24h
pup dop pafA prcA
48h
prcB arc
72h
Fig. S1: RT-PCR (A) and RT-qPCR (B) analysis of transcription of the pupylation and proteasome genes.
We detected transcripts for the pupylation (pup/dop/pafA) and proteasome (prcA/prcB/arc) genes at various time
points (24, 48 and 72h).
# no significant difference was observed between the two FC (Wilcoxon rank sum tests, p-value < 0.05)
FC 24h/72h 10,31+/-4,60 2,62+/-0,58 1,64+/-0,39 3,49+/-0,75 3,35+/-1,06 1,78+/-0,63 4,08+/0,75
FC 48h/72h 2,85+/-0,56 2,13+/-0,16 1,56+/-0,24 1,74+/-0,29 1,63+/-0,29 0,95+/-0,23 1,85+/0,11
0
2
4
6
8
10
12
14
16
arc dop pup sco1645 prcB prcA pafA
Fo
ld c
han
ge (
FC
)
FC 24h/72h FC 48h/72h
# #
B
A Figure S1
M. tuberculosis H37rv M. smegmatis S. coelicolor R. erythropolis
A. SCO6042 = unknown protein
Figure S2
Figure S2: Alignment of homologous pupylated proteins in actinobacteria, with their sites of pupylation.
A. SCO6042 and its homologues. B. SCO3629 and its homologues. Pupylated sites are indicated by arrows..
B. SCO3629=PurA
C. glutamicum
J+5
J+7
J+10
Figure S3
Figure S3: Morphological differentiation on SFM solid medium. Plates on which the wild-type strain (M145),
the pup mutant (∆pup), the pup mutant with the empty vector pSET152 (∆pup+pSET152), the pup mutant with the
vector pSET-E*-His-pup (∆pup+pSET-E*His-pup) and the proteasome mutant (prcB::pOJ260) were grown are
shown after 5, 7 and 10 days of cultivation.
Figure S4: Scanning electron microscopy of cultures on SFM. The wild type strain (M145), the pup mutant
(∆pup), the pup mutant with the empty vector pSET152 (∆pup+pSET152), the pup mutant with the vector pSET-
E*-His-pup (∆pup+pSET-E*His-pup) and the proteasome mutant (prcB::pOJ260) are observed.The magnification
is the same for all images and the scale bar represents 10 µm.
Figure S4
Strains Diameter
(cm)
wt 6.8+/-0.14
pup 6.25+/-0.07
pup + pSET152 6.7+/-0.28
pup + pSET-
E*His-pup
6.9+/-0.14
prcB::pOJ260 6.35+/-0.21
B
1 cm
Figure S5
Figure S5: Calcium-dependent antibiotic production. The wild-type strain (M145), the pup mutant (∆pup),
the pup mutant with the empty vector pSET152 (∆pup+pSET152), the pup mutant with the vector pSET-E*-
His-pup (∆pup+pSET-E*His-pup) and the proteasome mutant (prcB::pOJ260) were grown on ONA medium in
the presence of Ca(NO3)2. A. Inhibition zone using Micrococcus luteus as the indicator strain (Scale bar 1 cm).
B. Diameter of the inhibition zone.
∆pup M145 ∆pup+
pSET152
∆pup+pSET-E*His-pup prcB::pOJ260
A
Supplemental information 1
2
Materials and methods 3
Reverse transcription and PCR 4
RNA was isolated from S. coelicolor M145 wild type strain grown at 30°C on cellophane 5
disks laid on NE (1% glucose, 0.2% yeast extract, 0.2% meat extract, 0.2% casamino acids, 6
pH 7) solid medium. The RNA was purified with RNeasy Mini kits (Qiagen) and treated with 7
Turbo DNase (Turbo DNA-free kit, Ambion). Reverse transcription was performed with 8
Transcriptor Reverse Transcriptase (Roche). GoTaq polymerase (Promega) was used for 9
standard PCR, with the following cycling conditions: 95 °C/3 min; 32 cycles of 95 °C/45 sec, 10
58 °C/45 sec, 72 °C/45 sec; then 72 °C/5 min. The primers used are detailed in Table S2. 11
Each primer pair was tested with purified S. coelicolor genomic DNA as a template. The 12
absence of DNA contamination in each RNA sample was assayed with each primer pair by 13
using twice the amount of RNA used to generate the corresponding cDNA. 14
For quantitative (q)PCR, specific primers (Table S2) were designed with BEACON 15
Designer 4.02 software (Premier Biosoft International, Palo Alto, CA). RNA was extracted 16
from cells cultivated at 30°C with shaking at 200 rpm in R2YE liquid medium, and 20 µg 17
aliquots were treated with 2 Units of DNase I (TURBO DNA-free reagent, Ambion) twice for 18
30 min each time at 37°C. cDNA synthesis and quantitative real-time PCR were performed 19
as described by Bellier et al. (2) with the following modifications. PCR involved an initial 20
denaturation step at 95°C for 15 min, followed by 40 cycles of amplification (95°C for 15 s, 21
55°C for 30 s and 72°C for 30 s). Each assay was performed in triplicate at least and 22
repeated with at least two independent RNA samples. The critical threshold cycle (CT) was 23
defined for each sample. The expression levels of the tested genes were normalized using 24
the hrdB gene encoding the housekeeping RNA polymerase principal sigma factor, a gene 25
classically used as reference in RT-PCR experiments in Streptomyces. The change (n-fold) 26
in the amount of transcript was calculated using the following equations: : CT = CT(test DNA) – 27
CT(hrdB) and ratio = 2CT (8). The significance of fold changes was tested using Wilcoxon rank 28
sum statistical tests. 29
30
Exploitation of RNAseq datasets 31
We used different S. coelicolor M145 RNAseq datasets for available in the GEO NCBI 32
database (1). Moody and collaborators used RNA extracted from mycelium grown on 33
maltose, yeast extract, malt extract media (MYM) and isolated at various time points (from 34
vegetative growth to sporulation, datasets GSM1121652 and GSM1121655) (10). Nasser 35
and collaborators used RNA extracted from mycelium grown on R2YE solid medium after 1 36
or 3 days of growth (datasets GSM1378112, GSM1378113 and GSM1378114) (12). The 37
SRA data were converted to BAM format by using Sratoolkit.2.5.1 38
(https://github.com/ncbi/sra-tools) and bowtie2 (6). Mapping of reads was done on the region 39
from SCO1649 to SCO1638 with Tablet 1.14.10.20 (9). 40
41
42
Table S1: bacterial strains and plasmids used 43
Strain or
plasmid
Description Reference
E. coli
ET12567
pUZ8002
strain used for intergeneric conjugation between E.
coli and S. coelicolor
(5)
DH5α host strain for cloning experiments Promega
S. coelicolor
M145 SCP1− SCP2− (5)
pup M145 with the pup deletion. This work
pup+
pSET152
pup deletion mutant harboring the empty vector
pSET152.
This work
pup+ pSET-
E*-His-pup
pup deletion mutant harboring the vector pSET-E*-
His-pup.
This work
prcB::pOJ260 disruption of prcB transcription by insertion of
pOJ260-prcB vector (aprar).
This work
Plasmids
pGEM-T
Easy
High copy number (ampir) vector with a polycloning
site within lacZ gene.
Promega
pGEM-T
Easy-pup-BG
pGEM-T Easy (ampir) with 2kb DNA fragment
corresponding to the upstream region of pup (PCR
product, primers used HBP32-HBP59).
This work
pGEM-T
Easy-pup-BD
pGEM-T Easy with 2kb DNA fragment corresponding
to the downstream region of pup (PCR product,
primers used HBP30-HBP58).
This work
pGEM-T
Easy-prcB
pGEM-T Easy with internal fragment of prcB gene
(PCR product, primers used HB88-HB89).
This work
pOSV234 Source of the excisable apramycin cassette (att3
aacC4) used for the pup deletion.
(13)
pOSV236 Plasmid containing the xis and int genes for site
specific excision of the att3 aacC4 cassette (ampir,
thior).
(13)
pOSV400 Shuttle E.coli/Streptomyces (OriT, hygror) used as
suicide vector in Streptomyces.
F. Lorieux,
unpublished
pOSV400-
pup
Insertion into the HindIII-BamHI sites of pOSV400 of
the apramycin cassette (att3 aacC4 from pOSV234)
flanked by the pup upstream and downstream regions
(respectively from pGEM-T Easy-pup-BD and pGEM-T
Easy-pup-BG).
This work
pHM11a E. coli/Streptomyces integrative shuttle vector. (11)
pSET152 E.coli/Streptomyces integrative shuttle vector. (3)
pSET-E*-His-
pup
pSET152 with a modified pup gene encoding a protein
with a His6 N-terminal tag. pup transcription is under
the control of the strong promoter ermE*.
This work
pOJ260 Shuttle E.coli/Streptomyces (OriT, aprar) used as
suicide vector in Streptomyces.
(3)
pOJ260-prcB pOJ260 with an internal fragment of the prcB gene
(557nt, primers HBP88-HBP89).
This work
ampir: ampicillin resistance; aprar: apramycin resistance, hygror: hygromycin resistance, thior: 44
thiostrepton resistance 45
46
Table S2: primers used 47
Primers Sequence 5' to 3’ Used for
HBP88 CGGGTCCTCATCCTTCATGG amplification of a sequence internal to
the prcB gene HBP89 CACGGAACAGCTTCTTCATC
HBP32 AAGCTTACACGGTGGCAAAC amplification of the upstream region of
pup with HindIII site in forward
HBP59 GATATCCCCTCACCCCGCTCGGT amplification of the upstream region of
pup with EcoRV site in reverse
HBP58 GGATCCCGACGACGACAAACTG amplification of the downstream
region of pup with BamHI site in
reverse
HBP30 GATATCAAGGGCGGCGAGTAG amplification of the downstream
region of pup with EcoRV site in
forward
D5 GGATGTGCTGCAAGGCGATT Verification of the disruption of prcB
by amplification and sequencing.
Primer in lacZ of pOJ260
HBP27 TGCGACGACGACAAACTG Verification of the disruption of prcB
by amplification. Primer in prcA in
reverse orientation
HBP6 AGCCCGTCACGCATCGCCTTGTTTC Verification of the scar obtained before
and after cassette excision for deletion
in pup. In reverse orientation
HBP5 AAGCAGCCGGACAGGGTGGAATATC Verification of the scar obtained before
and after cassette excision for deletion
in pup. In forward orientation
L-acc2R CCTGTCAGTCATGCGGGCAAC Verification of the scar obtained before
cassette excision for deletion in pup. In
reverse orientation
R-acc2F GGCCGTGACTGAGGAGGTCTAC Verification of the scar obtained before
cassette excision for deletion in pup. In
forward orientation
NS9 GGAATTCCATATGCACCACCACCACCA
CCACATGGCGACCAAGGACACCGGCG
amplification of his6 pup with NdeI site
in forward orientation
NS12 CGCGGATCCTTGTGGTCCTTACACCGC
GA
amplification of his6 pup with BamHI
site in reverse orientation
MG183 CCTCGCGGAGCACGAGAAGGACAA RT PCR experiment to probe the
transcription of arc MG184 CAGTCGTCGGGGTTGGTGGTGTT
MG156 TCGAGACGGAGTACGGAAT RT PCR experiment to probe the
transcription of dop MG157 GTGGTCGACGTAGAGCCGTG
MG158 CTACTCGCCGCCCTTTTGAA RT PCR experiment to probe the
transcription of pup NS11 ATGGCGACCAAGGACACCGG
MG185 TGGAGCACTTCGAGAAGGTCGA RT PCR experiment to probe the
transcription of prcB MG186 TGATCACAGTGATGATCGGATAGA
MG152 GTTCTATGTATCTCCTCAGC RT PCR experiment to probe the
transcription of prcA MG153 CCGATCCGCAGGTTCTCGTA
MG150 TTCGGGCTGGAGAACGAGTA RT PCR experiment to probe the
transcription of pafA MG151 CTTGTCGTGGGTGACGAGTT
MG192 CTCTTCCTGGACCTCATC qRT PCR experiment to probe the
transcription of hrdB MG193 TTGTAGCCCTTGGTGTAG
MG194 AGTACAACGAGTACGAGAAC qRT PCR experiment to probe the
transcription of prcA MG195 CACGGTCGTAGGTGTAAC
MG196 AGATGGTGAAGCTGTTC qRT PCR experiment to probe the
transcription of prcB MG197 TTGCCCTCCAAGGAC
MG198 GCGTGATTTGTTTGAAGG qRT PCR experiment to probe the
transcription of SCO1645 MG199 GCAGTTGAAGCACAGTAC
MG200 TCGGAGGACCTCAAGGAA qRT PCR experiment to probe the
transcription of pup MG201 AGTACATCGTCGATCTCGTC
MG202 CACCTCTACAAGAACAACAC qRT PCR experiment to probe
transcription of dop MG203 GGTTTCCCGCTTCATCAG
MG204 TCGACGTGAAGATCAAGAT qRT PCR experiment to probe the
transcription of arc MG205 CGTTCGGTGAGGTACTTG
MG206 ATGAAGTACAAGCTGCTC qRT PCR experiment to probe the
transcription of pafA MG207 TAGGCGAGGTCTATCTGC
48
49
50
Table S3: Predictions about the pupylated lysine identified in S. coelicolor by different 51
pupylation site prediction softwares (4, 7, 14) 52
Gene locus Protein name
Pupylated lysine(s)
GPS-Pup iPUP Pup-pred
SCO1814 InhA/ FabI K177 High No Low
SCO2090 FtsI K582 No No No
SCO2318 - K293 High Medium Low
SCO2389 AcpP K31 No High Low
SCO2390 FabF K333 No High Low
SCO2950 HupA K38 K42
Low No
High No
No No
SCO3373 ClpC K431 No High No
SCO3581 - K134 No No Low
SCO3629 PurA K139 No No No
SCO3878 DnaN K182 No No No
SCO4296 GroEL2 K41 No No No
SCO4496 - K147 No High Low
SCO4662 Tuf1 K397 High Medium Medium
SCO4762 GroEL1 K338 K490
No Low
Low No
Low No
SCO5032 AhpC K31 No No No
SCO5679 - K351 No High No
SCO5748 OsaA K813 High Medium Low
SCO6042 - K62 No High Medium
SCO7343 HemC1 K113 No No No
SCO7442 - K22 No No No
Total - 22 6 11 10 high, medium and low prediction scores are accounted in the total. 53
54
55
Supplemental References: 56
57
1. Barrett, T., S. E. Wilhite, P. Ledoux, C. Evangelista, I. F. Kim, M. Tomashevsky, K. A. 58 Marshall, K. H. Phillippy, P. M. Sherman, M. Holko, A. Yefanov, H. Lee, N. Zhang, C. L. 59 Robertson, N. Serova, S. Davis, and A. Soboleva. 2012. NCBI GEO: archive for functional 60 genomics data sets--update. Nucleic Acids Res 41:D991-5. 61
2. Bellier, A., M. Gominet, and P. Mazodier. 2006. Post-translational control of the 62 Streptomyces lividans ClgR regulon by ClpP. Microbiology 152:1021-7. 63
3. Bierman, M., R. Logan, K. O'Brien, E. T. Seno, R. N. Rao, and B. E. Schoner. 1992. Plasmid 64 cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. 65 Gene 116:43-9. 66
4. Chen, X., J. D. Qiu, S. P. Shi, S. B. Suo, and R. P. Liang. 2013. Systematic analysis and 67 prediction of pupylation sites in prokaryotic proteins. PLoS One 8:e74002. 68
5. Kieser, T., M. J. Bibb, K. Chater, and D. A. Hopwood. 2000. Practical Streptomyces genetics. 69 Norwich, John Innes Foundation. 70
6. Langmead, B., and S. L. Salzberg. 2012. Fast gapped-read alignment with Bowtie 2. Nat Meth 71 9:357-359. 72
7. Liu, Z., Q. Ma, J. Cao, X. Gao, J. Ren, and Y. Xue. 2011. GPS-PUP: computational prediction of 73 pupylation sites in prokaryotic proteins. Mol Biosyst 7:2737-2740. 74
8. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-75 time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408. 76
9. Milne, I., G. Stephen, M. Bayer, P. J. A. Cock, L. Pritchard, L. Cardle, P. D. Shaw, and D. 77 Marshall. 2013. Using Tablet for visual exploration of second-generation sequencing data. 78 Briefings in Bioinformatics 14:193-202. 79
10. Moody, M. J., R. A. Young, S. E. Jones, and M. A. Elliot. 2013. Comparative analysis of non-80 coding RNAs in the antibiotic-producing Streptomyces bacteria. BMC Genomics 14:558. 81
11. Motamedi, H., A. Shafiee, and S. J. Cai. 1995. Integrative vectors for heterologous gene 82 expression in Streptomyces spp. Gene 160:25-31. 83
12. Naseer, N., J. A. Shapiro, and M. Chander. 2014. RNA-Seq analysis reveals a six-gene SoxR 84 regulon in Streptomyces coelicolor. PLoS One 9:e106181. 85
13. Raynal, A., F. Karray, K. Tuphile, E. Darbon-Rongere, and J. L. Pernodet. 2006. Excisable 86 cassettes: new tools for functional analysis of Streptomyces genomes. Appl Environ Microbiol 87 72:4839-4844. 88
14. Tung, C. W. 2013. Prediction of pupylation sites using the composition of k-spaced amino 89 acid pairs. J Theor Biol 336:11-7. 90
91 92
93
Top Related