extract was read by ICP Spectroscopy (Rayment and
Higginson 1992).
Bacterial colony counting
A serial dilution method was used to determine the number of bacterial colonies. Bacterial
colony counting was conducted the next day after soil samples were taken from the field.
The mat soil sample was obtained by gently shaking the mat, over a 2 mm sieve. One gram
of representative fresh soil from each of the 16 samples was placed into a 30 ml sterile
capped container containing 9 ml of 0.9% (w/v) NaCl. The soil solution was shaken for 10
minutes and then 10-1
to 10-5
serial dilutions were made. A 100 µl aliquot of each of the 5
diluted solutions was spread out on nutrient agar (NA) plates. The plates were then sealed
with parafilm and incubated at 28oC for 48 hours before observing bacterial colonies. The
number of colonies (generally 30 to 300 colonies on each plate) was counted in the
appropriate dilution. By working backwards using multiplication with the dilution factor,
41
the number of bacteria in the original soil solution was determined. Three replicate plates
were set up for each soil sample at all dilution concentrations.
Soil microbial biomass
Microbial biomass C was measured using the ninhydrin method developed by Amato and
Ladd (1988a), and modified by Grierson et al. (1998). Two sets of 5 g fresh soils which
were collected one day previously were sieved with a 2 mm sieve and prepared into 50 ml
centrifuge tubes. One set was treated by exposure to chloroform, and the other was not.
For the first set, 20 ml of 2 M KCl was added in the prepared soil tubes and then shaken in
an end-over-and shaker for 1 hour. The solution was centrifuged at 7000 rpm for 10
minutes and supernatants were extracted into 30 ml sterile plastic containers. Two ml of
the 2 M KCl extract was placed into a 15 ml glass test tube, 2 ml of ninhydrin reagent was
added to the extract and heated for 15 minutes in a boiling water bath. The tubes were
removed and allowed to cool down for 10 minutes. After that, 5 ml of collidine solvent
(Appendix 3.1) was added to the tubes which were then shaken, and the absorbance was
read at 570 nm in a spectrophotometer (Hitachi U-1100).
For the second set, 2 ml of chloroform was added into the prepared centrifuge tubes, and
the tubes were covered with aluminium foil and fumigated for 36 hours in a laboratory
fume hood. After fumigation, chloroform was evaporated overnight in a fume hood. Then,
2 M KCl was used to extract ninhydrin-reactive N. The following steps were the same as
those which had been carried out in the first set of samples. Microbial ninhydrin-reactive N
was estimated from the difference between the fumigated and unfumigated soil samples.
Soil microbial community
Microbial community-level physiological profiles (CLPP) were explored using the Biolog
EcoPlate which contains 31 sole carbon sources (Appendix 3). Overall, 24 soil samples, 12
from mat and 12 from non-mat soils, were analyzed.
42
Soil solution for inoculation was prepared as follows. Soil samples were first sieved
through a 2 mm mesh sieve and thoroughly mixed. Then, 2 g fresh soil was placed into 50
ml sterile centrifuge tubes containing 20 ml of 0.85% (w/v) NaCl solution. This solution
was vortexed for 1 minute before shaking for 30 minutes on an end-to-end shaker. The
standardization of inoculation density was based on bacterial colony counting by serial
dilution in conjunction with aseptic spreading on NA plates. Dilutions of 10-1
,
approximately 106 CFU/ml, of each soil sample were used for the standardization of
inoculation density. After standardizing the dilution, 1.2 ml of the standardized extract of
each soil sample was added to a centrifuge tube containing 10.8 ml of 0.85% (w/v) NaCl
to make 12 ml of the final solution of 10-2
CFU. Then, 100 µl of each standardized extract
was put into each well of the Biolog EcoPlate.
The plates were incubated at 25 oC with moist paper towels in a plastic box, and the colour
development of each well was read by a microplate reader (BioRad Model 680)
immediately after inoculation and then every 24 hours for 7 days. Data were analyzed
(SPSS version 17) on the basis of parameters including average metabolic response
(AMR), community metabolic diversity (CMD), and similarity of mat and non-mat soil
samples by principal component analysis (PCA).
3.2.4 Characterization of fungal mat and mat-forming fungi
Fungal mat and ECM root structure description
Fungal mats were characterized both by direct inspection with naked eyes and using a
dissecting microscope (Zeiss Stemi SV 11). The mats were described in terms of
composition, colour, size and wetting.
ECM root structure was examined using the following histological procedure. Putative
ECMs from within mats were fixed in 3% gluteraldehyde in 0.025 M phosphate buffer (pH
43
7) overnight at 4 oC. The specimens were then washed in several changes of buffer and
dehydrated through 30%, 50%, 70% and 90% acetone before transferring to 100% acetone
at room temperature. Two changes of each solution concentration were carried out each 15
minutes. These specimens were infiltrated with 5%, 10%, 20%, 40% and 80% Spurr’s
resin in acetone, for at least 2 hours at room temperature before transferring to 100%
Spurr’s resin for 1-2 hours and subsequently 100% Spurr’s resin overnight. They were
then embedded at 60 oC for 24 hours.
Thin sections were cut using a glass knife to which a water bath had been attached. They
were then placed into a drop of water on a glass slide using a toothpick. The slide was
placed on a hot plate and dried at 60 oC. To dissolve the resin, a drop of saturated KOH in
ethanol was added. After 10-20 seconds, the slides were washed with a gentle stream of
water and reheated at 60 oC again. The sections were stained for 5 minutes with a mixture
of 1% azur II and 1% methylene blue in 1% sodium tetraborate (Richardson et al. 1960),
rinsed with water, allowed to dry and then mounted in immersion oil. Stained sections
were examined under a light microscope (Olympus BX 51) and digital images obtained
using a digital camera (Olympus DP70).
Fungal identification by DNA analysis
The ECM fungus MURU6276 from dense mats was identified by gene sequence analysis
of the ITS region. The mycelia were first isolated, from basidiomes collected within the
mats associated with E. gomphocephala onto MMN medium (Appendix 1). The 7 day old
fungal mycelia were used as a template for polymerase chain reaction (PCR). Primers of
ITS1F and ITS4 were used so that conserved regions could be amplified from any fungi.
The PCR products were purified and used as a template in cycle sequencing. The
sequencing procedure was carried out to determine the nucleotide sequence. Finally, the
sequence was compared to other known nucleotide sequences in the GenBank database
44
using a BLAST (Basic Local Alignment Search Tool) search for identification. Details are
as follows.
Isolates were grown on half-strength PDA plates for approximately 1 week at 20 oC, and
the mycelium was harvested, frozen in liquid nitrogen, ground to a fine powder and
genomic DNA extracted using a hexadecyl trimethyl ammonium bromide protocol
(Graham et al. 1994) modified by the addition of 100 g/ml Proteinase K and 100 g/ml
RNAse A to the extraction buffer (Andjic et al. 2007).
Partial amplification of the internal transcibed spacer 1, the 5.8S ribosomal RNA gene and
the complete internal transcribed spacer 2 (ITS1, 5.8S, ITS2) was achieved using the
primers ITS1F (5’ CTT GGT CAT TTA GAG GAA GTAA 3’) (Gardes and Bruns 1993)
and ITS4: 5’ GCT GCG TTC TTC ATC GAT GC 3’ (White et al. 1990).
The PCR reaction mixture (25 ml) contained 200 mM of each deoxynucleotide
triphosphate,150 nM of each primer, 10 mM Tris-HCl, 1.5 mM MgCl2, 50mM KCl, 5–10
ng of DNA template and 1Uof Taq polymerase (Fisher Biotech, Perth,WA). Cycling
conditions were as follows: initial denaturation at 96 oC for 2 min, followed by 10 cycles
of 30 s at 95 oC, 30 s at 54
oC, 1 minute at 72
oC and 25 cycles of 30 s at 95
oC, 30 s at 56
oC, 1 minute at 72
oC, with 5 s extension after each cycle. A final elongation step was
carried out for 7 minute at 72 oC. PCR amplicons were visualized under UV light on a 1 %
agarose gel.
The PCR products were cleaned using Sephadex G-50 columns (Sigma Aldrich, Sweden).
The columns were prepared as follows: 650 ml of Sephadex solution (3.33 g in 50 ml of
distilled water) were added to clean Centri-Sep columns (Princeton Separations, Freehold,
NJ). The columns were spun at 750 g for 2 minutes in a Microfuge18 bench centrifuge
(Beckman Coulter, Germany) and the filtrate was discarded. The PCR product was added
45
to the top of the column and was spun again at 750 g for 2 minutes. The filtrate was used
in the sequencing reaction (Sakalidis et al. 2011).
Products were sequenced with the Big- Dye terminator cycle sequencing kit according to
the manufacturer’s instructions (PE Applied Biosystems, California, USA) using the same
primers that were used in the initial amplification. The PCR conditions were: 25 cycles of
10 s at 96 oC; 4 s at 50
oC; 4 minutes at 60
oC. The sequencing products were also cleaned
in Sephadex G-50 columns and were separated by an ABI 3730 48 capillary sequencer
(Applied Biosystems, California, USA).
3.2.5 Characterization of bacteria
Indole acid acetic (IAA) production
A colorimetric method was used for determination of IAA production of bacterial isolates
in the presence or absence of L-tryptophan (L-TRP) (Khalid et al. 2004). Thirty nine
bacterial isolates were isolated from 8 mat and 8 non-mat soil samples. Twenty nine,
which could grow in nutrient broth (NB) and glucose peptone broth (GPB) (Appendix 1),
were used for IAA production assay. Each bacterial isolate was inoculated into 5 ml of NB
solution in a 30 ml sterile plastic tube before being incubated at 28 oC for 48 hours on a
rotary shaker which was run at 200 rpm. The culture solution was adjusted to an optical
density of 0.5 at 600 nm using a Hitachi V-1100 spectrophotometer. One ml of the OD
adjusted culture was placed into a 30 ml sterile tube containing 10 ml of GPB giving a
final volume of 11 ml. Following this, 1 ml of filter sterilized 0.2% L-TRP solution was
added taking the total volume to 12 ml. The bacterial cultures both in the presence and
absence of L-TRP were incubated at 28 oC for 48 hours on a rotary shaker at 200 rpm.
After incubation, 1.5 ml of this culture was placed in a 1.5 ml eppendorf tube and
centrifuged at 5000 g for 10 minutes to remove bacterial cells. One ml aliquot of the
46
supernatant was taken and placed into 10 ml sterile centrifuge tube before adding 4 ml of
Salkowski reagent (Appendix 1). The solution was mixed, covered by aluminum foil and
left for 30 minutes for colour development before measuring the absorbance at 535 nm
(Hitachi V-1100 Spectrophotometer). An IAA (Sigma-Aldrich) standard curve was set up
with a range of IAA concentrations from 0 to 30 µg/ml. Bacterial IAA production was
quantified by comparison of collected absorbance measurements based on the established
IAA standard curve.
Phosphate solubilization
Modified Pikovskaya medium (MPVK) (Appendix 1) containing hydroxylapatite,
Ca5HO13P3 (Sigma-Aldrich) was used to test the ability of isolates to solubilize phosphate.
The pH of the MPVK medium was adjusted to 7.0 before autoclaving. Pure bacterial
isolates were placed into 30 ml sterile tubes containing 5 ml of nutrient broth (NB)
medium, and incubated at 28 oC for 48 hours on a rotary shaker at 200 rpm before being
adjusted to an optical density of 0.5. After that, 20 µl of the adjusted culture were placed
on a MPVK agar plate which was then incubated at 28oC and monitored for 14 days. The
ability of isolates to solubilize phosphate was determined by measuring the zone of
clearance. The larger the halo zone produced by bacteria, the higher the P solubilization
efficiency. Each test was replicated 3 times.
ACC deaminase production
Bacterial isolates were tested for their ability to produce 1-aminocyclopropane-1-
carboxylic acid (ACC) deaminase which is able to reduce ACC, a precursor of ethylene, a
plant hormone. Isolates were checked for their ability to utilize ACC acid as a sole
nitrogen source. Isolates that produce ACC deaminase can survive and grow in the
medium with ACC acid as a sole N source. The DF salts agar plates (Appendix 1) were
47
prepared for the test, and these plates were spread with 300 µl of 0.5 M ACC acid solution
(Appendix 1) before inoculation. Isolates were subsequently streaked on the Petri dishes
and the dishes incubated at 28oC.
3.3 Results
3.3.1 Characterization of fungal mat
Fungal mat description
Fungal mats were frequently observed in E. gomphocephala woodland in Yalgorup
National Park (Fig. 3.4A). The composition of fungal mats included mat rhizomorphs,
ectomycorrhizas, non-mycorrhizal mostly lignified roots of E. gomphocephala, and litter
fragments. Mats appear to be long-lived structures of underground ecosystems. At the
survey time, September 2010, most of the mats were grey-white in colour, strongly
hydrophobic, ranging in size from a few cm2
up to one m2
or more in diameter, and mostly
in the 0-10 cm of the soil horizon. The fungal mats (Fig. 3.4A) were readily observed by
removing the 1-2 cm litter layer on the forest floor. In general, there was a dense network
of mats on the forest floor but the extent was not quantified.
Basidiomes of Hysterangium were observed within some fungal mats (Fig. 3.5A).
Ectomycorrhizas within mats were similar in shape and size to non-mycorrhizal short roots
but were covered in white mycelium (Fig. 3.4B). The mantle surface was thin tomentose
and were connected to multi-branched, white rhizomorphs. Mycorrhizas and woody host
roots, rhizomorphs, and litter were intimately linked together forming coherent fungal
mats.
48
Fig. 3.4. Fungal mat under E. gomphocephala in the field. (A) surface of mat after removal
of litter, (B) detail of fungal mat under a dissecting microscope
Hysterangium description
Truffle-like basidiomes - hypogeous, 5-20 mm in diameter, slightly lobed to sometimes
flattened, and clustered within some fungal mats (Fig. 3.5A). Peridium – thin. Gleba -
gelatinous and greenish to dark green in colour. Basidiospores - elongate-ellipsoid,
smooth, 0-septate, 2.5-4 µm wide and 6-8.5 µm long (Fig. 3.5C). Mycelium in pure culture
- dense and white in colour (Fig. 3.5B), hyphae - 3.5-5 µm thick.
Fig 3.5. Photographs of Hysterangium obtained from Yalgorup National Park. (A)
Basidiomes of Hysterangium sp. L0103, (B) Mycelium of Hysterangium MURU6276 on
MMN medium, (C) Spores of Hysterangium MURU6276
A B
A B C
49
Structure of ECM
Cross-sections of feeder roots in the fungal mats showed that the majority of the roots were
ECMs of the superficial type described by Malajczuk et al. (1987). Details of the ECM
anatomy are given in Fig. 3.6. Key features were: a thin hyphal mantle (M) on the root
surface; epidermal cells (E) not elongated; and a shallow Hartig net which partially
penetrates between the epidermal cells.
Fig. 3.6. Structure of natural ECM between mat forming fungi and E. gomphocephala in
the field in Yalgorup National Park. (A) TS short root in epoxy resin stained with azure
II/methylene blue, (B) TS part of a A. E = epidermal cell, M = mantle and Hartig net
(arrow) are visible
DNA analysis of ECM mycelium
The ECM mycelium of Hysterangium isolate MURU6276, isolated from basidiomes
collected within the mats associated with E. gomphocephala, was used for identification
by ITS1F and ITS4 gene region analysis. After the phases of extraction, amplification, and
sequencing, a DNA sequence of 691 base pairs with good quality was obtained (see
Appendix 3). The nucleotide sequence was compared to some known nucleotide sequences
A B
E M
50
in the GenBank database using a BLAST for identification. The result of the BLAST
search is presented in Appendix 3.
The DNA sequence (Appendix 3) matched 18 species or isolates from GenBank with
percentage of identity from 86.3 to 94.1%. There was no genus with identity more than
94.1% for this sequence. These species belong to 6 different fungal genera including
Hysterangium, Lysurus, Clathrus, Austrogautieria, Gallacea and Ramaria. All species
listed belong to the fungal class of Agaricomycetes. Hysterangium and Lysurus had the
highest percentage of identity, 94.1% and 90.6%, respectively, while the lower percentage
of identity was shown with Ramaria species, from 86.3% to 87.9%.
A majority of the matched sequences originated from countries in the Northern
Hemisphere (The United State of America, Spain, England, and Canada), accounting for
83.3%. The best matched sequence (Uncultured Hysterangium) originated from Canada.
There was one sequence (Uncultured Hysterangiales) from Tasmania, Australia and 2
sequences (Hysterangium sp. and Gallacea eburnea) from New Zealand.
3.3.2 Soil properties
Soil moisture
The distribution of the soil moisture (%) was not normally distributed for the mat and non-
mat soils. Therefore, a Mann-Whitney U test (U-test) was used to compare the means of
soil moisture (%) in mat and non-mat soils (Fig. 3.7). From this data, it can be concluded
that there was a statistically significant difference between soil moisture (%) in mat and
non-mat soils (U = 54, P < 0.05). It can be further concluded that soil moisture (%) in mat
soils (M = 27.4, SD = 7.1%, n=15) was 8.4% higher than in non-mat soils (M = 19, SD =
2.8, n=15).
51
Fig. 3.7. Soil moisture (%) in mat and non-mat soils in Yalgorup National Park. Bars are
standard deviations. The soils were sampled in September 2010
Soil physiochemical properties
Paired-samples T-test (paired T- test) and Wilcoxon Signed-Rank test, where data did not
meet the required assumptions to use the parametric method, were used to compare the
level of chemicals between mat and non-mat soils. There were higher levels of all
chemicals and other parameters tested in mat soils than in non-mat soils (Table 3.2).
Notably, the levels of NO3-N, S, Mn, Exchangeable Ca, Exchangeable Mg, Exchangeable
Na, B were significantly higher in mat than non-mat soils. Soil pH values, measured by
both H2O and CaCl2 solutions, were significantly lower in mat than in non-mat soils.
Table 3.2. Soil physicochemical properties of mat and non-mat soils collected in
Yalgorup National Park
Soil property Measurement unit Mat soil Non-mat soil
Colour Dark grey Dark grey
Gravel % 0 0
Texture mm 1.5 1.5
NH4-N mg/kg 9.50 ± 3.11a 4.25 ± 0.96
b
NO3-N mg/kg 4.25 ± 3.86a
2.75 ± 1.50a
P mg/kg 30.5 ± 7.33a
22.75 ± 5a
K mg/kg 108 ± 30.36a
79.75 ± 16.58a
0
5
10
15
20
25
30
35
40
Soil condition
Soil
mo
istu
re (
%)
Mat soil
Non-mat soil
52
S mg/kg 14.13 ± 3.04a
6.6 ± 3.78b
Organic carbon % 4.01 ± 0.5a
3.38 ± 0.29a
Conductivity d S/m 0.38 ± 0.08a
0.2 ± 0.03b
pH CaCl2 pH 7.43 ± 0.15a
7.63 ± 0.1b
pH H2O pH 7.97 ± 0.05a
8.33 ± 0.13b
Cu mg/kg 0.89 ± 0.17a
0.76 ± 0.08a
Fe mg/kg 19.28 ± 12.92a
23.14 ± 10.14a
Mn mg/kg 11.3 ± 3.94a
3.76 ± 1.81b
Exchangeable Ca meq/100g 36.38 ± 3.38a
23.92 ± 1.13b
Exchangeable Mg meq/100g 6.15 ± 1.69a
3.53 ± 0.52b
Exchangeable K meq/100g 0.28 ± 0.07a
0.21 ± 0.04a
Exchangeable Na meq/100g 0.82 ± 0.27a
0.4 ± 0.1b
B mg/kg 3.12 ± 0.44a
1.84 ± 0.36b
Notes: Values are mean ± with standard deviation. Means with the same letter are not
significantly different (Independent T-test or Mann-Whitney U test, α = 0.5, n= 4)
Soil microbial biomass
Plate counting of bacterial colonies
An independent-samples T-test was conducted to compare the number of colonies in mat
and non-mat soils. There was a significantly higher number colonies in mat (M = 47.7, SD
= 5.1) than in non-mat soils, M = 18, SD =2.7; t (6) = 10.3, p < 0.01 (Fig. 3.8).
Fig.3.8. Number of bacterial colonies in mat and non-mat soils in Yalgorup National Park.
Values are means (n = 3), bar = standard deviation
0
10
20
30
40
50
60
Soil condition
Nu
mb
er
of
colo
nie
s (1
0 5
/g
soil)
Mat soil
Non-mat soil
53
Ninhydrin-reactive N
The Mann-Whitney U test was used to compare the amount of ninhydrin-reactive N
released in mat and non-mat soils. As can be seen in Fig. 3.9, although there was high
variance in the data on mat soils, the amount of ninhydrin-reactive N released in mat soils
(M = 38.6, SD = 20.9) was significantly higher than in non-mat soils (M = 12.3, SD = 3.9;
U = 0, p < 0.01).
Fig. 3.9. Amount of ninhydrin-reactive N released in mat and non-mat soils. Values are
means (n = 3), bar = standard deviation
Soil microbial community
Following 148 hours of incubation, purple colour development with different intensity for
each well was observed on Biolog EcoPlates (Fig. 3.10). Given the average colour
development, parameters of average metabolic response (AMR) and community metabolic
diversity (CMD) were calculated, and principal component analysis (PCA) was conducted.
0
10
20
30
40
50
60
70
Soil condition
Nin
hyd
rin
-re
acti
ve N
(µ
g/m
l) Mat soil
Non-mat soil
54
Fig. 3.10. Biolog Ecoplate with soil samples incubated for 148 hours
Average metabolic responses (AMR)
The AMR is a parameter, related to microbial respiration, which can be used to
characterize microbial density and activity. The change in AMR over incubation time is
shown in Fig. 3.11. Overall, there was a gradual increase in ARM in both mat and non-mat
soils, from OD = 0 at the beginning of incubation to OD = around 1.1 after 172 hours of
incubation. For the first 72 hours of incubation, the ARM value of mat soil increased a bit
more actively than of non-mat soil, however, after that the AMR activity of non-mat soil
surpassed the mat soil reaching an OD of 1.1 at the end of incubation.
Fig 3.11. Change in AMR in mat and non-mat soils with incubation time
0.0
0.2
0.4
0.6
0.8
1.0
1.2
0 24 48 72 96 120 144 172
AM
R (
OD
at
59
5 n
m)
Incubation time (hrs)
Mat
Non-mat
55
Community metabolic diversity (CMD)
The CMD was calculated from the data and graphed (Fig. 3.12). Overall, the number of
wells which developed purple colour was slightly higher in mat soil than non-mat soil. No
colour development occurred in the first 24 hours of incubation. There was strong colour
development in 25 wells between 24 and 96 hours of incubation. The number of reactive
wells increased to 30 at the end of the incubation time. It can be concluded from the graph
that community metabolic diversity in mat soil was slightly higher than non-mat soil.
Fig. 3.12. CLPP profiles comparing the CMD of mat and non-mat soils
Shannon’s diversity index (H) was also calculated to assess microbial community
functional diversity in mat and non-mat soils. There was no significant difference in the
index between mat (independent T-test, M = 3.3, SD = 0.01) and non-mat soil, M = 3.31,
SD = 0.037, t = - 0.98, 6 d.f., p = 0.387.
Principal component analysis
A principal component analysis (PCA) was conducted on 24 items which included 12 mat
and 12 non-mat soils with varimax orthogonal rotation. The 31 sole carbon sources were
the 31 variables in the PCA. A suitability of use of PCA statistic was assessed before
0
5
10
15
20
25
30
35
0 24 48 72 96 120 144 172
Ave
rage
CM
D
Time (hrs)
Mat
Non-mat
56
analysis. All 31 variables in the correlation matrix had at least one correlation which was
greater than 0.3. Eleven variables were removed from the PCA analysis to reach a possible
definite correlation matrix and the Kraiser-Meyer-Olkin (KMO) measure of 0.58 which
indicated the sampling adequacy for the analysis. The acceptable limit of KMO was 0.5
(Field, 2009). Bartlett’s Test of Sphericity was statistically different, χ2 (190) = 379.9, p <
0.01, indicating that the samples were sufficiently large for PCA analysis.
Eigenvalues for each component were obtained by an initial PCA analysis. The PCA
analysis showed that there were five principal components which had eigenvalues greater
than 1 (Kaiser’s criterion). These five components accounted for 79% of the total variance.
Visual inspection of the scree plot indicated that three components which accounted for
66% of the variance could be extracted. As such, given the eigenvalues of the scree plot
and the Kaiser’s criterion, 3 principal components were retained in the final analysis. A
varimax rotation which exhibited a “simple structure” (Thurstone 1947) was used to
enhance interpretability. The component loadings after rotation are shown in Table 3. 3.
Based on items which were highly correlated with the same component, component 1
represents the group of most easily-used carbon sources in soil which could be suitable for
a variety of soil microorganisms. The variables with a higher number in absolute value are
more important to that component, thereby three sources of carbon, Tween 80, Tween 40
and D-Mannitol, were important for the metabolic activity of the soil microbial
community. Component 2 may represent groups of sole carbons which are not easily used
by common bacteria, but which can be used by specific groups of bacteria in soil. Some
sole carbons belonging to this group included D-Galacturonic Acid, β-Methyl-D-
Glucoside, and N-Acetyl-D-Glucosamine.
57
Table 3.3. Rotated structure matrix for PCA with Varimax rotation
Item Rotated component coefficients
Component 1 Component 2 Component 3
Tween 40 0.920* -0.201 0.050
Tween 80 0.807 -0.029 0.351
D-Mannitol 0.800 0.245 -0.287
L-Arginine 0.792 0.110 -0.081
L-Phenylalanine 0.787 0.000 0.172
α-Cyclodextrin 0.765 0.527 0.087
D,L-α-Glycerol Phosphate 0.741 -0.138 0.165
D-Malic Acid 0.598 0.166 -0.463
L-Asparagine 0.547 0.456 -0.081
α-D-Lactose 0.540 0.223 0.385
i-Erythritol 0.539 -0.380 0.429
D-Galacturonic Acid -0.006 0.874 -0.082
D-Glucosaminic Acid 0.138 0.837 0.219
β-Methyl-D-Glucoside -0.213 0.830 0.085
N-Acetyl-D-Glucosamine -0.114 0.830 -0.196
D-Xylose 0.460 0.654 0.096
D-Cellobiose 0.437 0.653 -0.318
α-Ketobutyric Acid 0.040 -0.121 0.779
2-Hydroxy Benzoic Acid -0.029 -0.022 0.614
Pyruvic Acid Methyl Ester 0.241 0.230 0.524
*Note. Major loadings for each item are bold
Scores from the first 2 principal components were graphed to aid the interpretation of data
(Fig. 3.13). Principal component 1 tended to separate scores of the mat (13-24) and non-
mat soils (1-12). It appears that the microbial community of non-mat soils had higher
metabolic activity than in mat soil samples. As for principal component 2, soil samples 10,
11 and 12 from non-mat soil clearly stand out from the other soil samples.
58
Fig. 3.13. Scatterplot of the scores of the first two principal components against mat (13-
24) and non-mat soil (1-12)
3.3.3 Characterization of bacteria
Sixteen soil samples, 8 from mat and 8 from non-mat soils, were used to isolate bacteria
with the view to screening for potential PGPR candidates. Given differences in shape,
colour and growth rate of colonies on NA, 39 bacteria were obtained for assessing plant
growth promoting attributes. Of these, 10 isolates did not grow well in either NB or GPB,
therefore, they did not have enough bacterial cells required for assays regarding plant
growth promoting ability of rhizobacteria, therefore, a total of 29 isolates which included
14 isolates from mat and 15 from non-mat soils were ultimately tested.
IAA synthesis
The results of the assay of IAA-equivalent production by bacteria are presented in Table
3.4. Twenty eight of the 29 bacterial isolates (96.5%) produced IAA, from 1.62 to 8.83
µg/ml, in the presence or absence of the auxin precursor L-tryptophan (L-TRP). Of these,
19 isolates (65.5%) produced less than 5µg/ml IAA-equivalents in both the presence and
absence of L-TRP. Nine isolates (31%), 5 from mat and 4 from non-mat soils, produced
59
from >5 to 8.83 µg/ml IAA-equivalents. The 3 isolates which were able to produce the
highest level of IAA-equivalents were T2M2 (8.83 µg/ml), T2M4 (8.75 83 µg/ml), and
T2M3 (8.43 µg/ml).
There was no significant difference in IAA-equivalent production by bacteria between
isolates from mat and non-mat soils, either with L-TRP present (Mann-Whitney U test, U
= 104, p = 0.965) or absent (Mann-Whitney U test, U = 96.5, p = 0.709). However, the
amount of IAA-equivalents produced by bacterial isolates in the presence of L-TRP (M =
4.19, SD = 2.22) was significantly higher than in the absence of L-TRP (M = 2.09, SD =
0.54) (Mann-Whitney U test, U = 114, p < 0.005).
Table 3.4. In vitro production of IAA-equivalents of bacteria isolated from mat and
non-mat soils in Yalgorup National Park
Bacterial
isolates from
mat soils
Production of IAA
equivalents (µg/ml)
Bacterial
isolates from
non-mat soils
Production of IAA
equivalents (µg/ml)
+ L-TRP -L-TRP + L-TRP -L-TRP
T2M2 8.83 0 T3N2 7.22 1.62
T2M4 8.75 0 T4N4 6.66 2.18
T2M3 8.43 1.62 T4N6 6.34 1.78
T3M2 6.66 1.70 T3N4 5.30 2.10
T1M3 6.10 1.62 T1N1 4.66 1.78
T4M4 3.70 2.18 T4N7 4.02 2.42
T1M2 3.46 4.10 T2N3 3.70 2.66
T3M1 3.22 2.74 T2N7 3.46 2.02
T4M3 2.74 2.50 T2N5 3.22 0
T2M1 2.50 2.02 T4N5 2.82 2.18
T1M1 2.26 2.34 T2N1 2.58 1.94
T3M4 2.10 2.50 T3N1 2.58 0
T4M1 2.02 2.42 T4N9 2.42 2.10
T3M3 0 0 T4N3 2.34 2.02
T2N4 1.94 2.26
+ L-TRP: in the presence of L-tryptophan
-L-TRP: in the absence of L-tryptophan
60
Ability of bacteria to solubilize phosphate
Twenty nine isolates of bacteria were tested for their ability to solubilize phosphate, and of
these seven were positive (Table 3.5). Of the 7 isolates, there were 4 isolates from mat and
3 from non-mat soils. Two isolates showing the highest P solubilization ability were T2M3
(Fig, 3.14A) and T2M2, with solubilization diameters of 15.7 mm and 15.2 mm,
respectively, after 7 days of incubation.
Fig. 3.14. Ability of bacteria to solubilize phosphate on Pikovskaya’s agar medium with
phosphate substrate of Ca5HO13P3. (A) good P solubilization ability by isolate T2M3, (B)
low P solubilization ability by isolate T3N4
Table 3.5. Bacterial isolates with ability to solubilize phosphate after 7 days of
incubation. Values are mean ± standard deviation, n = 3
Isolate d1 (mm)* d2 (mm)* d = d1 – d2 (mm)*
T2M3 24.7 ± 0.76 9.0 ± 0.86 15.7 ± 1.52
T2M2 24.0 ± 1.50 8.8 ± 0.76 15.2 ± 0.76
T3M4 16.0 ± 0.50 13.7 ± 0.57 2.3 ± 0.28
T1N2 13.3 ± 0.28 11.7 ± 0.28 2.0 ± 0.00
T3N1 12.8 ± 0.58 10.8 ± 0.57 1.8 ± 0.29
T4N6 12.7 ± 1.90 10.8 ± 1.60 1.8 ± 0.29
T1M2 12.7 ± 1.89 10.8 ± 2.00 1.7 ± 0.28
*d1: diameter of colony and clearance zone, d2: diameter of colony; and d: clearance zone
A B
61
There was a significant difference in phosphate solubilization by 7 bacterial isolates
(Kruskal Wallis H Test, χ2 (6, n=3) = 16.56, p < 0.05). Follow-up tests were conducted to
evaluate pairwise differences among the seven isolates. The results of the tests showed that
P solubilization efficiency of T2M2 and T2M3 was significantly higher than that of the
other 5 bacterial isolates.
ACC deaminase production by bacteria
Thirty nine bacterial isolates, which were isolated from 8 mat and 8 non-mat soils, were
used to test whether they can use ACC acid as a sole N source. Two of these bacterial
isolates, T4N3 and T4N8, were able to use ACC acid as a sole N source (Fig. 3.15).
Fig 3.15. Ability of bacteria to use ACC acid as a sole N source after 21 days of
incubation. (A) use of ACC acid by isolate T4N8, (B) without ability to use ACC acid by
isolate T4M1, (C) T4N8 on DF medium with (NH4)2SO4 as sole N source. (ACC) DF
medium containing ACC acid as sole N source, (WN) DF medium without N
3.4 Discussion
3.4.1 ECM mat and fungi
The characterization and identification of ECM fungi forming dense mats is necessary to
begin an understanding of what role ECM fungal mats play in tuart woodland ecosystems.
From results of characterization and identification of the fungus, there was evidence that
A B
ACC WN ACC WN
C
62
Hysterangium was the likely candidate genus forming a common mat type under tuart.
Principal characteristics of these fungal mats were formation in the organic horizon, their
white-gray colour and high hydrophobicity. These traits are similar to mats described by
Kluber et al. (2010) under Pseudotsuga menziesii in that they both had an ashy appearance
and were highly hydrophobic. However, fungal mats under tuart occurred in the organic
and mineral horizon interface, while hydrophobic mats under P. menziesii were deeper in
the mineral horizon. Hydrophobic mats under P. menziesii were reported to be formed by
Hysterangium setchelli in earlier studies (Entry et al. 1992; Griffiths et al. 1991a).
Hysterangium species are a dominant component of the macrofungi in eucalypt forests of
Western Australian (Castellano 1988; Malajczuk et al. 1987). Therefore, based on their
morphology, fungal mats under tuart in South Western Australia in this study have similar
features to those formed by the genus Hysterangium. This conclusion is also supported by
characteristics of the basidiome and basidiospores which are in agreement with published
descriptions. For example, Hysterangium was described to have the following features:
hypogeous basidiome, green gleba, small and elliptical spores (Miller et al. 1988);
hypogeous basidiome 5-20 mm in diameter, gelatinous gleba, elongate-ellipsoid
basidiospores (Grgurinovic 1998). However, spore size in this study was 2.5-4 µm wide
and 6-8.5 µm long while in other descriptions, spores are larger: mostly 10-15 µm long,
sometimes over 20 µm, rarely very small <5 µm for Hysterangium Vitt. 1831 (Grgurinovic
1998); 9-12 x 3-5 µm for Hysterangium inflatum (Castellano and Beever 1994).
Almost all roots which were sectioned showed ECM characteristics, including a thin
mantle on the root surface, epidermal cells not elongated, and a shallow Hartig net
between the epidermal cells. These traits are similar to those previously described as a
Hysterangium/Eucalyptus association by Malajczuk et al. (1987) as superficial ECMs.
63
The BLAST search result showed that the DNA sequence best matched 18 sequences of 6
different genera including Hysterangium, Lysurus, Clathrus, Austrogautieria, Gallacea
and Ramania. Among them, an uncultured Hysterangium isolate had the highest
percentage of identify (94.1%) following by Lysurus cruciatus (90.6%) and uncultured
Hysterangiales (90.3%), the only isolate coming from Australia.
According to the database of Royal Botanic Gardens Melbourne, there are a large number
of Hysterangium species reported in Australia such as H. affine, H. aggregatum, H.
burburianum, H. clathroides, H. fischeri, H. inflatum, H. membranaceum, H. moseleyi, H
neglectum, H. neotunicatum, H. pseudacaciae, H. pumilum, H. rhodocarpum, H.
rupticutis, H. salmonnaceum and H. subglobosum. However, ITS sequences for these
species were not available.
Fruiting bodies of Lysurus species with their long receptacle structure are distinctly
different from the basidiomes described in this study. Therefore, based on both
morphological and molecular characteristics, it can be concluded that the fungus, which
forms common gray mats in Yalgorup National Park, belongs to Hysterangium.
3.4.2 Soil properties
This the first study to explore properties of ECM fungal mats under tuart and affects on
soil properties. A number of differences were found between mat and non-mat soils.
Soil moisture
The results showed that soil moisture under mats was significantly higher than in non-mat
soils. This is contrary to the results reported by Griffiths et al. (1991b). These authors
collected soil samples from non-mat and mat soils formed by 2 genera of fungi,
Hysterangium and Gautieria, in 3 locations in America and compare different
64
measurements including soil moisture. There was no significant difference in moisture
between mat and non-mat soils in mineral soil horizon colonized by G. monticola in two
locations in Oregon. Soil moisture under Hysterangium mats was also drier than in non-
mat soils in all three locations of sampling.
It is hypothesized that tuart fungal mats protect soils from sunlight, thus reducing soil
temperature and water evaporation from the soil. It could be anticipated that soil moisture
might be related to the level of organic C in soil but chemical analysis showed that there
was no difference between organic C in mat and non-mat soils. A further possibility is that
some hydraulic lift occurs at night causing leakage of water from mat roots. According to
Unestam (1991), although fungal mats were highly hydrophobic, there was no effect on
adjacent soils and plant debris. How water is shed or passes through hydrophobic mats
during rainfall events is a fascinating area that requires investigation. Likewise, relative
water contents of mat and non-mat soils during the onset of the summer drought warrants
study. Higher soil moisture may play an important role in producing a favourable
environment for microorganism life and nutrient cycling, especially in dry seasons. To
obtained a full understanding of mat hydrology, monthly sampling of mat and non-mat
soils should be taken over a full year.
Soil pH
Soil pH, measured in H2O and CaCl2 solutions, was significant lower in mat soil (pH H2O
7.97, pH CaCl2 7.43) than in non-mat soils (pH H2O 8.33, pH CaCl2 7.63). The results
agree with several previous studies. For example, soil pH within the fungal mats formed
by Hysterangium crassum with Pseudotsuga menziesii was significant lower than the
surrounding soils (Cromack Jr et al. 1979). Griffiths et al. (1991b), in comparing soil
moisture associated with fungal mats formed by H. setchellii and Gautieria monticola,
reported that the pH was significantly higher in non-mat mineral soils and litter than in mat
65
soils and litter in all three locations of sampling in America. More recently, soil pH was
reported to be significantly higher in mat than non-mat soils in both the organic and
mineral horizons (Kluber et al. 2010). In both mat and non-mat soils in the present study,
the pH was above 7 and this is due to the presence of limestone at depths of under 1 m at
the study site. It is possible that the lower pH in mat soils is because of the release of
organic acids by mat-forming fungi. For example, Cromack Jr et al. (1979) reported that
mat-forming Hysterangium crassum exuded large amounts of oxalic acid, and the
concentration of soil oxalate was significantly higher in mat than in non-mat soils. Also,
the concentration of oxalate anions released to the rhizosphere by Hysterangium setchellii
and Gautieria monticola were reported to be significantly higher in mat than in non-mat
soil solutions (Griffiths et al. 1994). Recently, further evidence of oxalate release by ECM
mycelium was reported by Van Hees (2006).
Soil chemical nutrients
The result of this study showed that mat soils had significantly higher levels of N-NO3, S,
B, DTPA Mn and exchangeable Ca, Mg, Na than in non-mat soils. These findings are
similar to studies in coniferous forests. Entry et al. (1992), in comparing soil chemicals of
mat soils, non-mat soils and mat soils with mats removed in the Hysterangium setchellii-
Pseudotsuga menziesii association, reported that the concentrations of P, Al, Zn, Fe, Cu, B,
Mn, K, Ca, N and Mg were higher in mat than in non-mats soils, especially 10 times
higher P and Al concentrations. Furthermore, Griffiths et al. (1994) showed that there were
significantly greater concentrations of dissolved organic C, oxalate, PO4, SO4, H, Fe, Cu,
Mg and Zn in mat than in non-mat soils for both Hysterangium and Gautieria. In another
study, nearly twice as much N and P were released in mat soils compared to non-mat soils
and mat soil had higher concentrations of NO3, Fe, Cu and B compared to non mat soils
66
(Entry et al. 1991b). A higher chemical level in mat soils than non-mat soils was also
reported in other publications (Cromack Jr et al. 1979; Entry et al. 1992).
Two possible reasons may account for the fact that the chemical concentration in mat was
higher than in non-mat soils. Firstly, it may be due to the release of organic acids by ECM
fungi, producing a favourable weathering environment. As indicated above, there is
evidence of release of oxalate anions into the rhizosphere by some ECM fungi (Cromack
Jr et al. 1979; Griffiths et al. 1994). Griffiths et al. (1994) also showed that there was a
strong correlation between dissolved organic C or oxalate and PO4 in mat soils indicating
that organic acids may affect the weathering and solubilization of PO4. Secondly,
microorganisms may play an important role in the release of chemical nutrients. Entry et
al. (1991b), in comparing mat and non-mat soils with H. setchelli-Pseudotsuga menziesii
association, showed that microbial biomass and litter decomposition were 4.0 and 1.1
times greater, respectively in mat than in non-mat soils. In another study, the same author
showed that there were 3-6 times higher microbial biomass in mat than in non-mat soils,
and mat soils had higher rates of cellulose and lignin degradation than non-mat soils
(Entry et al. 1991a).
Microbial biomass
For microbial properties, the concentration of ninhydrin-reactive N in mat soils was
significantly higher than in non-mat soils. This was similar to some results previously
reported. Using the chloroform fumigation incubation method, Entry et al. (1992) reported
that microbial biomass of H. setchellii mat soil was higher than the surrounding non-mat
soil. In other studies, as mentioned earlier, with the same association between H. setchellii
and Pseudotsuga menziesii, the authors reported that microbial biomass was 3 - 6 times
greater in ECM mat soil than in non-mat soils (Entry et al. 1991a; Entry et al. 1991b).
Also, there was a greater microbial biomass C in mat soil in the mineral horizon than in the
67
non-mat soil, however, there was no significant difference in microbial biomass C between
the rhizomorphic mat inorganic horizon and non-mat soils (Kluber et al. 2010).
Higher soil microbial biomass in mat than non-mat soils could be explained by 3 factors. It
is possible that higher soil moisture and nutrients may result in a favourable environment
that attracts microorganisms. There may be particular associations between some bacteria
and ECM fungi. Specific data on the soil microbial communities are required to
substantiate this. Lastly, but not least, the exudates produced by ECM fungi in mats may
support higher bacteria populations than in non-mat soil.
Soil microbial community
There was no evidence of any difference in microbial activity and diversity between mat
and non-mat soils using community level physiological profiling. Few studies have
compared soil microbial communities between mat and non-mat soils. Kluber et al. (2011)
analyzed bacterial communities associated with Piloderma mats in the forest floor of P.
menziesii using T-RFLP profiles, clone libraries and quantitative PCR and showed that
there were distinct microbial communities associated with the Piloderma mats, however,
there was little difference in the size of the microbial populations between mat and non-
mat soils. Furthermore, Kluber et al. (2011) showed that although the size of the microbial
populations varied temporally, the composition of microbial communities remained
unchanged over time.
Although the ninhydrin-reactive N level in mat soils was significantly greater than in non-
mat soils, there was no difference in microbial activity and diversity between mat and non-
mat soils in the present study. This could be explained if there were some inactive bacterial
populations in the mat soils at the time of soil microbial community analysis. It is
important to realize that the CLPP method has limitations. The method is useful for
68
examining microbial activity and diversity of fast growing, but not slow growing,
microorganisms. Also, standardizing the soil solution by plate counting may be not
accurate because it can not include microorganisms that do not grow in pure culture. These
limitations reduce the likelihood of detecting differences in this study. Additional
approaches should be explored in future research and this is discussed further in Chapter 5.
Given AMR, CMD and Shannon’s diversity index, there was no significant difference in
soil microbial community activity and diversity in mat and non-mat soils. However, it was
interesting that PCA appeared to be quite sensitive to detect the pattern of the score of
principal components against mat and non-mat soils.
In conclusion, mat soils produce a distinct environment regarding soil moisture, soil pH,
nutrients and microbial biomass in Yalgorup National Park.
3.4.3 Plant growth promoting properties of PGPR
We hypothesized that there were PGPR within the ECM fungal mats under tuart in
Yalgorup National Park, and this study was designed to screen and characterize some plant
growth promoting properties of bacteria under tuart in Yalgorup National Park.
IAA production
Most (96.5%) of the bacterial isolates tested were able to produce IAA, between 1.54 and
8.83 µl/ml in the presence or absence of the auxin precursor L-tryptophan. There was no
difference in the number of IAA producing bacteria isolated in mat and non-mat soils. The
limitation of only being able to test isolates that were able to grow on NB and GPB media
limited the number of isolates that could be tested.
There are limited publications on PGPR in fungal mats and even in forest soils (Chapter
2). The amount of IAA produced by bacterial isolates in this study was low compared to
69
published accounts. For example, Deepa et al. (2010) reported that bacteria, isolated from
non-rhizospheric soil in Western ghat forest in India, could produce between 23.8 and
104.8 µg/ml in the presence of L-tryptophan. Further, six pseudomonad isolates, from
different plant rhizospheres in Myanmar, produced between 40 and 48 µg/ml in the
presence of 5 g/l of L-tryptophan (Lwin et al. 2008). In this tuart study, the number of IAA
producing bacterial isolates was high and similar to the 97% previously reported by Swift
(2006). It is generally considered that around 80% of rhizosphere organisms are capable of
producing IAA (Lwin et al. 2008; Patten and Glick 1996). In general, IAA production
increased with added L-tryptophan in the majority of bacteria isolates. Addition of L-
tryptophan to the media increased IAA production by several times. Interestingly, in this
study, isolates T2M2 and T2M4 did not produce IAA in the absence of L-tryptophan, yet
they were the best IAA producers in the presence of 1µg of L-tryptophan/ml of bacterial
suspension. This is not surprising as L-tryptophan is a primary precursor for auxin
synthesis (Sachdev et al. 2009).
According to Swift (2006), the screening method used in this study has limitations. The
Salkowski reagent can react with some of the chemical intermediates in IAA synthesis, in
particular indolepyruvic acid (IPyA) and indoleacetamine (IAM). This can lead to an
overestimation of the IAA concentration. Another limitation is that L-tryptophan may react
with colorimetric reagents. In spite of these drawbacks, this method is simple and can be
used to examine a large number of bacterial isolates over a short period of time. Also, to
reduce the above limitations, this study used a limited amount of Salkowski reagent,
1µg/ml.
Phosphate solubilization
The present study screened 7 out of 29 bacterial isolates tested (24%) which can solubilize
phosphate, with a halo zone diameter from 1.7 to 15.7 mm after 7 days of incubation. The
70
2 isolates with the best P solubilization ability were T2M3 and T2M2 with clearance zone
diameters of 15.7 and 15.2 mm, respectively.
The production of organic acids by soil bacteria is a key mechanism for mineral phosphate
solubilization (Rodríguez and Fraga 1999; Yasmin et al. 2009). They include formic,
acetic, propionic, lactic, fumaric and succinic acids (Kucey 1983; Rodríguez and Fraga
1999). These acids react with mineral phosphate to release anions of P such as HPO42-
to
the soil solution. Moreover, chelation by organic acids binds metal ions in mineral
phosphate and releases phosphate into the soil solution.
ACC deaminase production
Thirty nine bacterial isolates from both mat and non-mat soils were tested for their ability
to use ACC acid as a sole N source. Three of them showed ability to use ACC acid as sole
N source after 30 days of incubation.
The enzyme 1-amino-cyclopropane-1-carboxylate (ACC) deaminase can cleave the ACC
acid, a precursor for plant ethylene synthesis. Therefore, this enzyme can potentially lower
the level of ethylene in plants. Ethylene is a natural plant hormone that plays pivotal roles
in fruit ripening, senescence and the plant response to abiotic and biotic stressors (Chapter
2). However, high levels of ethylene inhibits the growth and development of plant roots
(Jackson 1991). A number of soil bacteria contain ACC deaminase, and these bacteria may
be important for plants under stress.
To sum up, screening and characterization of potential PGPR properties of E.
gomphocephala forest soil in Yalgrorup National Park showed that there were bacteria
which can produce IAA, solubilize P and use ACC acid as a sole N source. Whether any of
these bacteria play a role in promoting growth and health of tuart will be explored in
Chapter 4.
71
CHAPTER 4
INTERACTION AMONG TUART-ASSOCIATED RHIZOBACTERIA,
ECTOMYCORRHIZAL FUNGI AND EUCALUPTUS SEEDLINGS
4.1 Introduction
The preceding chapter explored properties of bacteria associated with ECM fungal mats
and non-mat soils of E. gomphocephala. However, from an ecosystem point of view,
interactive relationships between organisms and host trees are of greater importance.
Therefore, the purpose of this chapter is to investigate interactions between selected mat
and non-mat bacteria, ECM fungi and eucalypt hosts in vitro.
Some PGPR can promote the growth of a range of Eucalyptus species (Mafia et al. 2009a;
Mafia et al. 2009c; Martínez et al. 2009; Mohammad and Prasad 1988). Of the possible
growth promoting mechanisms (Chapter 2), production of IAA by soil bacteria is a well-
explained mechanism (Kloepper 2003). For example, Teixera et al. (2007b) reported that 2
bacterial isolates, R98 and R97, produced IAA in vitro at concentrations as low as 0.7 and
0.67 µg/ml, respectively, but increased root formation and root biomass of Eucalyptus spp.
clones compared to the uninoculated control. Therefore, it is of interest to know whether
any of the IAA-producing bacteria, associated with E. gomphocephala, can promote
growth of seedlings of the host tree.
Furthermore, ectomycorrhizas are symbiotic associations in which ECM fungi and plants
exchange metabolic products required for their survival and growth (Chapter 2), and
stimulating effects of ECM fungi on some eucalypts have been reported (Alves et al. 2010;
Brundrett et al. 2005; Chen et al. 2006; Lu et al. 1998; Souza et al. 2008). In this study,
fungal mats under E. gomphocephala were thought to be formed by an ECM fungus and
confirmation of this is required using in vitro ECM synthesis and histological examination
of the structures formed.
72
Bacteria may be strongly associated with ECM hyphae and sporocarps (Bertaux et al.
2005b; Garbaye et al. 1990; Izumi and Finlay 2011; Kretzer et al. 2009) but the role that
these bacteria play in ECM formation in eucalypts is not well elucidated. Some
mycorrhizosphere inhabiting bacteria can stimulate growth and development of ECM
hyphae (Chapter 2), an example being the associations between Pinus radiata, P. sylvestris
and Pseutotsuga menziessi and various MHBs (Duponnois and Garbaye 1991b; Garbaye
1994; Garbaye and Bowen 1987; Garbaye and Bowen 1989; Poole et al. 2001). Action
mechanisms for bacterial effects on the growth of fungal hyphae are still poorly
understood, however, release of active molecules, including volatiles, appears important
for the interaction (Bonfante and Anca 2009). As interactions between soil bacteria and
ECM fungi associated with eucalypts are poorly studied, this chapter also explores effects
of soil bacteria from ECM fungal mats and non-mat soils on the growth in vitro of ECM
fungal hyphae.
Eucalyptus grandis was chosen for inclusion in this study because it has been extensively
used in in vitro studies on ECM formation (Burgess 1995; Burgess et al. 1994a; 1996). In
fact, E. grandis was recommended as a model system for the in vitro synthesis of
Pisolithus-Eucalyptus ectomycorrhiza (Burgess et al. 1996) due to the following traits:
uniform seed germination, ability to quickly produce large numbers of lateral roots, small
seedling size, and rapid colonization by a range of ECM fungi.
The following specific objectives will be addressed:
1) to investigate effects of potential PGPR on the growth of seedlings of E.
gomphocephla and E. grandis,
2) to confirm ECM synthesis by Hysterangium MURU6276 with E. gomphocephala
seedlings in vitro, and
3) to investigate whether there was a stimulating effect of bacteria on the growth of
ECM fungi in vitro.
73
This chapter examined the following hypotheses:
The fungal mats under E. gomphocephala are formed by an ECM fungus, and
There are PGPR and MHB associated with the fungal mats of E. gomphocephala.
4.2 Materials and methods
4.2.1 Effect of bacteria on eucalypt seedling growth
A bioassay to assess the effect of bacteria on the growth of E. gomphocephala and E.
grandis seedlings was conducted using 1.5 cm deep petri dishes containing MMN medium
(Appendix 1) overlaid with cellophane.
Seed preparation
Healthy and uniform-size seeds of E. gomphocephala and E. grandis were selected. They
were surface sterilized before incubation to exclude resident microbes. Seeds of E.
gomphocephala and E. grandis were treated by soaking in 70% ethanol containing 0.1%
Tween 80 as a surfactant for 30 seconds. They were then sterilized using 3% NaOCl for 5
minutes and rinsed with 3 changes of sterile distilled water.
Bacterial inoculum preparation
Thirty two bacterial isolates, 28 potential PGPRs (Chapter 3) and 4 PGPRs provided by
Rebecca Swift (Appendix 4), Centre for Rhizobium Studies, Murdoch University, were
grown separately in 30 ml sterile plastic tubes containing 5 ml of nutrient broth (NB)
medium on a 200 rpm shaker for 4 days at 28 oC. The accumulated biomass of bacteria
was obtained by centrifuging the solution in a 10 ml centrifuge tube at 5000 rpm for 10
minutes. The supernatant was discarded, the pellets were washed twice with 10% sucrose
to make sure that they were free from the bacterial growth medium, the pellets were
resuspended in sterile 10% sucrose, and concentrations of inocula were adjusted using a
Hitachi V-1100 Spectrophotometer to measure the absorbance of the bacterial suspensions
at 600 nm to an optical density of 0.15 immediately before use.
74
Assay set-up and assessment
Following sterilization, the seeds were transferred into petri dishes containing 8% water
agar for pregermination. When seeds germinated, three seedlings were placed on
cellophane overlying MMN in each deep petri dish and incubated for 6 days. When
seedlings were 7 days old, 30 µl of bacterial suspension of each isolate was pipetted along
the tap root of seedlings. The plates were kept on a 70o slope in a temperature controlled
room at 25 oC with 16 hours light (150 uEs
-1 m
-1 light intensity) and 8 hours dark cycle.
Tap root length, number of lateral roots, lateral root length and hair root abundance were
assessed at the time of incubation and every 7 days for 2 weeks afterwards. The number of
lateral roots was counted, and lateral root length was measured using a grid line under a
dissecting microscope. Root hair abundance was assessed on a scale from 0 to 4 for the
whole root (Fig. 4.1).
Fig 4.1. Visual scale for estimating root hair abundance of E. grandis. (A) very long and
dense root hairs (4), (B) shorter and dense root hairs (3), (C) moderately short and dense
root hairs (2) and (D) very short and sparse root hairs (1)
A B
C D
75
4.2.2 In vitro ECM synthesis between Hysterangium MURU6276 and tuart
Seedling preparation
Selection and sterilization of tuart seeds was conducted as previously described for the
PGP assay by bacteria. Six sterile seeds were placed on each of 10 water agar petri dishes
(8% agar) and incubated under continuous light at 25 o
C for germination. It took between
2 and 3 days for the radicles to emerge, and the seedlings to be ready for ECM synthesis.
Fungal culture preparation
The Hysterangium fungal culture, the same used for ITS gene region analysis (Chapter 3),
was used in the assay. Ten petri dishes, 90 mm in diameter and 14 mm in height,
containing MMN medium were prepared for subculture. Between 4 and 5 pieces of fungal
mycelium, approximately 3-4 mm2
each, taken from the edge of rapidly growing cultures,
were placed on each of the 10 prepared petri dishes. The plates were sealed with parafilm,
placed in a plastic bag, and incubated at 25 oC for 14 days in the dark for mycelia to be
produced suitable for ECM synthesis.
ECM synthesis
After 14 days of incubation, when the fungal culture had grown to around 1 cm in
diameter, the tuart seedlings were transferred so that each tap root was near the edge of
actively growing MURU6276 mycelium in petri dishes. The plates were incubated at 25
oC with 16 hours light (150 uEs
-1 m
-1 light intensity) and 8 hours dark cycle for 3 months to
confirm ECM formation. Putative ECM structures were investigated under a dissecting
microscope, and root structures were examined using histological procedures as described
in Chapter 3.
76
4.2.3 Effect of bacteria on the growth of ECM mycelium
Preparation of fungal and bacterial inocula
Fungal isolates which were used in the experiment were Hysterangium isolate MURU6276
and Pisolithus isolate MURU6275. The cultures of both fungi were isolated from fruiting
bodies which were collected under tuart forest in Yalgorup National Park. They were
subcultured to make sure that young cultures were ready for the experiment. Pisolithus
was included as this genus has been extensively used in in vitro studies in the past with
eucalypts and provides a standard for comparison.
Thirty six bacterial isolates which were isolated from mat and non-mat soils were used in
this experiment. They were grown in 30 ml sterile tubes containing 5 ml of the nutrient
broth (NB) medium and incubated for 2 days on a shaker at 200 rpm at 28 oC. After 2 days
of incubation, the bacterial solutions were adjusted to an optical density of 0.15 using
0.89% NaCl solution before their immediate use.
Assay set-up and assessment
Half plate petri dishes (Techno Plas), 14 mm high and 90 mm wide, were used to assess
potential ability of potential MHB to promote the growth of ECM mycelium. One
compartment was prepared with NA medium for bacterial inoculation, and the other was
poured with MMN for ECM inoculation. A piece of ECM mycelium, taken from the edge
of rapidly growing cultures using a cork borer, was placed centrally in the compartment
containing MMN medium and incubated until the culture grew to 1 cm in diameter. Then,
2 drops of 10 µl of bacterial solutions, adjusted with a Hitachi V-1100 Spectrophotometer
to OD (600 nm) = 0.15, were placed on the compartment containing NA medium. Instead
of bacterial suspension, 2 drops of 10 µl of NaCl (0.89%) solution was placed on the
compartment containing NA medium as the control. The petri dishes were sealed with
parafilm, placed in a plastic bag, and incubated at 28 oC in the dark. Three replicates were
77
set up for each bacterial isolate. The diameter of the ECM fungi were measured in two
directions and compared, after deducting the diameters at the time of addition of bacteria,
to evaluate the bacterial effect on ECM mycelium growth.
4.2.4 Data analysis
SPSS (version 18) was used for data analysis for all 3 experiments. One-way ANOVA
analysis or the Kruskal-Wallis H test was used to detect the difference among treatments.
Where there were significant results, Fisher’s Least Significant Difference (LSD) or
Mann-Whitney U post-hoc tests were conducted to evaluate pairwise differences between
treatments.
4.3 Results
4.3.1 Effect of bacteria on the root growth of eucalypt seedlings
Petri dish systems overlaid with cellophane (Fig. 4.2) were used to investigate the effect of
bacteria on the taproot length, number of lateral roots, lateral root length and root hair
abundance of E. grandis and E. gomphocephala seedlings. Details of the results are as
follows.
Fig. 4.2. Petri dish overlaid with cellophane for assessing the effect of bacteria on eucalypt
seedling root growth. (A) E. grandis seedling with bacterial isolate T3M1 and (B) control
without bacteria
A B
78
Taproot length
There was a significant difference in the taproot length of E. grandis seedlings among
bacterial treatments as determined by one-way ANOVA (F(32, 66) = 4.545, p < 0.01). A
LSD post-hoc test revealed that taproot length of 2 bacterial isolates (6.3% isolates), T1N2
and T4N7, were significantly higher than that of the uninoculated control seedlings and
that 4 isolates (12.5%), T1M2, NCH7, T1N1 and PMK9, significantly inhibited taproot
growth of E. gandis (Fig. 4.3).
For E. gomphocephala, there was a significant difference among bacterial treatments
(F(32, 66) = 3.24, p < 0.01). As determined by a LSD post-hoct test, 6 bacterial isolates
(18.7%), T4N8, T1M2, T2N3, NCH7, T3N1 and T3M2, inhibited taproot length of E.
gomphocephala (Fig. 4.3) and no bacteria stimulated tap root elongation.
Fig. 4.3. Effect of bacterial treatments on tap root length of E. grandis and E.
gomphocephala after 14 days of incubation. Values are mean (n=3) with one SD. (*) are
treatments that significantly (p ≤ 0.05) promoted taproot length while (#) are treatments
that significantly (p ≤ 0.05) inhibited taproot length compared to the uninoculated control
0 5
10 15 20 25 30 35 40 45 50
Co
ntr
ol
T1N
2
T2M
1
T4N
6
T1M
3
T1M
1
NC
H4
5
T4N
8
T1M
2
T2N
3
T4N
5
T3N
4
T2N
7
NC
H7
T4N
4
T2N
5
T4M
3
T1N
1
PM
K4
T3N
1
T2M
2
T2M
3
T4N
3
T3M
1
T4M
1
T3N
2
PM
K9
T4N
7
T3M
4
T4M
4
T2N
4
T3M
2
T2N
1
Tap
roo
t le
ngt
h (
mm
)
Bacterial treatment
E. grandis
E. gomphocephala * *
#
# # #
# # # #
#
#
79
Number of lateral roots
One-way ANOVA analysis revealed a significant difference in the number of lateral roots
of E. grandis among bacterial treatments (F(32, 66) = 1.714, p < 0.05). A pairwise LSD
post-hoct test revealed that the number of lateral roots was significantly higher when
inoculated with PMK4 and lower with T2N1. The number of lateral roots did not differ for
E. gomphocephala across all bacterial treatments determined by one-way ANOVA (F(32,
66) = 1.366, p = 0.142).
Fig. 4.4. Effect of bacterial treatments on the number of lateral roots of E. grandis and E.
gomphocephala after 14 days of incubation. Values are mean (n=3) with one SD. (*) are
treatments that significantly (p ≤ 0.05) promoted the number of lateral roots compared to
the uninoculated control
Lateral root length
According to the Kruskal-Wallis H test, there was a significant difference in the lateral
root length of both E. grandis (H(32) = 53.711, p < 0.01) and E. gomphocephala (F(32) =
59.845, p < 0.01) between bacteria treatments. Pairwise Mann-Whitley U tests showed that
11 bacterial isolates (34.4% isolates) stimulated lateral root length of E. grandis while 6
isolates (18.8 %) promoted lateral root length of E. gomphocephala. Five bacterial isolates
(15.6%) inhibited the lateral root length of E. gomphocephala (Fig. 4.5).
0
5
10
15
20
25
30
35
Co
ntr
ol
T1N
2
T2M
1
T4N
6
T1M
3
T1M
1
NC
H4
5
T4N
8
T1M
2
T2N
3
T4N
5
T3N
4
T2N
7
NC
H7
T4N
4
T2N
5
T4M
3
T1N
1
PM
K4
T3N
1
T2M
2
T2M
3
T4N
3
T3M
1
T4M
1
T3N
2
PM
K9
T4N
7
T3M
4
T4M
4
T2N
4
T3M
2
T2N
1
Nu
mb
er o
f la
tera
l ro
ots
Bacterial treatment
E. grandis
E. gomphocephala *
*
80
Fig. 4.5. Effect of bacterial treatments on the lateral root length of E. grandis and E.
gomphocephala after 14 days of incubation. Values are mean (n=3) with one SD. (*) are
treatments that significantly (p ≤ 0.05) promoted lateral root length compared to the
uninoculated control
Root hair density and length
There was a significant difference among bacterial treatments in the root hair abundance
index of E. grandis and E. gomphocephala (Fig 4.6) determined by the Kruskal-Wallis H
test (H(32) = 61.11, p < 0.05 and H (32) = 81.28, p < 0.01, respectively) (Fig. 4.7).
Fig. 4.6. Eucalypt hair roots. (A) E. gomphocephala and (B) E. grandis
0.0
1.0
2.0
3.0
4.0
5.0
6.0
Co
ntr
ol
T1N
2
T2M
1
T4N
6
T1M
3
T1M
1
NC
H4
5
T4N
8
T1M
2
T2N
3
T4N
5
T3N
4
T2N
7
NC
H7
T4N
4
T2N
5
T4M
3
T1N
1
PM
K4
T3N
1
T2M
2
T2M
3
T4N
3
T3M
1
T4M
1
T3N
2
PM
K9
T4N
7
T3M
4
T4M
4
T2N
4
T3M
2
T2N
1
Late
ral r
oo
t le
ngt
h (
mm
)
Bacterial treatment
E. grandis
E. gomphocephala
A B
* *
*
* * *
* *
* *
* * *
*
* *
*
# # #
# #
81
The Mann-Whitney test was used for pairwise comparison between treatments. The results
showed that the root hair abundance index was significantly greater in 13 out of 32
bacterial treatments tested with E. grandis. T3N4, PMK4 and T4N4 were among the best
stimulating isolates while NCH7 significantly lowered root hair abundance. As for E.
gomphocephala, 10 bacterial isolates (31.2% isolates) had a significant effect on root hair
abundance when compared to the control. The best stimulating isolates included T4N6,
T1M3 and T2N3. Eight isolates (25% isolates) led to significantly lower root hair
abundant index than the control. The most inhibiting bacterial isolate was NCH7 (Fig. 4.7).
Fig. 4.7. Effect of bacterial treatments on the root hair abundance index of E. grandis and
E. gomphocephala. Values are mean (n=3) with one SD. (*) are treatments that
significantly (p ≤ 0.05) promoted taproot length while (#) are treatments that significantly
(p ≤ 0.05) inhibited taproot length compared to the uninoculated control
4.3.2 ECM synthesis in vitro
In vitro ECM formation was confirmed between tuart seedlings and Hysterangium isolate
MURU6276 (Fig. 4.8A). The fungal mycelium grew slowly, and it took up to 2 months of
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
4.0
4.5
Co
ntr
ol
T1N
2
T2M
1
T4N
6
T1M
3
T1M
1
NC
H4
5
T4N
8
T1M
2
T2N
3
T4N
5
T3N
4
T2N
7
NC
H7
T4N
4
T2N
5
T4M
3
T1N
1
PM
K4
T3N
1
T2M
2
T2M
3
T4N
3
T3M
1
T4M
1
T3N
2
PM
K9
T4N
7
T3M
4
T4M
4
T2N
4
T3M
2
T2N
1
Hai
r ro
ot
den
sity
an
d le
ngt
h in
dex
(1
-4)
Bacterial treatment
E. grandis
E. gomphocephala * * *
* *
* * * *
* * * *
* * *
* * *
* *
*
*
#
# #
# # #
# # #
82
incubation to initially show the ECM association. Tuart seedlings could survive well up to
4 months in petri dishes when they were associated with Hysterangium. The in vitro
formed ECMs were thin, and bright brown in colour. Single short lateral roots formed
unbranched ECMs (Fig. 4.8C). There was a considerable reduction in root elongation (Fig
4.8B), and the ECM roots were thicker than non mycorrhizal roots and were black in
colour at the root tips (Fig. 4.8D).
Fig. 4.8. In vitro ECM formation by Hysterangium isolate MURU6276 and E.
gomphocephala after 2 months of incubation (A) Setup used to synthesize ECM. (B)-(D)
detail of root system with developing mycorrhizal structure (arrows). ip = inoculation site
In vitro ECM structures formed between Hysterangium isolate MURU6276 and tuart
seedlings were examined anatomically (Fig 4.9). Transverse sections of ECM showed that
external hyphae were abundant, the hyphal mantle was thin, and the Hartig net was weakly
A B
D C
ip ip ip
83
developed with only partial penetration of mycelia between the epidermal cells. In
addition, the epidermal and cortical cells showed no radial elongation.
Fig. 4.9. Structure of an ECM formed in vitro between Hysterangium MURU6276 and a
tuart seedling. (A) Transverse section of a lateral root, (B) higher magnification of part of
(A). E = epidermal cell, M = mantle, EH = external hyphae and shallow Hartig net =
arrow
4.3.3 Effect of bacteria on the growth of fungal mycelium
Pisolithus MURU6275
Pisolithus MURU6275 isolate grew fast and therefore the colony diameter was measured 7
days after addition of the bacterial inoculum to the second compartment of the petri dish.
A Kruskal-Wallis test was run to determine if there were differences in ECM growth
diameter with different bacterial treatments. Pairwise comparisons were performed using
Dunn’s (1964) procedure with a Bonferroni correction for multiple comparisons. In
general, there was a statistically significant difference in ECM growth diameter between
bacterial treatments (χ2(37) = 74.93, p < 0.01). However, post-hoc analysis revealed that
A B
E
M
EH
84
there was no sifgnificant effect of bacteria on ECM growth between bacterial treatments
and the unoculated control. Details are given in Figures 4.10 and 4.11.
Fig. 4.10. Pisolithus MURU6276 (lower compartment) inoculated with bacteria (upper
compartment) 2 days after bacterial incubation. (A) inoculated with bacterial isolate
T1M2, (B) with bacterial isolate T2N
Fig. 4.11. Effect of bacteria on the diameter growth of mycelium of Pisolithus isolate
MURU6275 after 7 days. Values are means (n=3) with a SD bar
0
5
10
15
20
25
Co
ntr
ol
T3N
3
T2N
3
T4N
5
T3M
3
T4M
2
T2M
2
T2N
7
T3M
1
T3M
2
T3N
2
T4N
2
T3M
3
T4N
4
T4N
3
T3N
1
T4N
1
T4N
6
T1N
1
T3M
4
T4N
8
T2M
4
T3N
4
T2N
2
T4M
1
T2N
1
T2M
1
T2N
2
T4M
4
T1M
3
T2N
6
T1M
2
T2N
5
T1M
1
T2N
4
T4N
7
T1M
2
Fun
gal g
ow
th d
iam
eter
(m
m)
Bacterial treatment
A B
85
Hysterangium MURU6276
Due to the slower growth of Hysterangium MURU6276, diameter growth was assessed
after 3 weeks. In general, the diameter growth in the uninoculated control was higher than
those in all the bacterial treatments (Figs. 4.12 and 4.13). Prior to determining whether
there were differences between treatments, the assumptions underlying the one-way
ANOVA were tested. The result of Levene’s Test of Homogeneity of Variance showed
that the assumption of homogeneity of variance was not met (F (35, 72) = 2.089, p = 0.04).
Instead of using the traditional ANOVA, significant differences between treatments was
determined using the Welch test. At least two of the 36 treatments differed statistically in
the diameter growth of fungal mycelium between treatments determined by the Welch test
(F (35, 25.324) = 36.875, p < 0.001). A Tukey post-hoc test revealed that the diameter
growth of fungal mycelium in the presence of bacterial isolates T3N4 and T4N4 were
significantly smaller than the uninoculated control after 21 days of incubation.
Fig. 4.12. Growth of Hysterangium MURU6275 (left compartment) without bacteria (A)
and with bacteria (right compartment) isolate T3N4 (B)
B A
86
Fig. 4.13. Effect of bacteria on the growth of Hysterangium MURU6276 mycelium after 3
weeks of incubation. (*) are treatments that significantly (p ≤ 0.05) inhibited the growth of
Hysterangium mycelium compared to the uninoculated control
4.4. Discussion
4.4.1. Effect of bacteria on the growth of eucalypt seedlings
Significant stimulating and inhibiting effect of bacteria on root growth of E. grandis and E.
gomphocephala seedlings were observed in the in vitro study and these are summarized for
comparative purposes in Table 4.1. Most isolates from under tuart had an inhibiting or
stimulating effect on the root growth of E. grandis and/or E. gomphocephala. These
included isolates from mat and from non-mat soils. The 6 best isolates, stimulating at least
3 root parameters in both eucalypt species, were T1M3, T1N2, T2N7, T3N4, T4N4 and
T4N6, and all except T1M3 came from non-mat soil. Lateral root and root hair
development were particularly responsive to inoculation. Of the 4 proven PGPR isolates,
obtained from the Centre for Rhizobium Studies at Murdoch University, that had been
isolated from agricultural soils in Western Australia, only 2 isolates stimulated root
development of E. grandis.
The most inhibiting bacterial isolates were NCH7, T1M2 and T1N1. They had a negative
effect on at least 3 root parameters and both Eucalyptus species. Furthermore, 5 bacterial
isolates reduced taproot elongation in E. gomphocephala.
0
5
10
15
20
25
Co
ntr
ol
T1N
1
T3M
3
T3N
5
T4M
2
T3N
1
T4N
7
T3N
4
T4N
3
T2N
6
T1N
2
T3M
2
T4M
4
T4N
8
T2N
1
T4M
3
T4N
6
T3M
4
T2N
5
T4N
4
T2N
4
T1M
3
T4N
1
T2N
3
T2N
7
T3N
2
T4N
9
T4N
5
T2N
2
T3M
1
T2M
1
T1M
1
T4M
1
T4N
6
T1M
2
T4N
2 M
ycel
ial g
row
th d
iam
eter
(m
m)
Bacterial treatment
*
*
87
The results establish that bacteria with PGPR properties were indeed present under tuart in
natural stands. However, they were less prevalent in Hysterangium mats. Previously,
Teixeira et al. (2007a) found that 10 out of 107 bacterial isolates, isolated from rhizosphere
of Eucalyptus spp. clones plantations in Brazil, stimulated the rooting (110 %) and root
biomass (250%) of Eucalytus clones compared to untreated control. Also, according to the
work of Karthikeyan and Sakthivel (2011), rooting of stem cuttings of Eucalyptus
camaldulensis was significantly (p < 0.05) promoted when treated with Azotobacter
chroococcum isolated from the rhizosphere of 7 years old E. camaldulensis in Coimbatore,
India.
Production of IAA by soil bacteria is one PGP mechanism (Chapter 2) because IAA is
known to be involved in cell division, cell enlargement and root initiation (Patten and
Glick 2002; Salisbury 1994). In the present study, IAA production may be a possible
mechanism explaining the stimulating effect of bacteria on the root growth of E. grandis
and E. gomphocephala. Teixeira et al. (2007a), observed that bacteria that produced low
levels (0.67-0.7 µg/ml) of IAA in culture were able to stimulate rooting and biomass of
Eucalyptus spp. In the present study, the amount of IAA produced by bacteria isolated
from under tuart ranged from 1.54 to 8.83 µg/ml, with most isolates producing more than 2
µg/ml.
However, the ability to produce IAA did not explain all the growth responses observed. In
particular, it is worth noting that isolate NCH7, producing 35 µg/ml of IAA, significantly
(p < 0.01) inhibited taproot length and root hair abundance of E. grandis and taproot
length, lateral root length and root hair abundance of E. gomphocephala. Two possible
reasons for this have been mentioned in the literature. Firstly, high IAA concentrations
were inhibitory for eucalypt seedlings. According to Xie et al. (1996), although low
concentrations of IAA can stimulate primary root development, the synthesis of high
amounts of IAA can inhibit root growth. Moreover, IAA may inhibit the growth of plant
roots by promoting ethylene synthesis (Xie et al. 1996) that promotes radial rather than
88
elongation growth (Chapter 3). Secondly, some bacteria can produce phytotoxic
substances. Friedman et al. (1989) researched bacterial populations from Pseudotsuga
menziesii forest and adjacent regeneration clear-cut soil. The results showed that bacterial
isolates obtained from the clear-cut area had 5 times the phytotoxic effect compared to
forest soil.
Table 4.1 Effect of bacteria on the growth of Eucalyptus grandis and E.
gomphocephala seedlings in vitro
Isolate
E. grandis E. gomphocephala
Taproot
length
Lateral
root
number
Lateral
root
length
Hair root
density
Taproot
length
Lateral
root
number
Lateral
root
length
Hair root
density
Mat bacteria
T1M1 +
T1M2 - - -
T1M3 + + + +
T2M1 + +
T2M2 +
T2M3 + +
T3M1 +
T3M2 -
T3M4 -
T4M4 + +
T4M1 + -
T4M3 + - -
T4M4 +
Non-mat bacteria
T1N1 - - -
T1N2 + + +
T2N1 -
T2N3 +
T2N4 -
T2N5 +
T2N7 + + +
T3N1 - -
T3N2 -
T3N4 + + +
T4N3 + +
T4N4 + + +
T4N6 + + +
T4N7 + +
T4N8 + + - + +
PGPRs from other studies
PMK9 - -
NCH7 - - - - -
PMK4 + +
NCH45 + +
(+) stimulating effect, (-) inhibiting effect
89
4.4.2 ECM synthesis
ECM formation between E. gomphocephala and Hysterangium MURU6276 was
confirmed in vitro. A thin hyphal mantle, narrow Hartig net and epidermal cells that were
not elongated were key characteristics observed in most of the material examined. This in
vitro ECM structure was consistent with that within Hysterangium mats under E.
gomphocephala forest (Chapter 3), and the structure was similar to the superficial
ectomycorrhizas described previously for this genus in ECM mats under other species of
eucalypts in southwestern Australia (Malajczuk et al. 1987). These ECMs are quite distinct
from those associations where the Hartig net penetrates to the outer cortex and there is
often extensive radial elongation of epidermal cells. Examples where these have been
reported include in E. marginata-P. tinctorius mycorrhizas (Tonkin et al. 1989), E.
pilularis-Hydnangium carneum mycorrhizas (Moore et al. 1989), E. pilularis-P. tinctorus
mycorrhizas (Grenville et al. 1986) and E. grandis-Pisolithus mycorrhizas (Burgess et al.
1994b).
Unlike some other ectomycorrhiza-eucalypt associations, a longer time was needed for the
Hysterangium-E. gomphocephala ECM formation. In the present study, the system needed
30 days to initially show ECM formation. A shorter time was reported for ECM formation
between some eucalypt-ectomycorrhiza associations. For example, E. urophylla-Pisolithus
ECM formation were initiated after between 2 and 7 days depending on fungal isolates
tested (Malajczuk et al. 1990). In another study, ECM formation between E. pilularis and
Hydnangium carneum was reported to occur within 14 days after inoculation (Moore et al.
1989). Moreover, mycorrhizas were observed on second-order roots after 6-9 days after
inoculation of seedlings (Grenville et al. 1986). In another study, Burgess and Dell (1996)
characterized the ECM lateral development sequence of E. grandis-Pisolithus
ectomycorrhizas in detail. The authors showed that mycorrhizas were fully developed with
90
9 day old tips of the 13-19 day old segment of the primary roots. The root segments that
were 1-4 days old with two day old inoculated tips showed fungal attachment to the tips.
The 5-8 days old segments with 2 day old tips showed fungal attachment to the root
surface and commencement of epidermal cell elongation. The Hartig net started
developing with 3 day old inoculated tips of 9-12 day old segments of primary roots.
4.4.3 Effect of bacteria on ECM mycelial growth
There is no evidence that any of the bacteria isolated under tuart had MHB activity when
tested with Pisolithus MURU6275 or Hysterangium MURU7276. Indeed, T3N4 and T4N4
significantly inhibited the growth of Hysterangium mycelium after 3 weeks of incubation.
Unlike the present study, MHBs were commonly detected in many previous studies. For
example, of 47 bacterial isolates, taken from Laccaria laccata sporocarps and mycorrhizas
of L. laccata-Pseudotsuga menziesii associations and screened for MHB (Duponnois and
Garbaye 1991c), as many as 30 bacterial isolates stimulated mycorrhizal development in
vitro. In other research, Founoune et al. (2002b) investigated the effect of 76 isolates,
taken from Acacia holosericea-Pisolithus sp. mycorrhizosphere soil, roots and associated
rhizobium nodules, on the establishment of the ectomycorrhizal symbiosis between Acacia
holosericea and Pisolithus sp. strain IR 100. Ectomycorrhizal symbiosis was promoted by
14 isolates from the mycorrhizosphere soil, 3 from the roots and 4 from the nodules.
Moreover, Strzelczyk et al. (1993) investigated the effect of 3 bacteria, Arthrobacter
globiformis, Pseudomonas fluorescens and Bacillus subtilis isolated from the rhizosphere
soil on biomass production by Laccaria laccata, Hebeloma crustuliniforme and
Rhizopogon vinicolor under Pseudotsuga menziesii forest using media of different
composition. The results showed that these bacteria had a range of effects, stimulating,
inhibiting or no effect on biomass production of the ECM fungi.
91
An inhibiting effect of bacteria on the growth of ECM mycelium has been reported in
other studies. Friedman et al. (1989) investigated the effect of actinomycetes on the growth
of Laccaria lacccata and Hebeloma ovstuliniforme and found that some actinomycete
isolates, 2.6% from Pseudotsuga menziesii forest and 4% from the adjacent clear-cut,
significantly inhibited the growth of the ECM fungi. According to Strzelczyk et al. (1993),
inhibition of the growth of ECM mycelium by bacteria can be explained by mechanisms
such as competition for nutrients, production of detrimental metabolites (Garbaye et al.
1990) and fungistatic substances (Friedman et al. 1989). The first two direct mechanisms
of action cannot be explained with our study design. Inhibiting effect of bacteria in the
present study may be due to fungistatic volatile compounds being released by the bacteria.
Although “MHB can be found every time they have been looked for” (Garbaye 1994) and
in diverse environments such as Pisolithus albus sporocarps (Duponnois and Didier 2004),
Acacia mangium rhizosphere (Duponnois and Plenchette 2003), Laccaria bicolor-
Pseudotsuga menziesii mycorrhizas, Laccaria laccata sporocarps and mycorrhizas
(Dunstan et al. 1998; Duponnois and Garbaye 1991c), no studies have explored their
presence in Hysterangium mats. The failure to identify MHB in this study may simply
reflect their absence in the samples taken and isolations made. Alternatively, bacteria may
be present that can stimulate ECM formation but are not detected using the standard
screening procedure that depends on volatile compounds. For example, MHB can directly
provide mycorrhiza with nutrients, growth hormones and indirectly detoxify the medium,
and such mechanisms were not assessed in the present study. It would be interesting to
further evaluate those bacteria that promoted root growth in vitro in the presence of a range
of ECM fungi.
92
CHAPTER 5
GENERAL DISCUSSION
5.1. Properties of fungal mats and associated organisms
Fungal mats, formed by a Hysterangium species, and associated bacteria were investigated
under tuart in Yalgorup National Park. The aims of the present study were to investigate
effects of Hysterangium mats on the chemical and microbial properties of the soil, screen
associated potential PGPR and MHB, and assess the efficacy of selected isolated bacteria
for promoting growth of eucalypt seedlings.
The research was based on a number of hypotheses and the main findings that relate to
these hypotheses are summarized in Table 5.1.
Table 5.1. Hypotheses and results obtained in the present study
Hypothesis Result
1 The fungus forming common grey mats under
tuart belongs to Hysterangium
Hysterangium MURU6276
2 ECM fungal mats enhance soil moisture and
nutrient and levels compared to non-mat soil
Improved soil moisture and nutrient levels
(Chapter 3)
3 ECM fungal mats improve soil microbial biomass
level and microbial activity and diversity
Improved microbial biomass (Ninhidryn
reactive N) but not microbial activity and
diversity (Chapter 3)
4 There exist bacteria with beneficial properties
under tuart
Bacteria with IAA production, P
solubilization and ACC deaminase production
were isolated; no difference in propotion of
bacterial isolates with PGP properties between
mat and non-mat soils detected (Chapter 3, 4)
5 The fungus forming the common grey mat under
tuart is an ECM fungus
ECM was confirmed by investigating root
structure and ECM synthesis in vitro (Chapter
3 and 4)
6 There exist PGPR and MHB associated with
ECM fungal mats of tuart
PGPR but not MHB demonstarted (Chapter 4)
93
Sampling in September showed that the mats significantly improved soil moisture, pH and
nutrient status (N-NO3; S; Exc. Mg, Ca and Na; DTPA Mn and B). Mats also enhanced the
level of ninhydrin-reactive N in soil, however, there was no evidence of differences in
microbial activity and diversity between mat and non-mat soils. The combined findings of
Chapters 3 and 4 are summarised in Table 5.2. Ectomycorrhiza formation between
Hysterangium MURU6276 and E. gomphocephala seedlings was confirmed in vitro. None
of the bacterial isolates tested were able to promote the growth of vegetative mycelia of
Hysterangium MURU6276 or Pisolithus MURU6275 in vitro.
The present study identified the mat-forming fungus at the genus level to Hysterangium
using the ITS gene region. This region was chosen because it is the most commonly
sequenced gene region in molecular research on ECM fungi (Horton and Bruns 2001;
Martin 2007). However, the sequence obtained in Chapter 3 in this study did not match
with high identity those ITS sequences for Hysterangium originating from Australia.
Databases from the Royal Botanic Gardens Melbourne reveal that taxonomic work is
proceeding broadly on hypogeous ECM fungi in Australian eucalypt forests (Jumpponen et
al. 2004) and that the 25S gene region is preferred to the ITS region for species
comparisons. Therefore, the 25S gene region is of interest to determine whether the
Hysterangium MURU6276 in this study matches any of the Hysterangium species
described so far in Australia. The current study did not have a strong taxonomic focus as
the main aim was to investigate mat properties. In order to better define the species of
Hysterangium, a larger collection of basidiomes would be required along with detailed
morphological and molecular descriptions, preferably by an expert in fungal taxonomy.
94
Table 5.2 Summary of bacterial isolates with beneficial properties and their PGP
effect on the growth of eucalyt seedlings
Isolate
IAA production
(µg/ml)
P
solubilization
(mm)
ACC
deaminase
production
Effect of bacteria on eucalypt seedling root
growth
(+) L-
TRP
(-) L-
TRP
Inhibition Promotion
Mat bacteria
T1M1 2.26 2,34 Root hairs
T1M2 3.46 4.1 1.7 Taproot, root hairs
T1M3 6.1 1.62 Lateral root, root hairs
T2M1 2.5 2.02 Lateral root
T2M2 8.83 0 15.2 Lateral root
T2M3 8.43 1.62 15.7 Lateral root, root hairs
T2M4 8.75 0 Root hairs
T3M1 3.22 2.74
T3M2 6.66 1.7 Taproot, root hairs
T3M4 2.1 2.5 2.3 Taproot
T4M4 3.7 2.18 Lateral root, root hairs
T4M1 2.02 2.42
T4M3 2.74 2.5
T4M4 3.7 2.18 Root hairs
Non-mat bacteria
T1N1 4.66 1.78 Taproot, lateral root
and root hairs
T1N2 2 Taproot, root hairs
T2N1 2.58 1.94 Lateral root Root hairs
T2N3 3.7 2.66 Root hairs
T2N4 1.94 2.66 Root hair
T2N5 3.22 0 Root hairs
T2N7 3.46 2.02 Lateral root, root hair
T3N1 2.58 0 1.8 Taproot, lateral root
T3N2 7.22 1.62 Root hairs
T3N4 5.3 2.1 Root hairs, lateral root
T4N3 2.34 2.02 + Lateral root
T4N4 6.66 2.18 Root hairs, lateral root
T4N5 2.82 2.18 Root hairs
T4N6 6.34 1.78 1.8 Taproot, lateral root
T4N7 4.02 2.42
T4N8 + taproot Lateral root, root hairs
T4N9 2.42 2.1
PGPRs from other studies
PMK9 19* 2.5* Taproot, lateral root
NCH7 35* 3.5* Taproot, lateral root
and root hairs
PMK4 37* 4* Lateral root, root hairs
NCH45 13.25* 2* Lateral root, root hairs
* Data provided by Rebecca Swift
Hysterangium mats created a distinct soil microenvironment with enriched soil fertility
likely to be beneficial for maintaining tuart health. This result has similarities to a number
of findings on ECM mats under mature coniferous forests in Europe and North America.
Fungal mats are well documented to enhance soil nutrients (Aguilera et al. 1993; Cromack
Jr et al. 1979; Entry et al. 1992; Griffiths et al. 1994). Dell et al. (2006) reported that based
95
on the foliar nutrient levels of plantation eucalypt species such as E. globulus and E.
grandis, 6 nutrients including N and S in tuart were possibly within the deficient range in
some stands of tuart in the field where tuart decline was occurring. Interestingly, N and S
were significantly improved under Hysterangium mats in this study (Chapter 3). Therefore,
a greater understanding of mat dynamics, mat longevity and roles in nutrient capture and
nutrient cycling is needed in tuart forests. For example, in the present study, enzymes
which enhance reaction rates at which plant residues decompose and release nutrients were
not considered. Moreover, although some soil microbial properties were investigated in the
present research, according to USDA Natural Resources Conservation Service (2010), the
activity of enzymes is not highly correlated with microbial biomass and respiration due to
40-60% of the enzyme activity stemming from stabilized enzymes. To have more
understanding of the biochemical processes under Hysterangium mats, knowledge of the
seasonal activities of enzymes involved in the decomposition and degradation of lignin and
cellulose is of importance.
Higher microbial biomass has been found under fungal mats in coniferous forests in the
Northern Hemisphere (Entry et al. 1992; Kluber et al. 2010). Increased microbial biomass
may bring about a certain microbial function, however, in the present study there was no
evidence of any differences in microbial activity and diversity between mat and non-mat
soils. The study used CLPP to explore the soil microbial community, and this method was
sensitive for assessing general activity and diversity of the soil microbial community.
However, nothing is known about the functional groups of bacteria and their diversity
associated with Hysterangium mats. Molecular profiling will be required to provide us
with further understanding on the functions of bacterial populations in the microbial
community under and within Hysterangium mats. The extraction of total community DNA
or RNA followed by fingerprinting (e.g. DGGE/TGGE, SSCP, ARDRA or T-RFLP) is a
96
useful approach to study the diversity and function of microbial populations at various
levels of resolution (Van Elsas et al. 2006).
There was clear evidence of the presence of potential PGPR under tuart. The high number
of bacteria tested that expressed IAA production in the study is in agreement with previous
studies (Lwin et al. 2008; Patten and Glick 1996). As for P solubilization bacteria,
Gyaneshwar (2002) reported that these bacteria may account for 1-50% of the total
bacterial population which is in agreement with the present study (24.1%). Further, ACC
demaminase is commonly present in soil bacteria (Glick et al. 2007). For example, 27 out
of 233 Rhizobium isolates tested showed some ability for ACC deaminase production
(Duan et al. 2009), and 62 out of 88 Pseudomonad isolates contained ACC deaminase
(Wang et al. 2001). In this study, 2 out of 38 isolates produced detectable ACC deaminase.
Identification of these bacteria of interest is of importance before further research and
application of those bacteria is conducted to improve tuart health and soil quality in the
study site.
Table 5.2 reveals the improved growth of roots obtained after direct inoculation of the
taproot of seedlings with some bacteria in vitro. The PGP effect can be partly explained by
the results obtained in Chapter 3. Bacterial isolates T2M2, T2M3 and T2M4, the highest
IAA producers in Chapter 3, all promoted root growth of E. grandis and E.
gomphocephala. Similarly, the 2 best P solubilizing bacteria and 2 isolates able to produce
ACC deaminase all significantly enhanced the root growth of the eucalypt species.
Therefore, production of growth hormones and nutrient improvement are possible
mechanisms underpinning the observed responses in the present study.
It is speculated that Hysterangium MURU6276, as a common ECM fungus under tuart,
can enhance tuart forest health. It is interesting that tuart decline has been associated with a
decrease in ECM in seedlings grown in field soil (Ishaq 2012, unpublished data). In
97
another study, Scott et al. (2012) (in preparation) investigated the relationship between
tuart crown health and ECM total density scores. They established that there was a
significant correlation between crown health, seedling survival and ECM total density
scores and that tuart trees with severe crown decline had significantly fewer ECM fungal
mats and reduced seedling health than trees with healthy crowns. The authors postulated
that reduced seedling heath and crown health were associated with the absence of ECM.
The loss of Hysterangium and other ECM fungal mats is likely to have a negative
consequence on soil fertility. Therefore, the managers of tuart forests should be interested
in the potential role of Hysterangium as well as other associated ECM fungi.
Fluorescent pseudomonads are well documented to associate with ECM and have a
stimulating effect on the growth of ECM fungi (Duponnois and Plenchette 2003;
Duponnois and Didier 2004; Founoune et al. 2002a; Founoune et al. 2002b; Garbaye 1994;
Garbaye and Bowen 1989). For example, Garbaye and Bowen (1989) investigated bacteria
associated with the mantle of Rhizopogon-Pinus radiata ectomycorrhizas. They found that
these bacteria were mostly fluorescent pseudomonads, and as many as 80% of them
showed a significant positive effect on mycorrhiza establishment. In the present study, the
design of the study did not focus on a particular group of bacteria, so nutrient agar (NA)
was used for the isolation of bacteria under tuart. This approach is commonly used for
routine cultivation of many bacteria. However, NA may be unsuitable for the isolation of
fluorescent pseudomonads. To isolate Pseudomonas bacteria, Pseudomonas Agar F (PAF)
medium is more suitable. Therefore, the nutrient medium used might exclude some
bacteria with beneficial properties, especially some MHB in the present study.
Soil and mat sampling in the present study was conducted towards the end of the wet
season (in September). Thus it was not possible to study temporal changes in mat
ecosystems. This is a large gap in knowledge that a longer term study can investigate using
98
target organisms in the future. Large seasonal events are anticipated given the climatic
extremes (Chapter 3) present in the region. For example, Griffiths et al. (1990) reported
that there was strong seasonal variation in nitrogen cycle transformation rates affected by
changes in moisture, light and temperature.
5.2 Future research
From the earlier discussion, further research is recommended.
5.2.1 ECM fungi
Descomyces-like and other ECM fungi were observed under Hysterangium mats and litter
on the forest floor. Other ECM mats, mostly ephemeral in nature, were also observed to be
present under tuart at certain times of the year but they were not studied. The role that the
diversity of ECM fungi and ECM fungal mats play in tuart health and soil quality should
be considered.
The role of Hysterangium MURU6276 ECM on tuart productivity and health should be
considered under nursery and field conditions. Research on inoculation methods and
inoculum dosage should be considered and conducted at the first stage. Following that, the
potential of Hysterangium to assist the recovery of degraded tuart forests can be
investigated under field conditions.
Analysis of the 25S gene region for Hysterangium MURU6276 should be conducted
because many of the Hysterangium sequences coming from Australia on Genbank were
based on the analysis of this gene region. A full taxonomic study is required to identify
Hysterangium MURU6276 to the species level. This will involve the collection and
curation of Hysterangium taxa more broadly in the region.
99
5.2.2 Fungal mats
To fully understand biochemical and microbial process in Hysterangium mats, soil and mat
sampling in the dry season as well as the periods before and after the dry period are
recommended for future research.
To support the understanding of biochemical processes under Hysterangium mats,
assessing the effect of fungal mats on the activity of the main soil enzymes (chitinase,
phosphatase, amidase, glucosidase) which are involved in C, N and P cycling should be
investigated. Following that, the relationship between enzyme activity and the affect of
Hysterangium mats on litter decomposition, degradation of lignin and cellulose should be
considered.
More generally, there is a need for research more widely on Hysterangium mats in
eucalypt ecosystems including declining stands of tuarts, and relationships between the
fungal mats, fire regimes and diseases such as those caused by Phytophthora.
Furthermore, attention should be paid to the molecular profiling of soil microbial
communities for further understanding of the function and diversity of bacterial
populations under Hysterangium mats.
5.2.3 Bacterial associated with fungal mats
Molecular identification of the bacteria of interest which showed beneficial properties and
PGP effect in this study by analysis of 16S rRNA gene sequences should be conducted.
The isolates with beneficial properties include T2M2, T2M3 (IAA production and
phosphate solubilization); T2M4 (IAA production); T4N3 and T4N8 (ACC deaminase
production) while the best isolates with their ability to growth promotion were T1M3,
T1N2, T2N7, T3N4, T4N4 and T4N6.
100
Some further approaches to screening potential PGPR are suggested. Firstly, quantitative
methods should be used to assess the efficacy of the bacteria with ACC deaminase
production. Secondly, three bacterial isolates which inhibited the growth of the mycelium
of Hysterangium MURU6276 (Chapter 4) can be screened as a potential biocontrol agent
against fungal pathogens for tuart. Finally, screening bacteria for water repellency in
hydrophobic Hysterangium mats is an interesting topic. These bacteria should be tested in
dry sites for any ability to promote plant fitness.
A different approach should be explored to screen MHB from the Hysterangium mats.
Instead of investigating MHB from the mat soils, potential MHB should be isolated from
basidiomes of Hysterangium and their ECMs. Because of the Hysterangium mat’s
hydrophobicity, some other aspects of MHB which should also be considered including
how bacteria can survive in the hydrophobic environment and how these bacteria acquire
water from within the mats. In addition, PAF medium is recommended for future research
to detect fluorescent pseudomonads.
Finally, as time constraints did not allow the bacteria to be assessed with and without
Hysterangium MURU6276 in the rhizosphere of eucalypts in soil in the greenhouse, this
should be investigated.
In conclusion, this Masters thesis has provided some insight into Hysterangium mats under
tuart, but much more research needs to be done before an understanding of the role of
these mats in eucalypt forests can be realized.
101
APPENDICES
102
Appendix 1: Media, reagents and buffer
MMN Medium (g/L)
(NH4)2HPO4 0.25 FeCl3 0.001
KH2PO4 0.5 Glucose 10
MgSO4.7H2O 0.15 Malt extract 3
CaCl2 0.05 Thiamine HCl 0.0001
NaCl 0.025 Agar 18
Distilled water
Adjusted to pH 5.8
1000 ml
DF Salts Minimal Medium (g/L)
K2HPO4 4 Trace elements 0.1 ml
Na2HPO4 6 FeSO4.7H2O 0.1 ml
MgSO4.7H2O 0.2 (NH4)2SO4 2.0
Glucose 2 Agar 18
Gluconic acid 2 Distilled water 1000 ml
Citric Acid 2 Adjusted to pH 7.2
Trace Elements
H3BO3 10 mg CuSO4.5H2O 78.22 mg
MnSO4.H2O 11.19 mg MoO3 10 g
ZnSO4.7H2O 124.6 mg Sterile distilled water 100 ml
Add one ingredient at a time, ensuring it is dissolved. Store at 4oC.
FeSO4.7H2O Solution
FeSO4.7H2O 100 mg
Sterile distilled H2O 10 ml
Can be stored at 4oC for several months
Pikovskaya Medium (g/L)
Ca5HO13P3 5 g KCl 0.2 g
Glucose 10 g Yeast Extract 0.5 g
(NH4)2SO4 0.5 g MnSO4.H2O 0.002 g
NaCl 0.2 g FeSO4.7H2O 0.002 g
MgSO4.7H2O 0.1 g Distilled water 1000 ml
103
Glucose Peptone Broth (g/L)
Glucose 10 g
Peptone 5 g
Distilled water 1000 ml
Adjusted to pH 7.0
4 M Sodium Acetate Buffer
164.1 g Na-acetate is dissolved in 500 mL of distilled water. 4 M acetic acid is made up by
adding 230 mL glacial acetic acid to 500 mL DI water, and then making to 1000 mL
volume. To prepare buffer, adjust the pH of the sodium acetate solution to pH 5.5 using
the 4 M acetic acid.
Collidine Solvent
100 mL ethanol and 10 mL collidine (2,4,6-trimethylpyridine) are combined and made up
to 1000 mL with DI water. The solution should be stored in another container because of
high toxicity.
Leucine Standards
A stock of 500 ppm leucine is made by dissolving 0.4707 g leucine in 100 mL of distilled
water, and a stock of 100 ppm is made by diluting 2 mL of 500 ppm to 100 mL in DI
water. Store at 4- 10oC.
Ninhydrin Reagent
10.0 g ninhydrin and 1.0 g hydrindantin are dissolved in 250 mL dimethylsulfoxide. 250
mL of the 4 M sodium acetate buffer is then added. When the acetate is added, the reagent
changes from bright yellow to a deep red colour.
Salkowski Reagent
0.5 M FeCl3 2 ml
35% perchloric acid 98 ml
104
Appendix 2: Sole carbon sources used in Biolog EcoPlate
Carbohydrates Carboxylic acids Amino acids
β-Methyl-D-Glucoside D-Galactoric Acid γ-
Lactone
L-Arginine
D-Xylose D-Galacturonic Acid L-Asparagine
i-Erythritol 2-Hydroxy Benzoic Acid L-Phenylalanine
D-Mannitol 4-Hydroxy Benzoic Acid L-Serine
N-Acetyl-D-Glucosamine γ-Hydroxybutyric Acid L-Threonine
D-Cellobiose D-Glucosaminic Acid
α-D-Lactose Itaconic Acid Esters
D-Malic Acid Glycyl-L-Glutamic Acid Pyruvic Acid Methyl Ester
α-Ketobutyric Acid
Polymers Phosphorylated chemicals Amines
Tween 40 Glucose-1-Phosphate Phenylethyl-Amine
Tween 80 D,L-α-Glycerol Phosphate Putrescine
α-Cyclodextrin
Glycogen
105
Appendix 3: DNA sequences and BLAST search results
GW777C04 sequence from fruiting body under mats
AGGTCAGATTGTGATTAACATTTGTCCGAAGACGACTGTAAGCCACCCACACGAC
CGGCCGACGCGAGTGAGTTTATTTCTTATCACACCGTTGTCGATGAAACCGAGGTG
GGAAACAGCTAATGCATTTCGAGACGAGCCACCTTCAACGACGGCAACGTCCAAA
TCCGAACCCCGACACAACAAAGGTCGGGGACGAGAGACTTCACGACACTCAAAC
AGGCATGCTCCTCGGAATGCCAAGGAGCGCAAGATGCGTTCAAAGATTCGATGAT
TCACTGAATTCTGCAATTCACATTACGTTTCGCGCTTTCGCGGCGTTCTTCATCGAT
GCGAAAGCCAAGAGATCCGTTGTTGAAAGTTGTATTAAGTTTGCGCTCCGTAGAG
CCTACTAGACATGCTTCGTTACAAGTGCCATTGAATATAAAAGTGTAGCGGACCG
CCTCGACCCGAGGGGTCAGCACGGTCCACTGGGTGCACAGGTGTGTGTGTAATGT
GTATTCTCCAGGGCGGGCACGCACACATGGCAATTAAGTCTGGACAGGGGCGAAC
CCCATCTACAGTTAAGCCTGCGTATGCGCTCGGCCTCTAAGGCCCAGCCACTTCGC
GCCTTGCTGGTCGCTACGATAAACCCCGCTAAAAACATTGTCGGACGCTTGATGAT
TTGATACTGTAATGATCCTTCCGCAGT
AW1693E07 sequence from ECM tip under fungal mats
AGGGGAGAGGTTGTCGACCTGGATTTGAGGTCAGATTGTGATTAACATTTGTCCG
AAGACGACTGTAAGCCACCCACACGACCGGCCGACGCGAGTGAGTTTATTTCTTA
TCACACCGTTGTCGATGAAACCGAGGTGGGAAACAGCTAATGCATTTCGAGACGA
GCCACCTTCAACGACGGCAACGTCCAAATCCGAACCCCGACACAACAAAGGTCGG
GGACGAGAGACTTCACGACACTCAAACAGGCATGCTCCTCGGAATGCCAAGGAGC
GCAAGATGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACGTT
TCGCGCTTTCGCGGCGTTCTTCATCGATGCGAAAGCCAAGAGATCCGTTGTTGAAA
GTTGTATTAAGTTTGCGCTCCGTAGAGCCTACTAGACCTGCTTCGTTACAAGTGCC
ATTGAATATAAAAGTGTAGCGGACCGCCTCGACCCGAGGGGTCAGCACGGTCCAC
TGGGTGCACAGGTGTGTGTGTAATGTGTATTCTCCAGGGCGGGCACGCACACATG
GCAATTAAGTCTGGACAGGGGCGAACCCCATCTACAGTTAAGCCTGCGTATGCGC
TCGGCCTCTAAGGCCCAGCCACTTCGCGCCTTGCTGGTCGCTACGATAAACCCCGC
TAAAAACATTGTCGGACGCTTGATGATTTGATACTGTAATGATCCTTCCGCAGGTT
CACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCAAG
106
BLAST search results of fungal DNA sequence isolated from ECM basidiome
Order
number
Genbank
locus
BLAST search results Percentage
of identity
Class of fungi
1 JN652950 Uncultured Hysterangium 94.1% Agaricomycetes
2 AJ878737 Lysurus cruciatus 90.6% Agaricomycetes
3 JF960786 Uncultured Hysterangiales 90.3% Agaricomycetes
4 GQ981501 Clathrus ruber 90.2% Agaricomycetes
5 GQ981492 Austrogautieria macrospora 90.0% Agaricomycetes
6 HM234152 Uncultured Hysterangium 89.7% Agaricomycetes
7 HQ533034 Gallacea eburnea 88.8% Agaricomycetes
8 AJ408384 Ramaria pseudogracilis 87.9% Agaricomycetes
9 EU669369 Ramaria rainierensis 87.7% Agaricomycetes
10 JQ408222 Ramaria cf. 87.6% Agaricomycetes
11 EU258553 Ramaria gracilis 87.5% Agaricomycetes
12 AJ408383 Ramaria abietina 87.4% Agaricomycetes
13 DQ365605 Ramaria sp. 87.3% Agaricomycetes
14 DQ974736 Hysterangium sp. 87.1% Agaricomycetes
15 AF442098 Ramaria aff. 86.7% Agaricomycetes
16 HQ533033 Hysterangium sp. 86.7% Agaricomycetes
17 EU819419 Ramaria stricta 86.6% Agaricomycetes
18 HM234149 Uncultured Hysterangium 86.3% Agaricomycetes
107
Appendix 4: Bacteria isolates used in assay of effect of bacteria on growth of eucalypt
seedlings in vitro (Chapter 4)
Isolate Source Reason chosen
T2M2 YNP*, eucalypt woodland IAA production
T2M3 YNP, eucalypt woodland IAA production
T3N2 YNP, eucalypt woodland IAA production
T3M2 YNP, eucalypt woodland IAA production
T4N4 YNP, eucalypt woodland IAA production
T4N6 YNP, eucalypt woodland IAA production
T1M3 YNP, eucalypt woodland IAA production
T3N4 YNP, eucalypt woodland IAA production
T1N1 YNP, eucalypt woodland IAA production
T4N7 YNP, eucalypt woodland IAA production
T4M4 YNP, eucalypt woodland IAA production
T2N3 YNP, eucalypt woodland IAA production
T1M2 YNP, eucalypt woodland IAA production
T2N7 YNP, eucalypt woodland IAA production
T3M1 YNP, eucalypt woodland IAA production
T2N5 YNP, eucalypt woodland IAA production
T4N5 YNP, eucalypt woodland IAA production
T4M3 YNP, eucalypt woodland IAA production
T2N1 YNP, eucalypt woodland IAA production
T3N1 YNP, eucalypt woodland IAA production
T2M1 YNP, eucalypt woodland IAA production
T4N3 YNP, eucalypt woodland IAA production
T1M1 YNP, eucalypt woodland IAA production
T3M4 YNP, eucalypt woodland IAA production
T4M1 YNP, eucalypt woodland IAA production
T2N4 YNP, eucalypt woodland IAA production
T1N2 YNP, eucalypt woodland P solubilization
T4N8 YNP, eucalypt woodland ACC deaminase activity
PMK4 Meckering, agricultural land Known PGPR in annual crops
NCH7 Chittering, agricultural land Known PGPR in annual crops
PMK9 Meckering, agricultural land Known PGPR in annual crops
NCH45 Chittering, agricultural land Known PGPR in annual crops
* Yalgorup National Park
108
REFERENCES
Abarenkov K, Henrik Nilsson R, Larsson K-H, Alexander I J, Eberhardt U, Erland S, Høiland K, Kjøller R, Larsson E, Pennanen T, Sen R, Taylor A F S, Tedersoo L, Ursing B M, Vrålstad T, Liimatainen K, Peintner U and Kõljalg U 2010 The UNITE database for molecular identification of fungi-recent updates and future perspectives. New Phytologist 186, 281-285.
Aguilera L M, Griffiths R P and Caldwell B A 1993 Nitrogen in ectomycorrhizal mat and non-mat soils of different-age Douglas-fir forests. Soil Biology and Biochemistry 25, 1015-1019.
Akkermans A D L, van Elsas J D and de Bruijn F 1995 Molecular microbial ecology manual. Kluwer Academic, Dordrecht, The Netherlands.
Ali N A and Jackson R M 1989 Stimulation of germination of spores of some ectomycorrhizal fungi by other micro-organisms. Mycological Research 93, 182-186.
Alves L, Oliveira V L and Silva Filho G N 2010 Utilization of rocks and ectomycorrhizal fungi to promote growth of eucalypt. Brazilian Journal of Microbiology 41, 676-684.
Amann R I, Ludwig W and Schleifer K H 1995 Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiological Reviews 59, 143-169.
Amato M and Ladd J 1988a Assay for microbial biomass based on ninhydrin-reactive nitrogen in extracts of fumigated soils. Soil Biology and Biochemistry 20, 107-114.
Amato M and Ladd J 1994 Application of the ninhydrin-reactive N assay for microbial biomass in acid soils. Soil Biology and Biochemistry 26, 1109-1115.
Anderson A J 1988 Mycorrhizae-host specificity and recognition. Phytopathology 78, 375-378. Anderson J and Domsch K 1978 A physiological method for the quantitative measurement of
microbial biomass in soils. Soil Biology and Biochemistry 10, 215-221. Andjic V, Barber P A, Carnegie A J, Hardy G S J, Wingfield M J and Burgess T I 2007 Phylogenetic
reassessment supports accommodation of Phaeophleospora and Colletogloeopsis from eucalypts in Kirramyces. Mycological Research 111, 1184-1198.
Aspray T J, Frey-Klett P, Jones J E, Whipps J M, Garbaye J and Bending G D 2006 Mycorrhization helper bacteria: a case of specificity for altering ectomycorrhiza architecture but not ectomycorrhiza formation. Mycorrhiza 16, 533-541.
Balser T C, Kirchner J W and Firestone M K 2002 Methodological variability in microbial community level physiological profiles. Soil Science Society of America Journal 66, 519-523.
Barea J-M 2002 Mycorrhizosphere interactions to improve plant fitness and soil quality. Antonie van Leeuwenhoek 81, 343-351.
Bashan Y and Holguin G 2002 Plant growth-promoting bacteria: a potential tool for arid mangrove reforestation. Trees-Structure and Function 16, 159-166.
Beall F and Tipping B 1989 Plant growth-promoting rhizobacteria in forestry. Proceedings of the forest research marketing. Abstract 117, Ontario Forest Research Committee, Toronto.
Bending G D 2007 What are the mechanisms and specificity of mycorrhization helper bacteria? New Phytologist 174, 707-710.
Bending G D, Poole E J, Whipps J M and Read D J 2002 Characterisation of bacteria from Pinus sylvestris–Suillus luteus mycorrhizas and their effects on root–fungus interactions and plant growth. FEMS Microbiology Ecology 39, 219-227.
Bertaux J, Schmid M, Hutzler P, Hartmann A, Garbaye J and Frey-Klett P 2005a Occurrence and distribution of endobacteria in the plant-associated mycelium of the ectomycorrhizal fungus Laccaria bicolor S238N. Environmental Microbiology 7, 1786-1795.
Bertaux J, Schmid M, Hutzler P, Hartmann A, Garbaye J and Frey Klett P 2005b Occurrence and distribution of endobacteria in the plant associated mycelium of the ectomycorrhizal fungus Laccaria bicolor S238N. Environmental Microbiology 7, 1786-1795.
Blair G J, Chinoim N, Lefroy R D B, Anderson G and Crocker G 1991 A soil sulfur test for pastures and crops. Soil Research 29, 619-626.
109
Bloem J, Hopkins D W and Benedetti A 2006 Microbiological Methods For Assessing Soil Quality. CABI.
Boasson R and Shaw M 1979 Colony initiation in flax rust in axenic culture: involvement of a volatile factor. Canadian Journal of Botany 57, 2657-2662.
Bolwerk A, Lagopodi A L, Lugtenberg B J J and Bloemberg G V 2005 Visualization of interactions between a pathogenic and a beneficial Fusarium strain during biocontrol of tomato foot and root rot. Molecular Plant-Microbe Interactions 18, 710-721.
Bonfante P and Anca I A 2009 Plants, mycorrhizal fungi, and bacteria: A network of interactions. Annual Review of Microbiology 63, 363-383.
Brookes P 2001 The soil microbial biomass: concept, measurement and applications in soil ecosystem research. Microbes and Environments 16, 131-140.
Brulé C, Frey-Klett P, Pierrat J C, Courrier S, Gérard F, Lemoine M C, Rousselet J L, Sommer G and Garbaye J 2001 Survival in the soil of the ectomycorrhizal fungus Laccaria bicolor and the effects of a mycorrhiza helper Pseudomonas fluorescens. Soil Biology and Biochemistry 33, 1683-1694.
Brundrett M, Malajczuk N, Mingqin G, Daping X, Snelling S and Dell B 2005 Nursery inoculation of Eucalyptus seedlings in Western Australia and Southern China using spores and mycelial inoculum of diverse ectomycorrhizal fungi from different climatic regions. Forest Ecology and Management 209, 193-205.
Brundrett M C and Cairney J W G 2004 Ectomycorrhizas in Plant Communities. In Microorganisms in Plant Conservation and Biodiversity. Eds. K Sivasithamparama, K W Dixon and R L Barrett. pp 105-150. Springer Netherlands.
Burd G I, Dixon D G and Glick B R 1998 A plant growth-promoting bacterium that decreases nickel toxicity in seedlings. Applied and Environmental Microbiology 64, 3663.
Burgess T 1995 Changes in protein biosynthesis associated with the development of Pisolithus-Eucalyptus grandis ectomycorrhizas. Phd diss, Murdoch University, Perth.
Burgess T and Dell B 1996 Changes in protein biosynthesis during the differentiation of Pisolithus-Eucalyptus grandis ectomycorrhiza. Canadian Journal of Botany 74, 553-560.
Burgess T, Dell B and Malajczuk N 1994a Variation in mycorrhizal development and growth stimulation by 20 Pisolithus isolates inoculated on to Eucalyptus grandis W. Hill ex Maiden. New Phytologist 127, 731-739.
Burgess T, Dell B and Malajczuk N 1994b Variation in mycorrhizal development and growth stimulation by 20 Pisolithus isolates inoculated onto Eucalyptus grandis W. Hill ex Maiden. New Phytologist 127, 731-739.
Burgess T, Dell B and Malajczuk N 1996 In vitro synthesis of Pisolithus-Eucalyptus ectomycorrhizae: synchronization of lateral tip emergence and ectomycorrhizal development. Mycorrhiza 6, 189-196.
Buyer J S and Drinkwater L E 1997 Comparison of substrate utilization assay and fatty acid analysis of soil microbial communities. Journal of Microbiological Methods 30, 3-11.
Cai Y F, Barber P, Dell B, O'Brien P, Williams N, Bowen B and Hardy G 2010 Soil bacterial functional diversity is associated with the decline of Eucalyptus gomphocephala. Forest Ecology and Management 260, 1047-1057.
Caldwell B, Castellano M and Griffiths R 1991 Fatty acid esterase production by ectomycorrhizal fungi. Mycologia 83, 233-236.
Can T O and Nonaka M 2002 Effect of difference in fumigation period on the accumulation of ninhydrin-reactive compounds in Japanese Andosols. Soil Science and Plant Nutrition 48, 279-282.
Cao Y, Fu S, Zou X and Cao H 2010 Soil microbial community composition under Eucalyptus plantations of different age in subtropical China. European Journal of Soil Biology 46, 128-135.
Carter M 1991 Ninhydrin-reactive N released by the fumigation-extraction method as a measure of microbial biomass under field conditions. Soil Biology and Biochemistry 23, 139-143.
110
Castellano M A and Beever R E 1994 Truffle-like Basidiomycotina of New Zealand: Gallacea, Hysterangium, Phallobata, and Protubera. New Zealand Journal of Botany 32, 305-328.
Castellano M A and Bougher N L 1994 Consideration of the taxonomy and biodiversity of Australian ectomycorrhizal fungi. Plant and Soil 159, 37-46.
Chaia E E 2010 Life in soil by the actinorhizal root nodule endophyte Frankia. A review. Symbiosis (Philadelphia, Pa.) 51, 201-226.
Chanway C and Holl F 1991 Biomass increase and associative nitrogen fixation of mycorrhizal Pinus contorta seedlings inoculated with a plant growth promoting Bacillus strain. Canadian Journal of Botany 69, 507–511.
Chanway C, Radley R and Holl F 1991 Inoculation of conifer seed with plant growth promoting Bacillus strains causes increased seedling emergence and biomass. Soil Biology and Biochemistry 23, 575-580.
Chanway C P 1995 Differential response of western hemlock from low and high elevations to inoculation with plant growth-promoting Bacillus polymyxa. Soil Biology and Biochemistry 27, 767-775.
Chanway C P 2000 Endophytic colonization and field responses of hybrid spruce seedlings after inoculation with plant growth-promoting rhizobacteria. Forest Ecology and Management 133, 81.
Chanway C P and Holl F B 1994 Ecological growth-response specificity of 2 Douglas-fir ecotypes inoculated with coexistent beneficial rhizosphere bacteria. Canadian Journal of Botany 72, 582-586.
Chappelka A H, Estes B L and Enebak S A 2004 Loblolly pine seedling growth after inoculation with plant growth-promoting rhizobacteria and ozone exposure. Canadian Journal of Forest Research 34, 1410-1416.
Chau H W, Si B C, Goh Y K and Vujanovic V 2009 A novel method for identifying hydrophobicity on fungal surfaces. Mycological Research 113, 1046-1052.
Chen Y L, Kang L H and Dell B 2006 Inoculation of Eucalyptus urophylla with spores of Scleroderma in a nursery in south China: Comparison of field soil and potting mix. Forest Ecology and Management 222, 439-449.
Chin-A-Woeng T F C, Bloemberg G V, van der Bij A J, van der Drift K M G M, Schripsema J, Kroon B, Scheffer R J, Keel C, Bakker P A H M and Tichy H V 1998 Biocontrol by Phenazine-1-carboxamide-Producing Pseudomonas chlororaphis PCL1391 of tomato root rot caused by Fusarium oxysporum f. sp. radicis-lycopersici. Molecular Plant-microbe Interactions 11, 1069-1077.
Claridge A W, Barry S C, Cork S J and Trappe J M 2000 Diversity and habitat relationships of hypogeous fungi. II. Factors influencing the occurrence and number of taxa. Biodiversity and Conservation 9, 175-199.
Colwell J 1965 An automatic procedure for the determination of phosphorus in sodium hydrogen carbonate extracts of soils. Chemistry and Industry 14, 893-895.
Cromack Jr K, Fichter B, Moldenke A, Entry J and Ingham E 1988 Interactions between soil animals and ectomycorrhizal fungal mats. Agriculture, Ecosystems and Environment 24, 161-168.
Cromack Jr K, Sollins P, Graustein W C, Speidel K, Todd A W, Spycher G, Li C Y and Todd R L 1979 Calcium oxalate accumulation and soil weathering in mats of the hypogeous fungus Hysterangium crassum. Soil Biology and Biochemistry 11, 463-468.
Dalal R C 1998 Soil microbial biomass—what do the numbers really mean? Australian Journal of Experimental Agriculture 38, 649-665.
Dashti N, Zhang F, Hynes R and Smith D L 1998 Plant growth promoting rhizobacteria accelerate nodulation and increase nitrogen fixation activity by field grown soybean Glycine max (L.) Merr. under short season conditions. Plant and Soil 200, 205-213.
Deepa C, Dastager S and Pandey A 2010 Isolation and characterization of plant growth promoting bacteria from non-rhizospheric soil and their effect on cowpea (Vigna unguiculata (L.) Walp.) seedling growth. World Journal of Microbiology and Biotechnology 26, 1233-1240.
111
Dell B, Bowen B, Barber P and Thomas S 2006 Beneficial fungi and the health of tuart. Tuart decline research findings. Tuart bulletin No.8.
Dell B, N. Malajczuk, T.S. Grove and G Thomson 1990 Ectomycorrhiza formation in Eucalyptus. IV. Ectomycorrhizas on the sporocarps of the hypogeous fungi Mesophellia and Castorium in eucalypt forests of Western Australia. The New phytologist 114, 449-456.
Díaz K, Valiente C, Martínez M, Castillo M and Sanfuentes E 2009 Root-promoting rhizobacteria in Eucalyptus globulus cuttings. World Journal of Microbiology and Biotechnology 25, 867-873.
Duan J, Müller K, Charles T, Vesely S and Glick B 2009 1-Aminocyclopropane-1-Carboxylate (ACC) deaminase genes in rhizobia from Southern Saskatchewan. Microbial Ecology 57, 423-436.
Dunham S, Larsson K-H and Spatafora J 2007 Species richness and community composition of mat-forming ectomycorrhizal fungi in old- and second-growth Douglas-fir forests of the HJ Andrews Experimental Forest, Oregon, USA. Mycorrhiza 17, 633-645.
Dunstan W A, Malajczuk N and Dell B 1998 Effects of bacteria on mycorrhizal development and growth of container grown Eucalyptus diversicolor F. Muell. seedlings. Plant and Soil 201, 241-249.
Duponnois and Plenchette 2003 A mycorrhiza helper bacterium enhances ectomycorrhizal and endomycorrhizal symbiosis of Australian Mycorrhiza 13, 85-91.
Duponnois R and Didier L 2004 Sporocarps of Pisolithus albus as an ecological niche for fluorescent pseudomonads involved in Acacia mangium Wild - Pisolithus albus ectomycorrhizal symbiosis. Canadian Journal of Microbiology 50, 691-696.
Duponnois R and Garbaye J 1990 Some mechanisms involved in growth stimulation of ectomycorrhizal fungi by bacteria. Canadian Journal of Botany 68, 2148-2152.
Duponnois R and Garbaye J 1991a Effect of dual inoculation of Douglas fir with the ectomycorrhizal fungus Laccaria laccata and mycorrhization helper bacteria (MHB) in two bare-root forest nurseries. Plant and Soil 138, 169-176.
Duponnois R and Garbaye J 1991b Mycorrhization helper bacteria associated with the Douglas fir-Laccaria laccata symbiosis: effects in aseptic and in glasshouse conditions. Annals of Forest Science 48, 239-251.
Duponnois R and Garbaye J 1991c Mycorrhization helper bacteria associated with the Douglas fir-Laccaria laccata symbiosis: effects in aseptic and in glasshouse conditions. pp 239-251.
Duponnois R, Garbaye J, Bouchard D and Churin J L 1993 The fungus-specificity of mycorrhization helper bacteria (MHBs) used as an alternative to soil fumigation for ectomycorrhizal inoculation of bare-root Douglas-fir planting stocks with Laccaria laccata. Plant and Soil 157, 257-262.
Enebak S 2005 Rhizobacteria Isolated from loblolly pine seedlings mediate growth-promotion of greenhouse-grown loblolly, slash, and longleaf pine seedlings. Forest Science 51, 541-545.
Enebak S, Wei G and Kloepper J 1998 Effects of plant growth-promoting rhizobacteria on loblolly and slash pine seedlings. Forest Science 44, 139-144.
Entry J A, Donnelly P K and Cromack K 1991a Influence of ectomycorrhizal mat soils on lignin and cellulose degradation. Biology and Fertility of Soils 11, 75-78.
Entry J A, Rose C L and Cromack Jr K 1991b Litter decomposition and nutrient release in ectomycorrhizal mat soils of a Douglas fir ecosystem. Soil Biology and Biochemistry 23, 285-290.
Entry J A, Rose C L and Cromack K 1992 Microbial biomass and nutrient concentrations in hyphal mats of the ectomycorrhizal fungus Hysterangium setchellii in a coniferous forest soil. Soil Biology and Biochemistry 24, 447-453.
Founoune H, Duponnois R, Ba A M, Sall S, Branget I, Lorquin J, Neyra M and Chotte J L 2002a Mycorrhiza Helper Bacteria stimulate ectomycorrhizal symbiosis of Acacia holosericea with Pisolithus alba. New Phytologist 153, 81-89.
112
Founoune H, Duponnois R, Meyer J M, Thioulouse J, Masse D, Chotte J L and Neyra M 2002b Interactions between ectomycorrhizal symbiosis and fluorescent pseudomonads on Acacia holosericea: isolation of mycorrhiza helper bacteria (MHB) from a Soudano Sahelian soil. FEMS Microbiology Ecology 41, 37-46.
Frey-Klett P, Churin J-L, Pierrat J-C and Garbaye J 1999 Dose effect in the dual inoculation of an ectomycorrhizal fungus and a mycorrhiza helper bacterium in two forest nurseries. Soil Biology and Biochemistry 31, 1555-1562.
Frey Klett P, Garbaye J and Tarkka M 2007 The mycorrhiza helper bacteria revisited. New Phytologist 176, 22-36.
Friedman J, Hutchins A, Li C and Perry D 1989 Actinomycetes inducing phytotoxic or fungistatic activity in a Douglas-fir forest and in an adjacent area of repeated regeneration failure in southwestern Oregon. Biologia Plantarum 31, 487-495.
Frostegard A, Baath E and Tunlio A 1993 Shifts in the structure of soil microbial communities in limed forests as revealed by phospholipid fatty acid analysis. Soil Biology and Biochemistry 25, 723-730.
Garbaye J 1994 Tansley Review No. 76 Helper bacteria: a new dimension to the mycorrhizal symbiosis. New Phytologist 128, 197-210.
Garbaye J and Bowen G 1987 Effect of different microflora on the success of ectomycorrhizal inoculation of Pinus radiata. Canadian Journal of Forest Research 17, 941-943.
Garbaye J and Bowen G D 1989 Stimulation of ectomycorrhizal infection of Pinus radiata by some microorganisms associated with the mantle of ectomycorrhizas. New Phytologist 112, 383-388.
Garbaye J, Churin J L and Duponnois R 1992 Effects of substrate sterilization, fungicide treatment, and mycorrhization helper bacteria on ectomycorrhizal formation of pedunculate oak (Quercus robur) inoculated with Laccaria laccata in two peat bare-root nurseries. Biology and Fertility of Soils 13, 55-57.
Garbaye J and Duponnois R 1993 Specificity and function of mycorrhization helper bacteria (MHB) associated with the Pseudotsuga menziesii-Laccaria laccata symbiosis. Symbiosis 14, 335-344.
Garbaye J, Duponnois R and Wahl J 1990 The bacteria associated with Laccaria laccata ectomycorrhizas or sporocarps: effect of symbiosis establishment on Douglas fir. Symbiosis 9, 267-273.
Gardes M and Bruns T 1993 ITS primers with enhanced specificity for basidiomycetes‐application to the identification of mycorrhizae and rusts. Molecular Ecology 2, 113-118.
Garland J L and Mills A L 1991 Classification and characterization of heterotrophic microbial communities on the basis of patterns of community-level sole-carbon-source utilization. Applied and Environmental Microbiology 57, 2351-2359.
Glen M, Tommerup I, Bougher N and O'Brien P 2002 Are Sebacinaceae common and widespread ectomycorrhizal associates of Eucalyptus species in Australian forests? Mycorrhiza 12, 243-247.
Glick B, Cheng Z, Czarny J and Duan J 2007 Promotion of plant growth by ACC deaminase-producing soil bacteria. European Journal of Plant Pathology 119, 329-339.
Gonzalez-Quiñones V, Stockdale E, Banning N, Hoyle F, Sawada Y, Wherrett A, Jones D and Murphy D 2011 Soil microbial biomass-Interpretation and consideration for soil monitoring. Soil Research 49, 287-304.
Graham G, Mayer P and Henry R 1994 A simplified method for preparation of fungal DNA for PCR and RAPID analysis. Biotechniques 16, 48-50.
Grenville D, Peterson R and Ashford A 1986 Synthesis in growth pouches of mycorrhizae between Eucalyptus pilularis and several strains of Pisolithus tinctorius. Australian Journal of Botany 34, 95-102.
Grgurinovic C A 1998 Larger Fungi of South Australia. Botanic Gardens of Adelaide and State Herbarium.
113
Grierson P, Comerford N and Jokela E 1998 Phosphorus mineralization kinetics and response of microbial phosphorus to drying and rewetting in a Florida spodosol. Soil Biology and Biochemistry 30, 1323-1331.
Griffiths R, Baham J and Caldwell B 1994 Soil solution chemistry of ectomycorrhizal mats in forest soil. Soil Biology and Biochemistry 26, 331-337.
Griffiths R, Castellano M and Caldwell B 1991a Hyphal mats formed by two ectomycorrhizal fungi and their association with Douglas-fir seedlings: A case study. Plant and Soil 134, 255-259.
Griffiths R, Ingham E, Caldwell B, Castellano M and Cromack K 1991b Microbial characteristics of ectomycorrhizal mat communities in Oregon and California. Biology and Fertility of Soils 11, 196-202.
Griffiths R P, Caldwell B A, Cromack Jr K and Morita R Y 1990 Douglas-fir forest soils colonized by ectomycorrhizal mats. I. Seasonal variation in nitrogen chemistry and nitrogen cycle transformation rates. Canadian Journal of Forest Research 20, 211-218.
Gyaneshwar P, Naresh Kumar G, Parekh L J and Poole P S 2002 Role of soil microorganisms in improving P nutrition of plants. Plant and Soil 245, 83-93.
Haas D and Keel C 2003 Regulation of antibiotic production in root-colonizing Pseudomonas spp. and relevance for biological control of plant disease. Annual Review of Phytopathology 41, 117-153.
Heuer H, Hartung K, Wieland G, Kramer I and Smalla K 1999 Polynucleotide probes that target a hypervariable region of 16S rRNA genes to identify bacterial isolates corresponding to bands of community fingerprints. Applied and Environmental Microbiology 65, 1045-1049.
Holl F B and Chanway C P 1992 Rhizosphere colonization and seedling growth promotion of lodgepole pine by Bacillus polymyxa. Canadian Journal of Microbiology 38, 303-308.
Horton T R and Bruns T D 2001 The molecular revolution in ectomycorrhizal ecology: peeking into the black-box. Molecular Ecology 10, 1855-1871.
Illmer P and Schinner F 1992 Solubilization of inorganic phosphates by microorganisms isolated from forest soils. Soil Biology and Biochemistry 24, 389-395.
Imolehin E and Grogan R 1980 Effect of oxygen, carbon dioxide, and ethylene on growth, sclerotial production, germination, and infection by Sclerotinia minor. Phytopathology 70, 158-1161.
Ingham E, Griffiths R, Cromack K and Entry J 1991 Comparison of direct vs fumigation incubation microbial biomass estimates from ectomycorrhizal mat and non-mat soils. Soil Biology and Biochemistry 23, 465-471.
Islam K and Weil R 1998 Microwave irradiation of soil for routine measurement of microbial biomass carbon. Biology and Fertility of Soils 27, 408-416.
Izumi H and Finlay R D 2011 Ectomycorrhizal roots select distinctive bacterial and ascomycete communities in Swedish subarctic forests. Environmental Microbiology 13, 819-830.
Jackson M B Ed. 1991 Ethylene in root growth and development. pp. 259-278. Jackson R 1989 Stimulation of germination of spores of some ectomycorrhizal fungi by other
microorganisms. Mycological Research 93, 182-186. Jeffries P, Gianinazzi S, Perotto S, Turnau K and Barea J M 2003 The contribution of arbuscular
mycorrhizal fungi in sustainable maintenance of plant health and soil fertility. Biology and Fertility of Soils 37, 1-16.
Jenkinson D 1988 Determination of microbial biomass carbon and nitrogen in soil. In Advance in Nitrogen Cycling in Agricultural Ecosystems. Ed. J R Wilson. pp 368-386, Commonwealth Agricultural Bureau International, Wallingford.
Jenkinson D and Powlson D 1976 The effects of biocidal treatments on metabolism in soiI. Fumigation with chloroform. Soil Biology and Biochemistry 8, 167-177.
Jenkinson D S and Oades J 1979 A method for measuring adenosine triphosphate in soil. Soil Biology and Biochemistry 11, 193-199.
114
Joergensen R and Brookes P 1990 Ninhydrin-reactive nitrogen measurements of microbial biomass in 0.5 M K2SO4 soil extracts. Soil Biology and Biochemistry 22, 1023-1027.
Joergensen R G 1996 Quantification of the microbial biomass by determining ninhydrin-reactive N. Soil Biology and Biochemistry 28, 301-306.
Johri B, Sharma A and Virdi J 2003 Rhizobacterial diversity in India and its influence on soil and plant health. Biotechnology in India I, 49-89.
Jumpponen A, Claridge A, Trappe J, Lebel T and Claridge D 2004 Ecological relationships among hypogeous fungi and trees: inferences from association analysis integrated with habitat modeling. Mycologia 96, 510-525.
Juzwik J and Meyer J M 1997 Colonization of oak wilt fungal mats by Ophiostoma piceae during spring in Minnesota. Plant Disease 81, 410-414.
Kamilova F, Validov S, Azarova T, Mulders I and Lugtenberg B 2005 Enrichment for enhanced competitive plant root tip colonizers selects for a new class of biocontrol bacteria. Environmental Microbiology 7, 1809-1817.
Karthikeyan A and Sakthivel K 2011 Efficacy of Azotobacter chroococcum in rooting and growth of Eucalyptus camaldulensis stem cuttings. Research Journal of Microbiology 6, 618-624.
Kataoka R and Futai K 2009 A new mycorrhizal helper bacterium, Ralstonia species, in the ectomycorrhizal symbiosis between Pinus thunbergii and Suillus granulatus. Biology and Fertility of Soils 45, 315-320.
Kaur R, Macleod J, Foley W and Nayudu M 2006 Gluconic acid: An antifungal agent produced by Pseudomonas species in biological control of take-all. Phytochemistry 67, 595-604.
Khalid A, Arshad M and Zahir Z A 2004 Screening plant growth-promoting rhizobacteria for improving growth and yield of wheat. Journal of Applied Microbiology 96, 473-480.
Kloepper J 2003 A review of mechanisms for plant growth promotion by PGPR. In 6th International PGPR Workshop pp 5-10, Calcutta, India.
Kluber L A 2010 Microbial and biochemical dynamics of ectomycorrhizal mat and non-mat forest soils. Oregon State University, Oregon, America.
Kluber L A, Smith J E and Myrold D D 2011 Distinctive fungal and bacterial communities are associated with mats formed by ectomycorrhizal fungi. Soil Biology and Biochemistry 43, 1042-1050.
Kluber L A, Tinnesand K M, Caldwell B A, Dunham S M, Yarwood R R, Bottomley P J and Myrold D D 2010 Ectomycorrhizal mats alter forest soil biogeochemistry. Soil Biology and Biochemistry 42, 1607-1613.
Kowalchuk G A, Bruijn F J, Head I M, Akkermans A D and van Elsas J D 2004 Molecular Microbial Ecology Manual. London: Kluwer Academic.
Kozdrój J, Piotrowska-Seget Z and Krupa P 2007 Mycorrhizal fungi and ectomycorrhiza associated bacteria isolated from an industrial desert soil protect pine seedlings against Cd(II) impact. Ecotoxicology 16, 449-456.
Kretzer A, King Z and Bai S 2009 Bacterial communities associated with tuberculate ectomycorrhizae of Rhizopogon spp. Mycorrhiza 19, 277-282.
Krupa P and Kozdrój J 2007 Ectomycorrhizal fungi and associated bacteria provide protection against heavy metals in inoculated Pine ( Pinus sylvestris L.) seedlings. Water, Air and Soil Pollution 182, 83-90.
Kucey R 1983 Phosphate-solubilizing bacteria and fungi in various cultivated and virgin Alberta soils. Canadian Journal of Soil Sciences. 63, 671-678.
Lavicoli A, Boutet E, Buchala A and Métraux J P 2003 Induced systemic resistance in Arabidopsis thaliana in response to root inoculation with Pseudomonas fluorescens CHA0. Molecular Plant-microbe Interactions 16, 851-858.
Leckie S 2005a Methods of microbial community profiling and their application to forest soils. Forest Ecology and Management 220, 88-106.
Leckie S E 2005b Methods of microbial community profiling and their application to forest soils. Forest Ecology and Management 220, 88-106.
115
Lehr N A, Schrey S D, Bauer R, Hampp R and Tarkka M T 2007 Suppression of plant defence response by a mycorrhiza helper bacterium. New Phytologist 174, 892-903.
Lemanceau P and Alabouvette C 1991 Biological control of fusarium diseases by fluorescent Pseudomonas and non-pathogenic Fusarium. Crop Protection 10, 279-286.
Leyval C and Berthelin J 1990 Influence of acid producing agrobacteriaum and Laccaria laccata on pine and beech growth, nutrient uptake and exudation. Agriculture Ecosystems and Environment 28, 313-319.
Li C and Hung L 1987 Nitrogen-fixing (acetylene-reducing) bacteria associated with ectomycorrhizae of Douglas-fir. Plant and Soil 98, 425-428.
Li C, Massicote H and Moore L 1992 Nitrogen-fixing Bacillus sp. associated with Douglas-fir tuberculate ectomycorrhizae. Plant and Soil 140, 35-40.
Lu X, Malajczuk N and Dell B 1998 Mycorrhiza formation and growth of Eucalyptus globulus seedlings inoculated with spores of various ectomycorrhizal fungi. Mycorrhiza 8, 81-86.
Lucy M, Reed E and Glick B R 2004 Applications of free living plant growth-promoting rhizobacteria. Antonie van Leeuwenhoek 86, 1-25.
Ludwig B, Khanna P K, Bauhus J and Hopmans P 2002 Near infrared spectroscopy of forest soils to determine chemical and biological properties related to soil sustainability. Forest Ecology and Management 171, 121-132.
Lugtenberg B and Kamilova F 2009 Plant-growth-promoting rhizobacteria. Annual Review of Microbiology 63, 541-556.
Mafia R G, Alfenas A C, Ferreira E M, Binoti D H B, Mafia G M V and Mounteer A H 2009a Root colonization and interaction among growth promoting rhizobacteria isolates and eucalypt species. Revista Árvore 33, 1-9.
Mafia R G, Alfenas A C, Ferreira E M, Binoti D H B, Mafia G M V and Mounteer A H 2009b Root colonization and interaction among growth promoting rhizobacteria isolates and eucalypts species. Revista Árvore 33, 1-9.
Mafia R G, Alfenas A C, Maffia L A, Ferreira E M, Binoti D H B and Mafia G M V 2009c Plant growth promoting rhizobacteria as agents in the biocontrol of Eucalyptus mini-cutting rot. Tropical Plant Pathology 34, 10-17.
Malajczuk N 1982 Ectomycorrhiza formation in Eucalyptus. I. Pure culture synthesis, host specificity and mycorrhizal compatibility with Pinus radiata. New Phytologist 91, 467-482.
Malajczuk N, Dell B and Bougher N L 1987 Ectomycorrhiza formation in Eucalyptus. III. Superficial ectomycorrhizas initiated by Hysterangium and Cortinarius species. New Phytologist 105, 421-428.
Malajczuk N, Lapeyrie F and Garbaye J 1990 Infectivity of pine and eucalypt isolates of Pisolithus tinctorius on roots of Eucalyptus urophylla in vitro. New Phytologist 114, 627-631.
Malajczuk N, Molina R and Trappe J M 1984 Ectomycorrhiza Formation in Eucalyptus. II. The ultrastructure of compatible and incompatible mycorrhizal fungi and associated roots. New Phytologist 96, 43-53.
Mamoun M and Olivier J M 1992 Effect of soil Pseudomonads on colonization of hazel roots by the ectomycorrhizal species Tuber melanosporum and its competitors. Plant and Soil 139, 265-273.
Martens R 1995 Current methods for measuring microbial biomass C in soil: Potentials and limitations. Biology and Fertility of Soils 19, 87-99.
Martin K J 2007 Introduction to Molecular Analysis of Ectomycorrhizal Communities. Soil Science Society of America Journal 71, 601-601-610.
Martínez M, Díaz K, Sanfuentes E, Valiente C and Castillo M 2009 Root-promoting rhizobacteria in Eucalyptus globulus cuttings. World Journal of Microbiology and Biotechnology 25, 867-873.
Mavrodi D V, Blankenfeldt W and Thomashow L S 2006 Phenazine compounds in fluorescent pseudomonas spp. biosynthesis and regulation. Annual Review of Phytopathology 44, 417-445.
116
Mayo K, Davis R E and Motta J 1986 Stimulation of germination of spores of Glomus versiforme by spore-associated bacteria. Mycologia 78, 426-431.
Mele P and Carter M 1996 Short communication: Estimation of microbial biomass by ninhydrin-reactive N using liquid chloroform. Canadian Journal of Soil Sciences. 76, 37-40.
Miller O K, Miller H H and Clem C 1988 Gasteromycetes: Morphological and Developmental Features with Keys to the Orders, Families, and Genera. Mad River Press.
Mohammad G and Prasad R 1988 Influence of microbial fertilizers on biomass accumulation in polypotted Eucalyptus camaldulensis Dehn. seedlings. Journal of Tropical Forest Science 4, 74-77.
Moore A, Massicotte H and Peterson R 1989 Ectomycorrhiza formation between Eucalyptus pilularis Sm. and Hydnangium carneum Wallr. in Dietr. New Phytologist, 193-204.
Nüsslein K and Tiedje J M 1998 Characterization of the dominant and rare members of a young Hawaiian soil bacterial community with small-subunit ribosomal DNA amplified from DNA fractionated on the basis of its guanine and cytosine composition. Applied and Environmental Microbiology 64, 1283-1289.
Nylund J E 1988 The regulation of ectomycorrhiza formation - carbonhydrate and hormone theories revisited. Scandinavian Journal of Forest Research 3, 465-470.
O'Neili G, Chanway C, Axelrood P, Radley R and Holl F 1992 An assessment of spruce growth response specificity after inoculation with coexistent rhizosphere bacteria. Canadian Journal of Botany 70, 2347-2353.
Pandey R, Bahl R and Rao P 1986 Growth stimulating effects of nitrogen fixing bacteria (biofertiliser) on oak seedlings. Industria Forestry 112, 75-79.
Paquot M, Arpigny J-L, Ongena M, Brans A, Joris B, Thonart P, Adam A and Jourdan E 2007 Surfactin and fengycin lipopeptides of Bacillus subtilis as elicitors of induced systemic resistance in plants. Environmental Microbiology 9, 1084-1090.
Patten C L and Glick B R 1996 Bacterial biosynthesis of indole-3-acetic acid. Canadian Journal of Microbiology 42, 207-220.
Patten C L and Glick B R 2002 Role of Pseudomonas putida indoleacetic acid in development of the host plant root system. Applied and Environmental Microbiology 68, 3795-3801.
Penrose D M and Glick B R 2003 Methods for isolating and characterizing ACC deaminase-containing plant growth-promoting rhizobacteria. Physiologia Plantarum 118, 10-15.
Perret X, Howieson J G, Martinez-Romero E, Sessitsch A and Antoun H 2002 Advances in rhizobium research. Critical Reviews in Plant Sciences 21, 323-378.
Pliego C 2008 Two similar enhanced root-colonizing strains differ largely in their colonization strategies of avocado roots and hyphae. Environmental Microbiology 10, 3295-3304.
Pokojska-Burdziej A 1982 The effect of microorganisms, microbial metabolites and plant growth regulators (IAA and GA3) on the growth of pine seedlings (Pinus sylvestris L.). Polish Journal of Soil Science 15, 137-143.
Poole E J, Bending G D, Whipps J M and Read D J 2001 Bacteria associated with Pinus sylvestris–Lactarius rufus ectomycorrhizas and their effects on mycorrhiza formation in vitro. New Phytologist 151, 743-751.
Probanza A, Lucas García J A, Ruiz Palomino M, Ramos B and Gutiérrez Mañero F J 2002 Pinus pinea L. seedling growth and bacterial rhizosphere structure after inoculation with PGPR Bacillus (B. licheniformis CECT 5106 and B. pumilus CECT 5105). Applied Soil Ecology 20, 75-84.
Rajkumar M and Freitas H 2008 Influence of metal resistant-plant growth-promoting bacteria on the growth of Ricinus communis in soil contaminated with heavy metals. Chemosphere 71, 834-842.
Rayment G and Higginson F 1992 Australian Laboratory Handbook of Soil and Water Chemical Methods. Inkata Press Pty Ltd.
Richardson A E 2001 Prospects for using soil microorganisms to improve the acquisition of phosphorus by plants. Australian Journal of Plant Physiology 28, 897-906.
117
Richardson K, Jarett L and Finke E 1960 Embedding in epoxy resins for ultrathin sectioning in electron microscopy. Biotechnic and Histochemistry 35, 313-323.
Riedlinger J, Schrey S D, Tarkka M T, Hampp R, Kapur M and Fiedler H P 2006 Auxofuran, a novel metabolite that stimulates the growth of fly agaric, is produced by the mycorrhiza helper bacterium Streptomyces strain AcH 505. Applied and Environmental Microbiology 72, 3550.
Rodríguez H and Fraga R 1999 Phosphate solubilizing bacteria and their role in plant growth promotion. Biotechnology Advances 17, 319-339.
Rojas A, Holguin G, Glick B R and Bashan Y 2001 Synergism between Phyllobacterium sp. (N2 fixer) and Bacillus licheniformis (P solubilizer), both from a semiarid mangrove rhizosphere. FEMS Microbiology Ecology 35, 181-187.
Rózycki H, Kampert E, Strzelczyk E, Li C Y and Perry D A 1994 Effect of different soil bacteria on mycorrhizae formation in Scots pine (Pinus sylvestris L.) in vitro studies. Folia Forestalia Polonica 36, 92-102.
Ryu C M, Farag M A, Hu C H, Reddy M S, Kloepper J W and Pare P W 2004 Bacterial volatiles induce systemic resistance in Arabidopsis. Plant Physiology. 134, 1017-1026.
Ryu C M, Farag M A, Hu C H, Reddy M S, Wei H X, Pare P W and Kloepper J W 2003 Bacterial volatiles promote growth in Arabidopsis. In Proceedings of the National Academy of Sciences of the United States of America. pp 4927-4932.
Sachdev D P, Chaudhari H G, Kasture V M, Dhavale D D and Chopade B A 2009 Isolation and characterization of indole acetic acid (IAA) producing Klebsiella pneumoniae strains from rhizosphere of wheat (Triticum aestivum) and their effect on plant growth. Indian Journal of Experimental Biology 47, 993.
Saharan B and Nehra V 2011 Plant Growth Promoting Rhizobacteria: A critical review. Life Science and Medicine Research 2011, 1-30.
Sakalidis M L, Hardy G E and Burgess T I 2011 Endophytes as potential pathogens of the baobab species (Adansonia gregorii): a focus on the Botryosphaeriaceae. Fungal Ecology 4, 1-14.
Salisbury F 1994 The role of plant hormones. Plant-Environment Interactions. Ed. RE Wilkinson, 39-81.
Schoenholtz S H, Miegroet H V and Burger J 2000 A review of chemical and physical properties as indicators of forest soil quality: challenges and opportunities. Forest Ecology and Management 138, 335-356.
Schrey S D, Schellhammer M, Ecke M, Hampp R and Tarkka M T 2005 Mycorrhiza helper bacterium Streptomyces AcH 505 induces differential gene expression in the ectomycorrhizal fungus Amanita muscaria. New Phytologist 168, 205-216.
Schuhegger R, Lhring A, Gantner S, Bahnweg G N, Knappe C, Vogg G, Hutzler P, Schmid M, Van Breusegem F and Eberl L 2006 Induction of systemic resistance in tomato by N acyl L homoserine lactone producing rhizosphere bacteria. Plant, Cell and Environment 29, 909-918.
Searle P L 1984 The berthelot or indophenol reaction and its use in the analytical chemistry of nitrogen. A review. Analyst 109, 549-568.
Selvakumar G, Joshi P, Nazim S, Mishra P, Bisht J and Gupta H 2009 Phosphate solubilization and growth promotion by Pseudomonas fragi CS11RH1 (MTCC 8984), a psychrotolerant bacterium isolated from a high altitude Himalayan rhizosphere. Biologia 64, 239-245.
Silveira É L d, Pereira R M, Scaquitto D C, Pedrinho E A N, Val-Moraes S P, Wickert E, Carareto-Alves L M and Lemos E G d M 2006 Bacterial diversity of soil under Eucalyptus assessed by 16S rDNA sequencing analysis. Pesquisa Agropecuária Brasileira 41, 1507-1516.
Smits T H M, Wick L Y, Harms H and Keel C 2003 Characterization of the surface hydrophobicity of filamentous fungi. Environmental Microbiology 5, 85-91.
Souza L A B d, Bonnassis P A P, Silva Filho G N and Oliveira V L d 2008 New isolates of ectomycorrhizal fungi and the growth of eucalypt. Pesquisa Agropecuária Brasileira 43, 235-241.
118
Sparling G, Gupta V and Zhu C 1993 Release of ninhydrin-reactive compounds during fumigation of soil to estimate microbial C and N. Soil Biology and Biochemistry 25, 1803-1805.
Sparling G and Zhu C 1993 Evaluation and calibration of biochemical methods to measure microbial biomass C and N in soils from Western Australia. Soil Biology and Biochemistry 25, 1793-1801.
Strzelczyk E, Pokojska A, Rozycki H, Perry D A and Li C Y 1993 Growth of mycorrhizal fungi in dixenic cultures with bacteria in media of different composition. Acta Microbiologica Polonica 42, 41-41.
Teixeira D A, Alfenas A C, Mafia R G, Ferreira E M, Siqueira L, Maffia L A and Mounteer A H 2007a Rhizobacterial promotion of eucalypt rooting and growth. Brazilian Journal of Microbiology 38, 118-123.
Teixeira D A, Alfenas A C, Mafia R G, Ferreira E M, Siqueira L d, Maffia L A and Mounteer A H 2007b Rhizobacterial promotion of eucalypt rooting and growth. Brazilian Journal of Microbiology 38, 118-123.
Thies J E 2007 Soil microbial community analysis using terminal restriction fragment length polymorphisms. Soil Science Society of America Journal 71, 579-591.
Thurstone L L 1947 Multiple factor analysis. Tilak K, Ranganayaki N, Pal K, De R, Saxena A, Nautiyal C S, Mittal S, Tripathi A and Johri B 2005
Diversity of plant growth and soil health supporting bacteria. Current Science 89, 136-150.
Tonkin C, Malajczuk N and McComb J 1989 Ectomycorrhizal formation by micropropagated clones of Eucalyptus marginata inoculated with isolates of Pisolithus tinctorius. New Phytologist 111, 209-214.
Torsvik V, Goksøyr J and Daae F L 1990 High diversity in DNA of soil bacteria. Applied and Environmental Microbiology 56, 782-787.
Tuart Response Group 2002 Status report tuart conservation and protection Government of Werstern Australia, Perth, Australia, 45.
Unestam T 1991 Water repellency, mat formation, and leaf-stimulated growth of some ectomycorrhizal fungi. Mycorrhiza 1, 13-20.
Unestam T and Sun Y-P 1995 Extramatrical structures of hydrophobic and hydrophilic ectomycorrhizal fungi. Mycorrhiza 5, 301-311.
Van Elsas J, Mäntynen V and Wolters A 1997 Soil DNA extraction and assessment of the fate of Mycobacterium chlorophenolicum strain PCP-1 in different soils by 16S ribosomal RNA gene sequence based most-probable-number PCR and immunofluorescence. Biology and Fertility of Soils 24, 188-195.
Van Elsas J and Rutgers M 2006 Soil microbial diversity and community composition. In Microbiological Methods for Assessing Soil Quality. Ed. D W H Jaap Bloem, Anna Benedetti. pp 183-227. CABI Publishing, Cambridge.
Van Elsas J, Smalla K and Tebbe C 2000 Extraction and analysis of microbial community nucleic acids from environmental matrices. In Tracking Genetically Engineered Microorganisms. Eds. JANSSON JK, ELSAS VAN JD and BAILEY MJ. pp 29-61. Landes Bioscience, Georgetown, Texas.
Van Elsas J D, Top E M and Smalla K 2006 Soil microbial community finger printing based on total community DNA or RNA. In Microbiological Methods for Assessing Soil Quality. Eds. J Bloem, D W Hopkins and A Benedetti. CABI Publishing, Cambridge.
Van Hees P A W 2006 Oxalate and ferricrocin exudation by the extramatrical mycelium of an ectomycorrhizal fungus in symbiosis with Pinus sylvestris. New Phytologist 169, 367-378.
Van Loon L, Bakker P and Pieterse C 1998 Systemic resistance induced by rhizosphere bacteria. Annual Review of Phytopathology 36, 453-483.
Van Peer R, Niemann G and Schippers B 1991 Induced resistance and phytoalexin accumulation in biological control of Fusarium wilt of carnation by Pseudomonas sp. strain WCS 417 r. Phytopathology 81, 728-734.
119
Vance E, Brookes P and Jenkinson D 1987 Microbial biomass measurements in forest soils: The use of the chloroform fumigation-incubation method in strongly acid soils. Soil Biology and Biochemistry 19, 697-702.
Vessey J K 2003 Plant growth promoting rhizobacteria as biofertilizers. Plant and Soil 255, 571-586.
Waksman S A 1927 Principles of Soil Microbiology. Williams & Wilkins, Baltimore. Walkley A and Black I A 1934 An examination of the Degtjareff method for determining soil
organic matter, and a proposed modification of the chromic acid titration method. Soil Science 37, 29.
Wang C, Ramette A, Punjasamarnwong P, Zala M, Natsch A, Moënne‐Loccoz Y and Défago G 2001 Cosmopolitan distribution of phlD‐containing dicotyledonous crop‐associated biocontrol pseudomonads of worldwide origin. FEMS Microbiology Ecology 37, 105-116.
Wang D 2012 Symbiosis specificity in the legume - rhizobial mutualism host specificity in root nodule symbiosis. Cellular Microbiology 14, 334-342.
White D, Davis W, Nickels J, King J and Bobbie R 1979 Determination of the sedimentary microbial biomass by extractible lipid phosphate. Oecologia 40, 51-62.
White T, Bruns T and Taylor J 1990 Amplification and direct sequencing of fungal ribosomal RNA genes for phylognetics. In: A Guide to Molecular Methods and Applications (Innis MA, Gelfand DH, Sninsky JJ, White JW, eds). Academic Press, New York, 315-332.
Wu J, Liu Z, Wang X, Sun Y, Zhou L, Lin Y and Fu S 2011 Effects of understory removal and tree girdling on soil microbial community composition and litter decomposition in two Eucalyptus plantations in South China. Functional Ecology 25, 921-931.
Xavier L J C and Germida J J 2003 Bacteria associated with Glomus clarum spores influence mycorrhizal activity. Soil Biology and Biochemistry 35, 471-478.
Xiao-Qin W, Liang-Liang H, Jiang-Mei S and Jia-Hong R 2012 Effects of ectomycorrhizal fungus Boletus edulis and mycorrhiza helper Bacillus cereus on the growth and nutrient uptake by Pinus thunbergii. Biology and Fertility of Soils 48, 385-391.
Xie H, Pasternak J and Glick B R 1996 Isolation and characterization of mutants of the plant growth-promoting rhizobacterium Pseudomonas putida GR12-2 that overproduce indoleacetic acid. Current Microbiology 32, 67-71.
Xie Z P, Staehelin C, Vierheilig H, Wiemken A, Jabbouri S, Broughton W J, Vogeli-Lange R and Boller T 1995 Rhizobial nodulation factors stimulate mycorrhizal colonization of nodulating and nonnodulating soybeans. Plant Physiology. 108, 1519-1525.
Yasmin F, Othman R, Sijam K and Saad M S 2009 Characterization of beneficial properties of plant growth-promoting rhizobacteria isolated from sweet potato rhizosphere. African Journal of Microbiology Research 3, 815-821.
Zaady E and Perevolotsky A 1995 Enhancement of growth and establishment of oak seedlings (Quercus ithaburensis Decaisne) by inoculation with Azospirillum brasilense. Forest Ecology and Management 72, 81-83.
Zaady E, Perevolotsky A and Okon Y 1993 Promotion of plant growth by inoculum with aggregated and single cell suspensions of Azospirillum brasilense Cd. Soil Biology and Biochemistry 25, 819-823.
Zelles L 1999 Fatty acid patterns of phospholipids and lipopolysaccharides in the characterisation of microbial communities in soil: a review. Biology and Fertility of Soils 29, 111-129.
Zornoza R, Guerrero C, Mataix-Solera J, Scow K M, Arcenegui V and Mataix-Beneyto J 2008 Near infrared spectroscopy for determination of various physical, chemical and biochemical properties in Mediterranean soils. Soil Biology and Biochemistry 40, 1923-1930.
Top Related