Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
1
Glycerol dehydrogenase plays a dual role in glycerol metabolism
and 2,3-butanediol formation in Klebsiella pneumoniae*
Yu Wang‡, Fei Tao
‡, Ping Xu
§
From the State Key Laboratory of Microbial Metabolism, and School of Life Sciences &
Biotechnology, Shanghai Jiao Tong University, Shanghai 200240, People’s Republic of China
Running title: Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
To whom correspondence should be addressed: Ping Xu, State Key Laboratory of Microbial
Metabolism, and School of Life Sciences & Biotechnology, Shanghai Jiao Tong University, Shanghai
200240, People’s Republic of China, Tel./Fax: +86-21-34206723; Email: [email protected]
Keywords: Dehydrogenase; glycerol; enzyme kinetics; protein evolution; bacterial metabolism;
glycerol dehydrogenase; enzyme promiscuity; 2,3-butanediol; Klebsiella pneumoniae
Background: Glycerol dehydrogenase catalyzes
the initial step of glycerol oxidation.
Results: DhaD, a glycerol dehydrogenase from
Klebsiella pneumoniae, plays a dual role in
glycerol metabolism and 2,3-butanediol
formation.
Conclusion: This dual role related to the
enzyme promiscuity switches according to
physiological requirements, suggesting a
mechanism involved in evolution of the enzyme.
Significance: This work highlights the
sophistication of enzyme evolution.
ABSTRACT
Glycerol dehydrogenase (GDH) is an
important polyol dehydrogenase for glycerol
metabolism in diverse microorganisms and
for value-added utilization of glycerol in the
industry. Two GDHs from Klebsiella
pneumoniae, DhaD and GldA, were expressed
in Escherichia coli, purified and
characterized for substrate specificity and
kinetic parameters. Both DhaD and GldA
could catalyze the interconversion of
(3R)-acetoin/(2R,3R)-2,3-butanediol or
(3S)-acetoin/meso-2,3-butanediol, in addition
to glycerol oxidation. Although purified GldA
appeared more active than DhaD, in vivo
inactivation and quantitation of their
respective mRNAs indicate that dhaD is
highly induced by glycerol and plays a dual
role in glycerol metabolism and
2,3-butanediol formation. Complementation
in K. pneumoniae further confirmed the dual
role of DhaD. Promiscuity of DhaD may have
vital physiological consequences for K.
pneumoniae growing on glycerol, which
include balancing the intracellular
NADH/NAD+ ratio, preventing acidification,
and storing carbon and energy. According to
the kinetic response of DhaD to modified
NADH concentrations, DhaD appears to
show positive homotropic interaction with
NADH, suggesting that the physiological role
could be regulated by intracellular NADH
levels. The co-existence of two functional
GDH enzymes might be due to a gene
duplication event. We propose that while
DhaD is specialized for glycerol utilization,
GldA plays a role in backup compensation
and can turn into a more proficient catalyst
to promote a survival advantage to the
organism. Revelation of the dual role of
DhaD could further the understanding of
mechanisms responsible for enzyme evolution
through promiscuity, and guide metabolic
engineering methods of glycerol metabolism.
Polyol dehydrogenases consist of a large
family of oxidoreductases with activity toward
di- and polyhydroxylated species (1). Owing to
their important physiological roles in organisms
and applications in industry, studies on polyol
dehydrogenases are of particular interest (1-4).
Glycerol dehydrogenase (GDH)1, a typical
polyol dehydrogenase, which catalyzes the
initial step of glycerol oxidation, is responsible
http://www.jbc.org/cgi/doi/10.1074/jbc.M113.525535The latest version is at JBC Papers in Press. Published on January 15, 2014 as Manuscript M113.525535
Copyright 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
2
for glycerol utilization in diverse
microorganisms (5). Reports show that some
GDHs are involved in the pathogenicity of some
human pathogens (6-7). GDHs are also crucial
for the bioconversion of glycerol to produce
useful biochemicals and biofuels such as
1,3-propanediol (1,3-PD) (a monomer for
biomaterials), 2,3-butanediol (BD), and ethanol
(8-11). During the past few decades, GDHs
from different sources have been characterized
(5,12-16). Recently, the glycerol surplus
produced by the tremendous growth of the
biodiesel industry stimulated intensive research
efforts focused on glycerol metabolism and
related enzymes and pathways, especially in
efficient glycerol utilizers, such as Klebsiella
and Clostridium (17-20). In K. pneumoniae,
glycerol is metabolized in a dismutation process
via two branches, reductive and oxidative (21)
(Fig. 1a). NAD+-Dependent GDH initiates the
oxidative branch by converting glycerol to
dihydroxyacetone, which provides NADH for
1,3-PD production (21).
BD is a major product of the glycerol
oxidative branch, as well as a promising bulk
chemical with extensive industrial applications
(22). There are three isomeric forms of BD:
(2S,3S)-, (2R,3R)- and meso-forms. The
optically active BD isomers are particularly
valuable chemicals that provide chiral groups in
pharmaceutical drugs or for liquid crystals
(22-23). Another kind of polyol dehydrogenase,
BD dehydrogenase (BDH), catalyzes the
interconversion between acetoin (AC,
3-hydroxy-2-butanone) and BD (22).
Stereospecific BDHs are responsible for the
formation of different BD isomers. Several
BDHs with different stereospecificities have
been characterized in previous studies (24-32).
The meso-BDHs from K. pneumoniae, Serratia
marcescens, and Enterobacter cloacae belong to
the short-chain dehydrogenase/reductase (SDR)
family and catalyze the conversion of (3R)-AC
to meso-BD and (3S)-AC to (2S,3S)-BD (24-28).
(2R,3R)-BDHs from Paenibacillus polymyxa,
Bacillus subtilis, and Saccharomyces cerevisiae
belong to the medium-chain
dehydrogenase/reductase family (MDR) and
catalyze the conversion of (3R)-AC to
(2R,3R)-BD, and (3S)-AC to meso-BD (29-32).
Generally, a mixture of meso- and
(2S,3S)-BD is produced by K. pneumoniae due
to the existence of a meso-BDH (23-24) (Fig. 1a
and Fig. 1c). Recently, three isomers of BD
were detected simultaneously in the
fermentation broth, when K. pneumoniae strain
ATCC 25955 utilized glycerol as a carbon
source (33) (Fig. 1d). However, (2R,3R)-BD
metabolism and the enzymes responsible for
(2R,3R)-BD formation in K. pneumoniae have
never been described. Analysis of the genome
sequence of K. pneumoniae strain ATCC 25955
indicated the presence of a meso-BDH (budC
encoding). However, no (2R,3R)-BDH encoding
genes were identified (33). Therefore, it is likely
that an oxidoreductase related to glycerol
metabolism may be responsible for the
formation of (2R,3R)-BD. It has been reported
that there are two genes (dhaD and gldA)
encoding GDH in K. pneumoniae, and the two
GDHs both show activity toward BD (12).
Considering that BD and AC have similar
structures to glycerol and dihydroxyacetone,
respectively, we hypothesized that GDHs
catalyze the conversion between BD and AC,
and are involved in (2R,3R)-BD formation.
To confirm our hypothesis, we expressed the
dhaD and gldA genes from K. pneumoniae in
Escherichia coli and characterized the purified
enzymes for their substrate specificity and
kinetic properties. Additionally, deactivation
and complementation of dhaD and gldA in K.
pneumoniae were carried out to investigate their
roles in BD isomer formation and glycerol
utilization. This work provides insights into the
dual role of DhaD in glycerol metabolism and
BD production in K. pneumoniae. The
physiological implications of the dual role and
co-existence of two GDHs were also discussed.
EXPERIMENTAL PROCEDURES
Bacterial strains, plasmids and growth
conditions–All bacterial strains and plasmids
used in this study are listed in Table 1. K.
pneumoniae (ATCC 25955) was obtained from
American Type Culture Collection. E. coli
DH5α and E. coli BL21 (DE3) were used for
general cloning and expression procedures,
respectively. E. coli S17-1 that is able to host
pKR6K and its derivatives was used for
conjugation with K. pneumoniae. The
pEASY-Blunt cloning vector (Transgen, China)
was used to subclone the gene, and pET-28a(+)
was used for protein expression. pDK7 with a
tac promoter was used for overexpression of
protein in K. pneumoniae. R6K origin of
replication was amplified by PCR from the
plasmid pCAM140 by using primers
oriR6K-F(BspHI) and oriR6K-R(BsaXI) (Table
2). We derived pKR6K from pK18mobsacB by
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
3
replacing its replicon with the oriR6K replicon
through the BspHI and BsaXI sites. pKR6K was
used to create gene disruption mutations by
homologous recombination. K. pneumoniae was
cultured in a medium described previously (34).
Either 30 g liter-1
of glucose or glycerol was
used as the carbon source; 500-ml flasks with
100 ml of medium were incubated at a shaker
speed of 180 rpm at 37°C. E. coli was cultured
in Luria-Bertani (LB) broth or on LB agar at
37°C supplemented with ampicillin (100 μg ml-1
)
or kanamycin (50 μg ml-1
) as required.
Cloning, expression and purification of
GDHs–The cloning of dhaD was performed by
PCR amplification of K. pneumoniae genomic
DNA. A pair of primers that introduced the
BamHI and XhoI restriction sites
(dhaD-F(BamHI) and dhaD-R(XhoI)) (Table 2)
was used. The amplified fragment of 1.1 kb was
subcloned into the pEASY-Blunt vector and
sequenced. The 1.1 kb BamHI/XhoI fragment
digested from the pEASY-Blunt-dhaD was
ligated to pET-28a(+), yielding pET-28a-dhaD.
To clone and construct the overexpression
vector for gldA, the protocol described above
was used with primers gldA-F(BamHI) and
gldA-R(XhoI). The FastPfu DNA polymerase
was acquired from Transgen Biotech (China).
The restriction enzymes and T4 DNA ligase
were purchased from New England Bio-Labs
(Beverly, MA). Genomic DNA of K.
pneumoniae was extracted using the Wizard
Genomic DNA Purification Kit (Promega,
Madison, WI, USA).
E. coli BL21 (DE3) cells carrying the
overexpression vector were cultivated in LB
medium containing kanamycin (50 μg ml-1
) at
37°C. When the OD620nm reached 0.5-0.7, the
expression of recombinant GDH was induced by
addition of 1 mM IPTG at 16°C for
approximately 10 h. The cells were harvested
and then washed twice with 0.85% NaCl. The
cell pellet was resuspended in binding buffer (20
mM potassium phosphate, 500 mM NaCl, 20
mM imidazole, pH 7.4), and disrupted by
sonication in an ice bath. The lysed cells were
centrifuged at 18,000 × g for 30 min at 4°C, and
the supernatant was used for further purification.
The enzyme was purified from the crude extract
by using a 5-ml HisTrap HP column (GE
Healthcare, USA), which had been equilibrated
with 25 ml binding buffer. GDH was eluted by
using 20% and 100% elution buffer (20 mM
potassium phosphate buffer, 500 mM NaCl, 500
mM imidazole, pH 7.4). The 100% fraction was
collected, concentrated, and desalted by gel
filtration on Sephadex G25 medium (Pharmacia).
The expressed and purified enzyme was
confirmed by sodium dodecyl sulfate
polyacrylamide gel electrophoresis (SDS-PAGE)
and stored at -80°C for further study.
Enzyme activity assays–GDH activity was
assayed spectrophotometrically by measuring
the initial velocity change in absorbance at 340
nm corresponding to the oxidation of NADH or
reduction of NAD+ (ε340 = 6220 M
-1 cm
-1) at
30°C. One unit of activity was defined as the
amount of enzyme that consumed or produced 1
μmol of NADH per minute. The specific activity
of GDH was defined as the enzyme unit (U)
divided by the amount of enzyme protein (mg).
The reaction mixture contained 0.1 M potassium
carbonate buffer, pH 9.0, 30 mM ammonium
sulfate, 0.6 mM NAD+ or 0.3 mM NADH, and
0.1 M substrate (35). To determine the kinetic
constants, all parameters were kept constant,
and only the substrate concentration was
modified. NAD+ was used for oxidation of
glycerol and BD, while NADH was used for
reduction of (3R)/(3S)-AC and diacetyl (DA).
The Michaelis-Menten equation was used for
determination of the kinetic parameters. To
perform the Hill plots analyses, 100 mM of
(3R)/(3S)-AC and modified NADH
concentrations (0.025-0.5 mM) were used. Hill
coefficient (h) was obtained from the Hill plots
(36).
Conversion of (3R)/(3S)-AC by purified
enzyme–To study the catalytic rate toward
(3S)-AC and (3R)-AC, the conversion of
(3R)/(3S)-AC by purified enzyme was carried
out in a mixture containing 0.1 M potassium
carbonate buffer, pH 9.0, 30 mM ammonium
sulfate, 50 mM NADH, 100 mM (3R)/(3S)-AC,
and 2 mg DhaD or GldA in a final volume of 1
ml. (3R)/(3S)-AC exists as a crystalline dimer
and the two stereoisomers are presumed to have
a ratio of 1:1. The conversion was stopped at 15
min by the addition of HCl and the products
were detected by gas chromatography (GC).
Quantitation of dhaD and gldA mRNAs–K.
pneumoniae cells cultured using glucose or
glycerol as a carbon source in the middle of the
exponential phase were collected for RNA
isolation by using the RNAprep pure
Cell/Bacteria Kit (Tiangen Biotech, Beijing,
China). Total RNA was treated with DNase I
(Fermentas) and then used as a template for
cDNA synthesis by using random primers and
SuperScript III Reverse Transcriptase
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
4
(Invitrogen). The resultant cDNA was used for
quantitative PCR (qPCR) analysis. Primers for
genes dhaD, gldA, and 16S rRNA were designed
with Beacon Designer software (Table 2). qPCR
was performed by using SuperReal Premix
SYBR Green kit (Tiangen Biotech, Beijing,
China) and the CFX96 Real-Time system
(Bio-Rad) according to the manufacturer’s
instructions.
Construction of gene disruption mutations of
K. pneumoniae–pKR6K-budC::BamHI
containing a mutant allele of budC was
constructed to disrupt the budC gene of K.
pneumoniae. A mutant allele of budC was
generated by connecting a left and a right
homologous flank with a BamHI restriction site.
The selected flanks were 300-500 bp long and
homologous to sequences upstream and
downstream of the region targeted for disruption.
Initially, the left (437 bp) and right (390 bp)
flanking sequences were amplified from the
genomic DNA of K. pneumoniae by using
primer pairs
ΔbudC-F(EcoRI)/ΔbudC-F1(BamHI) and
ΔbudC-R1(BamHI)/ΔbudC-R(PstI), respectively.
The PCR products were digested with
EcoRI/BamHI and BamHI/PstI, respectively.
The gel-purified fragments were ligated to the
pKR6K vector digested with EcoRI and PstI to
produce pKR6K-budC::BamHI. Then,
pKR6K-budC::BamHI was transformed into E.
coli S17-1.
E. coli S17-1 (pKR6K-budC::BamHI) was
used as the donor in conjugation with K.
pneumoniae. The conjugation and allelic
exchange were performed as previously
described with slight modifications (37). The
merodiploid (single-crossover) colony was
selected using M9 minimal medium with
kanamycin (50 μg ml-1
). Single colonies were
then parallel patched into LB broth
supplemented with kanamycin (50 μg ml-1
) to
screen for integration of pKR6K-budC::BamHI.
The merodiploid genotype was confirmed by
colony PCR to detect the mutant allele using
primers ΔbudC-F(EcoRI) and ΔbudC-R(PstI).
Next, a single merodiploid colony was grown in
LB broth overnight and plated onto LB agar
without NaCl, supplemented with 15% (w/v)
sucrose (LAS medium). LAS plates were
incubated at 25°C. Colonies were screened by
patching for the double-crossover resistance
phenotype. The preservation of the mutant allele
was verified by PCR using the primers
ΔbudC-F(EcoRI) and ΔbudC-R(PstI). The budC
disruption mutant was designated as KP∆budC.
dhaD and gldA disruption mutants were
constructed by using the protocol described
above and primers listed in Table 2.
Production of BD isomers by the wild-type
and mutant strains–The wild-type and mutant
strains of K. pneumoniae were cultured using
glycerol as a carbon source for 12 h. The
supernatant was used to assay for the BD
isomers produced. The pellet of cells was
washed twice with 0.85% NaCl and resuspended
in 50 mM potassium phosphate buffer (pH 7.4).
Whole-cell biocatalysis was carried out for 6 h
with 10 ml of mixture in a 100 ml Erlenmeyer
flask at 37°C, at 180 rpm. The cell concentration
in the reaction mixture was 5.0 g DCW liter-1
.
Substrate used was 10 g liter-1
(3R)/(3S)-AC and
the source of reducing equivalent was 20 g liter-1
glucose. BD and AC isomers were analyzed by
GC.
Complementation of dhaD and gldA in K.
pneumoniae mutant–The dhaD fragment was
digested with BamHI and XhoI from
pET28a-dhaD, and was introduced into the
BamHI-SalI site (XhoI and SalI were
isocaudomers) of expression vector pDK7. The
resultant recombinant plasmid pDK7-dhaD was
transformed into KP∆dhaD∆gldA by standard
transformation protocol by using a standard
electroporation transformation protocol (38).
The chloramphenicol-resistant transformants
were selected, and the insert was confirmed by
colony PCR and sequencing. The confirmed
clone harboring pDK7-dhaD was designated as
KP∆dhaD∆gldA(pDK7-dhaD). To complement
the gldA disruption mutation, the protocol
described above was used. The wild-type and
mutant strains were cultured using glycerol as a
carbon source at 37°C. When the OD620nm
reached 0.5-0.7, expression of the recombinant
GDH was induced by addition 1 mM IPTG.
Samples were withdrawn periodically and the
biomass was determined by measuring the
OD620nm. The concentration of glycerol was
measured by HPLC using a method described
previously (26).
Analytical techniques–BD and AC isomers
were analyzed by using a gas chromatograph
equipped with a chiral column using a method
described previously (32). Prior to GC analysis,
the samples were extracted with an equal
volume of ethyl acetate after the addition of
isoamyl alcohol as the internal standard. The GC
(Agilent GC6820) system consisted of a flame
ionization detector and a fused silica capillary
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
5
column (Supelco Beta DEXTM
120, inside
diameter, 0.25 mm; length, 30 m). Nitrogen was
used as the carrier gas. The injector temperature
and detector temperature were both 280°C. The
following temperature program was used. The
column oven was maintained at 40°C for 3 min
and then programmed to increase to 80°C at a
rate of 1.5°C min-1
. The temperature was then
raised to 86°C at a rate of 0.5°C min-1
and
finally to 200°C at a rate of 30°C min-1
. The
injection volume was 3 μl. A standard mixture
of (3R)/(3S)-AC, (2S,3S)-BD, (2R,3R)-BD, and
meso-BD was prepared by dissolving the pure
compounds, and then analyzed by GC (Fig. 1b).
Standard (2R,3R)-BD, (2S,3S)-BD, and
meso-BD were purchased from ACROS (The
Kingdomof Belgium). (3R)/(3S)-AC was
obtained from Apple Flavor Group (Shanghai,
China).
RESULTS
Cloning, expression, and purification of
DhaD and GldA–K. pneumoniae ATCC 25955
has been sequenced, and two GDH-encoding
genes (dhaD and gldA) were identified from the
genome sequence (33). The dhaD gene is
located in the dha regulon and is 1,089 bp long,
with a deduced amino acid sequence that shares
58% identity with GDH of E. coli (13), 50%
identity with GDH of Geobacillus
stearothermophilus (14), and 46% identity with
GDH of Clostridium butyricum (20). The gldA
gene is 1,104 bp long, and its deduced amino
acid sequence has 60% and 89% identities with
DhaD of K. pneumoniae ATCC 25955 and GDH
of E. coli, respectively (13). The dhaD and gldA
genes were cloned into the pET-28a(+) vector
and highly expressed in E. coli BL21 (DE3).
Purified DhaD and GldA enzymes were detected
by SDS-PAGE as shown in Fig. 2.
Substrate specificity and kinetic
properties–Both DhaD and GldA could catalyze
the oxidization of glycerol, (2R,3R)-BD and
meso-BD, and the reduction of (3R)/(3S)-AC (a
racemic mixture of (3R)- and (3S)-AC) (Table 3).
(2S,3S)-BD and DA were not substrates for
DhaD or GldA. A gas chromatograph equipped
with a chiral column was used to further detect
the products of the enzymatic reactions. With
respect to the BD oxidation reactions, when
meso-BD and NAD+ served as the substrates of
DhaD or GldA, (3S)-AC was the only product
detected, which was the result of the selective
oxidation of the alcohol function at the R-carbon
of meso-BD. Accordingly, (3R)-AC was the only
product obtained from (2R,3R)-BD. When
(3R)/(3S)-AC was incubated with NADH and
DhaD or GldA, a complete enantioselective
reduction of the carbonyl groups produced an
R-alcohol. Consequently, a product mixture of
(2R,3R)-BD (from (3R)-AC) and meso-BD
(from (3S)-AC) was observed. The results
indicated that the GDHs DhaD and GldA have
similar substrate specificity and stereospecificity
toward isomers of BD and AC with the
experimentally verified (2R,3R)-BDHs from P.
polymyxa and S. cerevisiae (30-31).
Kinetic parameters of DhaD and GldA for
glycerol, (2R,3R)-BD, meso-BD, and
(3R)/(3S)-AC were determined, and the results
are shown in Table 3. The Km values of DhaD
and GldA for glycerol are comparable with
those of GDHs reported previously, such as
GDHs from E. coli (38 mM) (13) and Candida
valida (58 mM) (16), suggesting that the kinetic
data are reasonable for this class of enzymes.
The Km values of the two GDHs for different
substrates were reduced by an order of
magnitude from (2R,3R)-BD > glycerol >
meso-BD > (3R)/(3S)-AC. Interestingly, both
DhaD and GldA had much lower Km values for
meso-BD and higher Km values for (2R,3R)-BD
than (2R,3R)-BDHs from previous studies
(30-31). The catalytic efficiency constant
(kcat/Km) of DhaD was greater for the reduction
of (3R)/(3S)-AC than for the oxidation of
glycerol and BD. Considering that the Km value
for (3R)/(3S)-AC was lower than that for other
alcohols, the DhaD should preferentially
function as a reductase rather than a
dehydrogenase. With respect to GldA, the
kcat/Km value for meso-BD was the highest,
followed by (3R)/(3S)-AC, glycerol and
(2R,3R)-BD. Although DhaD and GldA have
similar catalytic properties, the much lower Km
values and higher kcat/Km values for a specific
substrate indicate that GldA is more active. The
kinetic parameters combined with the results
from the substrate specificity test suggest that
DhaD and GldA could act as NAD+-dependent
(2R,3R)-BDHs.
Conversion of (3R)/(3S)-AC by purified
enzyme–Because the chiral (3S)-AC and
(3R)-AC were not commercially available, it
was difficult to determine the kinetic properties
toward the two isomers. Conversions using
purified enzymes were carried out to study their
catalytic rate toward (3S)-AC and (3R)-AC. GC,
described in the experimental procedures, was
performed to quantify the concentration of BD
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
6
isomers produced. As shown in Fig. 3, after 15
min reaction, higher concentrations of meso-BD
than (2R,3R)-BD were achieved by both DhaD
and GldA. This suggests a higher catalytic rate
of (3S)-AC/meso-BD conversion. The two
GDHs produced (2R,3R)-BD at similar
concentrations, but GldA catalyzed the reaction
from (3S)-AC to meso-BD more rapidly than
DhaD, resulting a higher concentration of
meso-BD. The results of GDHs were opposite to
those of (2R,3R)-BDHs, which catalyzed the
(3R)-AC/(2R,3R)-BD conversion more rapidly
(30-31).
Homotropic interactions of GDHs with
NADH–Kinetic responses of DhaD and GldA to
modified NADH concentrations are shown in
Fig. 4a. The enzyme activities of both DhaD and
GldA increase at higher NADH concentrations,
possibly suggesting a positive co-operativity
between GDHs and NADH. Similar phenomena
have been observed in a previously reported
NADH/NAD+-dependent dehydrogenase, and a
Hill plot with a Hill coefficient (h) was used to
verify this co-operativity (36). Hill plots of the
data obtained from plots of enzyme activity (v)
versus concentration of NADH produced lines
with maximal slopes (h value) greater than or
close to 2 (2.32 for DhaD and 1.77 for GldA)
(Fig. 4b). These findings support the existence
of positive homotropic interactions between the
two GDHs and NADH.
Quantitation of dhaD and gldA mRNAs–Both
DhaD and GldA are able to catalyze the
(3R)-AC/(2R,3R)-BD conversion and might be
involved in (2R,3R)-BD formation when
glycerol is utilized. Additionally, the production
of (2R,3R)-BD occurred during glycerol
metabolism, suggesting that GDH encoding
genes might be glycerol-induced. Therefore,
qPCR was performed to determine the
transcription levels of dhaD and gldA when
glucose or glycerol was utilized. When K.
pneumoniae was cultured in glucose medium,
the transcriptional levels of dhaD and gldA were
rather low (Fig. 5). Nevertheless, when glycerol
was used as a carbon source, the mRNA level of
dhaD increased by approximately 130-fold,
suggesting dhaD being highly induced by
glycerol. Meanwhile, the transcription level of
gldA was almost not affected by glycerol and
remained rather low. Therefore, we suggest that
dhaD is highly expressed when the strain
utilizes glycerol and is crucial for the formation
of (2R,3R)-BD in K. pneumoniae.
Construction of gene disruption mutations in
K. pneumoniae–To investigate the roles of dhaD
and gldA genes in the (2R,3R)-BD formation
and glycerol metabolism in K. pneumoniae,
dhaD and gldA genes disruption mutations were
constructed. The meso-BDH encoding gene
budC was also deactivated to eliminate its
influence on the production of BD isomers. PCR
followed by DNA sequencing was performed to
confirm the disruption of the genes in K.
pneumoniae. Four mutants of K. pneumoniae,
KP∆budC, KP∆budC∆dhaD, KP∆budC∆gldA
and KP∆budC∆dhaD∆gldA, were constructed.
Production of BD isomers by the wild-type
and mutant strains–The mutants together with
the wild-type K. pneumoniae (KPwild) were
cultured using glycerol as a carbon source.
Dramatic differences in the BD isomers
produced by different strains were observed, and
the results were shown in Fig. 6a. meso-,
(2S,3S)-, and (2R,3R)-BD were detected
simultaneously in the broth of KPwild, in an
order of magnitude from meso-BD >
(2R,3R)-BD > (2S,3S)-BD. Interestingly,
deactivation of budC resulted in a large increase
of (2R,3R)-BD and a large decrease of meso-BD,
suggesting that there are other enzymes with
different stereospecificities responsible for the
formation of BD. (2S,3S)-BD was not a product
of KP∆budC strain. A double mutant was
generated by disrupting the gldA gene in the
budC mutant background. The resulting strain
KP∆budC∆gldA was still able to produce
(2R,3R)-BD with a small amount of meso-BD.
However, the final titer of BD decreased,
indicating that gldA was not crucial for
(2R,3R)-BD production.
To investigate the role of dhaD in
(2R,3R)-BD formation, mutants deficient in
dhaD were generated. Deactivation of dhaD
eliminated the formation of all isomers of BD
and weakened the glycerol oxidation pathway
dramatically. This may be due to the fact that
DhaD catalyzes the first step of glycerol
oxidation (12). Besides the dihydroxyacetone
pathway, glycerol can also be utilized through a
sn-glycerol-3-phosphate pathway in several
organisms, including K. pneumoniae (35,39-40).
In the dhaD-disrupted mutants,
KP∆budC∆dhaD and KP∆budC∆dhaD∆gldA,
glycerol can be first phosphorylated by glycerol
kinase to form sn-glycerol-3-phosphate.
sn-Glycerol-3-phosphate can then be converted
to dihydroxyacetone phosphate by
glycerol-3-phosphate dehydrogenase and further
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
7
fed into central metabolism (35). However, the
sn-glycerol-3-phosphate pathway in K.
pneumoniae is inefficient (40). Therefore, the
dhaD-disrupted mutants were still able to grow
on glycerol but little AC was accumulated,
making the role of dhaD in formation of BD
undetermined.
Whole-cell biocatalysis using (3R)/(3S)-AC
as substrate was performed to further investigate
the role of dhaD in conversion of AC to BD. As
shown in Fig. 6b, (2R,3R)-BD and meso-BD
were detected in the broth of KP∆budC∆gldA,
while no BD was detected when budC, dhaD,
and gldA were deactivated simultaneously. This
result demonstrated that dhaD is crucial not only
for glycerol metabolism but also for the
formation of BD when glycerol was utilized. It
should be noted that meso-BD became the main
isomer of BD produced from (3R)/(3S)-AC by
the KP∆budC∆dhaD and KP∆budC∆gldA
strains. This result suggests DhaD and GldA
have higher catalytic rate toward
(3S)-AC/meso-BD conversion than
(3R)-AC/(2R,3R)-BD conversion, which is
consistent with the results of conversion of
(3R)/(3S)-AC by the purified enzyme. The
differences in the BD isomers produced from
glycerol and (3R)/(3S)-AC were due to the
amount of (3S)-AC in the two systems. (3R)-AC
was the main isomer of AC produced from
glycerol, and little (3S)-AC was formed.
Therefore, (2R,3R)-BD was mainly produced
with a small amount of meso-BD in the growth
system, and meso-BD became the major product
in whole-cell biocatalysis due to the high
catalytic rate of (3S)-AC/meso-BD conversion
of GDHs.
Complementation of dhaD and gldA in K.
pneumoniae mutants–Since DhaD and GldA
share similar catalytic properties, these two
enzymes are likely to play the same
physiological role in glycerol utilization.
Unexpectedly, we found that dhaD was highly
induced by glycerol while the expression level
of gldA remained rather low. To confirm their
roles in glycerol utilization and BD formation,
dhaD and gldA were complemented in a dhaD
and gldA disruption mutant (KP∆dhaD∆gldA)
using protocols described in the experimental
procedures. PCR was used to verify the
disruption and complementation events of dhaD
and gldA genes. The result in Fig. 7a shows that
PCR generated the products of expected sizes.
The resulting mutants,
KP∆dhaD∆gldA(pDK7-dhaD) and
KP∆dhaD∆gldA(pDK7-gldA), were evaluated in
terms of cell growth and glycerol utilization. As
controls, KPwild, KP∆dhaD∆gldA and
KP∆dhaD∆gldA(pDK7) were used.
As shown in Fig. 7b, KP∆dhaD∆gldA grew to
a lower OD620nm as compared to the wild-type
strain, indicating that cell growth of K.
pneumoniae was inhibited because of the
disruption of dhaD and gldA. The glycerol
uptake rate was also decreased (Fig. 7c). To
induce the expression of dhaD and gldA in the
plasmid, IPTG was added at 5 h when the
OD620nm reached approximately 0.7. At the stage
of 6-10 h, KP∆dhaD∆gldA(pDK7-dhaD) and
KP∆dhaD∆gldA(pDK7-gldA) grew more slowly
than wild-type K. pneumoniae, possibly due to
the heterologous expression of dhaD and gldA.
At the stage of 10-16 h, cell growth and glycerol
uptake recovered (Fig. 7b and Fig. 7c),
indicating that DhaD and GldA are both usable
for glycerol oxidation in K. pneumoniae.
Introduction of dhaD and gldA also resumed the
production of (2R,3R)-BD.
DISCUSSION
Enzymes are generally specific for their
substrates and the reactions they catalyze.
However, certain enzymes that do not show
such specificity are sometimes called
promiscuous (41). It has been suggested that
enzyme promiscuity may have an important role
in enzyme evolution and industrial applications
(41-43). Here, we reported two promiscuous
GDHs (DhaD and GldA) with relaxed substrate
and reaction specificities. The promiscuity of
DhaD and GldA allows them to act as
(2R,3R)-BDHs and catalyze the interconversions
of (3R)-AC/(2R,3R)-BD and (3S)-AC/meso-BD.
However, further analysis of the kinetic data of
DhaD and GldA showed that there are
differences in the catalytic properties between
GDHs and (2R,3R)-BDHs. First, DhaD and
GldA show higher rates of both oxidation and
reduction reactions towards vicinal alcohols of
S-configuration, which is opposite to
(2R,3R)-BDHs. Second, DA with two carbonyl
groups does not serve as a substrate for DhaD or
GldA, but is a good substrate for (2R,3R)-BDHs
from P. polymyxa and S. cerevisiae (30-31),
possibly indicating structural differences in
substrate binding or the catalytic sites between
GDHs and (2R,3R)-BDHs. Both GDH and
(2R,3R)-BDH belong to the MDR family (44),
but it is possible that GDH has evolved
separately from (2R,3R)-BDH, because GDHs
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
8
from K. pneumoniae have a low amino acid
sequence identity (9%) to (2R,3R)-BDH from P.
polymyxa (31). To further investigate this, the
amino acid sequences of GDHs and
(2R,3R)-BDHs from different strains were used
to construct a phylogenetic tree. The
phylogenetic analysis clearly showed that these
enzymes belong to different branches of the
MDR family, suggesting that GDH has evolved
separately from (2R,3R)-BDH (Fig. 8). The
results also provide an explanation of why GDH
does not have significant similarities with
(2R,3R)-BDH. It is known that DhaD and GldA
have high amino acid sequence identities and
reserved substrate binding sites with GDHs
from other strains (14), possibly indicating that
enzyme promiscuity is common among GDHs.
Some scientists regard enzyme promiscuity as
the starting point for enzyme divergent
evolution (42-43). Based on the results obtained
here, it is possible that GDH has been
evolutionarily adapted to AC/BD conversion,
facilitating a dual role of DhaD in glycerol
utilization and BD production. We reasoned that
the dual role of DhaD is favorable for the
growth of K. pneumoniae on glycerol.
Biosynthesis of BD has vital physiological
relevance to the microbes, one of which is the
regulation of the intracellular NADH/NAD+
ratio (22). Compared with glucose catabolism,
an excess of NADH is generated by glycerol
catabolism (45-46), making the
NADH-consuming pathway necessary (Fig. 1a).
The promiscuity of DhaD allows K. pneumoniae
to use the AC/BD conversion for NADH
disposal and recovery. The “spare
NADH-regulation pathway” may be more
important when K. pneumoniae grows
anaerobically on glycerol (39). The promiscuity
of DhaD may also contribute to the prevention
of acidification by shifting glycerol metabolism
from acid production to the formation of neutral
compounds. This hypothesis is supported by the
fact that BD production from glycerol is
responsive to spontaneous pH drops during
glycerol metabolism and can be increased by
forced pH fluctuations (9,47). Additionally, as
an intestinal bacterium, K. pneumoniae could
utilize the glycerol that is decomposed from
triglyceride in the intestinal tract. Considering
that the intestines of animals are rich in nutrition,
the dual role of DhaD may also include storing
carbon and energy. Interestingly, DhaD has
higher BD formation rates at higher NADH
concentrations owing to the positive homotropic
interaction between DhaD and NADH. This
may allow DhaD to switch its role from glycerol
utilization to BD formation according to the
intracellular NADH level, which would allow
DhaD to perform its physiological roles.
Despite the importance of enzyme
promiscuity in physiology, it is not always
advantageous for industrial applications because
the side reactions negatively affect the
biocatalytic efficiency and purity of products
(48-49). BD is the main by-product of 1,3-PD
production from glycerol by K. pneumoniae,
and efforts have been made to eliminate BD
production through inactivation of BDH
(encoded by budC). However, BD was still
detected in the fermentation broth (50-51). Our
results show that the promiscuity of DhaD is
responsible for the production of BD in budC
inactivation mutations. Although disruption of
dhaD eliminated the production of BD, it also
dramatically lowered glycerol utilization rates
(Fig. 7c), which further decreased 1,3-PD
production. Therefore, BD production in K.
pneumoniae could not be eliminated simply by
blocking the BD synthetic pathway.
Combination of the approaches for enzymatic
technology and metabolic engineering should
help improve the specificities of key enzymes
(48,52) and consequently eliminate by-products
such as BD in 1,3-PD production.
The functional genes of prokaryotes usually
exist as a single copy in the genome, including
gldA, which exists widely in bacteria; however,
a few species that can convert glycerol to
1,3-PD, such as Citrobacter freundii, K.
pneumoniae, and K. oxytoca, possess a second
GDH-encoding gene dhaD, which is located in
the dha regulon (53). Our results suggest that
DhaD is specialized for glycerol utilization and
production of 1,3-PD and has evolved separately
from GldA. This conclusion was supported by
the following experimental data. First, the Km
value of DhaD toward a specific substrate was
much higher than that of GldA, indicating that
DhaD is less promiscuous than GldA (Table 3).
Second, dhaD was highly induced by glycerol,
whereas gldA was expressed constitutively at a
low level (Fig. 5). Third, the topology of the
phylogenetic tree (Fig. 8) suggests that DhaD
and GldA belong to two different groups. The
co-existence of dhaD and gldA in one strain
might be due to a gene duplication event, which
is of great importance and prevalence in
biological evolution (54). This phenomenon
might be an example of more rapid evolution
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
9
under the influence of functional specialization
than under the influence of taxonomic
divergence (12). Interestingly, when we
compared DhaD and GldA with two archaeal
GDHs from Halopiger xanaduensis (AEH39369)
and Methanosarcina barkeri (YP_303855), we
found that GldA had higher amino acid
sequence identities (49% and 21%, respectively)
than did DhaD (47% and 19%, respectively).
This finding suggests that gldA is a more ancient
gene and may serve as a backup that can turn
into a more efficient catalyst under selective
pressure, providing a survival benefit to the
organism. A previous study provides
considerable support for our hypotheses (55).
GDH (encoded by gldA) from Bacillus
coagulans acquired D-lactate dehydrogenase
activity through mutations during adaptive
evolution. The expression level of gldA was also
increased as a result of an upstream transposon
insertion, facilitating production of D-lactic acid
and restoring anaerobic growth (55).
In summary, the dual role of DhaD in glycerol
metabolism and BD formation in K. pneumoniae
was characterized. The dual role is able to
switch according to physiological requirements,
indicative of a mechanism of enzyme evolution
though promiscuity. GldA, the other GDH of K.
pneumoniae, may be a more ancient gene, which
may serve as a backup for the organism.
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
10
REFERENCES
1. Wulf, H., Mallin, H., and Bornscheuer, U. (2012) Protein engineering of a thermostable polyol
dehydrogenase. Enzyme Microb. Technol. 51, 217–224
2. Chung, S. S., Ho, E. C., Lam, K. S., and Chung, S. K. (2003) Contribution of polyol pathway to
diabetes-induced oxidative stress. J. Am. Soc. Nephrol. 14, S233–S236
3. Chakravorty, M., Veiga, L. A., Bacila, M., and Horecker, B. L. (1962) Pentose metabolism in
Candida II. The diphosphopyridine nucleotide-specific polyol dehydrogenase of Candida utilis. J.
Biol. Chem. 237, 1014–1020
4. Zeng, A. P., and Sabra, W. (2011) Microbial production of diols as platform chemicals: Recent
progresses. Curr. Opin. Biotechnol. 22, 1–9
5. Forage, R. G., and Lin, E. C. C. (1982) DHA system mediating aerobic and anaerobic dissimilation
of glycerol in Klebsiella pneumoniae NCIB 418. J. Bacteriol. 151, 591–599
6. Zhang, K., Zhao, W. D., Li, Q., Fang, W. G., Zhu, L., Shang, D. S., and Chen, Y. H. (2009)
Tentative identification of glycerol dehydrogenase as Escherichia coli K1 virulence factor cglD
and its involvement in the pathogenesis of experimental neonatal meningitis. Med. Microbiol.
Immunol. 198, 195–204
7. Gonçalves, A. T., Marçal, D., Carrondo, M. A., and Enguita, F. J. (2009) Crystallization and
preliminary X-ray characterization of a glycerol dehydrogenase from the human pathogen
Salmonella enterica serovar Typhimurium. Acta. Crystallogr. Sect. F Struct. Biol. Cryst. Commun.
65, 698–701
8. Tao, F., Tai, C., Liu, Z., Wang, A., Wang, Y., Li, L., Gao, C., Ma, C., and Xu, P. (2012) Genome
sequence of Klebsiella pneumoniae LZ, a potential platform strain for 1,3-propanediol production.
J. Bacteriol. 194, 4457–4458
9. Petrov, K., and Petrova, P. (2009) High production of 2, 3-butanediol from glycerol by Klebsiella
pneumoniae G31. Appl. Microbiol. Biotechnol. 84, 659–665
10. Oh, B. R., Seo, J. W., Heo, S. Y., Hong, W. K., Luo, L. H., Joe, M. H., Park, D. H., and Kim, C. H.
(2011) Efficient production of ethanol from crude glycerol by a Klebsiella pneumoniae mutant
strain. Bioresour. Technol. 102, 3918–3922
11. Liu, H., Xu, Y., Zheng, Z., and Liu, D. (2010) 1,3-Propanediol and its copolymers: Research,
development and industrialization. Biotechnol. J. 5, 1137–1148
12. Tang, J. C., Forage, R. G., and Lin, E. C. C. (1982) Immunochemical properties of NAD+-linked
glycerol dehydrogenases from Escherichia coli and Klebsiella pneumoniae. J. Bacteriol. 152,
1169–1174
13. Truniger, V., and Boos, W. (1994) Mapping and cloning of gldA, the structural gene of the
Escherichia coli glycerol dehydrogenase. J. Bacteriol. 176, 1796–1800
14. Ruzheinikov, S. N., Burke, J., Sedelnikova, S., Baker, P. J., Taylor, R., Bullough, P. A., Muir, N.
M., Gore, M. G., and Rice, D. W. (2001) Glycerol dehydrogenase: structure, specificity, and
mechanism of a family III polyol dehydrogenase. Structure 9, 789–802
15. McGregor, W. G., Phillips, J., and Suelter, C. H. (1974) Purification and kinetic characterization of
a monovalent cation-activated glycerol dehydrogenase from Aerobacter aerogenes. J. Biol. Chem.
249, 3132–3139
16. Gärtner, G., and Kopperschläger, G. (1984) Purification and properties of glycerol dehydrogenase
from Candida valida. J. Gen. Microbiol. 130, 3225–3233
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
11
17. Yang, F., Hanna, M. A., and Sun, R. (2012) Value-added uses for crude glycerol–a byproduct of
biodiesel production. Biotechnol. Biofuels 5, 13
18. Saxena, R. K., Anand, P., Saran, S., and Isar, J. (2009) Microbial production of 1,3-propanediol:
recent developments and emerging opportunities. Biotechnol. Adv. 27, 895–913
19. Zhang, H., Lountos, G. T., Ching, C. B., and Jiang, R. (2010) Engineering of glycerol
dehydrogenase for improved activity towards 1,3-butanediol. Appl. Microbiol. Biotechnol. 88,
117–124
20. Raynaud, C., Lee, J., Sarçabal, P., Croux, C., Meynial-Salles, I., and Soucaille, P. (2011)
Molecular characterization of the glycerol-oxidative pathway of Clostridium butyricum VPI 1718.
J. Bacteriol. 193, 3127–3134
21. Celińska, E. (2010) Debottlenecking the 1,3-propanediol pathway by metabolic engineering.
Biotechnol. Adv. 28, 519–530
22. Ji, X. J., Huang, H., and Ouyang, P. K. (2011) Microbial 2,3-butanediol production: a
state-of-the-art review. Biotechnol. Adv. 29, 351–364
23. Celińska, E., and Grajek, W. (2009) Biotechnological production of 2,3-butanediol–current state
and prospects. Biotechnol. Adv. 27, 715–725
24. Zhang, G. L., Wang, C. W., and Li, C. (2012) Cloning, expression and characterization of
meso-2,3-butanediol dehydrogenase from Klebsiella pneumoniae. Biotechnol. Lett. 34, 1519–1523
25. Ui, S., Okajima, Y., Mimura, A., Kanai, H., Kobayashi, T., and Kudo, T. (1997) Sequence analysis
of the gene for and characterization of D-acetoin forming meso-2,3-butanediol dehydrogenase of
Klebsiella pneumoniae expressed in Escherichia coli. J. Ferment. Bioeng. 83, 32–37
26. Li, L., Wang, Y., Zhang, L., Ma, C., Wang, A., Tao, F., and Xu, P., (2012) Biocatalytic production
of (2S,3S)-2,3-butanediol from diacetyl using whole cells of engineered Escherichia coli.
Bioresour. Technol. 115, 111–116
27. Wang, Y., Li, L., Ma, C., Gao, C., Tao, F., and Xu, P. (2013) Engineering of cofactor regeneration
enhances (2S, 3S)-2,3-butanediol production from diacetyl. Sci. Rep. 3, 2643;
DOI:10.1038/srep02643
28. Zhang, L., Xu, Q., Zhan, S., Li, Y., Lin, H., Sun, S., Sha, L., Hu, K., Guan, X., and Shen, Y. (2013)
A new NAD(H)-dependent meso-2,3-butanediol dehydrogenase from an industrially potential
strain Serratia marcescens H30. Appl. Microbiol. Biotechnol. DOI 10.1007/s00253-013-4959-x
29. Nicholson, W. L. (2008) The Bacillus subtilis ydjL (bdhA) gene encodes acetoin
reductase/2,3-butanediol dehydrogenase. Appl. Environ. Microbiol. 74, 6832–6838
30. González, E., Fernández, M. R., Larroy, C., Solà, L., Pericàs, M. A., Parés, X., and Biosca, J. A.
(2000) Characterization of a (2R,3R)-2,3-butanediol dehydrogenase as the Saccharomyces
cerevisiae YAL060W gene product. Disruption and induction of the gene. J. Biol. Chem. 275,
35876–35885
31. Yu, B., Sun, J., Bommareddy, R. R., Song, L., and Zeng, A. P. (2011) Novel
(2R,3R)-2,3-butanediol dehydrogenase from potential industrial strain Paenibacillus polymyxa
ATCC 12321. Appl. Environ. Microbiol. 77, 4230–4233
32. Xiao, Z., Lv, C., Gao, C., Qin, J., Ma, C., Liu, Z., Liu, P., Li, L., and Xu, P. (2010) A novel
whole-cell biocatalyst with NAD+ regeneration for production of chiral chemicals. PLoS One 5,
e8860
33. Wang, Y., Tao, F., Li, C., Li, L., and Xu, P. (2013) Genome Sequence of Klebsiella pneumoniae
strain ATCC 25955, an oxygen-insensitive producer of 1,3-propanediol. Genome Announc. 1,
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
12
e00587-13
34. Huang, H., Gong, C. S., and Tsao, G. T. (2002) Production of 1, 3-propanediol by Klebsiella
pneumoniae. Appl. Biochem. Biotechnol. 98–100, 687–698
35. Ruch, F. E., Lengeler, J., and Lin, E. C. C. (1974) Regulation of Glycerol Catabolism in Klebsiella
aerogenes. J. Bacteriol. 119, 50–56
36. Soler, J., De Arriaga, D., Busto, F., and Cadenas, E. (1982) Lactate dehydrogenase in Phycomyces
blakesleeanus. Biochem. J. 203, 383–391
37. van Aartsen, J. J., and Rajakumar, K. (2011) An optimized method for suicide vector-based allelic
exchange in Klebsiella pneumoniae. J. Microbiol. Methods 86, 313–319
38. Fournet-Fayard, S., Joly, B., and Forestier, C. (1995) Transformation of wild type Klebsiella
pneumoniae with plasmid DNA by electroporation. J. Microbiol. Methods 24, 49–54
39. González-Pajuelo, M., Meynial-Salles, I., Mendes, F., Soucaille, P., and Vasconcelos, I. (2006)
Microbial conversion of glycerol to 1, 3-propanediol: physiological comparison of a natural
producer, Clostridium butyricum VPI 3266, and an engineered strain, Clostridium acetobutylicum
DG1 (pSPD5). Appl. Environ. Microbiol. 72, 96–101
40. Seo, M. Y., Seo, J. W., Heo, S. Y., Baek, J. O., Rairakhwada, D., Oh, B. R., Seo P. S., Choi M. H.
and Kim, C. H. (2009) Elimination of by-product formation during production of 1,3-propanediol
in Klebsiella pneumoniae by inactivation of glycerol oxidative pathway. Appl. Microbiol.
Biotechnol. 84, 527–534
41. Hult, K., and Berglund, P. (2007) Enzyme promiscuity: mechanism and applications. Trends
Biotechnol. 25, 231–238
42. Jensen, R. A. (1974) Enzyme recruitment in evolution of new function. Annu. Rev. Microbiol. 30,
409–425
43. Khersonsky, O., Roodveldt, C., and Tawfik, D. S. (2006) Enzyme promiscuity: evolutionary and
mechanistic aspects. Curr. Opin. Chem. Biol. 10, 498–508
44. Auld, D. S., and Bergman, T. (2008) The role of zinc for alcohol dehydrogenase structure and
function. Cell. Mol. Life Sci. 65, 3961–3970
45. Lin, E. C. C. (1976) Glycerol dissimilation and its regulation in bacteria. Annu. Rev. Microbiol. 30,
535–578
46. Vasconcelos, I., Girbal, L., and Soucaille, P. (1994) Regulation of carbon and electron flow in
Clostridium acetobutylicum grown in chemostat culture at neutral pH on mixtures of glucose and
glycerol. J. Bacteriol. 176, 1443–1450
47. Petrov, K., and Petrova, P. (2010) Enhanced production of 2,3-butanediol from glycerol by forced
pH fluctuations. Appl. Microbiol. Biotechnol. 87, 943–949
48. Bornscheuer, U. T., Huisman, G. W., Kazlauskas, R. J., Lutz, S., Moore, J. C., and Robins, K.
(2012) Engineering the third wave of biocatalysis. Nature 485, 185–194
49. Bornscheuer, U. T., and Kazlauskas, R. J. (2004) Catalytic promiscuity in biocatalysis: using old
enzymes to form new bonds and follow new pathways. Angew. Chem. Int. Ed. 43, 6032–6040
50. Guo, X., Fang, H., Zhuge, B., Zong, H., Song, J., Zhuge, J., and Du, X. (2013) BudC knockout in
Klebsiella pneumoniae for bioconversion from glycerol to 1,3-propanediol. Biotechnol. Appl.
Biochem. DOI:10.1002/bab.1114
51. Wu, Z., Wang, Z., Wang, G., and Tan, T. (2013) Improved 1,3-propanediol production by
engineering the 2,3-butanediol and formic acid pathways in integrative recombinant Klebsiella
pneumoniae. J. Biotechnol. DOI:10.1016/j.jbiotec.2013.04.022
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
13
52. Bar-Even, A., and Salah Tawfik, D. (2013) Engineering specialized metabolic pathways–is there a
room for enzyme improvements? Curr. Opin. Biotechnol. 24, 310–319
53. Bouvet, O. M. M, Lenormand, P., Ageron, E., and Grimont, P. A. D. (1995) Taxonomic diversity
of anaerobic glycerol dissimilation in the Enterobacteriaceae. Res. Microbiol. 146, 279–290
54. Zhang, J. (2003) Evolution by gene duplication: an update. Trends Ecol. Evol. 18, 292–298
55. Wang, Q., Ingram, L. O., and Shanmugam, K. T. (2011) Evolution of D-lactate dehydrogenase
activity from glycerol dehydrogenase and its utility for D-lactate production from lignocellulose.
Proc. Natl. Acad. Sci. 108, 18920–18925
56. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. (2011) MEGA5:
molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and
maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739
57. Simon, R., Priefer, U., and Pühler, A. (1983) A broad host range mobilization system for in vivo
genetic engineering: transposon mutagenesis in gram negative bacteria. Nat. Biotechnol. 1,
784–791
58. Brooks, D. M., Hernández-Guzmán, G., Kloek, A. P., Alarcón-Chaidez, F., Sreedharan, A.,
Rangaswamy, V., Peñaloza-Vázquez, A., Bender, C. L., and Kunkel, B. N. (2004) Identification
and characterization of a well-defined series of coronatine biosynthetic mutants of Pseudomonas
syringae pv. tomato DC3000. Mol. Plant Microbe Interact. 17, 162–174
59. Schäfer, A., Tauch, A., Jäger, W., Kalinowski, J., Thierbach, G., and Pühler, A. (1994) Small
mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and
pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene
145, 69–73
60. Kleiner, D., Paul, W., and Merrick, M. J. (1988) Construction of multicopy expression vectors for
regulated overproduction of proteins in Klebsiella pneumoniae and other enteric bacteria. J. Gen.
Microbiol. 134, 1779–1784
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
14
FOOTNOTES *This work was supported by the National Basic Research Program of China (2011CBA00800) from
Ministry of Science and Technology of China, and the grant from National Natural Science
Foundation of China (31121064). This work was partially supported by the Chinese National Program
for High Technology Research and Development (2011AA02A207 and 2011AA02A202). ‡Co-first authors, both authors contributed equally to this work.
§To whom correspondence should be addressed: Ping Xu, State Key Laboratory of Microbial
Metabolism, and School of Life Sciences & Biotechnology, Shanghai Jiao Tong University, Shanghai
200240, People’s Republic of China, Tel./Fax: +86-21-34206723; Email: [email protected] 1The abbreviations used are: GDH, glycerol dehydrogenase; 1,3-PD, 1,3-propanediol; BD,
2,3-butanediol; BDH, 2,3-butanediol dehydrogenase; AC, acetoin; SDR, short-chain
dehydrogenase/reductase; MDR, medium-chain dehydrogenase/reductase family; SDS-PAGE, sodium
dodecyl sulfate polyacrylamide gel electrophoresis; U, enzyme unit; DA, diacetyl; h, Hill coefficient;
GC, gas chromatography; qPCR, quantitative PCR.
FIGURE LEGENDS
FIGURE 1. Formation of BD isomers in K. pneumoniae from glucose and glycerol. (a) BD isomers
production pathway in K. pneumoniae from glucose and glycerol. Dashed lines represent the
pathways that are active only in the glycerol medium. GDH(DhaD), glycerol dehydrogenase (encoded
by dhaD); GDHt, glycerol dehydratase; 1,3-PD DH, 1,3-PD dehydrogenase; DHAK,
dihydroxyacetone kinase; ALS, α-acetolactate synthase; ALDC, α-acetolactate decarboxylase;
meso-BDH, meso-BD dehydrogenase. (b) GC analysis of BD and AC isomer standards. (c) GC
analysis of BD isomers produced by K. pneumoniae from glucose. (d) GC analysis of BD isomers
produced by K. pneumoniae from glycerol.
FIGURE 2. SDS-PAGE analysis of purified DhaD and GldA. Lane M, marker; lane 1, crude extract
of E. coli BL21 (DE3); lane 2, crude extract of E. coli BL21 (DE3) (pET-28a-dhaD); lane 3, purified
DhaD; lane 4, crude extract of E. coli BL21 (DE3) (pET-28a-gldA); lane 5, purified GldA.
FIGURE 3. Conversion of (3R)/(3S)-AC by purified DhaD and GldA. (a) BD isomers produced from
(3R)/(3S)-AC by purified DhaD and GldA. (□) (2R,3R)-BD; (▨) meso-BD. Error bars indicate
standard deviation (n = 3). (b) GC analysis of the products of (3R)/(3S)-AC conversion by DhaD. (c)
GC analysis of the products of (3R)/(3S)-AC conversion by GldA.
FIGURE 4. Kinetic response of DhaD and GldA to different concentrations of NADH. (a) Enzyme
activities toward (3R)/(3S)-AC at different concentrations of NADH. (b) Hill plot analyses of the data
shown in Fig. 4a. The Vmax values were obtained from Scatchard plots. h value (Hill coefficient) was
the maximal slope of the lines given by Hill plot analyses. (■) DhaD; (○) GldA. Error bars indicate
standard deviation (n = 3).
FIGURE 5. Determination of relative transcriptional levels of dhaD and gldA in glucose and glycerol
mediums using qPCR. (□) Relative transcriptional levels of dhaD; (▨) relative transcriptional levels of
gldA. Error bars indicate standard deviation (n = 3).
FIGURE 6. Production of BD isomers by the wild-type and mutant strains. (a) Growth system using
glycerol as a carbon source. (b) Whole-cell biocatalysis using (3R)/(3S)-AC as a substrate. (□)
(2S,3S)-BD; (■) (2R,3R)-BD; (■) meso-BD.
FIGURE 7. Complementation of dhaD and gldA in the K. pneumoniae mutant. (a) Analysis of PCR
fragments to confirm disruption and complementation of dhaD and gldA. Lane M: marker; lane 1-3,
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
15
dhaD products amplified with KPwild, KP∆dhaD∆gldA, and KP∆dhaD∆gldA(pDK7-dhaD) genomic
DNAs as the template, respectively; lane 4-6, gldA products amplified with KPwild, KP∆dhaD∆gldA,
and KP∆dhaD∆gldA(pDK7-gldA) genomic DNA as the template, respectively. PCR of dhaD and gldA
was performed with primers dhaD-F(BamHI)/dhaD-R(XhoI) and gldA-F(BamHI)/gldA-R(XhoI),
respectively. (b) Effect of disruption and complementation of dhaD and gldA on cell growth. (c)
Effect of disruption and complementation of dhaD and gldA on glycerol consumption. Error bars
indicate standard deviation (n = 3).
FIGURE 8. Phylogenetic analysis of amino acid sequences of GDH and (2R,3R)-BDH from different
strains. The tree was constructed using the MEGA 5 program using the neighbor-joining method (56).
The sequences compared include GDHs from Escherichia coli (EcGDH, P0A9S6); Shigella sonnei
(SsGDH, YP_005459262); Citrobacter freundii (CfGDH(GldA), WP_003847842 and CfGDH(DhaD),
P45511); Salmonella enterica (SeGDH, YP_006888481); Enterobacter cloacae (EclGDH,
AFM62175); Klebsiella pneumoniae (KpGDH(GldA) and KpGDH(DhaD), this study); Klebsiella
oxytoca (KoGDH(GldA), YP_005017437 and KoGDH(DhaD), YP_005016612); Geobacillus
stearothermophilus (GsGDH, P32816); Clostridium butyricum (CbGDH, AAN17729); and
(2R,3R)-BDHs from Bacillus subtilis (Bs(2R,3R)-BDH, NP_388505); Paenibacillus polymyxa
(Pp(2R,3R)-BDH, ADV15558); Thermoanaerobacter brockii (Tb(2R,3R)-BDH, CAA46053); and
Clostridium beijerinckii (Cbe(2R,3R)-BDH, AAA23199).
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
16
TABLE 1 Bacterial strains and plasmids used in this study
Strain or plasmid Relevant characteristic(s)a Reference or source
Strain
K. pneumoniae ATCC 25955 Wild-type ATCC 25955
E. coli DH5α supE44∆lacU169 (Φ80 lacZ∆M15) hsdR17
recA1 endA1 gyrA96 thi-1 relA1
Novagen
E. coli BL21 (DE3) F- ompT hsdSB (rB
-mB
-) gal (λ c I 857 ind1
Sam7 nin5 lacUV5 T7gene1) dcm (DE3)
Novagen
E. coli S17-1 thi pro hsdR recA Tra+, conjugative strain able
to host λ-pir-dependent plasmids
(57)
KP∆budC K. pneumoniae ATCC 25955 budC disruption
mutant strain This study
KP∆budC∆dhaD K. pneumoniae ATCC 25955 budC and dhaD
disruption mutant strain This study
KP∆budC∆gldA K. pneumoniae ATCC 25955 budC and gldA
disruption mutant strain
This study
KP∆budC∆dhaD∆gldA K. pneumoniae ATCC 25955 budC, dhaD and
gldA disruption mutant strain
This study
KP∆dhaD∆gldA K. pneumoniae ATCC 25955 dhaD and gldA
disruption mutant strain This study
KP∆dhaD∆gldA(pDK7-dhaD) K. pneumoniae ATCC 25955 dhaD and gldA
disruption mutant strain harboring pDK7-dhaD This study
KP∆dhaD∆gldA(pDK7-gldA) K. pneumoniae ATCC 25955 dhaD and gldA
disruption mutant strain harboring pDK7-gldA
This study
Plasmid
pEASY-Blunt Apr, cloning vector Transgene
pET-28a(+) Kmr, overexpression vector, PT7 Novagen
pCAM140 Smr, Sp
r, Ap
r, R6K origin, mTn5SSgusA40 (58)
pK18mobsacB Kmr, gene replacement vector derived from
plasmid pK18, Mob+ sacB
(59)
pDK7 Cmr, expressing vector, Ptac (60)
pKR6K Kmr, gene replacement vector derived from
plasmid pK18mobsacB, R6K origin, Mob+ sacB
This study
pET-28a-dhaD dhaD in pET-28a This study
pET-28a-gldA gldA in pET-28a This study
pKR6K-budC::BamHI pKR6K derivative, carries a 354-bp deletion of
budC
This study
pKR6K-dhaD::BamHI pKR6K derivative, carries a 904-bp deletion of
dhaD
This study
pKR6K-gldA::HindIII pKR6K derivative, carries a 770-bp deletion of
gldA
This study
pDK7-dhaD dhaD in pDK7 This study
pDK7-gldA gldA in pDK7 This study
aAp
r, Sm
r, Sp
r, Km
r and Cm
r; resistance to ampicillin, streptomycin, spectinomycin, kanamycin and
chloramphenicol respectively.
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
17
TABLE 2 Sequences of primers used in this study
Primer Sequence (5’-3’)
oriR6K-F(BspHI) TCATGACAGTTCAACCTGTTGATAGTAC
oriR6K-R(BsaXI) GGAGAGGCGGTAGAGAGAGACAATGTCAG
CCGTTAAGTGTTC
ΔbudC-F(EcoRI) ATCGGAATTCGCCTGGCTGGTCAATCCTG
ΔbudC-F1(BamHI) ATCGGGATCCGCCGGTAACAAGTGCGAC
ΔbudC-R1(BamHI) ATTAGGATCCAGAGGGTCACGGCGGGAAAA
ΔbudC-R(PstI) CCGCCTGCAGTAGTTAAATACCATCCCGCC
ΔdhaD-F(EcoRI) ATCAGAATTCTCAGGATGCAGGCGGACTCA
ΔdhaD-F1(BamHI) ATTAGGATCCCCTCACCGCCGATCTGTTAG
ΔdhaD-R1(BamHI) GCAAGGATCCCATTCACCACTTTCTCTCCC
ΔdhaD-R(PstI) ATGGCTGCAGATTGTAAGGGCATTATGCGG
ΔgldA-F(EcoRI) ATCGGAATTCTGGATTGTCTGCTGGCTGGC
ΔgldA-F1(HindIII) ATGCAAGCTTTTTCGCGGTATCCAGGGTTT
ΔgldA-R1(HindIII) ATTAAAGCTTTGGTCAGCGCTTCCTGCAGG
ΔgldA-R(XmaI) TCTACCCGGGTGATTTGCTGGCACTAACGA
dhaD-F(BamHI) GCGGGGATCCATGCTAAAAGTTATTCAAT
dhaD-R(XhoI) AATACTCGAGTTAACGCGCCAGCCACTGC
gldA-F(BamHI) GCAAGGATCCATGGATCGCATTATTCAATC
gldA-R(XhoI) TTGTCTCGAGTTATTCCCATTCCTGCAGG
dhaD-RT-F GGCGAACACTTACCTCAG
dhaD-RT-R TGGCACTCTTCAAGAATGG
gldA-RT-F TCGCATTATTCAATCACCAG
gldA-RT-R TTACGCAGCATCTCTTCC
16SrRNA-RT-F CACGGTCCAGACTCCTAC
16SrRNA-RT-R TATTAACCTTATCGCCTTCCTC
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
18
TABLE 3 Kinetic parameters of GDHs and BDHs for glycerol, (2R,3R)-BD, meso-BD, (2S,3S)-BD, (3R)/(3S)-AC, and DA
Substrate
Km (mM) Vmax (U mg-1) kcat (s-1) kcat/Km (s-1 mM-1)
DhaD GldA EcGDHa (2R,3R)-BDHb meso-BDHc DhaD GldA DhaD GldA DhaD GldA
Glycerol 93.62 ± 3.17 14.49 ± 0.10 38.00 ND 16.13 ± 0.61 29.07 ± 0.11 10.51 ± 0.40 18.88 ± 0.18 0.11 ± 0.00 1.30 ± 0.00
(2R,3R)-BD 236.36 ± 6.17 119.25 ± 14.55 14.00 ± 5.00 ND 8.89 ± 0.18 5.89 ± 0.64 5.80 ± 0.12 3.82 ± 0.40 0.03 ± 0.00 0.03 ± 0.00
meso-BD 37.39 ± 6.48 4.94 ± 0.19 65.00 ± 9.00 13.00 ± 0.32 7.17 ± 0.83 23.62 ± 0.12 4.67 ± 0.54 15.33 ± 0.01 0.13 ± 0.01 3.11 ± 0.13
(2S,3S)-BD ND ND ND ND ND ND ND ND ND
(3R)/(3S)-AC 12.06 ± 0.06 4.15 ± 0.28 4.50 ± 0.50 0.65 ± 0.11 5.65 ± 0.06 15.99 ± 0.45 3.68 ± 0.04 10.38 ± 0.24 0.31 ± 0.00 2.51 ± 0.11
DA ND ND ND ND ND ND ND ND
aData for EcGDH (GDH from E. coli) are from reference 13. No average ± standard deviation was available.
bData for (2R,3R)-BDH of S. cerevisiae are from reference 30.
cData for meso-BDH of K. pneumoniae are from reference 24.
ND; the kinetic parameters were not determined because the enzymes showed no or extremely low activity towards the substrates.
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
19
FIGURE 1
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
20
FIGURE 2
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
21
FIGURE 3
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
22
FIGURE 4
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
23
FIGURE 5
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
24
FIGURE 6
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
25
FIGURE 7
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Dual role of glycerol dehydrogenase in Klebsiella pneumoniae
26
FIGURE 8
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Yu Wang, Fei Tao and Ping Xu2,3-butanediol formation in Klebsiella pneumoniae
Glycerol dehydrogenase plays a dual role in glycerol metabolism and
published online January 15, 2014J. Biol. Chem.
10.1074/jbc.M113.525535Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on March 19, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Top Related