Craniofacial Biology Research Informs Health Care: Past, Present & Future
Hal Slavkin, Professor & Dean Emeritus Center for Craniofacial Molecular Biology, Herman Ostrow School of Dentistry, University of Southern California, Los
Angeles, California ([email protected])
“USJI Seminar, NIDCR, NIH, Bethesda, Md” September 3rd, 2014
USA – Japan Biomedical Scientific Research Cooperation and Collaborations
- or - Center Craniofacial Molecular Biology &
NIAMS/NIDCR – Japanese Scientist Collaborations (Examples 1972-2000)
Marie Yamada (DDS/PhD), Masanori Nakamura (DDS/PhD), Shigeshi Kikunaga (PhD), Koji Kindaichi
(DDS/PhD), Yasanori Sakakura (PhD), Yasuyuki Sasano (DDS/PhD), Osamu Tanaka (DDS/PhD), Ichiro Semba
(DDS/PhD), Shogo Takashiba (DDS/PhD), Tsuyoshi Ikura (DDS/PhD), Kazuaki Nonaka (DDS/PhD), Katsu
Takahashi (DDS/PhD), Ichiro Takahashi (DDS/PhD), Amano Yamane (PhD)
Niigata, Showa, Okayama, Kyoto, Kyushu, Kagoshima, Tokai, Tohoku, Notre Dame Seishin Universities
The Burden of Congenital and Acquired Craniofacial Anomalies 1 out of every 10 people in industrial countries present
craniofacial-oral-dental disease or disfigurements 1 million people in USA have severe congenital
craniofacial-oral-dental disfigurements (e.g. non-syndromic and syndromic clefts, birth marks, hemangiomas, oligodontia, severe malocclusions)
Acquired craniofacial-oral-dental diseases and disorders include severe facial burns, head and neck trauma, head & neck cancers, hypertrophic scars, and severe acne with facial scars impact many millions of people
Total direct & indirect global health care costs are $500 billion per year
Craniofacial Biology
Highlights
Vertebrate fossils show craniofacial birth defects Aristotle and biological observations Anatomy, embryology, surgery, and facial deformities Synthesis of biology, genetics, biochemistry, embryology, histology to
become “Developmental Biology” (Evo-Devo) Hans Spemann receives Nobel Prize in 1935 Herbert Cooper creates first craniofacial team (1938) World War II and the derivatives of ultrasound, antibiotics,
anesthesiology, and craniofacial surgery and rehabilitation Vannevar Bush and the modern creation of the NIH (cancer, dental, and
heart) in 1948 NIDR creates “1st” Genetics Branch at NIH (1950) NIDR first grants for craniofacial in 1957 Thalidomide Epidemic & Teratogen-Induced Dysmorphology (10,000
infants with dysmorphology in 1957) Landmark Conference December 6-9, 1959 called “Gatlinburg
Conference” or “Congenital Anomalies of the Face and Associated Structures”
Paul Tessier, John Converse, Peter Randal, Bob Gorlin, Michael Cohen, Jr. & Sam Pruzansky Exemplars of Clinical Scholars
Basic, translational & clinical research in craniofacial diseases and disorders (genetics, teratogens, nutrition, hearing, speech, vision, occlusion & orthodontics) in USA, Japan, UK and Beyond (1980s)
NIDR to NIDCR in 1998 (budget doubles) “50 Year Anniversary” NIDCR sponsors “Face Base Initiative” 2004-present Gordon Conferences establish “Craniofacial Morphogenesis and Tissue
Engineering” conference every two years Customized or personalized craniofacial medicine and dentistry
From Fish to Philosopher: “Evo-Devo” Evolution & Developmental Biology
Slavkin Birth of a Discipline: Craniofacial Biology, Aegis Communications 2012
Slavkin Birth of a Discipline: Craniofacial Biology, Aegis Communications 2012
“A Tipping Point:” Thalidomide Tragedy Informs Teratology & Craniofacial Birth Defects (1950s – 1970s; Accutane in 1980s)
Slavkin Birth of a Discipline: Craniofacial Biology, Aegis Communications 2012
Highly Conserved Homeotic Genes Discovered that Control Craniofacial and Body Form (1980s)
From Chromosome Discovery
To Karyotyping
To Genomics
To Proteomics
To Metabolomics
To Pharmacogenomics and Systems Approaches
To Biomimetics and Tissue Engineering
To Regeneration and Nano-bio-informatics
And Beyond
SELECTED EVENTS Social Security Act included funds for the care of children with
congenital birth defects-1935 1st Cleft Palate Clinic- (Dr Herbert Cooper); 1st Craniofacial Team-
1938 (creation of Inter Professional Teams for Health Care) NIDR created-1948 Thalidomide Epidemic (10,000 babies) – October 1957 NIDR first genetics branch at NIH; March of Dimes -1958 NIDR supports Gatlinburg Conference-December 1959 1st March of Dimes Conference-1960 Dr Sam Pruzansky coins term “craniofacial biology” – 1968
(synthesis of embryology, biochemistry, clinical) Japanese, USA, UK, France, Australia, Canada, Scandinavia Cleft lip
and Cleft Palate Centers for Clinical Services as well as Research Institutes created at many Universities in the 1970s and 1980s
NIDR becomes NIDCR in 1998; leads Surgeon General’s Report on Oral Health
Regenerative medicine & dentistry, tissue engineering, clinical trials for ED, Gordon Conferences, NIDCR FaceBase, Personalized Health Care, Genomics, Saliva as diagnostic fluid, 3-D Imaging, Nanotechnology, $1,000 for patient’s complete genome, and microbiome in 21st Century
Dr Herb Cooper’s Interprofessional Team at Lancaster, PA (1938)
Dr. Cooper with patient Cooper Protocol for CL/CP
Composition of Craniofacial Interprofessional Health Teams (100s CF Teams in USA, Japan, Europe & Beyond, 2014)
Surgeon, Pediatrician, Pedodontist, Prosthodontist, Orthodontist, Speech Therapist, Audiologist/ ENT, Geneticist, Clinical Psychologist, Social Services, Physical Therapy for Feeding Disorders, Nursing, Psychiatry, Nutrition and Education, Dental Hygiene, Anesthesiology
Craniofacial (Multidisciplinary) Teams
Cooper HK. Crippled children? Am J Ortho & Oral Surg. 28:35-40, 1942
Cooper HK. Integration of services in the treatment of cleft lip and palate. J Am Dent Assoc. 47:27-35, 1953.
IOM & NRC. Improving access to oral health care for vulnerable and underserved populations. Washington DC:The National Academies Press, pp 114-115, 2011.
Fox LM, Stone PA. Examining the team process: developing and sustaining effective craniofacial team care. In: Cleft Lip and Palate (S Berkowitz, editor), Berlin;Springer-Verlag, 885-896, 2013.
Fundament research investments provides fuel for craniofacial biology in post-genomic era
Examples of Research Opportunities in Craniofacial Biology
Predications of patients in terms of repair, wound healing, and/or regeneration (phenomics: as genotype connects with phenotype)
Advances in osseoinduction, osseointegration, and future growth patterns (e.g. “Does lip repair affect midface growth? Speech?”)
Gene Therapy (e.g. saliva production with gland regeneration) Cell Therapy (e.g. immunomodulation, drug delivery, tissue and organ
regeneration) Protein Therapy (e.g. X-linked ectodermal dysplasia using protein
ectodysplasin A to rescue clinical EDX phenotype) Cell, Tissue & Organ Regeneration (Biomaterials) Advances towards understanding genotype/phenotype relationships
(Phenomics) and drug/genotype interactions (pharmacogenomics) Quantitative and Systems Biological approaches Innovations for digital 3-D imaging & impressions, speech & hearing
Craniofacial-Oral-Dental Genomics! Will Dentistry Ride the Wave or Watch From the
Beach? Now is the time!
A call for increased education in genetics for dental health professionals. Collins & Tabak, 2004 JDE
Genetics and its implications for clinical practice and
education. Report of Panel 3 of the Macy Study. Genco, Tabak, Tedesco et al, 2008 JDE
A view of the future: dentistry and oral health in
America. Garcia & Tabak, 2009 JADA
Larry Tabak and Francis Collins A call for increased education in genetics for dental health
professionals. Collins & Tabak, 2004 JDE
Dr. Paul Tessier A French Surgeon who created a major transformation of craniofacial surgery; consulted for NIDCR in 1960s-1980s; provided training for many craniofacial surgeons such as Dr. Henry Kawamoto; close friends with Drs. Sam Pruzansky and John Converse
One of thousands of innovative clinicians
Calls To Action for “Personalized Oral Health” (2012-2014) Personalized Medicine: Will Dentistry Ride the Wave or Watch from the Beach? Kornman & Duff, 2012 JDR Personalized Oral Health Care: Providing “ –omic” Answers to Oral Health Queries. Glick, 2012 JADA Evolution of the Scientific Basis for Dentistry and its Impact on Dental Education: Past, Present, and Future. Slavkin, 2012 JDE Patient Stratification for Preventive Care in Dentistry. Giannobile, Braun, Caplis, et al. 2013 JDR Personalized Medicine Enters Dentistry: What Might This Mean for Clinical Practice? Giannobile, Kornman & Williams. 2013 JADA Revising the scope of practice for oral health professionals in health care: Enter Genomics. The Santa Fe Group (Primary Author Slavkin). 2014 JADA From phenotype to genotype: enter genomics and transformation of health care. Slavkin. 2014 J Dent Res
Expanding the foundation for personalized medicine: implications and challenges for dentistry (Garcia, Kuska
& Somerman, 2013 in JDR “Clinical Reviews in Oral Biology & Medicine 92(suppl 1):3-10s)
Personalized health care aims to individualize care based on a person’s unique genetic (genotype), environmental, and clinical profile (phenotype)
The completion of the Human Genome Project (2004), and cost-effective whole genome-wide sequencing methods and bioinformatics (2013), now enable clinicians to formulate decisions based upon the patient’s genotype and phenotype (e.g. risk assessment, diagnosis, treatment, prognosis)
Now is the time for oral health professionals to prepare for the arrival of personalized health care
Strategic Plan 2014-2019 “Enable Precise and Personalized Oral Health Care”
Martha Somerman DDS, PhD. Director, NIDCR, NIH
Science fuels engine of technology & informs
clinical health care (21st Century)
Post-Genomic Era, Stem Cells, Systems Biology, Nanotechnology “Live Longer, Live Better” (Prevention & Behavioral Sciences) Non-Invasive Imaging (functional MRI, 3-D imaging), Biomedical Engineering Biomimetics & Regenerative Medicine/Dentistry (cells, tissues, organs) Major Revisions of Health Professional Education Multidisciplinary “Team” Primary Health Care
Types of Cl/CP (in California 1:500 live births)
The burden of craniofacial conditions cause $95.9 billion per year in medical and wage/household work costs (1999 dollars). A baby is born every hour with CL/CP in USA, every minute world-wide, and often
requires surgery, speech, hearing, learning, orthodontics, dental, feeding needs, social services & psychosocial health care needs
Human genetics very successful at explaining diseases caused by single
gene mutation (Mendelian Inheritance)
Phenotype
Genotype
Environment
PHENOTYPE + GENOTYPE from single nucleotide polymorphisms to patient,
family & population craniofacial phenotypes Phenomics Genomics
Cleft lip and/or Cleft palate Male vs female Isolated and/or Syndromic
TGFalpha, RARA, IRF6 and Other Gene Networks (e,g, BMPs, TGF-betas, Wnts, Shh)
Examples of the Regulatory Genes that Control Craniofacial-Oral-
Dental Morphogenesis •Anhydrotic Ectodermal Dysplasia: TNF-alpha ligand and receptor genes
•A Novel Oligodontia: PAX9 transcription factor gene
•Cleidocranial Dysplasia (supernumerary teeth): CBFA-1 transcription factor gene
•Rieger Syndrome (tooth number, size and shape): PitX2 transcription factor genes
• 700 genes identified in mice and 200 in humans (see Inborn Errors of Development)
Phenotype of the X-linked Anhidrotic Ectodermal Dysplasia (ED) child
Can we correct single gene mutations?
X-linked Anydrotic Ectodermal Dysplasia
Human defects include sweat and lacrimal glands, hair, nails and teeth
Mouse animal models Dog animal models Define and measure
clinical phenotype features
Therapeutic Strategies Inject TNF-alpha (EDA)
during pregnancy Inject TNF-alpha (EDA) after
birth “Proof of Principle” FDA approvals Public/private partnerships First patient injected with
ED1200 protein in 2013; with clinical trial in progress
WHAT IS EDA1200? It is a fusion protein which combines a portion of
the EDA1 protein (which, in XLHED patients, is not produced correctly) with a portion of an antibody molecule.
EDA1200 is called ectodysplasin A or EDA. In ‘replacement therapy’ clinical studies EDA1200 rescues clinical mutant phenotype in mice and dogs.
In dog studies, ‘replacement therapy’ with EDA1200 two days after birth was most effective to eliminate mutant phenotype. If two weeks after birth, there was no benefit.
Permanent correction of an inherited ectodermal dysplasia with recombinant EDA (TNF-alpha
receptors) Gaide & Schneider Nature Medicine 9:614, 2004
X-linked hypohidrotic ectodermal dysplasia Absent or deficient hair, teeth and sweat glands The mouse strain Tabby shares phenotypic
characteristics with human EDA Treat pregnant Tabby with recombinant form of
EDA1, that crosses the placenta, and it “rescues” the phenotype in all offspring
The first example of a developmental defect that can be permanently corrected
Ectodysplasin-A1 can rescue hair and tooth growth, and sweat gland
development in Tabby mice (Oliver Gaide, 2009) & dogs (Margaret Casal)
Mutations in ADA-A1 cause ectodermal dyspasia in mice, dogs and humans
EDA splice isoforms are EDA-A1 and EDA-A2; they both bind to EDAR and XEDAR (receptors) and promote transcription
EDA-A1 used in gene and protein therapy to administer to mammals (mice and dogs) to rescue genetic defects by producing “normal” phenotype (hair, sweat glands and teeth)
2001-2009: first time a genetic defect was rescued and produced “normal” clinical phenotype
In utero exposure to recombinant FcEDA1 results in complete reversion of the Tabby clinical phenotype.
FROM DARWIN TO CLINICAL TRIALS 1875 - 2014
1990, Jonathan Zonana and Juha Kere discovered XLHED [X-linked hypohidrotic (anhydrotic) ectodermal dysplasia].
2000-2009, Oliver Gaide and Pascal Schneider identified ED1200 protein and showed that this protein rescued mutant mice with HED.
2006-2009, Margaret Casal rescued HED in dogs 2010, FDA approval for EDIMER COMPANY to begin
‘replacement therapy’ clinical trials with the National Foundation Ectodermal Dysplasia
2012-2013 Studies to better define and quantitate phenotypes 2013 First ED infant injected with ED 1200
Key References: http://www.genecards.org (2013) Gaide and Schneider (2003) Nature Medicine 9:614-618 Casal et al (2007) American Journal Human Genetics 81:1050-
1056. Slavkin, H.C. (2009) What the future holds for ectodermal
dysplasias: future research and treatment directions. Amer Journal Medical Genetics. Part A 9999:1-4.
Jones et al (2013) Characterization of X-linked hypohidrotic ectodermal dysplasia (XL-HED) hair and sweat gland phenotypes using phototrichogram analysis and live confocal imaging. Amer Journal Medical Genetics Part A
National Foundation for Ectodermal Dyslasia (see www.nfed.org and [email protected])
Tissue Engineering Applications for Challenges of Craniofacial-Oral-Dental Birth Defects, Head and Neck Trauma, and Head and Neck Cancers
Mesenchymal Stem Cells
Robert Langer MIT
Biomimetic Approach for Nose Replacement: Stem Cells, Scaffolds, Tissue Engineering and Biomaterials
Biomimetic Solutions for Nasal Carcinoma
Stem cell-mediated Root/Perio-complex regeneration
Porcelain Crown
Dental implant
Bio-root implant
Design and Fabricate Human Roots Using Stem Cells
Songtao Shi 2006
George Washington’s false teeth were crafted from gold, ivory, lead, human and animal teeth in 18th century
Possibilities for tooth regeneration in 21st century?
Biomimetic Opportunities Tooth, muscle, cartilage, bone and nerve
regeneration Stem cells and tissue/organ engineering - - -soft and
hard tissues (birth defects? Bone augmentation?) Improve dental & medical implant technology Understand soft and hard tissue inflammation and
wound healing processes Antimicrobial resistance and discovery of new
pathogens (microbial genomics) Innovative diagnostics (saliva and bioimaging) Pharmacogenomics to design “personal”
therapeutics
Science is the fuel that drives the engine of technology and informs
clinical health care Stem cells
Nanobiotechnology
Haptics and related informatics
Synthetic biology
Biomimetics
HapMaps and SNPs (bioinformatics)
Systems Biology (e.g.“Diseasome”)
…ACGTATTGCTAATCGATTCGGCAT…
Genetic Code=Triplets or Codons (CGG, ATA)
Human Genomic Math: 21,000 genes & 19,000 pseudogenes
Human Genetic Variations, and Variation in DNA Sequences
(less than 0.1% of Human Genome) a att g g aag c a aat g a cat c a cag c a ggt c a gag a a aaa g g gtt g a gcg g c agg c a ccc ag agt a g tag g t ctt t g gca t t agg a g ctt g a gcc c a gac g g ccc t a gca g g gac c c cag cg ccc g a gag a c cat g c aga g g tcg c c tct g g aaa a g gcc a g cgt t g tct c c aaa c t ttt tt tca g c tgg a c cag a c caa t t ttg a g gaa a g gat a c aga c a gcg c c tgg a a ttg t c aga ca tat a c caa a t ccc t t ctg t t gat t c tgc t g aca a t cta t c tga a a aat t g gaa a g aga at ggg a t aga g a gct g g ctt c a aag a a aaa t c cta a a ctc a t taa t g ccc t t cgg c g atg tt ttt t c tgg a g att t a tgt t c tat g g aat c t ttt t a tat t t agg g g aag t c acc a a agc ag tac a g cct c t ctt a c tgg g a aga a t cat a g ctt c c tat g a ccc g g ata a c aag g a gga ac gct c t atc g c gat t t atc t a ggc a t agg c t tat g c ctt c t ctt t a ttg t g agg a c act gc tcc t a cac c c agc c a ttt t t ggc c t tca t c aca t t gga a t gca g a tga g a ata g c tat gt tta g t ttg a t tta t a aga a g act t t aaa g c tgt c a agc c g tgt t c tag a t aaa a t aag ta ttg g a caa c t tgt t a gtc t c ctt t c caa c a acc t g aac a a att t g atg a a gga c t tgc at tgg c a cat t t cgt g t gga t c gct c c ttt g c aag t g gca c t cct c a tgg g g cta a t ctg gg agt t g tta c a ggc g t ctg c c ttc t g tgg a c ttg g t ttc c t gat a g tcc t t gcc c t ttt tc agg c t ggg c t agg g a gaa t g atg a t gaa g t aca g a gat c a gag a g ctg g g aag a t cag tg aaa g a ctt g t gat t a cct c a gaa a t gat t g aaa a t atc c a atc t g tta a g gca t a ctg ct ggg a a gaa g c aat g g aaa a a atg a t tga a a act t a aga c a aac a g aac t g aaa c t gac tc gga a g gca g c cta t g tga g a tac t t caa t a gct c a gcc t t ctt c t tct c a ggg t t ctt tg tgg t g ttt t t atc t g tgc t t ccc t a tgc a c taa t c aaa g g aat c a tcc t c cgg a a aat at tca c c acc a t ctc a t tct g c att g t tct g c gca t g gcg g t cac t c ggc a a ttt c c ctg gg ctg t a caa a c atg g t atg a c tct c t tgg a g caa t a aac a a aat a c agg a t ttc t t aca aa agc a a gaa t a taa g a cat t g gaa t a taa c t taa c g act a c aga a g tag t g atg g a gaa tg taa c a gcc t t ctg g g agg a g gga t t tgg g g aat t a ttt g a gaa a g caa a a caa a a caa ta aca a t aga a a aac t t cta a t ggt g a tga c a gcc t c ttc t t cag t a att t c tca c t tct tg gta c t cct g t cct g a aag a t att a a ttt c a aga t a gaa a g agg a c agt t g ttg g c ggt tg ctg g a tcc a c tgg a g cag g c aag a c ttc a c ttc t a atg a t gat t a tgg g a gaa c t gga gc ctt c a gag g g taa a a tta a g cac a g tgg a a gaa t t tca t t ctg t t ctc a g ttt t c ctg ga tta t g cct g g cac c a tta a a gaa a a tat c a tC TTt ggt g t ttc c t atg a t gaa t a tagt aca g a agc g t cat c a aag c a tgc c a act a g aag a g gac a t ctc c a agt t t gca g a gaa ag aca a t ata g t tct t g gag a a ggt g g aat c a cac t g agt g g agg t c aac g a gca a g aat t
agaatttca at[T/C]gt aagaggaca
3.2 billion letters of human DNA encoded within 21,009 genes 1 Base per 1,000 Shows Single Nucleotide Polymorphism
Slavkin Birth of a Discipline: Craniofacial Biology, Aegis Communications 2012
Human Biome = Genome + Mitochondrial DNA + Microbiome
The Decreasing Cost of Genotype Information
Lu JT et al. N Engl J Med 2014;371:593-596.
NextSeq 500 Desktop Sequencer (from Illumina, San Diego)
• Faster (complete genome 8-12 hrs)
• Cheaper ($1,000 per human genome)
• Smarter (precise, efficient, accurate)
• DNA and RNA sequencing
• FDA approved in late 2013
• In 2014, now utilized in inherited disease
detection, genetic variance and risk assessments, stratification of patients within large populations, and cancer diagnostics for treatment/chemotherapy selections
PHENOTYPE + GENOTYPE from single nucleotide polymorphisms to patient,
family & population phenotypes Phenomics Genomics
Systems Biology & Phenomics are Transforming How We Understand, Diagnosis, Treatment & Prognosis for Craniofacial-Oral-Dental Diseases and Disorders
The Next Frontier: Changing & Emerging Opportunities
The Next Ten Years •Science-Based Health Care •Major Revisions in Professional Health Care Education •Advocacy For Health Promotion, Risk Assessment & Disease Prevention •Increased Cost Effectiveness & Clinical Efficacy •Human Genome-Wide Scans for $1,000 per person •Cellular, Molecular and Tissue and Organ Engineering •Virtual Surgery and Nanoinstrumentation •Bioimaging •Emphasis on Diagnostics, Therapeutics & Rehabilitation of “Aging Populations” •Access to Quality and Comprehensive Health Care for all People and Reduce Costs in USA and beyond
“Knowing is not enough; we must apply.
Willing is not enough; we must do.” Goethe
Top Related