Intro Gene regulation Synteny The End
Today
• Gene regulation• Synteny• Good bye!
Intro Gene regulation Synteny The End
Gene regulation
• What governs gene transcription?Genes active under different circumstances.
• Transcription factors bind to transcriptionfactor binding sites (TFBS).
• TFBS also known as regulatory elements(RE)
• TFBS can be grouped in regulatorymodules.
• cis-regulatory elements appear before thegene
Intro Gene regulation Synteny The End
Gene regulation
• What governs gene transcription?Genes active under different circumstances.
• Transcription factors bind to transcriptionfactor binding sites (TFBS).
• TFBS also known as regulatory elements(RE)
• TFBS can be grouped in regulatorymodules.
• cis-regulatory elements appear before thegene
Intro Gene regulation Synteny The End
Gene regulation
• What governs gene transcription?Genes active under different circumstances.
• Transcription factors bind to transcriptionfactor binding sites (TFBS).
• TFBS also known as regulatory elements(RE)
• TFBS can be grouped in regulatorymodules.
• cis-regulatory elements appear before thegene
Intro Gene regulation Synteny The End
Gene regulation
• What governs gene transcription?Genes active under different circumstances.
• Transcription factors bind to transcriptionfactor binding sites (TFBS).
• TFBS also known as regulatory elements(RE)
• TFBS can be grouped in regulatorymodules.
• cis-regulatory elements appear before thegene
Intro Gene regulation Synteny The End
Gene regulation
• What governs gene transcription?Genes active under different circumstances.
• Transcription factors bind to transcriptionfactor binding sites (TFBS).
• TFBS also known as regulatory elements(RE)
• TFBS can be grouped in regulatorymodules.
• cis-regulatory elements appear before thegene
Intro Gene regulation Synteny The End
Gene regulation
• Core promoter: about 35 bp prior to TSS,includes ”TATA box”
• Upstream promoter: 200 – 300 bp prior toTSS, activates transcription
• ”Enhancers” in a book: Up to 2000 bpbefore TSS.
• ”These experiments showed that, on average, the sequence
-300 to -50 bp of the TSS positively contributes to core
promoter activity. Interestingly, putative negative elements were
identified -1000 to -500 bp upstream of the TSS for 55 % of
genes tested.” (Cooper et al, Genome Res, 2005)
Intro Gene regulation Synteny The End
Gene regulation
• Core promoter: about 35 bp prior to TSS,includes ”TATA box”
• Upstream promoter: 200 – 300 bp prior toTSS, activates transcription
• ”Enhancers” in a book: Up to 2000 bpbefore TSS.
• ”These experiments showed that, on average, the sequence
-300 to -50 bp of the TSS positively contributes to core
promoter activity. Interestingly, putative negative elements were
identified -1000 to -500 bp upstream of the TSS for 55 % of
genes tested.” (Cooper et al, Genome Res, 2005)
Intro Gene regulation Synteny The End
Gene regulation
• Core promoter: about 35 bp prior to TSS,includes ”TATA box”
• Upstream promoter: 200 – 300 bp prior toTSS, activates transcription
• ”Enhancers” in a book: Up to 2000 bpbefore TSS.
• ”These experiments showed that, on average, the sequence
-300 to -50 bp of the TSS positively contributes to core
promoter activity. Interestingly, putative negative elements were
identified -1000 to -500 bp upstream of the TSS for 55 % of
genes tested.” (Cooper et al, Genome Res, 2005)
Intro Gene regulation Synteny The End
Gene regulation
• Core promoter: about 35 bp prior to TSS,includes ”TATA box”
• Upstream promoter: 200 – 300 bp prior toTSS, activates transcription
• ”Enhancers” in a book: Up to 2000 bpbefore TSS.
• ”These experiments showed that, on average, the sequence
-300 to -50 bp of the TSS positively contributes to core
promoter activity. Interestingly, putative negative elements were
identified -1000 to -500 bp upstream of the TSS for 55 % of
genes tested.” (Cooper et al, Genome Res, 2005)
Intro Gene regulation Synteny The End
Intro Gene regulation Synteny The End
Promoter and TSS
• Hard to recognize a TSS• Many attempts, little success• Recent understanding: several TSS
may exist
Intro Gene regulation Synteny The End
Correctness of TSS prediction
Fickett & Hatzigeorgiou, 1997
Intro Gene regulation Synteny The End
Regulatory elements
• Binding sites for transcription factors• Motifs, about 10 bp wide• Represent using PSSMs• Search strategy: use PSSM and look
upstream (2 kb – 5 kb) from gene.
Intro Gene regulation Synteny The End
Intro Gene regulation Synteny The End
Finding regulatory elements: ConSite• Problem: Overpredicting TFBS• Solution: Comparative genomics. Use
”nearby” species, look at conservation.
Intro Gene regulation Synteny The End
Finding regulatory elements
• Need: de novo motif discovery• Solution: Phylogenetic footprinting
• The mathematics: Gibbs sampling• Popular software: MEME• What it does: Iteratively improve a motif
from naive start point
Intro Gene regulation Synteny The End
Finding regulatory elements
• Need: de novo motif discovery• Solution: Phylogenetic footprinting• The mathematics: Gibbs sampling• Popular software: MEME• What it does: Iteratively improve a motif
from naive start point
Intro Gene regulation Synteny The End
Case study: motifs for TPX2 genes
Input: five sequences, 3000 nt longMotif 1, E = 1.7 · 10−14, width 39 bp
Pt TGCATGAGAGGGAGATTTAATCAGAAAGTTTGGTGCATGAGAGCAt TGCATGAGTGGGAGGTTTAATCAGAAAGTTTGTTGCATGAGAGCMt TGATTGAGAAGGAAATTTAATCAGAAAGTTTGGTGCAAGAGAGCZm -----GATCGGGATATATACTCAGAAGTTTGAGTCCCACCGCCCOs -----GACGGCAACGTCTCATCAGATGGTTGGTAGTAACACCAC
Motif 2, E = 2.8 · 10−5, width 28 bp
Pt TTGAGCATGTTTGTGATGTAGCAACAGAAt TAAAGCTTGTTGCTGATGTAGCAACAGAMt TAGAGCATGTTTGTGATGTAGCAACAGAZm TAGAGCTAGCTAGCTAGGTGGTCGCAAAOs TGGGGATGGCTGGTGAAGTGGCAGATTA
Intro Gene regulation Synteny The End
Case study: upstream analysis
ATG
ATG−1065−1682−2813
−125−297−819
−1616 −1212 −499 −112
−2149−2522−2642 −987−1072 −185
−233 −175
−1092−1535−1591 −378
ATG
ATG
ATG
−100
Intro Gene regulation Synteny The End
Comparative Genomics: Synteny
• Synteny: Preserved gene order
• Syntenic regions: Orthologous regionswith genes in synteny
• Applications:• Species phylogeny• Understandning evolution• Gene finding, regulatory elements• Support for orthology
Intro Gene regulation Synteny The End
Comparative Genomics: Synteny
• Synteny: Preserved gene order• Syntenic regions: Orthologous regions
with genes in synteny
• Applications:• Species phylogeny• Understandning evolution• Gene finding, regulatory elements• Support for orthology
Intro Gene regulation Synteny The End
Comparative Genomics: Synteny
• Synteny: Preserved gene order• Syntenic regions: Orthologous regions
with genes in synteny• Applications:
• Species phylogeny• Understandning evolution• Gene finding, regulatory elements• Support for orthology
Intro Gene regulation Synteny The End
Synteny background
• Macro-genomic mutations:• Transpositions
Segment moved• Reversals/inversions
Segment reversed• Transversals
End segment reversed
Intro Gene regulation Synteny The End
Populus chromosomesScience, 2006
Intro Gene regulation Synteny The End
Mouse chromosomes
Nature, 2002
Intro Gene regulation Synteny The End
Synteny explained by reversals
PNAS, 2003
Intro Gene regulation Synteny The End
Synteny explained by reversals
PNAS, 2003
Intro Gene regulation Synteny The End
Computational problems• How recognize ”orthologous regions”?• How recognize a syntenic region?
Intro Gene regulation Synteny The End
Computational problems• How recognize ”orthologous regions”?• How recognize a syntenic region?
Intro Gene regulation Synteny The End
Computational problems
• How many mutations separate two regions?• Which phylogeny explains synteny best?
Human
Sea urchin
Nematode
Fruit fly1
20 6
5
mtGenome, reversals
Intro Gene regulation Synteny The End
Computational problems
• How many mutations separate two regions?• Which phylogeny explains synteny best?
Human
Sea urchin
Nematode
Fruit fly1
20 6
5
mtGenome, reversals
Intro Gene regulation Synteny The End
Synteny in day-to-day work
• ”Are these two really orthologous?”
• ”Where is my gene? I cannot find it!”
Solutions
1. Look at neighbor genes2. Look at synteny map
Intro Gene regulation Synteny The End
Synteny in day-to-day work
• ”Are these two really orthologous?”• ”Where is my gene? I cannot find it!”
Solutions
1. Look at neighbor genes2. Look at synteny map
Intro Gene regulation Synteny The End
Synteny in day-to-day work
• ”Are these two really orthologous?”• ”Where is my gene? I cannot find it!”
Solutions
1. Look at neighbor genes2. Look at synteny map
Intro Gene regulation Synteny The End
Case study: Testatin
Intro Gene regulation Synteny The End
Case study: Testatin
Intro Gene regulation Synteny The End
Case study: Testatin
Intro Gene regulation Synteny The End
Case study: functional pseudogenes?
Target:
Intro Gene regulation Synteny The End
Case study: functional pseudogenes?
Must avoid:
Intro Gene regulation Synteny The End
Filtering with synteny
Require two predicted pseudogenes to be fromthe same syntenic region.
Intro Gene regulation Synteny The End
Intro Gene regulation Synteny The End
For the exam
• No pre-registration• Part 1: 15 p, bonus points apply
Minimum 10 points.• Part 2: 15 p, no bonus points• Pass exam at 15 points.
Top Related