ID1 mediates glioblastoma chemoresistance to temozolomide
by
Angela Maria Louisa Celebre
A thesis submitted in conformity with the requirements for the degree of Master of Science Laboratory Medicine and Pathobiology
University of Toronto
© Copyright by Angela Celebre 2016
ii
ID1 mediates glioblastoma chemoresistance to temozolomide
Angela Celebre
Master of Science
Laboratory Medicine and Pathobiology University of Toronto
2016
Abstract
Glioblastoma (GBM) is the most lethal primary brain tumour in adults, and represents a
therapeutic challenge. We investigated the role of inhibitor-of-DNA-binding-1 (ID1), a
transcriptional regulator implicated in cancer cell survival and cancer progression in breast and
colon cancer, as a mediator of chemoresistance in glioblastoma. Using immunohistochemical
and Western blot analysis, we determined that increased ID1 expression correlates with
decreased progression-free survival in GBM patient samples following chemotherapy, and TMZ
resistancy in GBM cell lines. Inhibition of ID1 using pimozide (chemical ID1 inhibitor), siRNA-
mediated knockdown, and CRISPR/Cas9-mediated knockout enhanced the effect of TMZ in
GBM cell lines and intracranial xenografts. In vitro, ID1 inhibition sensitized cells to TMZ-
treatment and ID1-knockout reduced colony formation post-TMZ. In vivo, ID1-knockout delayed
GBM tumour initiation and progression, and increased survival; pimozide combined with TMZ
delayed tumour recurrence. Our studies demonstrate that ID1 may serve as a potential
therapeutic target in glioblastoma.
iii
Acknowledgments My time in the Das Laboratory has been an incredible and exciting experience. Over the past two
years I have grown tremendously, both on an academic and personal level. I have met so many
inspiring, hard-working individuals who I have had the privilege of interacting with on a daily
basis and now have the honor of calling my friends. These individuals offered insight, guidance,
and support when I encountered challenges during my project, and celebrated in my successes
when experiments finally worked and my project moved forward.
I would like to sincerely thank my supervisor, Dr. Sunit Das, for his guidance and support
throughout my graduate studies, for his mentorship, and for allowing me to pursue numerous
opportunities both academic and extra-curricular. A very special thank-you goes to my
committee members, Dr. Jane McGlade and Dr. Cindi Morshead, for their instrumental guidance
and critique of my work. I would also like to thank the Das Lab Manager, Megan Wu, for her
mentorship, patience, and contagious optimism. Megan took me under her wing and showed me
the ropes of working in a wet-lab. She taught me how to prioritize my time in the lab, design
meaningful experiments, and critically analyze my work. Another huge thank-you goes to Dr.
Rohit Sachdeva for constantly challenging me, and making me think for myself. Many thanks to
the following members of the Das Lab for all their wonderful help; Uswa Shahzad, Chris Li,
Sandra Smiljanic, Jennifer Guan, Jeffrey Chan, and Karan Dhand. I am also grateful for the help
provided by Brian Golbourn, Patricia Rakopoulos, and Dr. Vijay Ramaswamy. Finally, I would
like to thank my family and friends for all their emotional support and patience.
iv
Table of Contents
Acknowledgments ............................................................................................................................. iii
Table of Contents .............................................................................................................................. iv
List of Tables ..................................................................................................................................... vii
List of Figures ................................................................................................................................... viii
Abbreviations ...................................................................................................................................... x
Chapter 1 Introduction ....................................................................................................................... 1
Glioblastoma ............................................................................................................................... 1
1.1 Clinical Relevance ............................................................................................................................ 1
1.2 Pathology and Molecular Biology .................................................................................................... 1
1.3 Current Standard of Care ................................................................................................................ 3
Treatment Resistance and Tumour Recurrence ........................................................................ 3
2.1 TMZ: Structure and Mechanism of Action ...................................................................................... 3
2.2 Mechanisms of Chemoresistance in GBM ....................................................................................... 4
2.2.1 Direct Repair via MGMT .............................................................................................................. 4
2.2.2 Mismatch Repair ......................................................................................................................... 5
2.2.3 Base Excision Repair .................................................................................................................... 6
2.2.4 Acquired Drug Resistance ........................................................................................................... 6
2.3 Cancer Stem Cells ............................................................................................................................ 6
2.4 Recurrent GBM ................................................................................................................................ 7
2.4.1 Molecular Biology ....................................................................................................................... 7
2.4.2 Treatment of Recurrent GBM ...................................................................................................... 8
ID1 in Normal Biology ................................................................................................................. 8
3.1 The ID Family: Structure and Function ............................................................................................ 8
3.2 ID1 in Cellular Differentiation .......................................................................................................... 8
3.3 ID1 in the Developmental Process .................................................................................................. 9
3.4 ID1 in Cell Cycle Regulation and Apoptosis ..................................................................................... 9
v
3.5 ID1 in Invasion, Migration, and Angiogenesis ............................................................................... 10
ID1 in Cancer Biology ................................................................................................................ 11
4.1 ID1 expression in Primary Tumour Cells ........................................................................................ 11
4.2 Multimodal Activation of ID1 in Cancer ........................................................................................ 11
4.3 ID1 in Tumorigenesis ..................................................................................................................... 13
4.4 ID1 in Tumour Invasion and Metastasis ........................................................................................ 14
4.5 ID1 in Tumour Angiogenesis .......................................................................................................... 14
4.6 The Role of ID1 in Cancer Stem Cells ............................................................................................. 15
4.7 ID1 in Contributing to Treatment Failure ...................................................................................... 15
4.8 ID1 in Glioblastoma ....................................................................................................................... 16
ID1 as a Therapeutic Target ..................................................................................................... 17
5.1 IDs in Cancer Therapy .................................................................................................................... 17
5.2 ID1: Potential Therapeutic Target in Combination with Chemotherapy ....................................... 18
Hypothesis ................................................................................................................................ 18
Chapter 2 Methods ........................................................................................................................... 20
Methods .................................................................................................................................... 20
7.1 Cell Culture .................................................................................................................................... 20
7.2 Clinical Chemotherapeutic Agents ................................................................................................ 20
7.3 Immunocytochemistry .................................................................................................................. 20
7.4 Alamar Blue ................................................................................................................................... 21
7.5 Western Blotting ........................................................................................................................... 21
7.6 Cell Viability Counter ..................................................................................................................... 21
7.7 ID1 Silencing .................................................................................................................................. 22
7.8 Pimozide (Clinical ID1 Inhibitor) .................................................................................................... 22
7.9 Immunohistochemical Staining and Scoring ................................................................................. 22
7.10 CRISPR/Cas9 System ...................................................................................................................... 23
7.11 Colony Forming Assay ................................................................................................................... 23
7.12 Evaluation of ID1 Knockout in an In Vivo Model of Glioblastoma ................................................. 23
7.13 Evaluation of ID1 Inhibition in Combination With Temozolomide Chemotherapy in an In Vivo
Model of Glioblastoma ............................................................................................................................... 24
7.14 Bioluminescence Imaging .............................................................................................................. 24
vi
7.15 Quantitative Real-‐time Polymerase Chain Reaction ..................................................................... 24
7.16 Polymerase Chain Reaction Amplification .................................................................................... 24
7.17 Statistical Analysis ......................................................................................................................... 25
Chapter 3 Results .............................................................................................................................. 26
Results ....................................................................................................................................... 26
8.1 ID1 Expression Correlates with Response to Temozolomide Treatment in Glioblastoma ............ 26
8.2 ID1 Expression Increases Following Temozolomide Treatment .................................................... 29
8.3 ID1 Inhibition Sensitizes GBM Cells to TMZ-‐Chemotherapy Treatment ....................................... 32
8.4 ID1 Knockout Reduces Colony Formation Capacity following TMZ-‐Treatment ............................ 34
8.4.1 Development of an ID1-‐knockout cell line ................................................................................. 34
8.4.2 ID1-‐knockout decreases colony formation following treatment with TMZ ............................... 37
8.5 ID1 Knockout Delays GBM Tumour Initiation/Progression and Increases Overall Survival .......... 39
8.6 Pimozide Enhances the Effect of TMZ-‐Treatment and Provides a Therapeutic Advantage in
Glioblastoma .............................................................................................................................................. 42
Chapter 4 Discussion and Future Directions .................................................................................... 45
Discussion and Future Directions ............................................................................................. 45
9.1 Glioblastoma: Discovering an Ideal Therapeutic Target ................................................................ 45
9.2 Treating Glioblastoma in vitro: ID1 Inhibition Enhances the Effect of Temozolomide ................. 47
9.3 Treating Glioblastoma in vivo: Targeting ID1 Provides a Therapeutic Advantage ........................ 48
9.4 Conclusions ................................................................................................................................... 49
9.5 Future Directions ........................................................................................................................... 49
References ........................................................................................................................................ 51
vii
List of Tables
Table 1: Top off-target hits in CRISPR/Cas9 ID1-knockout system. 36
Table 2: Survival outcomes in ID1-knockout in vivo study. 41
viii
List of Figures
Figure 1: Key DNA repair mechanisms that mediate TMZ cytotoxicity. 5
Figure 2: The role of ID1 in cell cycle regulation. 10
Figure 3: ID1 protein stabilization and degradation. 13
Figure 4: Increased ID1 expression following chemotherapy correlates with
decreased progression-free survival in glioblastoma human patient tumour
samples.
27
Figure 5: ID1 expression correlates with resistance to TMZ in vitro. 28
Figure 6: ID1 protein expression increases following TMZ-treatment in GBM
cells.
30
Figure 7: Increased ID1 expression is post-treatment is TMZ-specific. 31
Figure 8: ID1 inhibition (via siRNA) increases GBM cell sensitivity to TMZ-
chemotherapy treatment.
33
Figure 9: Development of an ID1-knockout line using CRISPR/Cas9. 35
Figure 10: Three top off-target hits in the CRISPR/Cas9 ID1-knockout model
display no mutation in the target region.
36
Figure 11: ID1-knockout reduces colony formation capacity following
treatment with temozolomide.
38
Figure 12: ID1-knockout delays glioblastoma tumour initiation and progression. 40
Figure 13: ID1-knockout increases overall survival time in glioblastoma. 41
Figure 14: Pimozide (small molecule inhibitor that targets ID1 degradation)
increases GBM cell sensitivity to TMZ-treatment.
43
ix
Figure 15: Pimozide enhances the effect of TMZ-treatment and provides a
therapeutic advantage in glioblastoma.
44
x
Abbreviations
ACC Animal care committee
AKT Protein kinase B
ATCC American type culture collection
AUP Animal use protocol
BCA Bicinechoninic acid
BER Base excision repair
bHLH Basic helix-loop-helix
BMPs Bone morphogenetic proteins
BSA Bovine serum albumin
Cas9 CRISPR associated protein 9
CDK Cyclin-dependent kinase
CDKN2A Cyclin-dependent kinase inhibitor 2A
CDKN2B Cyclin-dependent kinase inhibitor 2B
CNS Central nervous system
CO2 Carbon dioxide
CRISPR Clustered regularly interspaced short palindromic repeats
CSCs Cancer tem cells
DAPI 4’,6-diamidino-2-phenylindole
DMEM Dulbecco’s modified eagle media
xi
DMSO Dimethyl sulfoxide
DNA Deoxyribonucleic acid
DUBs Deubiquitylases
EGFR Epidermal growth factor receptor
EGR1 Early growth response 1
EMT Epithelial-to-mesenchymal transition
ETS E26 transformation-specific
FBS Fetal bovine serum
FDA Food and drug administration
FFPE Formalin-fixed paraffin-embedded
G1 Gap 1
G2 Gap 2
GAPDH Glyceraldehyde 3-phosphate dehydrogenase
GBM Glioblastoma
GIC Glioma-initiating cell
hEGF Human epidermal growth factor
hFGF Human basic fibroblast growth factor
HLH Helix-loop-helix
IC50 Half maximal inhibitory concentration
ICC Immunocytochemistry
xii
ID1 Inhibitor of DNA binding 1
ID1-KO ID1-knockout
IDH1 Isocitrate dehydrogenase 1
IHC Immunohistochemistry
IP Intraperitoneal injection
M Mitosis
MDM2 Mouse double minute 2 homolog
MeA Methyl adenine
MeG Methyl guanine
MET Mesenchymal-to-epithelial-transition
MGMT Methylguanine-DNA methyltransferase
Min Minutes
MMPs Matrix metalloproteinases
MMR Mismatch repair
mRNA Messenger RNA
MTIC Monomethyl triazone imidazole carboxamide
MYOD1 Myoblast determination protein 1
NF-kB NF-kappaB
NF1 Neurofibromatosis type I
NOD Non-obese diabetic
xiii
NPC Nasopharyngeal carcinoma
NSC Neocarzinostatin
NSG NOD/SCID/Gamma immunodeficient mice
NT No treatment
OS Overall survival
PAM Protospacer adjacent motif
PARP-1 Poly(ADP-ribose) polymerase-1
PBS Phosphate buffered saline
PCAO Peptide-conjugated antisense oligonucleotide
PCR Polymerase chain reaction
PDGFRA Platelet-derived growth factor receptor, alpha polypeptide
PFS Progression-free survival
PI3K Phosphatidylinositol-4,5-bisphosphate 3-kinase
PID Post-implantation day
PTEN Phosphatase and tensin homolog
RB Retinoblastoma
rMA Relative mask area
RNA Ribonucleic acid
S Synthesis
SCID Severe combined immunodeficiency
xiv
SDV Standard devation
Sec Seconds
SEM Standard error of the mean
SEMA3F Semaphorin 3F
sgRNA Single guide RNA
si-RNA Small (or short) interfering RNA
SMURF2 SMAD ubiquitylation regulatory factor 2
TALENs Transcription activator-like effector nucleases
TCGA The cancer genome atlas
TCP Toronto Centre for Phenogenomics
TGF-β Transforming growth factor-β
TMA Tissue microarray
TMZ Temozolomide
TP53 Tumor protein p53
USP1 Ubiquitin-specific protease 1
UV Ultraviolet
V Volts
VEGF Vascular endothelial growth factor
VEGFR1 Vascular endothelial growth factor receptor 1
VEGFR2 Vascular endothelial growth factor receptor 2
xv
WHO World Health Organization
ug Microgram
um Micrometer
uM Micromolar
nM Nanomolar
1
Chapter 1
Introduction
Glioblastoma
1.1 Clinical Relevance Glioblastoma (GBM) is the most common malignant primary brain tumour in adults, accounting
for over 50% of primary central nervous system (CNS) gliomas1. Approximately 0.59 to 3.69
GBM cases per 100,000 are diagnosed annually worldwide2. Moreover, GBM affects over
20,000 patients in North America every year3, and is responsible for the highest number of years
of life lost of any cancer, exceeding even breast and lung cancer4. This malignancy is associated
with an aggressive clinical course and poor prognosis, with a median overall survival (OS) of
less than 15 months despite maximal treatment5. OS of patients with newly diagnosed GBM is
17-30% at 1 year, and only 3-5% at 2 years6. The etiology of GBM remains largely unknown.
Only ionizing radiation7, and certain genetic syndromes are well-defined risk factors, including
Cowden, Turcot, Li-Fraumeni, neurofibromatosis type 1 and type 2, tuberous sclerosis, and
familial schwannomatosis8,9.
Treatment of GBM involves maximal site surgical resection followed by a combination of
radiotherapy and chemotherapy with temozolomide (TMZ), an alkylating agent that has been
shown to potentiate radiation and possess cytotoxic properties in GBM5. Tumour recurrence
typically occurs 6 months after the patient receives first-line therapy, and this is mainly attributed
to the development of treatment resistance10. Therefore, meaningful treatment of glioblastoma
requires the identification of new therapies that target chemoresistance, in order to effectively
prevent tumour recurrence.
1.2 Pathology and Molecular Biology The World Health Organization (WHO) classification system groups gliomas into 4 histological
grades defined by increasing degrees of undifferentiation, anaplasia, and aggressiveness11. These
grades carry prognostic and survival correlates. Glioblastoma is a WHO grade IV astrocytoma,
the most malignant grade11.
2
GBMs are morphologically heterogeneous tumours that are characterized by considerable
variability in biological behavior12. The histopathology of GBM includes considerable cellularity
and mitotic activity, poorly differentiated neoplastic astrocytes, vascular proliferation, and
necrosis13. Glioblastomas are highly invasive tumours, and considered pleomorphic because their
tumour cells vary in size and shape13. However, despite being highly invasive, they are typically
confined to the CNS and do not metastasize.
Recent comprehensive genetic screens of GBM have confirmed that genetic alterations are
scattered across the entire genome, and affect a number of chromosomes. These studies have
revealed that loss of heterozygosity on chromosome 10 is the most frequent genetic alteration in
GBM (60-80% cases)14. However, there are numerous regions of loss in GBM, including areas
on 1p, 6q, 9p, 10p, 10q, 13q, 14q, 15q, 17p, 18q, 19q, 22q, and Y15,16,17,18,19,20; many of these
regions of loss represent loss of specific tumour suppressor genes. For example, regions
frequently lost at chromosome 10 include those containing PTEN and MGMT21,6. Loss of
chromosome 9p is also frequently seen, which contains a variety of tumor-suppressor genes,
including CDKN2A and CDKN2B22,6. This impacts both the RB and P53 pathways because
CDKN2A and CDKN2B encode the cell cycle proteins, p14, p15, and p16, implicated in these
pathways23. Gains of gene expression due to genetic alteration have also been demonstrated in
GBM, however, oncogenic expression is much less frequent than loss of gene expression. The
most common oncogenic event is the amplification of EGFR gene on chromosome 724,25. Focal
amplification of EGFR correlates with mutations and deletions in the EGFR gene, and EGFR
overexpression26. EGFR amplification also correlates with subsequent activation of the
PI3K/AKT pathway27, which is associated with poor prognosis28. Oncogenic amplification of
CDK4 and MDM2 results in the disruption of the RB AND TP53 pathways29.
From a molecular standpoint, GBM is classified into 4 distinct transcriptional subgroups, as
based on genome-wide expression studies: classical, mesenchymal, proneural, and neural30,28.
Although many molecular abnormalities and mutations overlap across the transcriptional
subclasses, each subgroup displays its own unique mutational landscape. Verhaak and colleagues
described how each subtype was characterized by a distinct pattern of somatic mutations and
DNA copy number30. A key finding was that aberrations and gene expression of EGFR, NF1,
and PDGFRA/IDH1 each defined classical, mesenchymal, and proneural, respectively. Also,
3
different subtypes varied in their response to aggressive therapy, with the classical subtype
showing the greatest benefit, and the proneural subtype showing no benefit.
1.3 Current Standard of Care First-line treatment for GBM consists of maximal site surgical resection followed by adjuvant
radiotherapy and TMZ-chemotherapy. TMZ is a DNA alkylating agent that is administered
orally, concomitantly with radiotherapy, followed by an adjuvant course. The addition of TMZ to
first-line treatment is supported by a randomized phase 3 trial lead by Stupp5, which found an
increase in median survival from 12.1 to 14.6 months with the combination of TMZ and
radiotherapy, compared to radiotherapy alone; this represents a median survival benefit of 2.5
months. Furthermore, the two-year survival rate was 26.5% and 10.4% in the radiotherapy-plus-
temozolomide compared to radiotherapy alone group, respectively5. A study conducted by Hegi
and colleagues found that patients harbouring tumours with promoter methylation of the DNA
repair enzyme O6-methylguanine-DNA methyltransferase (MGMT), which results in gene
silencing, were more likely to benefit from the addition of TMZ to first-line treatment31.
Unfortunately, despite optimal treatment, virtually all patients will experience treatment
resistance and subsequent tumour recurrence.
Treatment Resistance and Tumour Recurrence
2.1 TMZ: Structure and Mechanism of Action TMZ is an imidazotetrazinone derivative of dacarbazine and functions as an alkylating agent
prodrug32. It is a small molecule with a molecular weight of 194 daltons, allowing it to be readily
absorbed in the digestive track33. TMZ is also lipophilic, which means that it can cross the blood-
brain barrier. It serves as a monofunctional agent with good tissue distribution, and is schedule
dependent in terms of anti-tumour activity34.
TMZ is stable at the acidic pH of the stomach, which allows it to be absorbed intact after oral
administration. However, once in contact with the slightly basic physiologic pH of the blood and
tissues, TMZ undergoes spontaneous hydrolysis to the active compound monomethyl triazone
imidazole carboxamide (MTIC)32. MTIC then rapidly breaks down to form the reactive
methyldiazonium ion, which primarily methylates guanine residues in the DNA molecule. More
specifically, the methyldiazonium ion preferentially methylates DNA at N7 positions of guanine
4
(N7-MeG; 70%), but also methylates N3 adenine (N3-MeA; 9%) and O6 guanine residues (O6-
MeG; 6%)35,36. TMZ has a half-life of 1.81h37 and studies have shown that the level of drug in
the brain and cerebrospinal fluid are 30-40% plasma concentration38. TMZ does not result in
chemical cross-linking of DNA strands, therefore is considered to be less toxic in comparison to
other chemotherapeutic agents.
TMZ cytotoxicity is primarily mediated through O6-MeG, a toxic lesion39,40. During DNA
replication, O6-MeG mispairs with thymine (not cytosine), which alerts DNA mismatch repair
(MMR)41. MMR recognises and excises the mispaired base on the daughter strand, but is unable
to recognise O6-MeG on the template strand. This mispairing at O6-MeG repeats itself over
numerous replication cycles, which leads to persistent DNA strand breaks, replication fork
collapse, G2/M cell cycle arrest, and ultimately apoptosis42,43,44. The cytotoxic effect of TMZ is
hindered at N7-MeG and N3-MeA because these sites are rapidly repaired by DNA base excision
repair (BER)45.
2.2 Mechanisms of Chemoresistance in GBM Patients with newly diagnosed GBM are typically given TMZ as first-line chemotherapy. Yet, all
patients succumb to the disease due to treatment failure and subsequent tumour recurrence. Four
of the main mechanisms of chemoresistance include direct repair via MGMT, mismatch repair
(MMR), base excision repair (BER), and acquired drug resistance.
2.2.1 Direct Repair via MGMT
The major DNA repair mechanism contributing to TMZ resistance in GBM is direct repair
(Figure 1). MGMT repairs O6-alkylguanine adducts in a single step by protecting cancer cells
from chemotherapeutic alkylating agents like TMZ39. Although MGMT activity can vary up to
300-fold in gliomas46, studies have found a strong positive correlation between MGMT activity
and TMZ resistance47,48. Zhang et al. showed MGMT is upregulated when U373 GBM cells are
exposed to incremental concentrations of TMZ, increasing resistancy by >4-fold49. In GBM
patient tumour samples, MGMT activity has been shown to be increased in recurrent tumours
post-chemoradiotherapy in comparison to the primary, untreated sample50. This finding can be
attributed to either TMZ selecting for MGMT-expressing cells or TMZ inducing MGMT
expression.
5
TMZ O6#G
+Me
O6#Me#G
G
MGMT)absent
Mutation)tolerated
#Me
MGMT)present
Cell)survival
CytotoxicityMMR+
MMR#
Cell)survival
2.2.2 Mismatch Repair
DNA mismatch repair is another mechanism of chemoresistance in GBM. MMR is the
recognition and correction of mispaired bases, which plays a very important role in correcting
replicative mismatches that have escaped polymerase proofreading. Loss of MMR results in a
drastic increase in the number of mutations. Cellular response to TMZ is influenced by MMR
status: TMZ requires functional MMR to produce its desired cytotoxic effect. Hence, MMR
deficiency in glioma can be caused by somatic mutations harboured within MMR proteins (i.e.
MSH2, MLH1 and MSH6), and is associated with TMZ tolerance49,51,52. A study conducted by
Yip et al. found MSH6 inactivation in vitro lead to an increase in TMZ resistance; conversely,
reconstitution of MSH6 expression restored TMZ sensitivity52. Furthermore, GBM MSH
mutations selected during TMZ treatment correlate with TMZ resistance, when studied in vivo. A
study investigating clinical GBM patient tumour samples found that MSH6 alterations in tumour
cell genome are associated with TMZ resistance. For example, MSH6 mutations are found in
26% of recurrent GBM cases following TMZ chemotherapy52.
Figure 1. Key DNA repair mechanisms that mediate TMZ cytotoxicity. TMZ, a DNA alkylating agent, exerts its cytotoxic effect by adding a methyl group to O6-G (O6-Me-G). In the presence of MGMT, MGMT will repair O6-methylguanine adducts in a single step by removing the methyl group, resulting in cell survival. If MGMT is absent and MMR is intact, MMR will repeatedly mispair O6-MeG, resulting in a cytotoxic response; if MMR is not intact, the mutation will be tolerated, resulting in cell survival. (Figure adapted from Zhang J, Stevens MFG, Bradshaw TD. Temozolomide: Mechanisms of Action, Repair and Resistance. Current Molecular Pharmacology 2012. 5: 102-114.)
6
2.2.3 Base Excision Repair
The third DNA repair mechanism contributing to TMZ resistance in GBM is base excision
repair. The BER pathway is responsible for the removal and repair of non-bulky damaged
nucleotides, abasic sites, and DNA single strand breaks generated by alkylating agents53. In
gliomas, the BER pathway repairs N-Me purine lesions, conferring resistance to TMZ54. A key
protein in DNA damage signaling and the BER pathway is poly(ADP-ribose) polymerase-1
(PARP-1). PARP-1 is activated in response to DNA damage, and facilitates efficient DNA repair
and survival of cells undergoing genotoxic stress55. Inhibition of PARP-1 increases the frequency
of DNA strand breaks, and may provide a means to overcome resistance to TMZ56.
2.2.4 Acquired Drug Resistance
Acquired drug resistance in GBM occurs when tumours that are initially sensitive to TMZ-
chemotherapy develop resistance, as a consequence of selective pressures in the presence of the
chemotherapeutic agent. Acquired resistance to TMZ can be attributed to a variety factors,
including selection of pre-existing resistant cell clones, genetic/epigenetic changes in neoplastic
cells induced by the drug, and selection of genes with a survival advantage57. Specific
mechanisms that can confer acquired resistance to TMZ include intracellular drug inactivation,
enhanced repair of drug-induced DNA damage, and alteration of drug target by mutation58,59. In
GBM, a highly heterogeneous tumour, chemotherapy eliminates TMZ-sensitive malignant cells;
however, it is hypothesized that chemoresistant cancer stem cells (CSCs) are able to survive, and
are later capable of driving tumour recurrence.
2.3 Cancer Stem Cells Cancer stems cells were first identified in acute myeloid leukemia (AML) by John Dick and
colleagues60. They determined that the tumour-initiating cell in AML possesses similar traits to a
normal stem cell61. Furthermore, they found that AML was organized in a cellular hierarchy, and
that tumorigenicity was coupled to the ability to self renew62. This seminal work gave rise to the
cancer stem cell hypothesis, which posits that tumour cells are heterogeneous and hierarchically
arranged; tumour growth is driven by a subpopulation of cells that possess behavioral and
phenotypic characteristics of normal stem cells, and are thus called cancer stem cells. CSCs are
characterized by their ability to proliferate and self-renew. Furthermore, they are multipotent and
7
can give rise to the diverse set of cells that make up a given tumour. Current therapies are
extremely cytotoxic to the bulk of the proliferative tumour cells, but appear to have a decreased
effect on CSCs, which are able to survive chemotherapy and later drive tumour recurrence. Also,
several studies have shown that prolonged treatment with TMZ enriches for tumour cells with
stem cell properties, and induces stemness, consequently increasing tumor aggressiveness63,64,65.
The role of CSCs has now been described in numerous solid tumours66,67,68,69,70, including
glioblastoma71,72.
CSCs in glioblastoma were first identified by Peter Dirks, who determined that glioblastoma is
arranged in a cellular hierarchy and tumorigenicity is limited to glioma cells that possess the
CSC identity71. Glioma stem cells (GSCs) have been shown to be enriched by chemoradiation,
suggesting that they may serve as a repository for tumour recurrence73. Moreover, Auffinger et
al. found that treatment of differentiated glioma cells with TMZ induced stem cell properties in
these cells63. The role of GSCs in glioblastoma tumour recurrence has been characterized in a
mouse model, where GSCs were shown to drive tumour recurrence following chemotherapy with
temozolomide (TMZ)74. It has therefore been postulated that meaningful treatment of
glioblastoma will require the development of new therapies that target glioma stem cells.
2.4 Recurrent GBM
2.4.1 Molecular Biology
The biology of recurrent GBM remains largely unknown, for two reasons. First and foremost,
only 20-30% of recurrent GBMs are accessible to surgery, therefore there are very few recurrent
samples available in the tissue bank for experimental use75. Secondly, recurrent tumours usually
contain much more necrotic tissue76. Thus, recurrence typically develops from tumour cells
located in the tumour periphery. Studies have shown that approximately two-thirds of GBM
tumours recur locally (i.e. within 2 cm of original tumour margin), and one-third recur far away
from the initial tumour bulk77,78,79. Furthermore, local recurrrences share ~70% mutations with
primary tumour; whereas distant recurrences only share ~25% mutations, despite the recurrence
stemming from the original tumour80. A study conducted by Andor et al. using the cancer
genome atlas (TCGA) genome sequencing data found that there are approximately ~7 genetically
different subclones per primary GBM sample (per 100 mg of vital tumour tissue)81. This number
did not vary in recurrent GBMs.
8
2.4.2 Treatment of Recurrent GBM
Nearly all patients experience disease progression after a median progression-free survival (PFS)
of 7-10 months, following first-line therapy82. At present, there is no standard treatment to
improve survival in recurrent GBM, therefore clinical trials should be strongly considered and
treatment individualized for each patient. The current available options include surgical
resection, salvage chemotherapy, and radiotherapy. Salvage chemotherapy includes
temozolomide rechallenge, bevacizumab, and other alkylating agents (i.e. carboplatin and
nitrosoureas)83. However, after TMZ and bevacizumab fail, prognosis is approximately 3-4
months. With no curable treatment being available for GBM, the field requires the development
of new therapies aimed at preventing chemoresistance and tumour recurrence.
ID1 in Normal Biology
3.1 The ID Family: Structure and Function Inhibitor of DNA binding 1 (ID1) is a dominant negative helix-loop-helix (HLH) protein that is
part of a family of highly conserved transcriptional regulators, composed of four known
members in vertebrates (ID1-4)84. The basic HLH (bHLH) transcription factors are a family of
proteins that control cell fate determination, differentiation, and cell proliferation85. Because ID
proteins lack a basic DNA binding domain, ID- bHLH heterodimers are unable to bind to the
DNA, blocking bHLH-directed transcription86. Therefore, ID proteins are also termed inhibitors
of differentiation. Moreover, early studies found ID proteins control differentiation of muscle86,
neurons87, mammary88, and B89 and T-cells90. Since then, further investigation into the function
of these proteins have demonstrated their important role in coordinating various cellular
processes including proliferation, cell-cycle regulation, angiogenesis, invasion and
migration91,92,93.
3.2 ID1 in Cellular Differentiation Mutational studies of the Drosophilia emc locus provided the first direct evidence that ID
proteins may play a role in regulating cellular differentiation. Drosophilia emc is a Drosophilia
HLH protein ortholog of ID. Mutation of emc in Drosophilia via loss- and gain-of-function
studies revealed that emc inhibits the function of bHLH proteins known to be involved in
processes of cellular differentiation, such as neurogenesis and sex determination94.
9
The role of ID proteins in cellular differentiation was then further studied in mammalian cell
culture systems84. These studies demonstrated that there was a correlation between
downregulation of ID expression and differentiation of various cell lineages. In vivo work using
targeted expression of ID genes to specific tissues and cell types in mice has demonstrated
inhibition of cellular differentiation in these systems95,96. For example, transduction of
retroviruses that express ID1 into embryonic mouse brains lead to significant impairment in
neuronal differentiation97. Furthermore, transgenic mice overexpressing ID1 in lymphoid
progenitors experienced cell-cycle arrest at an early developmental stage, the pro-B cell stage89.
3.3 ID1 in the Developmental Process ID proteins play a critical role throughout the developmental process. In situ analyses of ID gene
expression during mouse development from early gestation to birth, showed widespread
expression of ID proteins throughout the developing organism98. This study also highlighted that
ID1 and ID3 expression patterns were highly similar. Furthermore, several animal knockout
models have been generated for the purpose of identifying the role of ID genes in development.
A knockout animal model possessing a deletion of the ID1 gene did not show any major
abnormalities, therefore failing to produce an obvious phenotype99,90. Conversely, ID1/ ID3
double knock-out mice are embryonic lethal, and were found to possess aberrant angiogenesis
and neuronal differentiation87. Therefore, these two animal models taken together would suggest
redundant functions between ID1 and ID3 proteins.
3.4 ID1 in Cell Cycle Regulation and Apoptosis Several studies investigating the function of ID proteins have shown that they play a significant
role in regulating the cell cycle, more specifically, in promoting G1-S cell cycle transitions. A
study conducted by Hara and colleagues demonstrated that ID1 and ID2 levels are induced in
response to mitogenic signaling in fibroblasts100 (Figure 2). Conversely, when this response is
inhibited by antisense oligonucleotides directed against these IDs, the cells are no longer able to
enter the S phase101. ID1 has also been shown to inhibit E-protein and Ets-protein-mediated-
activation of p16, also known as cyclin-dependent kinase (CDK) inhibitor 2A102,103. An in vivo
study found that ID1 null mouse embryo fibroblasts have increased expression of p16, and these
mice experienced premature senescence103. Elevation of ID1 is associated with the
10
Mitogenic)signal
bHLH
CANNTG
bHLHbHLH
bHLH
ID1
ID1
G1)arrestDifferentiation
p15.genep16.genep21.gene
bHLH
downregulation of the CDK2 inhibitor p27, which correlated to increased RB phosphorylation
and inactivation104.
ID genes have been implicated in promoting apoptosis. ID1 has been shown to induce apoptosis
in neonatal and adult cardiac myocytes via a redox-dependent mechanism105. In a transgenic
model, mice with targeted ID1 expression in T cells showed a 96% decrease in total number of
thymocytes, due to significant apoptosis106. Finally, ID1 expression has also been shown to
induce apoptosis in dense mammary epithelial cell cultures107.
Figure 2. The role of ID1 in cell cycle regulation. Mitogenic signaling induces ID1 gene expression. ID1 binds to bLH proteins, and because ID proteins lack a basic DNA binding domain, ID1-bHLH heterodimers are unable to bind to the DNA, blocking bHLH-directed transcription, for example, the bHLH-mediated activation of p15, p16, and p21 (Figure adapted from Sikder HA et al. Id proteins in cell growth and tumorigenesis. Cancer Cell 2003. 3: 525-530.)
3.5 ID1 in Invasion, Migration, and Angiogenesis ID1 has been implicated in invasion and migration, as well as angiogenesis. ID1 overexpression
in mammary epithelial cells (SCp2) makes these cells partially refractory to differentiation
signals. This results in rapid proliferation, after an initial lag period, and these cells are then able
to invade the basement membrane. Furthermore, antisense targeting ID1 levels results in
decreased cell proliferation, increased differentiation88, and inhibits invasiveness108.
Studies investigating the effect of ID1 knockout mice on the ability to form new blood vessels
have shown that ID1 expression is required for normal embryogenesis87. Moreover, in addition
to the aforementioned ID1/ID3 double knockout mice being embryonic lethal, it has also been
11
shown that before death all embryos suffered a hemorrhage in the forebrain87. Therefore, these
studies suggest that ID1 is involved in both invasion and angiogenesis.
ID1 in Cancer Biology
4.1 ID1 expression in Primary Tumour Cells Increased expression of ID proteins has been reported in many types of human tumours and
associated with loss of differentiation, enhanced malignancy, and aggressive clinical
behavior109,110. For example, medullary thyroid cancers are associated with high ID1 expression
levels; these tumours exhibit characteristics of loss of cell-growth control, cell proliferation,
dedifferentiation, migration and invasion111. ID1 expression also correlates with loss of p16
expression in melanoma in situ112. Moreover, elevated ID1 expression was found around the
vasculature within metastatic melanoma lesions.
It has been hypothesized that ID proteins may play a role in the development of brain tumours, as
ID proteins are known to be involved in neurogenesis and neural differentiation. Studies have
found ID gene expression to be downregulated during astrocyte differentiation113. Furthermore,
ID1 expression has a positive correlation with tumour grade in astrocytomas114. Levels of ID1
protein expression correlate with less-differentiated phenotypes, high malignant potential, and
poor clinical outcome in cervical115, breast108 and prostate cancer116. Therefore, these studies
taken together would suggest that ID1 may serve as a potential diagnostic/prognostic marker, as
well as an attractive therapeutic target.
4.2 Multimodal Activation of ID1 in Cancer ID protein expression is high in stem and progenitor cells, and then typically downregulated
during differentiation. However, ID expression is known to be re-activated in cancer cells,
evidenced by many tumour types displaying high expression levels of ID proteins. Consequently,
there are a number of contributing factors implicated in the activation of ID1 in cancer, including
mediation via oncogenic pathways and the deregulation of protein stability.
ID genes serve as targets of upstream oncogenic events. Aberrantly high levels of ID protein
expression in cancer are often a consequence of transcriptional induction by oncoproteins such as
MYC, RAS, SRC, and by growth factor-directed signals such as transforming growth factor-β
12
(TGF-β) and bone morphogenetic proteins (BMPs)117,118,119,120. For example, activation of RAS
signaling results in increased ID1118 and ID3121 expression via the transcriptional activation of
early growth response 1 (EGR1). ID1 and ID3 also serve as downstream targets of MYC, and
induction of ID1 by MYC appears to be required for breast cancer cells to enter S phase in
vitro122. However, in many instances, the mechanisms of ID gene activation are unclear. The
combination of multiple genetic and epigenetic events is required to establish aberrant levels of
ID proteins necessary for tumour progression and maintenance. For example, in non-small-cell
lung cancer, ID1 is induced by a number of signaling pathways123,124, which as a result promote
cell proliferation, epithelial-to-mesenchymal transition (EMT), metastasis, and chemoresistance
in vitro and in xenograft models125.
ID proteins are short-lived proteins with a half-life of approximately 10-20 minutes, and are
targeted for degradation by a variety of E3 ubiquitin ligases in the ubiquitin-proteasome
pathway126. For example, the E3 ubiquitin ligase, SMAD ubiquitylation regulatory factor 2
(SMURF2), targets ID1 and ID3 for degradation during cellular senescence127 (Figure 3).
Perturbation of the ubiquitin-proteasome pathway is associated with the accumulation of ID
proteins in cancer. This can be achieved by deubiquitylases (DUBs), which oppose ubiquitin
ligase activity by removing ubiquitin moieties, thus increasing substrate stability. Therefore, both
E3 ligases and DUBs are implicated in the regulation of ID protein accumulation. Another
mechanism of ID protein stabilization involves the alteration of the ubiquitin-specific protease 1
(USP1), a specific DUB for ID1, ID2, and ID3 in osteosarcoma cells and mesenchymal stem
cells. USP1 overexpression in osteosarcoma cell lines sustains the accumulation of ID proteins,
which are responsible for conferring the stem cell-like properties in these cells128.
13
Stem%cells%orCancer%cells
Deubiquitylases(USP1) ID1
Ub
Differentiationor%senescence
E3%ubiquitin%ligases
(SMURF2)ID1
Ub
ID1$protein$stabilization
ID1$protein$degradation
Figure 3. ID1 protein stabilization and degradation. The E3 ubiquitin ligase, SMURF2, ubiquitinates ID1 during cellular senescence, targeting the protein for degradation. Deubiquitylases, such as USP1, can perturb the ubiquitin-proteasome pathway by removing the ubiquitin moieties on ID1, resulting in ID1 protein stabilization.
4.3 ID1 in Tumorigenesis ID1 was first linked to tumorigenesis in a 1999 study that showed constitutive expression of ID1
in keratinocytes ultimately lead to cell immortalization129. This was due to several key changes
in other cellular processes, including the induction of cell proliferation, inhibition of cellular
senescence and differentiation, and extension of life span. Numerous studies have since been
undertaken to elucidate the role of ID1 in both oncogenesis and tumorigenesis.
As previously mentioned, overexpression of ID1 is partly mediated by bona-fide oncogenes,
which in turn can activate or inhibit a number of key oncogenic signaling pathways. For
example, overexpression of ID1 in prostate cancer cells was found to induce serum-independent
cell growth through inactivation of the p16/RB tumour suppressor pathway130. A study
investigating colon tumours found that gain-of-function mutations in TP53, which are potentially
pro-tumorigenic, leads to protein stabilization and this is associated with ID1 overexpression131.
ID1 gene expression has been largely implicated in tumour development. In a transgenic mouse
model, targeted ID1 expression to thymocytes lead to the development of T cell lymphomas,
following aberrant T cell development and massive apoptosis106. Moreover, tumour development
also occurred when ID1 expression was targeted to B-lymphocytes and intestinal epithelia89. ID
proteins also inhibit programmed cell death and promote tumour cell survival, further
contributing to tumour progression. High ID1 levels are associated with upregulation of anti-
14
apoptotic and pro-survival factors (i.e. NF-kB)132,133 and inhibition of pro-apoptotic signals (i.e.
p21)134. Furthermore, studies have shown that silencing ID proteins in cancer cells can induce
programmed cell death135,136.
4.4 ID1 in Tumour Invasion and Metastasis ID1 expression correlates with disease progression in a number of cancers. A major component
of tumour progression involves invasion of cancer cells into the adjacent or distal regions,
resulting in tumour metastasis. One potential mechanism by which IDs influence metastatic
ability occurs at the transcriptional level, whereby it is hypothesized that increased ID1
expression increases migratory features by inhibiting bHLH-mediated transcription of anti-
metastatic genes such as semaphorin 3F (SEMA3F)137.
ID proteins are involved in metastatic colonization by inducing EMT at the primary site. Matrix
metalloproteinases (MMPs) are a protein family that are heavily involved in the EMT process via
regulating the degradation of the basement membrane and remodeling of the extracellular
matrix138. During cancer progression, MMPs are found to be overexpressed in cancer cells,
including MMP2, MMP9, and MMP14139. Moreover, overexpression of both ID1 and MMP
directly correlate with invasiveness in breast cancer cells140. In vivo studies revealed that high
levels of ID1 expression are associated with disease progression and tumour invasion in
endometrial141 and breast142 carcinomas. Conversely, downregulation of ID1 using siRNA
treatment results in decreased invasion and metastatic ability of breast cancer cells108.
Furthermore, a study investigating global expression analysis in human breast cancer identified
ID1 as a key component of its metastatic signature143. ID1 is also implicated in invasion and
metastasis in lung carcinoma. In an in vivo study, ID1 +/- mice implanted with Lewis lung
carcinoma cells showed an increase in survival (approximately 2-fold) and displayed
significantly fewer metastasis87.
4.5 ID1 in Tumour Angiogenesis Increased expression of ID proteins in cancer cells has been implicated in the promotion of
tumour angiogenesis. ID proteins induce expression of pro-angiogenic factors144 that increase
endothelial cell proliferation and migration145,146. The involvement of ID proteins in tumour
angiogenesis was demonstrated in tumour models derived from ID1-ID3 double null mice, which
15
displayed significant loss of tumour vasculature87,147,144. This finding suggests that ID1/ID3
inactivation in tumour endothelium may have a potential therapeutic benefit.
Moreover, ID1 in combination with ID3 have been shown to be essential during cancer
progression for tumour-associated angiogenesis. A study found that tumour xenografts with an
ID1/ID3 knockout show decreased tumour growth, loss of metastasis, and impaired
neovasculature of the tumour87. Furthermore, ectopic expression of ID1 resulted in significant
increase in vascular endothelial growth factor (VEGF) secretion, a downstream target of the ID1
protein, in prostate cancer cells148. This lead to the promotion of the growth and tube formation
of endothelial cells. Conversely, inactivation of ID1 via siRNA resulted in decrease in VEGF
gene transactivation and protein secretion148.
4.6 The Role of ID1 in Cancer Stem Cells Cancer stem cells are identified by their ability to proliferate and self-renew, they are
multipotent, and have the capacity to initiate tumours. The function of ID1 in CSCs is
extensively studied in malignant glioma. In an orthotopic model of brain cancer, conditional
deletion of ID1, ID2, and ID3 in tumour cells decreased the glioma stem cell population, blocked
tumour growth, and extended overall survival in mice149. Furthermore, the TGF- β signaling
pathway is known to activate ID1 and ID3 proteins in glioma stem cells150. A study found that
inhibiting the TGF- β receptor and silencing ID1/ID3 results in abrogation of the glioma stem
cell population both in vitro and in vivo150. Finally, a somewhat controversial study using
experimental mouse models of high-grade glioma showed that cells with high ID1 expression
had high self-renewal capacity in vitro and tumorigenic ability in vivo. However, cells with low
ID1 expression had low self-renewal potential in vitro, but demonstrated even more robust
tumorigenicity151. These results can potentially be explained by the existence of a cell population
that is the counterpart to CSCs, which are known as transit-amplifying cells. Therefore, it has
been proposed that targeting both cell populations will be critical to delivering effective
treatment to GBM patients.
4.7 ID1 in Contributing to Treatment Failure ID1 has also been implicated in treatment failure and tumour recurrence in various types of
cancer. The progression of breast and prostate cancer typically involves the development of
16
hormone refractory disease, which is the main reason for treatment failure. A study shows that
transfection of ID1 into androgen-dependent prostate cancer cells resulted in an androgen-
independent phenotype, whereby these transfected cells showed a decrease in responsiveness to
androgen stimulation152. These cells also mimicked androgen-independent prostate cancer cells
found in recurrent prostate cancer patients, following hormonal ablation therapy152. Furthermore,
in a study investigating clinical patient tumour samples, ID1 was found to be highly upregulated
in tumours from recurrent prostate cancer patients compared to metastatic prostate cancer
patients153. Therefore, these studies would suggest that ID1 may play a role in treatment failure
and tumour recurrence.
4.8 ID1 in Glioblastoma ID1 has been identified as a key player in modulating glioma cell invasiveness. A study found
that ID1 protein expression correlated with the magnitude of glioma cell invasion; specifically,
the high ID1-expressing U251 GBM cell line showed a substantial increase in cell invasion
compared to cell lines with low ID1 expression154. Furthermore, ID1 knockdown resulted in a
dramatic reduction in glioblastoma cell invasion, which corresponded to a decrease in the key
EMT regulator Snail, as well as active forms of MT1-MMP154. Finally, in an orthotopic model of
human GBM, ID1 genetic knockdown resulted in a significant increase in overall survival,
demonstrating a median increase in survival of 20 days154.
ID1 has also been implicated in the GBM stem cell population. ID1 is enriched in glioma stem
cell fractions (CD133+), and co-localizes with the stemness marker, SOX2, in primary GBM-
derived cultures154. Furthermore, ID1 knockdown resulted in inhibition in self-renewal potential,
a significant reduction in neurosphere growth, and decreased expression of glioma stem cell
markers154. In another study, ID1 and ID3 were identified as the key gene responses to TGF- β
inhibitors, known to target the glioma-initiating cell (GIC) population150. Inhibition of the TGF-
β pathway decreases the ID1high/CD44high GIC population by repressing ID1/ID3 levels, resulting
in inhibition of tumour initiation150. Taken together, these results suggest that ID1 expression
promotes a stem-like phenotype in human GBM, and serves as an attractive therapeutic target.
As previously mentioned, USP1 is a ubiquitination-specific protease involved in ID1 protein
stability. A study revealed that USP1 is highly expressed in GBM, and also promotes ID1
stability in glioblastoma cells155. USP1 inhibition resulted in decreased survival and clonogenic
17
growth in the glioma stem cell population155. Furthermore, targeting of USP1 either via shRNA-
mediated knockdown or its specific chemical inhibitor pimozide enhanced radiosensitivity of
GBM cells, and significantly prolonged survival of tumour-bearing mice155.
ID1 as a Therapeutic Target
5.1 IDs in Cancer Therapy ID proteins are attractive targets for cancer therapy due to a number of reasons. Firstly, ID
proteins mediate the activity of many important genes that are involved in regulating
tumorigenesis and cancer progression. Secondly, ID proteins are not expressed in most mature
adult tissues, however, they are reactivated in cancer cells; this confers an advantage for systemic
therapy by achieving selective targeting and less toxicity. Finally, only a partial reduction of ID
levels is sufficient to significantly reduce tumour invasion and metastasis.
The therapeutic benefit of targeting ID proteins has previously been demonstrated in various
tumour cell types. For example, ID1/ID3 double knockout mice show defective endothelial-cell
vasculature in tumour xenografts87, and could not support the growth and metastasis of three
different tumours. Moreover, studies have found that a decrease in ID protein levels via siRNA
treatment leads to decreased tumour aggressiveness, invasion, and metastasis110,156.
Current therapeutic approaches to target IDs can be grouped into two main categories. The first
approach is aimed at extinguishing ID gene expression by delivering an ID-specific siRNA
molecule in vivo. For example, in a mouse model, an si-ID1 was fused to a peptide (ID1-PCAO)
known to localize specifically to tumour neovasculature157. Systemic delivery of ID1-PCAO in
breast cancer and lung carcinoma mouse models resulted in increased intra-tumour hemorrhage,
hypoxia, and inhibited tumour growth and metastasis158. Importantly, these studies have found
that ID inhibition does not result in deleterious general or organ-specific effects. The second
common approach is aimed at targeting protein-protein interaction properties of ID proteins via
specific peptides. For example, ID-binding peptides were designed according to the amino acid
sequence of myoblast determination protein 1 (MYOD1), a bHLH protein159. These peptides
possess a high affinity for ID1, thus interfering with the interaction between ID1 and MYOD1,
causing a proliferative block in cancer cells159.
18
5.2 ID1: Potential Therapeutic Target in Combination with Chemotherapy
Chemotherapy is a widely used treatment against metastatic cancer, as it is capable of inducing
cellular apoptosis. Unfortunately, many cancer cell types are capable of developing drug
resistance, which ultimately results in disease recurrence. Recurrent tumours are usually highly
resistant to further chemotherapy treatments and are associated with a more aggressive
phenotype. Therefore, we must elucidate the mechanisms that underlie drug resistance in order to
improve the efficacy of chemotherapy.
Several studies have demonstrated the potential role of ID1 in chemotherapeutic resistance.
Ectopic expression of ID1 in both prostate160 and nasopharyngeal carcinoma (NPC)161 cells was
able to confer resistance to the chemotherapeutic agent, Taxol. In NPC cells, ID1 expression was
found to be associated with decreased sensitivity to Taxol-induced apoptosis161. Furthermore, in
prostate cancer cells, ID1 downregulation via siRNA treatment sensitized the cells to Taxol160.
Finally, a study that found combined expression of ID1 and ID3 increases both self-renewal and
tumour initiation in colon cancer stem cells, also revealed that silencing ID1/ID3 sensitized those
cells to the chemotherapeutic agent, oxilaplatin66. Therefore, although the role of ID1 in
therapeutic resistance in glioblastoma has yet to be explored, these studies would suggest that
ID1 may serve as a potential therapeutic target in combination with chemotherapy treatment in
GBM patients.
Hypothesis There is an unmet need for better therapeutic targets in glioblastoma due to its heterogeneous
clinical behavior and limited treatment strategies. While multi-modality treatment results in
immediate disease control, tumour recurrence is invariable and most patients succumb to their
disease within one year. Chemotherapeutic resistance is a fundamental cause of tumor recurrence
in GBM. ID1 has been shown to be involved in chemotherapeutic resistance in other cancers,
and ID1 ablation has resulted in enhanced chemosensitivity and prolonged survival in an in vivo
model. It is my hypothesis that ID1 expression mediates glioblastoma chemoresistance and
identifies the cell population that drives tumour recurrence; and is a potential therapeutic target
to enhance the chemotherapeutic effect in GBM.
19
Aim I: Investigate the interplay between ID1 expression and response to TMZ in glioblastoma
Aim II: Investigate the effect of ID1 knockout on GBM biology and overall survival in a
xenograft model
Aim III: Determine whether ID1 inhibition enhances the response to TMZ in a mouse xenograft
model of GBM
20
Chapter 2
Methods
Methods
7.1 Cell Culture Immortalized glioblastoma cell lines (U87, U118, U251, U373, and A172) from American Type
Culture Collection (ATCC), and primary glioblastoma cancer cell lines (GliNS1 and H818) were
used to study the effects of temozolomide and ID1 inhibition in vitro. Immortalized lines were
grown in Dulbecco’s modified eagle media (DMEM) (Wisent) supplemented with 10% FBS, and
1% penicillin/streptomycin (Wisent). GliNS1 and H818 were grown as adherent cells and
spheres, respectively, in Neurocult NS-A Basal Medium (Human Stem Cell Technologies),
supplemented with L-glutamine (2mM) (Invitrogen), antibiotic/antimycotic (1X) (Invitrogen),
N2 supplement (1%) (Gibco), B27 supplement (2%) (Gibco), 75ng/mL Bovine Serum Albumin
(BSA) (Sigma), human epidermal growth factor (hEGF) (20ng/ml) (Sigma) and human basic
fibroblast growth factor (hFGF) (20ng/ml) (Sigma). All cell lines were incubated at 37°C and 5%
CO2.
7.2 Clinical Chemotherapeutic Agents Temozolomide (Sigma) and Cisplatin (Sigma) were reconstituted in dimethyl sulfoxide (DMSO)
prior to treatment of cells at designated concentrations.
7.3 Immunocytochemistry Briefly, 1x105 GliNS1 cells were seeded on poly-L-ornithine (Sigma)/laminin (Sigma) coated
plates to aid in attachment. The following day cells were treated with either vehicle or incubated
with TMZ (25 or 100 uM) for a 7-day period, at which point the viable cells were cytospun onto
slides. Cells were then fixed with 4% paraformaldehyde, permeated with 0.5% Triton-X, and
blocked with 5% BSA at 37°C for 10 minutes. Slides were then incubated with primary antibody
overnight at 4°C. Primary antibody concentration was as follows: ID1 (1:500, SantaCruz). After
incubation, slides were washed with PBS and incubated with a fluorescent conjugated antibody
specific for the primary antibody for 1h at room temperature in a dark environment (Alexa 594
21
conjugated antibody 1:500; Life Technologies). Slides were mounted on DAPI containing
VECTASHIELD Mounting Medium (Vectorlabs, H-1200). Images were captured using a
spinning disk confocal microscope.
7.4 Alamar Blue The alamarBlue Assay (ThermoFisher) was used to evaluate the effect of temozolomide on cell
viability by incorporating a fluorometric/colorimetric growth indicator based on detection of
metabolic activity. Specifically, this assay was used to determine the half maximal inhibitory
concentration (IC50) in various GBM cell lines. Briefly, in a 96-well format, 2000 cells/well
were seeded in 5x replicates of U87, U118, U251, U373, and A172. Cells were allowed to
adhere overnight. The following morning, graded concentrations of TMZ ranging from 0 to
1600uM were added to the wells. On the seventh day, alamarBlue reagent was added (20ul,
amount equal to 10% of the culture volume), and re-incubated at 37°C, 5% CO2 for four hours.
Fluorescence was then measured with excitation wavelength at 560nm and emission wavelength
at 590 nm. IC50 plots were then generated using the corresponding values.
7.5 Western Blotting Cells were lysed with standard cell lysis buffer (Cell Signaling) containing protease inhibitors
(Roche). Protein concentration was determined using the bicinechoninic acid (BCA) assay
(Pierce Chemical Co.). Lysates containing 50 ug total protein were loaded onto 12% SDS-PAGE
gels and electrophoresed. Proteins were then transferred onto PVDF membranes (Bio-Rad) using
a semidry transfer apparatus (Bio-Rad). Membranes were probed for varying proteins overnight
in 5% milk. Antibodies were as follows: beta-actin (1:10,000; Cell Signaling), ID1 (1:200;
SantaCruz). After incubation, membranes were washed 3 times for 10 minutes with PBS with
0.1% Tween and incubated with horseradish peroxidase–conjugated antibodies specific for the
primary antibody (Cell Signaling). Binding was detected using Chemiluminescence Reagent Plus
(PerkinElmer).
7.6 Cell Viability Counter To evaluate the effect of temozolomide alone or in combination with ID1 inhibitor on cell
viability, direct cells viability measurements (Vi Cell XR cell counter, Beckman Coulter) were
taken. Briefly, 1x105 U251 cells were seeded in 6-well dishes in triplicate, treated with indicated
22
concentration of temozolomide alone or in combination with ID1 inhibitor, and counted on day
three or four post-treatment.
7.7 ID1 Silencing ID1 Smartpool siRNA (Dharmacon) and scrambled RNA control (Dharmacon) were
reconstituted according to manufacturer’s instructions. 100nM of scrambled and ID1 siRNA
were used to treat U251 cells. Cells were incubated with siRNA and scrambled control for a
period of four days, at which point the cells were collected for cell viability and Western blot
analysis.
7.8 Pimozide (Clinical ID1 Inhibitor) Pimozide (Sigma), a chemical ID1 inhibitor, was reconstituted according to manufacturer’s
instructions. 5uM of pimozide was used to treat U251 cells. Cells were incubated with pimozide
for a period of three days, at which point the cells were collected for cell viability and Western
blot analysis.
7.9 Immunohistochemical Staining and Scoring Paraffin-embedded blocks were cut into 5-µm sections and were dewaxed in xylene, followed by
rehydration in a standard alcohol series (90, 70, 50%). Antigen retrieval was achieved by 20
minutes of pressure cooking in citrate buffer (pH 6.0), followed by blocking for ten minutes
using Universal Blocking Buffer (Dako). The slides were then incubated with ID1 primary
antibody (1:500 dilution, SantaCruz) overnight at 4°C. Detection used biotinylated secondary
antibodies for 1 hr, the ABC reagent kit (Vector Labs), and DAB chromagen (Vector Labs).
Slides were washed with PBS three times after each step. Sections were then dehydrated using
increasing concentrations of ethanol (50, 70, 90%), followed by a brief washing in xylene.
Finally, the slides were mounted in Permount (Fisher Scientific Inc.). Immunoexpression of ID1
protein was quantified with 3d Histech Panoramic Image Analysis Software, which uses a
colorimetric algorithm to calculate the percentage of positive pixels over a designated tissue area,
defined as relative mask area (rMA).
23
7.10 CRISPR/Cas9 System To establish an ID1-knockout (ID1-KO) cell line, U251 cells were transfected via
electroporation with plasmid containing sgRNA targeted at ID1 packaged into lentiviral vector
(Sigma). Two plasmids containing sgRNA targeted at ID1 with different seed sequence were
used. The two sgRNA sequences were: ACAGCGAGCGGTGCGGGCGAGG and
AGGCCGGCAAGACAGCGAGCGG. The lentivector used was a pLV-U6g-EPCG vector,
containing the 22 base-pair sequence and cas9 endonuclease with a puromycin and GFP element.
The cells that integrated ID1-sgRNA were selected using puromycin selection. After five weeks
of selection, cells were isolated using single cells FACS in a 96-well plate. The individual
colonies were expanded to establish ID1 knockout cell lines.
7.11 Colony Forming Assay Briefly, 30,000 cells were seeded in 6-well dishes in triplicate, and treated with temozolomide.
These cells were treated for one week, at which point the media was changed, effectively
removing TMZ. The cells were allowed to continue to grow for one week in normal culture
media, at which point the media was removed, cells were washed with PBS, fixed with 4%
Paraformaldehyde (Electron Microscopy Sciences), and stained with crystal violet solution for
one hour. Cells were washed and colonies were counted.
7.12 Evaluation of ID1 Knockout in an In Vivo Model of Glioblastoma
Stereotactic-guided intracranial implantation in NOD/SCID/Gamma (NSG) immunodeficient
mice were performed by injecting 2.5x105 U251 control or U251 ID1-KO cells into the frontal
cortex (Coordinates: X=-1.0, Y=1.5, Z=2.4, with Bregma serving as reference point). Both cell
lines are luciferase-tagged allowing the use of bioluminescence imaging to monitor tumour
growth. Mice were sacrificed when they reached a humane endpoint (exemplar indicators
include rapid body weight loss and hunched or abnormal posture). Animal use protocol (AUP-
0293) was approved by the Toronto Centre for Phenogenomics (TCP) animal care committee
(ACC).
24
7.13 Evaluation of ID1 Inhibition in Combination With Temozolomide Chemotherapy in an In Vivo Model of Glioblastoma
Drugs were administered by IP injections into NSG immunodeficient mice implanted with
2.5x105 U251-luciferase cells. Experimental cohorts included Saline (vehicle), pimozide (15
mg/kg) daily for three 5-day cycles, temozolomide (40 mg/kg) once a day for two 5-day cycles,
or pimozide alone once a day for one 5-day cycle followed by a combination of daily pimozide
and temozolomide for two 5-day cycles. The mice were sacrificed as previously described, using
the same aforementioned AUP approved by TCP.
7.14 Bioluminescence Imaging Briefly, mice were put under anesthesia at 2% Isoflurane levels and injected with 0.15mL of
Luciferin (15mg/ml) via IP injection. After the mouse had been injected with Luciferin for 3
minutes, it was scanned to assess highest total flux; this is done repeatedly until there is no
longer an increase in signal. Living Image 4.3.1 software was used to analyze the scans and
quantify total flux. The color scale was adjusted to be the same for each mouse so that
comparisons could be made between experimental groups.
7.15 Quantitative Real-time Polymerase Chain Reaction Briefly, RNA was extracted from GBM cells post-TMZ treatment, and its complementary DNA
was synthesized according to manufacturer’s instructions (Invitrogen). Real-time PCR was
performed using Taqman probes (Aplplied Biosystems), according to the manufacturer’s
recommendations. Reactions were carried out using StepOnePlus Real-Time PCR System
(Applied Biosystems) and results were expressed as fold change calculated by the ΔΔ Ct method
relative to the control sample. GAPDH was used as an internal normalization control.
7.16 Polymerase Chain Reaction Amplification PCR reaction for sequencing was conducted using the following primers:
chr7:+108096350: Forward: 5’-AGCACAGGTGTACGCACTTC-3’
Reverse: 5’-GTGACACTGGGTCCTGCTC-3’
25
chr1:+236445511: Forward: 5’-TGTGGGAGTTGTGGTCCTG-3’
Reverse: 5’-GCCGAAGCCATCTCTACAAG-3’
chr2:-40006264: Forward: 5’-AGGCTCTCCGTCTCTCTCAC-3’
Reverse: 5’-GAAAGGAATGGTGGCTTCTC-3’
PCR amplification step was performed in a 20ul reaction volume and consisting of 11.35ul
nuclease free water, 2ul forward primer, 2ul reverse primer, 0.25ul template, 0.4ul HotStar
HiFidelity DNA Polymerase (Qiagen), and 4ul 5x PCR Buffer (Qiagen). Mixture solution was
amplified by PCR machine (Bio-Rad). Thermal cycle programmed for 5 minutes at 95°C as
initial denaturation, followed by 35 cycles of 15 sec at 94°C for denaturation, 1 min at 51-58°C
as annealing, 1 min at 72°C for extension, final extension at 72 °C for 10 min, and indefinitely at
4°C at end of PCR cycling. PCR products were examined by electrophoresis at 100 V for 30
minutes in a 1% (w/v) agarose gel in 1 x TAE buffer. The marker used DNA ladder 1 kb.
Electrophoresis gel was than visualized in UV light.
7.17 Statistical Analysis All experiments were done in triplicate. Mean and SDV were used where appropriate. Two
tailed T-tests and Linear regression analyses were used. Statistics were completed with
GraphPad Prism 6.0. *, **, *** denotes significance of p<0.05, p<0.01, p<0.001. Error bars
represent SDV or SEM.
26
Chapter 3
Results
Results
8.1 ID1 Expression Correlates with Response to Temozolomide Treatment in Glioblastoma
ID1 has previously been shown to be involved in chemotherapeutic resistance in other types of
cancers. We hypothesized that there is a relationship between ID1 expression and response to
TMZ-chemotherapy in glioblastoma. To test this hypothesis, first we evaluated ID1 protein
expression in primary and recurrent GBM patient tumour samples using a tissue microarray
(TMA), which was constructed from formalin-fixed-paraffin-embedded GBM samples obtained
from St. Michael’s Hospital Pathology Department. Criteria for TMA inclusion were: (1) patient
received TMZ-chemotherapy after primary tumour resection and (2) patient experienced tumour
recurrence. Immunohistochemical analysis demonstrated that there was a significant negative
correlation (r = -0.6779; p<0.05) between fold-change in ID1 expression from the primary to
recurrent tumour and latency to recurrence (Figure 4A), whereby patients with increased ID1
expression following chemotherapy had a shorter latency to recurrence (Figure 4B). These data
suggest that ID1 expression negatively correlates with progression-free survival in glioblastoma.
To test this correlation, we sought to determine if ID1 expression is proportional to TMZ
sensitivity in GBM cells in vitro. Drug response curves to TMZ were determined based on IC50
(the half maximal inhibitory concentration) using 5 immortalized GBM cell lines (U251, U87,
U118, U373, A172) with differential ID1 expression. We found that ID1 expression correlates
with TMZ resistancy in GBM cells. For example, U118 is a low ID1-expressing cell line and
highly sensitive to TMZ (IC50 value= 501uM); whereas, U373 is a high ID1-expressing cell line
and highly resistant to TMZ (IC50 value= 1959uM) (Figure 5A). IC50 curves for U118 and
U373 further highlight the significant difference in TMZ resistancy between the two cell lines
(Figure 5B), along with their corresponding microscopic images (Figure 5C).
27
Primary'Tumour Recurrent'Tumour
Patie
nt'3
Figure 4. Increased ID1 expression following chemotherapy correlates with decreased progression-free survival in glioblastoma human patient tumour samples. (A) Immunohistochemistry was used to measured ID1 expression in primary and recurrent patient tissue specimens (n=9); staining was quantified and the fold-change in ID1 expression was calculated. Increased ID1 expression post-chemotherapy correlates with a quicker recurrence. (B) An example of immunohistochemical staining of a patient tissue specimen who experienced short progression-free survival (187 days) showing increased ID1 expression in recurrent GBM tumour compared to the primary sample. * Denotes significance of p<0.05.
B
A
!1
0
1
2
3
4
5
6
7
8
0 100 200 300 400 500Fold/ch
ange/in/ID
1/expressio
n/fro
m/prim
ary/
to/recurrent/tum
our/(rM
A)
Progression!free/ Survival/(#of/days)
r/=/!0.6779*
28
ID1
0
500
1000
1500
2000
2500
U87 U118 U251 U373 A172
IC50-value-(u
M)
GBM-Cell-line
β;actin
U118$(7'day$TMZ$treatment)
U373$(7'day$TMZ$treatment)
CTL TMZ$100uM
CTL TMZ$100uM
Figure 5. ID1 expression correlates with resistance to TMZ in vitro. (A) Drug response curves to TMZ were determined based on the half maximal inhibitory concentration in 5 GBM cell lines with differential ID1 expression (U87, U118, U251, U373, A172). Baseline ID1 expression correlates with TMZ resistancy in GBM cells. (B) Exemplar IC50 curves (logarithmic) comparing a low-ID1 expresser, TMZ-sensitive cell line (U118) and high-ID1 expresser, TMZ-resistant cell line (U373); (C) corresponding microscopic images depicting the differential effect of 100uM of TMZ (7-day treatment) on U118 and U373. Images taken at 10X magnification at day 7 post-TMZ treatment.
0
0.2
0.4
0.6
0.8
1
1.2
0 50 200
600
1000
1400
Fold change in Cell V
iability
TMZ Treatment (uM)
Log. (U118)
Log. (U373)
A
B C
29
8.2 ID1 Expression Increases Following Temozolomide Treatment
Having previously established a correlation between ID1 expression and TMZ resistancy, we
next wanted to evaluate the effect of TMZ-chemotherapy on ID1 expression in vitro. We
hypothesized that TMZ has an effect of ID1 expression. To test this hypothesis, the primary
GBM cancer cell line GliNS1 was treated with graded concentrations of TMZ (0, 25, 100 uM)
for 7 days, at which point the viable cells were cytospun onto slides and immunocytochemistry
(ICC) was performed, staining for ID1 expression. It is important to emphasize that the viable
cells in the TMZ-treated groups are those that survived TMZ chemotherapy, therefore
representing the chemoresistant population. The control group (DMSO) exhibited very few cells
expressing ID1, with relatively weak intensity; conversely, in the TMZ-treated groups, the
majority of cells expressed ID1, with increased intensity (Figure 6A). The results from this
initial experiment would suggest that TMZ is either inducing ID1 expression in GBM cells or
selecting for the ID1-expressing cells.
We wanted to further study the effect of TMZ on ID1 expression in GBM cells by characterizing
the protein levels at various time points. Western blot analysis was used to measure ID1 protein
expression at 1, 3, 5, or 7 days post-TMZ treatment (100uM) in U251 and H818. ID1 protein
expression increased following TMZ treatment, peaking ~day 3 and remaining elevated to day 7
(Figure 6B). These results support the previous findings that TMZ exposure results in increased
ID1 expression in GBM cells. To determine if elevation in ID1 expression was due to increased
ID1 gene transcription, we performed comparative QT-PCR to measure ID1 mRNA expression
at 1, 3, 5, or 7 days post-TMZ treatment (100uM) in U251. We found that ID1 expression was
variable over the time course and did not remain stably increased up until day 7 (Figure 6C).
Therefore, we did not observe the same trend at the mRNA level as we did at the protein level.
All these findings taken together would suggest that TMZ is not inducing ID1 expression at the
genetic level, but rather selecting for the ID1-expressing cells.
30
0
0.5
1
1.5
2
2.5
CTL 1D 3D 5D 7D
Fold0change0in0ID10mRNA0
expression
#days0post0TMZFtreatment
CTL$$$$$$1D$$$$$$$$3D$$$$$$$$5D$$$$$$$$$7D
#days$post$TMZ4treatment
β4actin
ID1
β4actin
ID1H818
U251
Figure 6. ID1 protein expression increased following TMZ-treatment in GBM cells. (A) Immunocytochemistry analysis of the effect of TMZ on ID1 expression in GliNS1. ID1 expression is represented in red, and DAPI is represented in blue. TMZ exposure (25 or 100 uM) results in increased ID1 expression. (B) Western blot (U251 and H818) and (C) comparative QT-PCR (U251) analysis of the effect of TMZ (100uM) on ID1 expression at various time points (1, 3, 5, 7 days post-TMZ treatment). ID1 protein expression increased post-TMZ treatment, peaking ~Day 3 and remaining increased up until Day 7; however, we did not observe the same effect at the mRNA level. Scale bar represents 100um. Error bars represent the ±SD of triplicate measurements and significance was determined by comparing to untreated cells using t-test.
A
C B
31
GliNS1
ID1
β*actin
Ctl 10µM 25µM 25µM 100µM
Cisplatin7(48h) TMZ7(72h)
U251
ID1
β*actin
Additionally, since it is known that TMZ is not the only chemotherapeutic agent used today, we
asked whether increased ID1 expression is a TMZ-specific response? Cisplatin is a
chemotherapy drug that induces programmed cell death by causing the DNA strands to cross-
link. TMZ employs a different mechanism to induce apoptosis, therefore Cisplatin was selected
for comparison purposes in the following study. U251 and GliNS1 cells were treated with either
Cisplatin or TMZ for 48 or 72 hours, respectively. Western blot analysis demonstrated that
Cisplatin treatment does not result in increased ID1 protein expression in GBM cells, unlike
TMZ treatment (Figure 7). Therefore, these results suggest that the increase in ID1 expression
observed post-treatment is TMZ-specific.
Figure 7. Increased ID1 expression is post-treatment is TMZ-specific. Western blot analysis of the effect of TMZ (25 or 100 uM) compared to Cisplatin (10 or 25 uM) on ID1 expression in U251 and GliNS1. Cisplatin treatment does not result in increased ID1 protein expression in GBM cells, unlike TMZ treatment.
32
8.3 ID1 Inhibition Sensitizes GBM Cells to TMZ-Chemotherapy Treatment
Our previous results demonstrate an interplay between ID1 expression and response to TMZ-
treatment. We next wanted to determine whether ID1 inhibition could enhance the cytotoxic
effect of TMZ-chemotherapy. To address this question, we employed a knockdown study using a
pooled siRNA targeting ID1 in U251 GBM cells. The U251 cell line was selected because it was
previously identified as a high basal ID1-expressing, resistant cell line. U251 cells were first
treated with graded concentrations of si-ID1 (25, 50, 75, 100 nM) for optimization purposes. The
optimal concentration of si-ID1 was determined to be 100nM, as it achieved the greatest
knockdown of ID1 protein expression and was not cytotoxic to the cells (Figure 8A). U251 cells
were then either pre-treated with si-ID1 (100nM) followed by TMZ treatment (25, 50, 100 uM)
or treated with TMZ alone for 4 days. We observed a significant reduction in cell density in the
combined si-ID1 and TMZ-treatment group compared to the TMZ-alone condition (Figure 8B).
Furthermore, we found a decrease in the number of viable cells in U251 cells pre-treated with si-
ID1 followed by TMZ treatment compared to TMZ treatment alone (p<0.0001); western blot
confirms ID1 knockdown in si-ID1 treatment groups (Figure 8C). Moreover, there was no
significant difference in cell viability between the U251 control and si-ID1 (100nM) conditions,
confirming that the siRNA-mediated ID1-knockdown alone does not have an effect on cell
viability. These results demonstrate that ID1 inhibition increases GBM cell sensitivity to TMZ-
chemotherapy treatment.
33
TreatmentCondition
CTL-----scram--si25---si50---si75----si100CTL------nM----nM----nM-----nM
ID1
β9actin
CTL scramble,CTL si,100nM
TMZ,25uM
si+TMZ,25uM
TMZ,50uM
si+TMZ,50uM
TMZ,100uM
si+TMZ,100uM
ID1
β%actin
0
2
4
6
8
10
12
scramble/CTL
CTL si/100nM TMZ/25uM si+TMZ/25uM
TMZ/50uM si+TMZ/50uM
TMZ/100uM
si+TMZ/100uM
Cell/Viability/
(viable/cells/#cells/seeded)
Treatment/Condition
***
******
Figure 8. ID1 inhibition (via siRNA) increases GBM cell sensitivity to TMZ-chemotherapy treatment. (A) Western blot analysis of the optimal si-ID1 concentration to be used for subsequent experiments in U251. si-ID1 of 100nM achieved the greatest ID1 knockdown at the protein level. (B) Microscopic images of the differential treatment conditions, depicting fewer cells in si-ID1+TMZ groups compared to TMZ alone. (C) Cell viability decreased in U251 cells pre-treated with si-ID1 followed by TMZ treatment (25, 50, 100 uM) compared to TMZ treatment alone. Western blot analysis confirms ID1 knockdown in si-ID1 treatment groups. Scale bar represents 100um. Error bars represent the ±SD of triplicate measurements and significance (***) was determined by comparing combined si-ID1 + TMZ-treated to TMZ-treated alone using t-test (p<0.001).
A B
C
34
8.4 ID1 Knockout Reduces Colony Formation Capacity following TMZ-Treatment
8.4.1 Development of an ID1-knockout cell line
Our in vitro findings that siRNA-mediated knockdown of ID1 potentiated the cytotoxic effect of
TMZ in glioma cells prompts consideration that complete ID1-knockout could similarly enhance
the cytotoxic effect of TMZ in vitro. Two limitations of using an siRNA approach are that it only
provides a transient effect, and difficulties arise in the delivery of siRNA to the brain. To study
the effect of long-term ID1 inhibition on glioma cell biology we employed the CRISPR/Cas9
system and developed a GBM cell line with a stable ID1 knockout. After establishing potential
ID1 knockout (ID1-KO) clones through a rigorous multi-step process in U251 GBM cell line, we
screened these clones for complete ID1-KO at the protein level using Western blot, and
subsequently sent for sanger sequencing to validate ID1 mutation. The screen identified several
clones that achieved ID1 knockout at the protein level, including two clones that we named ID1-
KO 14 and 19; we also selected a clone that did not show ID1 knockout at the protein level, that
we named Clone-33, to serve as an experimental control. (Figure 9A). Sanger sequencing
validated that these two ID1-KO clones harbour a mutation in the region targeted by the sgRNA
within the ID1 gene (Figure 9B-C). ID1-KO 14 and 19 clones were therefore used to establish
cell lines for subsequent experimental use.
A potential concern when employing the CRISPR/Cas9 system is causing a mutation in a non-
targeted region. Using a bio-informatics database, CRISPR Design (http://crispr.mit.edu), we
identified the top off-targets against the sgRNA used in our ID1 knockout model (Table 1).
Sanger sequencing validated that there is no mutation in three of the five top off-targets (Figure
10). Therefore, the results found in subsequent experiments are most likely not due to off-target
effects in our system.
35
ID1$KO'14
ID1$KO'19
sgRNA PAM(sequence
β"actin
ID1
12,,,,13,,,,,14,,,,15Clone,#
β"actin
ID1
32,,,,33,,,,34,,, 37Clone,#
18,,,,,19,,,,20,,,,21
β"actin
ID1
Clone,#
Figure 9. Development of an ID1-knockout line using CRISPR/Cas9. (A) Western blot analysis of a screen to identify clones with ID1-knockout at the protein level. Clone-14 and Clone-19 achieved a complete knockout of ID1, whereas Clone-33 did not. ID1-KO 14 and 19 clones were used to establish cell lines for subsequent experimental use, and Clone-33 was selected for use as a control. (B) Pictorial depiction of the sgRNA used to target the ID1 sequence, followed by the PAM sequence required by Cas9 to identify the position for DNA cleavage. (C) Sanger sequencing validated ID1-KO 14 and 19 harbor a mutation in the region targeted by the sgRNA within the ID1 gene, a one nucleotide deletion depicted as a red tick upstream of the PAM sequence.
A B
C
36
ID1$KOWT
Off$target/1/chr7:+108096350/
Off#target)5)chr2:#40006264)
ID1#KOWT
ID1$KOWT
Off$target/4/chr1:+236445511/
Table 1: Top off-target hits in CRISPR/Cas9 ID1-knockout system
sequence score mismatches UCSC
gene
locus
GAAAGCGTGGGGTGCGGGCG
CGG
2.4 3MMs
[3:8:10]
chr7:+10809635
0
AACACCGGGGGGTGCGGGCG
GGG
1.3 3MMs
[5:8:10]
chr1:+23644551
1
TAATGCGAGAGGTGCGGGCG
CGG
1.3 3MMs
[3:4:10]
NR_02810
2
chr2:-40006264
Figure 10. Three top off-target hits in the CRISPR/Cas9 ID1-knockout model display no mutation in the target region. Sanger sequencing validated there is no mutation in the target regions (chr7:+108096350; chr1:+236445511; chr2:-40006264); the target sequences display perfect alignment between ID1-KO and wild-type (WT), with no insertions or deletions.
37
8.4.2 ID1-knockout decreases colony formation following treatment with TMZ
Using our established stable ID1-knockout cell lines, we next wanted to ask whether ID1
knockout enhances the effect of TMZ in vitro? To address this question, we treated Clone-33
control, ID1-KO 14 and 19 U251 GBM cells with TMZ for either 3 or 7 days, at which point we
measured cell viability. We found no significant difference in the number of viable cells in ID1-
KO 14 and 19 compared to the control, at either time points following TMZ treatment (Figure
11A). We also found that ID1-knockout did not result in decreased cell viability compared to the
control in the no treatment conditions at 3 and 7 days (Figure 11B).
Following from our initial experiments investigating the role of ID1 in GBM tumour recurrence
in patient tumour samples, we next wanted to determine whether knocking out ID1 has an effect
on colony formation in vitro. To address this question, we assessed the ability of GBM cells that
possessed ID1 knockout to form colonies following TMZ treatment. Clone-33 control, or ID1-
KO 14 and 19 cells were treated with TMZ (100uM) for 7 days, followed by 7 days of no
treatment. We identified colonies at this time point (day 14) using crystal violet staining. ID1-
KO 14 and 19 showed significantly less colony formation following TMZ treatment compared to
control (Figure 11C). These results reveal that knocking out ID1 significantly reduces the ability
of U251 glioma cells to form colonies following TMZ treatment, suggesting that ID1 inhibition
could impair the ability of GBM tumours to recur following chemotherapy.
38
Clone&33(Control ID1&KO(14 ID1&KO(19
0
1
2
3
4
5
6
7
8
Clone/330Control
D3/TMZ
ID1/KO014
D3/TMZ
ID1/KO019
D3/TMZ
Cell0Viability
(viable0cells/#cells0seeded)
Condition
0
0.5
1
1.5
2
2.5
3
3.5
4
4.5
Clone/330Control
D7/TMZ
ID1/KO014
D7/TMZ
ID1/KO019
D7/TMZ
Cell0Viability
(viable0cells/#cells0seeded)
Condition
0
1
2
3
4
5
6
7
Clone.33/Control/D3.NT
ID1.KO/14/D3.NT
ID1.KO/19/D3.NT
Cell/Viability
(viable/cells/#cells/seeded)
Condition
0
10
20
30
40
50
60
70
Clone/33/Control/D7.NT
ID1.KO/14/D7.NT
ID1.KO/19/D7.NT
Cell/Viability
(viable/cells/#cells/seeded)
Condition
Figure 11. ID1-knockout reduces colony formation capacity following treatment with temozolomide. (A) No significant difference in the number of viable cells between ID1-KO 14 and 19 compared to Clone-33 control, following TMZ-treatment for 3 or 7 days. (B) No significant decrease in cell viability in ID1-KO clones compared to control, following no treatment for 3 or 7 days. (C) Crystal violet staining depicts the difference in ability to form colonies post-TMZ treatment in Clone-33 control compared to ID1-KO 14 and 19 cells. The cells were treated with TMZ (100uM) for 7 days, followed by 7 days of no treatment. ID1-knockout cells show a significant reduction in colony formation following TMZ-treatment compared to the control condition. Error bars represent the ±SD of triplicate measurements. D3 = 3 days post-TMZ treatment; D7 = 7 days post-TMZ treatment; NT = no treatment.
A
C
B
39
8.5 ID1 Knockout Delays GBM Tumour Initiation/Progression and Increases Overall Survival
ID1-KO showed a profound effect on glioma cell colony formation following TMZ treatment in
vitro. Our next step was to investigate how ID1 knockout effects GBM biology in vivo.
Specifically, we wanted to determine the effect of knocking out ID1 on GBM tumour growth. To
do so, we developed orthotopic xenograft tumours in NSG mice using control U251 and U251
ID1-KO glioma cells. NSG mice were injected intracranially with U251-luciferase control (n=8)
or ID1-KO 14-luciferase (n=9) cells. Tumour initiation and progression were monitored using
bioluminescence imaging. U251 control mice quickly developed glioblastoma tumours, with all
of the mice showing tumour formation by post-implantation day (PID) 9. Conversely, ID1-KO
14 mice did not all show signs of tumour formation until PID 20 (Figure 12A). Furthermore, the
tumours of U251 control mice progressed rapidly, with some mice developing leptomeningeal
dissemination by PID 13. Conversely, ID1-KO 14 mice showed very slow tumour progression.
Bioluminescence imaging demonstrated a significant difference in total photon flux between
U251 control and ID1-KO 14 at 1-, 2-, and 3-weeks post-injection (p<0.001) (Figure 12B). We
additionally wanted to determine if ID1-KO effected survival outcomes. Mice were allowed to
reach end-point in both groups. We found that the ID1-KO 14 mice survived 2.27 times longer
than the U251 control mice (p<0.001) (Figure 13). The average survival time in the control
group was 21-days post-injection, whereas the average survival time in the ID1-KO 14 group
was 47-days post-injection (Table 2). These results suggest that ID1 plays a critical role in
tumour initiation and progression. Further, ID1 knockout has a significant impact on overall
survival in glioblastoma.
40
clone #
14 1w
k
Control 1
wk
clone #
14 2w
ks
Control 2
wks
clone #
14 3w
ks
Control 3
wks
clone #
14 4w
ks
clone #
14 5w
ks
clone #
14 6w
ks0
200000
400000
600000
800000
1000000
Weeks after cell inoculation
Tota
l Pho
ton
Flux
clone #14 1wk Control 1wkclone #14 2wks Control 2wksclone #14 3wks Control 3wksclone #14 4wksclone #14 5wksclone #14 6wks
Total&Photon&Flux
Weeks&after&Cell&Inoculation
1 2 3 4 5 6
ID19KO&14
U251&Control
*** ***
***
U251%Control%Xenograft ID13KO%14%Xenograft
Figure 12. ID1-knockout delays glioblastoma tumour initiation and progression. (A) ID1-KO 14 mice show delayed tumour initiation and very slow tumour progression compared to U251 control mice, which show quick GBM tumour development and rapid tumour progression as determined by bioluminescent imaging. Red indicates high cell density while purple represents low cell density. By day-20 post-injection, all U251 control mice demonstrate substantial tumour mass and some have developed leptomeningeal metastasis; whereas the ID1-KO 14 mice continue to display minimal tumour progression. (B) Signal progression of flux activity from U251 cell xenografts and ID1-KO 14 cell xenografts demonstrate a significant difference in total photon flux between the two cohorts 1-, 2-, and 3-weeks after cell inoculation. Error bars represent ±SEM and significance (***) was determined by comparing ID1-KO 14 to U251 control using t-test (p<0.001).
A
B
41
0 20 40 60 800
50
100
Time (days)
Perc
ent s
urviv
al
Survival of Data for ID1 KO clone #14
U251 Control (n=8)U251 ID1 KO clone#14 (n=9)
ID1$KO'14'(n=9)
U251'Control'(n=8)
Table 2: Survival outcomes in ID1-knockout in vivo study
Cohort #1 Cohort #2
U251 control Survival Time (days) ID1-KO 14 Survival Time (days)
5086 20 5081 38
5087 20 5082 51
5088 20 5083 43
5089 20 5084 52
5090 22 5085 41
5091 20 5094 48
5092 25 5095 56
5093 20 5096 40
5097 58
Average survival time: 21 days Average survival: 47 days***
*** (p<0.001)
Figure 13. ID1-knockout increases overall survival time in glioblastoma. Kaplan-Meier analysis showed a significant difference in survival time between the two cohorts; ID1-KO 14 mice survived 2.27 times longer than the U251 control mice (p<0.001).
42
8.6 Pimozide Enhances the Effect of TMZ-Treatment and Provides a Therapeutic Advantage in Glioblastoma
The sum of our prior work suggested that ID1 inhibition could be of multi-factorial benefit to
patients with GBM. As our final step, we sought to evaluate the potential clinical application of
our work. We reviewed the literature to identify a clinically translatable inhibitor of ID1.
Through this review we identified pimozide, an FDA approved drug that is currently used as an
antipsychotic to treat patients with Tourette’s Disorder. Pimozide chemically inhibits ID1 by
targeting ID1 degradation, and is capable of crossing the blood-brain-barrier. We decided to
evaluate the utility of pimozide in combination with TMZ-chemotherapy in glioblastoma. U251
GBM cells were first treated with graded concentrations of pimozide (2.5, 5, 7.5, 10 uM) for
optimization purposes. The optimal concentration of pimozide selected for subsequent
experimental use was 5 uM, as it was not cytotoxic to the cells, but resulted in decreased ID1
protein levels (Figure 14A). U251 cells were then either pre-treated with pimozide followed by
TMZ treatment or treated with TMZ alone for 3 days. We found that cell viability decreased in
U251 cells pre-treated with pimozide followed by TMZ treatment (50 uM) compared to TMZ
treatment alone (p<0.01) (Figure 14B). Western blot analysis confirms ID1 inhibition in
pimozide treated groups. These results highlight the potential clinical relevance of this work, as
pimozide treatment enhances the effect of TMZ in GBM cells.
We next wanted to determine whether pimozide provides a therapeutic advantage in
glioblastoma when combined with TMZ-chemotherapy. To address this question, NSG mice
were injected intracranially with U251 cells that were luciferase-tagged. Following tumour
formation as confirmed by bioluminescence imaging, mice were treated with vehicle (n=5),
pimozide only (n=5), TMZ only (n=5), or pimozide + TMZ (n=5) for 2 weeks. Tumour
progression was monitored with serial bioluminescence imaging. Mice treated with pimozide
alone showed similar tumour progression compared to control (vehicle-treated) mice. These
results suggest that pimozide treatment has no effect on glioblastoma initiation and development
(Figure 15A). Mice treated with TMZ alone showed slight tumour regression immediately
following TMZ; however, this cohort showed evidence of tumour recurrence at 5 days following
completion of TMZ treatment. Mice treated with a combination of pimozide + TMZ showed the
same slight tumour regression immediately following TMZ; however, 5 days following the
completion of TMZ treatment, these mice continued to show a decrease in tumour growth
43
0
20
40
60
80
100
120
CTL pimo.5uM pimo.10uM
Cell.Viability.
(viable.cells/#cells.seeded)
Treatment.Condition
0
20
40
60
80
100
120
CTL pimo.5uM TMZ.50uM pimo.5uM.+TMZ.50uM
Cell.Viability.
(Viable.cells/#cells.seeded)
Treatment.Condition
ID1
ßGactin
**
(Figure 15B). These data suggest that pimozide combined with TMZ treatment delays tumour
recurrence in vivo compared to TMZ treatment alone. Moreover, these findings further validate
the potential clinical application of ID1 inhibition in combination with TMZ in the treatment of
glioblastoma patients.
Figure 14. Pimozide (small molecule inhibitor that targets ID1 degradation) increases GBM cell sensitivity to TMZ-treatment. (A) Cell viability analysis of the optimal pimozide concentration to be used for subsequence experiments in U251 cells. Pimozide 5 uM was not cytotoxic to the cells in comparison to 10 uM, and so was selected for further use. (B) Cell viability decreased in U251 cells pre-treated with pimozide followed by TMZ treatment (50uM) compared to TMZ treatment alone. Western blot confirms ID1 inhibition in pimozide treated groups. Error bars represent the ±SD of triplicate measurements and significance (**) was determined by comparing combined pimozide + TMZ-treated to TMZ-treated alone using t-test (p<0.01).
A
B
44
Figure 15. Pimozide enhances the effect of TMZ-treatment and provides a therapeutic advantage in glioblastoma. (A) Pimozide-treated mice displayed similar tumour progression compared to vehicle control mice, showing rapid tumour growth and leptomeningeal metastasis. Pimozide treatment provides no therapeutic advantage on its own. (B) TMZ-treated mice showed a dramatic increase in tumour growth 5 days post-TMZ treatment; whereas, pimozide + TMZ-treated mice showed a decrease in tumour growth 5 days post-TMZ treatment determined by bioluminescent imaging. Pimozide combined with TMZ treatment delays tumour recurrence in vivo compared to TMZ treatment alone. Red indicates high cell density while purple represents low cell density.
A
B
45
Chapter 4
Discussion and Future Directions
Discussion and Future Directions
9.1 Glioblastoma: Discovering an Ideal Therapeutic Target The primary aim of our work was to elucidate the role of ID1 in glioblastoma treatment
resistance and tumour recurrence, and to determine whether ID1 represents a therapeutic target in
this tumour. As outlined in the introduction, ID1 overexpression has been reported in many
cancers and is associated with malignant potential and aggressive clinical behavior162. It has
previously been demonstrated that there is a positive correlation between ID1 expression and
tumour grade in astrocytomas, with highest ID1 expression found in glioblastoma154. Precisely,
Soroceanu et al used immunohistochemistry (IHC) of TMAs containing glioma samples with
various tumour grades and found a gradual increase of ID1 positive samples from normal, to
grade II astrocytoma, grade III astrocytoma, and finally grade IV astrocytoma (glioblastoma)154.
Also, ID1 has previously been found to be highly upregulated in tumours from recurrent prostate
cancer patients, suggesting that ID1 overexpression may be responsible for the development of
treatment resistance153. In our study, immunohistochemical analysis demonstrated that GBM
patients with increased ID1 expression following chemotherapy experienced a shorter latency to
recurrence. This suggests that ID1 expression negatively correlates with progression-free
survival in GBM. Although ours is the first study to our knowledge that describes a correlation
between ID1 expression and latency to recurrence in GBM, these previous findings support that
ID1 may be a potential therapeutic target in glioblastoma treatment resistance and tumour
recurrence.
We corroborated our clinical data by further characterizing the interplay between ID1 expression
and response to temozolomide treatment in vitro. We observed that ID1 expression correlates
with TMZ resistancy in five GBM cell lines with differential baseline expression, in which high
basal ID1 expression was associated with increased resistancy to temozolomide. These findings
are in accordance with a previous report that found ectopic ID1 expression conferred resistance
to the chemotherapeutic agent Taxol in prostate and nasopharyngeal carcinoma cells160,161. Taken
46
together, ID1 expression appears to be associated with a more aggressive, chemotherapy-
resistant phenotype in many cancer types, including GBM.
Having established a relationship between ID1 expression and response to treatment in both
human patient tumour samples and GBM cell lines, we wanted to further explore the effects of
TMZ-chemotherapy on ID1 expression in vitro. Using immunocytochemistry (ICC) and Western
blot analysis we observed that TMZ exposure results in an increase in ID1 levels in GBM cells.
Initially we believed that this was due to transcriptional changes resulting in increased ID1 gene
expression. However, when we examined the effect of TMZ on ID1 expression at the mRNA
level using QT-PCR, we saw no significant change. These results would suggest that TMZ is not
inducing changes in ID1 at the genetic level, but potentially altering ID1 via post-transcriptional
or post-translational modifications, or enriching for ID1-positive cells. Campos et al found that
TMZ treatment decreases the diversity of tumour subclasses by selecting for the most resistant
subtypes, ultimately diminishing tumour heterogeneity163. We postulate that TMZ may be
selecting for ID1-positive cells, as this subgroup may represent the chemoresistant population in
GBM tumours. Another potential explanation for the observed increase in ID1 protein expression
following TMZ treatment is protein stabilization. USP1 is a ubiquitin-specific protease known to
rescue several proteins from ubiquitination-mediated protein degradation, including ID1. Lee et
al demonstrated that USP1 is highly expressed in primary human glioblastoma and promotes ID1
stability in GBM cells155. Therefore, it can be proposed that TMZ may exert its effect on USP1
and consequently ID1 protein stability, resulting in the observed increase in ID1 protein
expression post-TMZ treatment in GBM cells.
Interestingly, the increase in ID1 seen with TMZ exposure is specific to TMZ and not a more
general response to DNA damage. We did not find the same effect on ID1 expression when
U251 and GliNS1 GBM cells were treated with cisplatin, another chemotherapeutic agent. It is
known that TMZ and cisplatin employ differing mechanisms to induce DNA damage: cisplatin
cross-links DNA, whereas TMZ methylates guanine residues in the DNA molecule. Therefore,
the effect of TMZ treatment on ID1 expression may be attributed to a specific apoptotic
mechanism that does not involve chemical cross-linking of DNA strands, which is considered to
be more toxic.
47
9.2 Treating Glioblastoma in vitro: ID1 Inhibition Enhances the Effect of Temozolomide
We found that ID1 inhibition using siRNA increases GBM cell sensitivity to TMZ-chemotherapy
treatment, as demonstrated by decreased cell viability in U251 cells pre-treated with si-ID1
followed by TMZ treatment compared to TMZ treatment alone. Similar to our results, Zhang et
al demonstrated that ID1 inhibition via siRNA resulted in sensitization of prostate cancer cells to
Taxol treatment160. This effect was mediated by JNK activation, a pathway that has previously
been implicated in the inhibition of chemotherapeutic drug-induced apoptosis in cancer cells.
Our results are further supported by the finding that silencing ID1 and ID3 sensitized colon
cancer stem cells to the chemotherapeutic agent, oxilaplatin66. Taken together, ID1 inhibition
enhances the cytotoxic effect of chemotherapy agents in multiple cancer types.
We also evaluated the effect of ID1 inhibition on TMZ sensitivity using pimozide, an FDA
approved drug that chemically inhibits ID1. Pimozide is known as a small-molecule inhibitor
that is capable of crossing the blood-brain-barrier, thus making it clinically applicable for
glioblastoma treatment. As with siRNA-mediated knockdown of ID1, pimozide sensitized U251
GBM cells to TMZ-treatment, resulting in decreased cell viability following TMZ therapy. Lee
at al have also demonstrated that pimozide enhances the therapeutic efficacy of irradiation in
GBM cells155. They found that pimozide combined with the radiometric drug neocarzinostatin
(NSC) resulted in more persistent DNA damage in comparison to NSC alone155.
We employed the CRISPR/Cas9 system to study the effect of long-term ID1 inhibition by
developing a GBM cell line with a stable ID1 knockout. There are many advantages to using this
system in comparison to other genome editing technologies that have previously been established
for gene and cell therapy. For example, the CRISPR/Cas9 system allows simple nuclease
construction and in vitro testing, good targeting efficiency, and low time investment and cost, in
comparison to meganucleases, zinc finger nucleases, and TALENs164. For these reasons, we
decided to utilize the the CRISPR/Cas9 system in our study. We found that knocking out ID1 in
glioma cells significantly reduces their ability to form colonies following TMZ-treatment. Our
data is corroborated by a previous study that showed ID1 inhibition combined with irradiation
significantly decreased clonogenic regrowth compared to irradiation alone in GBM cells155.
48
Taken together, these results further support that ID1 may be implicated in GBM tumour
recurrence following cytotoxic therapy.
9.3 Treating Glioblastoma in vivo: Targeting ID1 Provides a Therapeutic Advantage
Currently, there have been no studies showing an effective response to ID1 inhibition in
combination with TMZ-treatment in an in vivo model of glioblastoma. After obtaining promising
in vitro results showing that ID1 knockdown or knockout exhibited a significant effect on TMZ
efficacy, we proceeded to test the effectiveness in vivo. However, we first wanted to examine the
effect of knocking out ID1 on GBM biology, without combined TMZ treatment. To do so, we
implanted NSG mice with either U251-luciferase control or ID1-KO-luciferase GBM cells and
monitored tumour growth. We observed rapid tumour initiation and progression in our control
mice; whereas, the ID1-KO mice experienced severely delayed tumour initiation and minimal
tumour progression over the same period of time. Furthermore, the ID1-KO mice demonstrated a
significant increase in survival time, 2.27 times longer than the U251 control mice. Similar to our
findings, Soroceanu et al demonstrated that treatment with the nontoxic cannabinoid,
cannabidiol, significantly reduced ID1 expression and tumour growth in an in vivo model of
GBM154. Specifically, cannabidiol decreased the tumour area by 95%; and 1 of the 5 treated mice
showed no tumour cells in any of the brain regions analyzed154. This study also found that
cannabidiol significantly inhibits glioblastoma dispersal using an ex vivo model154. Additionally,
previous studies have demonstrated the therapeutic benefit of targeting ID proteins in tumour
xenografts. For example, ID1/ID3 double knockout mice could not support tumour growth and
metastasis in three different tumour models87. Our results, taken together with previous findings,
would suggest that ID1 plays a critical role in tumour initiation and progression, as well as
invasion and overall survival in glioblastoma.
Finally, we examined the efficacy of combining TMZ treatment and ID1 inhibition in an in vivo
model of GBM. We treated NSG mice implanted with U251 GBM cells with either saline
(vehicle control), pimozide, TMZ, or pimozide + TMZ. We found that pre-treatment with
pimozide followed by TMZ resulted in prolonged tumour regression following treatment
compared to TMZ alone. The TMZ alone cohort displayed signs of tumour recurrence 5 days
after treatment, whereas the combined treatment group continued to demonstrate a decrease in
49
tumour growth at the same time point following completion of treatment. These data suggest that
combined therapy with pimozide and TMZ has a prolonged inhibitory effect on tumour
recurrence in vivo compared to TMZ alone, providing a therapeutic advantage. Our study
suggests that patients will derive a therapeutic advantage by combining ID1 inhibition with
standard of care treatment in GBM.
9.4 Conclusions Our study provides in vitro and in vivo evidence that ID1 inhibition enhances the the efficacy of
temozolomide treatment in glioblastoma. Our findings are significant for two reasons. First, as
the vast majority of glioblastoma patients experience chemoresistance, the identification of
therapies that can prolong time to relapse is of paramount importance. Second, we demonstrated
that there is a significant survival benefit with ID1 knockout alone in a GBM xenograft model.
This finding demonstrates that ID1 is critical to glioma biology, and its targeting may have
benefit to patients with GBM independent of its effects on chemotherapy. While our results are
encouraging, more work is needed to evaluate the optimal combination of treatments in GBM.
For example, pimozide has been combined with irradiation in a previous study, and with
temozolomide in our current study; however, the combination of all three treatments should be
evaluated in the future using in vitro and in vivo models of GBM. Finally, since we are proposing
the use of pimozide in glioblastoma patients, more information about the drug’s long-term
effects, specifically when combined with toxic agents, should be taken into consideration if this
drug is to be used in the clinic in the future.
9.5 Future Directions Regarding the effect of temozolomide on ID1 expression in vitro, a better understanding of the
mechanism should be obtained as to what is causing this observed increase in ID1 protein
expression following treatment. We have identified four potential hypotheses to explain the
effect of TMZ on ID1 levels: (1) TMZ selects for ID1-positive glioma cells; (2) TMZ induces
ID1 gene expression; (3) TMZ enhances ID1 stability by post-translational modifications; and
(4) TMZ results in decreased ID1 degradation. To assess whether TMZ is selecting for ID1-
positive cells or inducing ID1 gene expression, we would employ a reporter gene and promoter-
reporter, respectively. One potential way that TMZ could enhance ID1 stability via post-
translational modifications is by increasing the half-life of ID1. To address this possibility, we
50
would treat GBM cells with cycloheximide, an inhibitor of protein synthesis that is used as an
experimental tool to determine the half-life of a protein, following either treatment with TMZ or
no treatment. Western blot analysis would then be used to measure ID1 protein levels at various
time points following treatment with cycloheximide. The major pathway of protein degradation
uses ubiquitin as a marker that targets nuclear and cytosolic proteins for proteolysis. To address
the hypothesis that TMZ results in decreased ID1 degradation, we would employ an in vitro
ubiquitination assay on GBM cells following treatment with TMZ or no treatment.
To further understand the function of ID1 and how it might mediate resistance, we could perform
ID1-pulldown followed by mass spectrometry to identify the binding partners of ID1,
specifically post-TMZ treatment. This will allow us to gain insight into potential pathways that
may be activated upon treatment with TMZ. For example, ID1 may be binding to a key player in
a DNA damage pathway following TMZ-treatment, thus resulting in its increased expression. In
our study we established a correlation between ID1 expression and TMZ resistancy, and also
demonstrated that ID1 inhibition sensitizes GBM cells to temozolomide. The next step would be
to evaluate the effect of ID1 overexpression on TMZ sensitivity, whereby we hypothesize that
ectopic ID1 expression will result in increased resistancy to treatment. Finally, combining
pimozide with other conventional therapies such as both radio- and chemo-therapy should be
evaluated in an in vivo setting.
51
References
1. Ostrom, Q. T. et al. CBTRUS Statistical Report: Primary Brain and Central Nervous
System Tumors Diagnosed in the United States in 2008-2012. Neuro-Oncol. 17 Suppl 4,
iv1–iv62 (2015).
2. Ohgaki, H. & Kleihues, P. Population-based studies on incidence, survival rates, and
genetic alterations in astrocytic and oligodendroglial gliomas. J. Neuropathol. Exp. Neurol.
64, 479–489 (2005).
3. Thumma, S. R. et al. Effect of pretreatment clinical factors on overall survival in
glioblastoma multiforme: a Surveillance Epidemiology and End Results (SEER) population
analysis. World J. Surg. Oncol. 10, 75 (2012).
4. Burnet, N. G., Jefferies, S. J., Benson, R. J., Hunt, D. P. & Treasure, F. P. Years of life lost
(YLL) from cancer is an important measure of population burden--and should be
considered when allocating research funds. Br. J. Cancer 92, 241–245 (2005).
5. Stupp, R. et al. Radiotherapy plus concomitant and adjuvant temozolomide for
glioblastoma. N. Engl. J. Med. 352, 987–996 (2005).
6. Ohgaki, H. et al. Genetic pathways to glioblastoma: a population-based study. Cancer Res.
64, 6892–6899 (2004).
7. Bondy, M. L. et al. Brain tumor epidemiology: consensus from the Brain Tumor
Epidemiology Consortium. Cancer 113, 1953–1968 (2008).
8. Hottinger, A. F. & Khakoo, Y. Update on the management of familial central nervous
system tumor syndromes. Curr. Neurol. Neurosci. Rep. 7, 200–207 (2007).
9. Gu, J., Liu, Y., Kyritsis, A. P. & Bondy, M. L. Molecular epidemiology of primary brain
tumors. Neurother. J. Am. Soc. Exp. Neurother. 6, 427–435 (2009).
10. Easaw, J. C. et al. Canadian recommendations for the treatment of recurrent or progressive
glioblastoma multiforme. Curr. Oncol. Tor. Ont 18, e126–136 (2011).
52
11. Louis, D. N. et al. The 2007 WHO classification of tumours of the central nervous system.
Acta Neuropathol. (Berl.) 114, 97–109 (2007).
12. Theeler, B. J., Yung, W. K. A., Fuller, G. N. & De Groot, J. F. Moving toward molecular
classification of diffuse gliomas in adults. Neurology 79, 1917–1926 (2012).
13. Dolecek, T. A., Propp, J. M., Stroup, N. E. & Kruchko, C. CBTRUS statistical report:
primary brain and central nervous system tumors diagnosed in the United States in 2005-
2009. Neuro-Oncol. 14 Suppl 5, v1–49 (2012).
14. Rasheed, B. K. et al. Chromosome 10 deletion mapping in human gliomas: a common
deletion region in 10q25. Oncogene 10, 2243–2246 (1995).
15. Kim, D. H., Mohapatra, G., Bollen, A., Waldman, F. M. & Feuerstein, B. G. Chromosomal
abnormalities in glioblastoma multiforme tumors and glioma cell lines detected by
comparative genomic hybridization. Int. J. Cancer 60, 812–819 (1995).
16. Vranová, V. et al. Screening of genomic imbalances in glioblastoma multiforme using high-
resolution comparative genomic hybridization. Oncol. Rep. 17, 457–464 (2007).
17. Collins, V. P. Brain tumours: classification and genes. J. Neurol. Neurosurg. Psychiatry 75
Suppl 2, ii2–11 (2004).
18. von Deimling, A. et al. Comprehensive allelotype and genetic anaysis of 466 human
nervous system tumors. J. Neuropathol. Exp. Neurol. 59, 544–558 (2000).
19. Nishizaki, T. et al. Investigation of genetic alterations associated with the grade of
astrocytic tumor by comparative genomic hybridization. Genes. Chromosomes Cancer 21,
340–346 (1998).
20. Mohapatra, G. et al. Genetic analysis of glioblastoma multiforme provides evidence for
subgroups within the grade. Genes. Chromosomes Cancer 21, 195–206 (1998).
21. Ohgaki, H. & Kleihues, P. Genetic pathways to primary and secondary glioblastoma. Am. J.
Pathol. 170, 1445–1453 (2007).
53
22. Yin, D. et al. High-resolution genomic copy number profiling of glioblastoma multiforme
by single nucleotide polymorphism DNA microarray. Mol. Cancer Res. MCR 7, 665–677
(2009).
23. Burton, E. C. et al. Genetic aberrations defined by comparative genomic hybridization
distinguish long-term from typical survivors of glioblastoma. Cancer Res. 62, 6205–6210
(2002).
24. Shinojima, N. et al. Prognostic value of epidermal growth factor receptor in patients with
glioblastoma multiforme. Cancer Res. 63, 6962–6970 (2003).
25. Wong, A. J. et al. Increased expression of the epidermal growth factor receptor gene in
malignant gliomas is invariably associated with gene amplification. Proc. Natl. Acad. Sci.
U. S. A. 84, 6899–6903 (1987).
26. Beroukhim, R. et al. Assessing the significance of chromosomal aberrations in cancer:
methodology and application to glioma. Proc. Natl. Acad. Sci. U. S. A. 104, 20007–20012
(2007).
27. Mellinghoff, I. K. et al. Molecular determinants of the response of glioblastomas to EGFR
kinase inhibitors. N. Engl. J. Med. 353, 2012–2024 (2005).
28. Phillips, H. S. et al. Molecular subclasses of high-grade glioma predict prognosis, delineate
a pattern of disease progression, and resemble stages in neurogenesis. Cancer Cell 9, 157–
173 (2006).
29. Cancer Genome Atlas Research Network. Comprehensive genomic characterization defines
human glioblastoma genes and core pathways. Nature 455, 1061–1068 (2008).
30. Verhaak, R. G. W. et al. Integrated genomic analysis identifies clinically relevant subtypes
of glioblastoma characterized by abnormalities in PDGFRA, IDH1, EGFR, and NF1.
Cancer Cell 17, 98–110 (2010).
31. Hegi, M. E. et al. MGMT gene silencing and benefit from temozolomide in glioblastoma.
N. Engl. J. Med. 352, 997–1003 (2005).
54
32. Newlands, E. S., Stevens, M. F., Wedge, S. R., Wheelhouse, R. T. & Brock, C.
Temozolomide: a review of its discovery, chemical properties, pre-clinical development
and clinical trials. Cancer Treat. Rev. 23, 35–61 (1997).
33. Newlands, E. S. et al. Phase I trial of temozolomide (CCRG 81045: M&B 39831: NSC
362856). Br. J. Cancer 65, 287–291 (1992).
34. Stevens, M. F. et al. Antitumor activity and pharmacokinetics in mice of 8-carbamoyl-3-
methyl-imidazo[5,1-d]-1,2,3,5-tetrazin-4(3H)-one (CCRG 81045; M & B 39831), a novel
drug with potential as an alternative to dacarbazine. Cancer Res. 47, 5846–5852 (1987).
35. Denny, B. J., Wheelhouse, R. T., Stevens, M. F., Tsang, L. L. & Slack, J. A. NMR and
molecular modeling investigation of the mechanism of activation of the antitumor drug
temozolomide and its interaction with DNA. Biochemistry (Mosc.) 33, 9045–9051 (1994).
36. Tisdale, M. J. Antitumor imidazotetrazines--XV. Role of guanine O6 alkylation in the
mechanism of cytotoxicity of imidazotetrazinones. Biochem. Pharmacol. 36, 457–462
(1987).
37. Tsang, L. L., Farmer, P. B., Gescher, A. & Slack, J. A. Characterisation of urinary
metabolites of temozolomide in humans and mice and evaluation of their cytotoxicity.
Cancer Chemother. Pharmacol. 26, 429–436 (1990).
38. Patel, M., McCully, C., Godwin, K. & Balis, F. M. Plasma and cerebrospinal fluid
pharmacokinetics of intravenous temozolomide in non-human primates. J. Neurooncol. 61,
203–207 (2003).
39. Drabløs, F. et al. Alkylation damage in DNA and RNA--repair mechanisms and medical
significance. DNA Repair 3, 1389–1407 (2004).
40. Wedge, S. R. & Newlands, E. S. O6-benzylguanine enhances the sensitivity of a glioma
xenograft with low O6-alkylguanine-DNA alkyltransferase activity to temozolomide and
BCNU. Br. J. Cancer 73, 1049–1052 (1996).
55
41. Kyrtopoulos, S. A. et al. DNA adducts and the mechanism of carcinogenesis and
cytotoxicity of methylating agents of environmental and clinical significance. Cancer
Detect. Prev. 21, 391–405 (1997).
42. Mojas, N., Lopes, M. & Jiricny, J. Mismatch repair-dependent processing of methylation
damage gives rise to persistent single-stranded gaps in newly replicated DNA. Genes Dev.
21, 3342–3355 (2007).
43. Cejka, P. et al. Methylation-induced G(2)/M arrest requires a full complement of the
mismatch repair protein hMLH1. EMBO J. 22, 2245–2254 (2003).
44. D’Atri, S. et al. Involvement of the mismatch repair system in temozolomide-induced
apoptosis. Mol. Pharmacol. 54, 334–341 (1998).
45. Horton, J. K. & Wilson, S. H. Hypersensitivity phenotypes associated with genetic and
synthetic inhibitor-induced base excision repair deficiency. DNA Repair 6, 530–543 (2007).
46. Silber, J. R. et al. O6-methylguanine-DNA methyltransferase-deficient phenotype in human
gliomas: frequency and time to tumor progression after alkylating agent-based
chemotherapy. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 5, 807–814 (1999).
47. Gerson, S. L. Clinical relevance of MGMT in the treatment of cancer. J. Clin. Oncol. Off. J.
Am. Soc. Clin. Oncol. 20, 2388–2399 (2002).
48. Gerson, S. L. MGMT: its role in cancer aetiology and cancer therapeutics. Nat. Rev. Cancer
4, 296–307 (2004).
49. Zhang, J., Stevens, M. F. G., Laughton, C. A., Madhusudan, S. & Bradshaw, T. D.
Acquired resistance to temozolomide in glioma cell lines: molecular mechanisms and
potential translational applications. Oncology 78, 103–114 (2010).
50. Wiewrodt, D. et al. MGMT in primary and recurrent human glioblastomas after radiation
and chemotherapy and comparison with p53 status and clinical outcome. Int. J. Cancer 122,
1391–1399 (2008).
56
51. Friedman, H. S. et al. Methylator resistance mediated by mismatch repair deficiency in a
glioblastoma multiforme xenograft. Cancer Res. 57, 2933–2936 (1997).
52. Yip, S. et al. MSH6 mutations arise in glioblastomas during temozolomide therapy and
mediate temozolomide resistance. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 15,
4622–4629 (2009).
53. Wood, R. D., Mitchell, M., Sgouros, J. & Lindahl, T. Human DNA repair genes. Science
291, 1284–1289 (2001).
54. Trivedi, R. N., Almeida, K. H., Fornsaglio, J. L., Schamus, S. & Sobol, R. W. The role of
base excision repair in the sensitivity and resistance to temozolomide-mediated cell death.
Cancer Res. 65, 6394–6400 (2005).
55. Aguilar-Quesada, R. et al. Modulation of transcription by PARP-1: consequences in
carcinogenesis and inflammation. Curr. Med. Chem. 14, 1179–1187 (2007).
56. Lockett, K. L., Snowhite, I. V. & Hu, J. J. Nucleotide-excision repair and prostate cancer
risk. Cancer Lett. 220, 125–135 (2005).
57. Alvino, E. et al. A single cycle of treatment with temozolomide, alone or combined with
O(6)-benzylguanine, induces strong chemoresistance in melanoma cell clones in vitro: role
of O(6)-methylguanine-DNA methyltransferase and the mismatch repair system. Int. J.
Oncol. 29, 785–797 (2006).
58. Bradshaw, T. D. et al. Mechanisms of acquired resistance to 2-(4-Amino-3-
methylphenyl)benzothiazole in breast cancer cell lines. Breast Cancer Res. Treat. 110, 57–
68 (2008).
59. Longley, D. B. & Johnston, P. G. Molecular mechanisms of drug resistance. J. Pathol. 205,
275–292 (2005).
60. Lapidot, T. et al. A cell initiating human acute myeloid leukaemia after transplantation into
SCID mice. Nature 367, 645–648 (1994).
57
61. Bonnet, D. & Dick, J. E. Human acute myeloid leukemia is organized as a hierarchy that
originates from a primitive hematopoietic cell. Nat. Med. 3, 730–737 (1997).
62. Hope, K. J., Jin, L. & Dick, J. E. Acute myeloid leukemia originates from a hierarchy of
leukemic stem cell classes that differ in self-renewal capacity. Nat. Immunol. 5, 738–743
(2004).
63. Auffinger, B. et al. Conversion of differentiated cancer cells into cancer stem-like cells in a
glioblastoma model after primary chemotherapy. Cell Death Differ. 21, 1119–1131 (2014).
64. Bleau, A.-M. et al. PTEN/PI3K/Akt pathway regulates the side population phenotype and
ABCG2 activity in glioma tumor stem-like cells. Cell Stem Cell 4, 226–235 (2009).
65. Beier, D. et al. Efficacy of clinically relevant temozolomide dosing schemes in
glioblastoma cancer stem cell lines. J. Neurooncol. 109, 45–52 (2012).
66. O’Brien, C. A., Pollett, A., Gallinger, S. & Dick, J. E. A human colon cancer cell capable of
initiating tumour growth in immunodeficient mice. Nature 445, 106–110 (2007).
67. Ricci-Vitiani, L. et al. Identification and expansion of human colon-cancer-initiating cells.
Nature 445, 111–115 (2007).
68. Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J. & Clarke, M. F.
Prospective identification of tumorigenic breast cancer cells. Proc. Natl. Acad. Sci. U. S. A.
100, 3983–3988 (2003).
69. Eramo, A. et al. Identification and expansion of the tumorigenic lung cancer stem cell
population. Cell Death Differ. 15, 504–514 (2008).
70. Schatton, T. et al. Identification of cells initiating human melanomas. Nature 451, 345–349
(2008).
71. Singh, S. K. et al. Identification of human brain tumour initiating cells. Nature 432, 396–
401 (2004).
58
72. Galli, R. et al. Isolation and characterization of tumorigenic, stem-like neural precursors
from human glioblastoma. Cancer Res. 64, 7011–7021 (2004).
73. Sanai, N., Alvarez-Buylla, A. & Berger, M. S. Neural stem cells and the origin of gliomas.
N. Engl. J. Med. 353, 811–822 (2005).
74. Chen, J. et al. A restricted cell population propagates glioblastoma growth after
chemotherapy. Nature 488, 522–526 (2012).
75. Weller, M., Cloughesy, T., Perry, J. R. & Wick, W. Standards of care for treatment of
recurrent glioblastoma--are we there yet? Neuro-Oncol. 15, 4–27 (2013).
76. Marucci, G. et al. Pathological spectrum in recurrences of glioblastoma multiforme.
Pathologica 107, 1–8 (2015).
77. Burger, P. C. et al. Computerized tomographic and pathologic studies of the untreated,
quiescent, and recurrent glioblastoma multiforme. J. Neurosurg. 58, 159–169 (1983).
78. De Bonis, P. et al. The influence of surgery on recurrence pattern of glioblastoma. Clin.
Neurol. Neurosurg. 115, 37–43 (2013).
79. van Nifterik, K. A. et al. Genetic profiling of a distant second glioblastoma multiforme after
radiotherapy: Recurrence or second primary tumor? J. Neurosurg. 105, 739–744 (2006).
80. Kim, J. et al. Spatiotemporal Evolution of the Primary Glioblastoma Genome. Cancer Cell
28, 318–328 (2015).
81. Andor, N., Harness, J. V., Müller, S., Mewes, H. W. & Petritsch, C. EXPANDS: expanding
ploidy and allele frequency on nested subpopulations. Bioinforma. Oxf. Engl. 30, 50–60
(2014).
82. Omuro, A. M. P., Faivre, S. & Raymond, E. Lessons learned in the development of targeted
therapy for malignant gliomas. Mol. Cancer Ther. 6, 1909–1919 (2007).
83. Omuro, A. & DeAngelis, L. M. Glioblastoma and other malignant gliomas: a clinical
review. JAMA 310, 1842–1850 (2013).
59
84. Lasorella, A., Uo, T. & Iavarone, A. Id proteins at the cross-road of development and
cancer. Oncogene 20, 8326–8333 (2001).
85. Massari, M. E. & Murre, C. Helix-loop-helix proteins: regulators of transcription in
eucaryotic organisms. Mol. Cell. Biol. 20, 429–440 (2000).
86. Benezra, R., Davis, R. L., Lockshon, D., Turner, D. L. & Weintraub, H. The protein Id: a
negative regulator of helix-loop-helix DNA binding proteins. Cell 61, 49–59 (1990).
87. Lyden, D. et al. Id1 and Id3 are required for neurogenesis, angiogenesis and vascularization
of tumour xenografts. Nature 401, 670–677 (1999).
88. Desprez, P. Y., Hara, E., Bissell, M. J. & Campisi, J. Suppression of mammary epithelial
cell differentiation by the helix-loop-helix protein Id-1. Mol. Cell. Biol. 15, 3398–3404
(1995).
89. Sun, X. H. Constitutive expression of the Id1 gene impairs mouse B cell development. Cell
79, 893–900 (1994).
90. Yan, W. et al. High incidence of T-cell tumors in E2A-null mice and E2A/Id1 double-
knockout mice. Mol. Cell. Biol. 17, 7317–7327 (1997).
91. Norton, J. D. ID helix-loop-helix proteins in cell growth, differentiation and tumorigenesis.
J. Cell Sci. 113 ( Pt 22), 3897–3905 (2000).
92. Zebedee, Z. & Hara, E. Id proteins in cell cycle control and cellular senescence. Oncogene
20, 8317–8325 (2001).
93. Ruzinova, M. B. & Benezra, R. Id proteins in development, cell cycle and cancer. Trends
Cell Biol. 13, 410–418 (2003).
94. Campuzano, S. Emc, a negative HLH regulator with multiple functions in Drosophila
development. Oncogene 20, 8299–8307 (2001).
60
95. Morrow, M. A., Mayer, E. W., Perez, C. A., Adlam, M. & Siu, G. Overexpression of the
Helix-Loop-Helix protein Id2 blocks T cell development at multiple stages. Mol. Immunol.
36, 491–503 (1999).
96. Wice, B. M. & Gordon, J. I. Forced expression of Id-1 in the adult mouse small intestinal
epithelium is associated with development of adenomas. J. Biol. Chem. 273, 25310–25319
(1998).
97. Cai, L., Morrow, E. M. & Cepko, C. L. Misexpression of basic helix-loop-helix genes in the
murine cerebral cortex affects cell fate choices and neuronal survival. Dev. Camb. Engl.
127, 3021–3030 (2000).
98. Yokota, Y. Id and development. Oncogene 20, 8290–8298 (2001).
99. Volpert, O. V. et al. Id1 regulates angiogenesis through transcriptional repression of
thrombospondin-1. Cancer Cell 2, 473–483 (2002).
100. Hara, E. et al. Id-related genes encoding helix-loop-helix proteins are required for G1
progression and are repressed in senescent human fibroblasts. J. Biol. Chem. 269, 2139–
2145 (1994).
101. Barone, M. V., Pepperkok, R., Peverali, F. A. & Philipson, L. Id proteins control growth
induction in mammalian cells. Proc. Natl. Acad. Sci. U. S. A. 91, 4985–4988 (1994).
102. Alani, R. M., Young, A. Z. & Shifflett, C. B. Id1 regulation of cellular senescence through
transcriptional repression of p16/Ink4a. Proc. Natl. Acad. Sci. U. S. A. 98, 7812–7816
(2001).
103. Ohtani, N. et al. Opposing effects of Ets and Id proteins on p16INK4a expression during
cellular senescence. Nature 409, 1067–1070 (2001).
104. Everly, D. N., Mainou, B. A. & Raab-Traub, N. Induction of Id1 and Id3 by latent
membrane protein 1 of Epstein-Barr virus and regulation of p27/Kip and cyclin-dependent
kinase 2 in rodent fibroblast transformation. J. Virol. 78, 13470–13478 (2004).
61
105. Tanaka, K. et al. Expression of Id1 results in apoptosis of cardiac myocytes through a
redox-dependent mechanism. J. Biol. Chem. 273, 25922–25928 (1998).
106. Kim, D., Peng, X. C. & Sun, X. H. Massive apoptosis of thymocytes in T-cell-deficient Id1
transgenic mice. Mol. Cell. Biol. 19, 8240–8253 (1999).
107. Parrinello, S. et al. Id-1, ITF-2, and Id-2 comprise a network of helix-loop-helix proteins
that regulate mammary epithelial cell proliferation, differentiation, and apoptosis. J. Biol.
Chem. 276, 39213–39219 (2001).
108. Fong, S. et al. Id-1 as a molecular target in therapy for breast cancer cell invasion and
metastasis. Proc. Natl. Acad. Sci. U. S. A. 100, 13543–13548 (2003).
109. Perk, J., Iavarone, A. & Benezra, R. Id family of helix-loop-helix proteins in cancer. Nat.
Rev. Cancer 5, 603–614 (2005).
110. Fong, S., Debs, R. J. & Desprez, P.-Y. Id genes and proteins as promising targets in cancer
therapy. Trends Mol. Med. 10, 387–392 (2004).
111. Kebebew, E., Treseler, P. A., Duh, Q. Y. & Clark, O. H. The helix-loop-helix transcription
factor, Id-1, is overexpressed in medullary thyroid cancer. Surgery 128, 952–957 (2000).
112. Polsky, D., Young, A. Z., Busam, K. J. & Alani, R. M. The transcriptional repressor of
p16/Ink4a, Id1, is up-regulated in early melanomas. Cancer Res. 61, 6008–6011 (2001).
113. Andres-Barquin, P. J., Hernandez, M. C. & Israel, M. A. Id4 expression induces apoptosis
in astrocytic cultures and is down-regulated by activation of the cAMP-dependent signal
transduction pathway. Exp. Cell Res. 247, 347–355 (1999).
114. Vandeputte, D. A. A. et al. Expression and distribution of id helix-loop-helix proteins in
human astrocytic tumors. Glia 38, 329–338 (2002).
115. Schindl, M. et al. Overexpression of Id-1 protein is a marker for unfavorable prognosis in
early-stage cervical cancer. Cancer Res. 61, 5703–5706 (2001).
62
116. Ouyang, X. S., Wang, X., Lee, D. T. W., Tsao, S. W. & Wong, Y. C. Over expression of
ID-1 in prostate cancer. J. Urol. 167, 2598–2602 (2002).
117. Lasorella, A. et al. Id2 is critical for cellular proliferation and is the oncogenic effector of
N-myc in human neuroblastoma. Cancer Res. 62, 301–306 (2002).
118. Tournay, O. & Benezra, R. Transcription of the dominant-negative helix-loop-helix protein
Id1 is regulated by a protein complex containing the immediate-early response gene Egr-1.
Mol. Cell. Biol. 16, 2418–2430 (1996).
119. Gautschi, O. et al. Regulation of Id1 expression by SRC: implications for targeting of the
bone morphogenetic protein pathway in cancer. Cancer Res. 68, 2250–2258 (2008).
120. Ying, Q. L., Nichols, J., Chambers, I. & Smith, A. BMP induction of Id proteins suppresses
differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3.
Cell 115, 281–292 (2003).
121. Bain, G. et al. Regulation of the helix-loop-helix proteins, E2A and Id3, by the Ras-ERK
MAPK cascade. Nat. Immunol. 2, 165–171 (2001).
122. Swarbrick, A. et al. Regulation of cyclin expression and cell cycle progression in breast
epithelial cells by the helix-loop-helix protein Id1. Oncogene 24, 381–389 (2005).
123. Schuller, H. M. Is cancer triggered by altered signalling of nicotinic acetylcholine
receptors? Nat. Rev. Cancer 9, 195–205 (2009).
124. Improgo, M. R., Tapper, A. R. & Gardner, P. D. Nicotinic acetylcholine receptor-mediated
mechanisms in lung cancer. Biochem. Pharmacol. 82, 1015–1021 (2011).
125. Ponz-Sarvisé, M. et al. Inhibitor of differentiation-1 as a novel prognostic factor in NSCLC
patients with adenocarcinoma histology and its potential contribution to therapy resistance.
Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 17, 4155–4166 (2011).
126. Bounpheng, M. A., Dimas, J. J., Dodds, S. G. & Christy, B. A. Degradation of Id proteins
by the ubiquitin-proteasome pathway. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 13,
2257–2264 (1999).
63
127. Kong, Y., Cui, H. & Zhang, H. Smurf2-mediated ubiquitination and degradation of Id1
regulates p16 expression during senescence. Aging Cell 10, 1038–1046 (2011).
128. Williams, S. A. et al. USP1 deubiquitinates ID proteins to preserve a mesenchymal stem
cell program in osteosarcoma. Cell 146, 918–930 (2011).
129. Alani, R. M. et al. Immortalization of primary human keratinocytes by the helix-loop-helix
protein, Id-1. Proc. Natl. Acad. Sci. U. S. A. 96, 9637–9641 (1999).
130. Ouyang, X. S. et al. Id-1 stimulates serum independent prostate cancer cell proliferation
through inactivation of p16(INK4a)/pRB pathway. Carcinogenesis 23, 721–725 (2002).
131. Wilson, J. W. et al. Expression of Id helix-loop-helix proteins in colorectal adenocarcinoma
correlates with p53 expression and mitotic index. Cancer Res. 61, 8803–8810 (2001).
132. Kim, H. et al. Id-1 regulates Bcl-2 and Bax expression through p53 and NF-kappaB in
MCF-7 breast cancer cells. Breast Cancer Res. Treat. 112, 287–296 (2008).
133. Lin, J. et al. Inhibitor of differentiation 1 contributes to head and neck squamous cell
carcinoma survival via the NF-kappaB/survivin and phosphoinositide 3-kinase/Akt
signaling pathways. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 16, 77–87 (2010).
134. Sharma, P., Patel, D. & Chaudhary, J. Id1 and Id3 expression is associated with increasing
grade of prostate cancer: Id3 preferentially regulates CDKN1B. Cancer Med. 1, 187–197
(2012).
135. Ling, M.-T., Kwok, W.-K., Fung, M. K., Xianghong, W. & Wong, Y.-C. Proteasome
mediated degradation of Id-1 is associated with TNFalpha-induced apoptosis in prostate
cancer cells. Carcinogenesis 27, 205–215 (2006).
136. Mern, D. S., Hoppe-Seyler, K., Hoppe-Seyler, F., Hasskarl, J. & Burwinkel, B. Targeting
Id1 and Id3 by a specific peptide aptamer induces E-box promoter activity, cell cycle arrest,
and apoptosis in breast cancer cells. Breast Cancer Res. Treat. 124, 623–633 (2010).
137. Coma, S. et al. Id2 promotes tumor cell migration and invasion through transcriptional
repression of semaphorin 3F. Cancer Res. 70, 3823–3832 (2010).
64
138. Egeblad, M. & Werb, Z. New functions for the matrix metalloproteinases in cancer
progression. Nat. Rev. Cancer 2, 161–174 (2002).
139. Shiomi, T. & Okada, Y. MT1-MMP and MMP-7 in invasion and metastasis of human
cancers. Cancer Metastasis Rev. 22, 145–152 (2003).
140. Desprez, P. Y. et al. A novel pathway for mammary epithelial cell invasion induced by the
helix-loop-helix protein Id-1. Mol. Cell. Biol. 18, 4577–4588 (1998).
141. Takai, N., Miyazaki, T., Fujisawa, K., Nasu, K. & Miyakawa, I. Id1 expression is
associated with histological grade and invasive behavior in endometrial carcinoma. Cancer
Lett. 165, 185–193 (2001).
142. Lin, C. Q. et al. A role for Id-1 in the aggressive phenotype and steroid hormone response
of human breast cancer cells. Cancer Res. 60, 1332–1340 (2000).
143. Minn, A. J. et al. Genes that mediate breast cancer metastasis to lung. Nature 436, 518–524
(2005).
144. Ruzinova, M. B. et al. Effect of angiogenesis inhibition by Id loss and the contribution of
bone-marrow-derived endothelial cells in spontaneous murine tumors. Cancer Cell 4, 277–
289 (2003).
145. Fontemaggi, G. et al. The execution of the transcriptional axis mutant p53, E2F1 and ID4
promotes tumor neo-angiogenesis. Nat. Struct. Mol. Biol. 16, 1086–1093 (2009).
146. Jin, X. et al. EGFR-AKT-Smad signaling promotes formation of glioma stem-like cells and
tumor angiogenesis by ID3-driven cytokine induction. Cancer Res. 71, 7125–7134 (2011).
147. Lyden, D. et al. Impaired recruitment of bone-marrow-derived endothelial and
hematopoietic precursor cells blocks tumor angiogenesis and growth. Nat. Med. 7, 1194–
1201 (2001).
148. Ling, M.-T. et al. Overexpression of Id-1 in prostate cancer cells promotes angiogenesis
through the activation of vascular endothelial growth factor (VEGF). Carcinogenesis 26,
1668–1676 (2005).
65
149. Niola, F. et al. Mesenchymal high-grade glioma is maintained by the ID-RAP1 axis. J.
Clin. Invest. 123, 405–417 (2013).
150. Anido, J. et al. TGF-β Receptor Inhibitors Target the CD44(high)/Id1(high) Glioma-
Initiating Cell Population in Human Glioblastoma. Cancer Cell 18, 655–668 (2010).
151. Barrett, L. E. et al. Self-renewal does not predict tumor growth potential in mouse models
of high-grade glioma. Cancer Cell 21, 11–24 (2012).
152. Ling, M.-T. et al. Id-1 expression induces androgen-independent prostate cancer cell
growth through activation of epidermal growth factor receptor (EGF-R). Carcinogenesis
25, 517–525 (2004).
153. Li, H., Gerald, W. L. & Benezra, R. Utilization of bone marrow-derived endothelial cell
precursors in spontaneous prostate tumors varies with tumor grade. Cancer Res. 64, 6137–
6143 (2004).
154. Soroceanu, L. et al. Id-1 is a key transcriptional regulator of glioblastoma aggressiveness
and a novel therapeutic target. Cancer Res. 73, 1559–1569 (2013).
155. Lee, J.-K. et al. USP1 targeting impedes GBM growth by inhibiting stem cell maintenance
and radioresistance. Neuro-Oncol. 18, 37–47 (2016).
156. Tsuchiya, T. et al. Targeting Id1 and Id3 inhibits peritoneal metastasis of gastric cancer.
Cancer Sci. 96, 784–790 (2005).
157. Henke, E. et al. Peptide-conjugated antisense oligonucleotides for targeted inhibition of a
transcriptional regulator in vivo. Nat. Biotechnol. 26, 91–100 (2008).
158. de Candia, P. et al. Angiogenesis impairment in Id-deficient mice cooperates with an Hsp90
inhibitor to completely suppress HER2/neu-dependent breast tumors. Proc. Natl. Acad. Sci.
U. S. A. 100, 12337–12342 (2003).
159. Chen, C.-H., Kuo, S.-C., Huang, L.-J., Hsu, M.-H. & Lung, F.-D. T. Affinity of synthetic
peptide fragments of MyoD for Id1 protein and their biological effects in several cancer
cells. J. Pept. Sci. Off. Publ. Eur. Pept. Soc. 16, 231–241 (2010).
66
160. Zhang, X., Ling, M.-T., Wang, X. & Wong, Y. C. Inactivation of Id-1 in prostate cancer
cells: A potential therapeutic target in inducing chemosensitization to taxol through
activation of JNK pathway. Int. J. Cancer 118, 2072–2081 (2006).
161. Cheung, H. W., Ling, M., Tsao, S. W., Wong, Y. C. & Wang, X. Id-1-induced Raf/MEK
pathway activation is essential for its protective role against taxol-induced apoptosis in
nasopharyngeal carcinoma cells. Carcinogenesis 25, 881–887 (2004).
162. Ling, M.-T., Wang, X., Zhang, X. & Wong, Y.-C. The multiple roles of Id-1 in cancer
progression. Differ. Res. Biol. Divers. 74, 481–487 (2006).
163. Campos, B., Olsen, L. R., Urup, T. & Poulsen, H. S. A comprehensive profile of recurrent
glioblastoma. Oncogene (2016). doi:10.1038/onc.2016.85
164. Maeder, M. L. & Gersbach, C. A. Genome-editing Technologies for Gene and Cell
Therapy. Mol. Ther. J. Am. Soc. Gene Ther. 24, 430–446 (2016).
Top Related