1
Coordination of swarming motility, biosurfactant synthesis, and 1
biofilm matrix exopolysaccharides production in Pseudomonas 2
aeruginosa 3
4
Shiwei Wanga, Shan Yu a, Zhenyin Zhanga, Qing Weia, Lu Yana, Guomin Aia, Hongsheng 5
Liub, Luyan Z. Maa# 6
State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese 7
Academy of Sciences, Beijing 100101, Chinaa; 8
College of Life Sciences, Liaoning University, Shenyang, 110136, Chinab 9
10
Running head: Coordination of swarming motility and polysaccharides 11
12
#Corresponding author. Present address: 13
State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese 14
Academy of Sciences, Beijing 100101, China. Tel: 86-10-64807437; Fax: 15
86-10-64806101. E-mail: [email protected] 16
17
18
19
20
21
AEM Accepts, published online ahead of print on 29 August 2014Appl. Environ. Microbiol. doi:10.1128/AEM.01237-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.
2
ABSTRACT 22
Biofilm formation is a complex process with many factors involved. Bacterial swarming 23
motility and exopolysaccharides both contribute to biofilm formation, yet it is unclear 24
how bacteria coordinate the swarming motility and the production of exopolysaccharides. 25
Psl and Pel are two key biofilm matrix exopolysaccharides in Pseudomonas aeruginosa. 26
This opportunistic pathogen has three types of motilities including swimming, twitching, 27
and swarming. Here we demonstrated that elevated Psl and/or Pel production reduced 28
swarming motility of P. aeruginosa, but had little effect on swimming and twitching. The 29
reduction was due to decreased rhamnolipids production with no relation to the 30
transcription of rhlAB, two key genes involved in biosynthesis of rhamnolipids. 31
Rhamnolipids negative mutants rhlR and rhlAB synthesized more Psl, whereas 32
exopolysaccharide-deficient strains exhibited hyper-swarming phenotype. These results 33
suggested that competition for common sugar precursors catalyzed by AlgC could be a 34
tactic for P. aeruginosa to balance the synthesis of exopolysaccharides and rhamnolipids 35
and to control bacterial motilities and biofilm formation inversely, because the 36
biosynthesis of rhamnolipids, Psl, and Pel all requires AlgC to provide the sugar 37
precursors and an additional algC enhances the biosynthesis of Psl and rhamnolipids. In 38
addition, our data indicated that the increasing of RhlI/RhlR expression attenuated Psl 39
production. This implied that the quorum sensing signals could regulate 40
exopolysaccharides biosynthesis indirectly in bacterial communities. In summary, this 41
study represents a mechanism that bacteria utilize to co-ordinate swarming motility, the 42
synthesis of biosurfactant, and the production of biofilm matrix exopolysaccharides, 43
which is critical for biofilm formation and bacterial survival in environment. 44
3
45
INTRODUCTION 46
Pseudomonas aeruginosa is a ubiquitous environmental microorganism. This 47
Gram-negative bacterium is also an opportunistic pathogen that can infect the 48
immunocompromised individuals suffering from cystic fibrosis (CF), cancer, severe burn 49
wound, and AIDS. P. aeruginosa causes severe nosocomial infections due to its capacity 50
to form biofilms on medical devices and in the lungs of immunocompromised patients (1, 51
2). Thus it becomes an important model organism for the study of biofilm. Bacterial 52
biofilms are surface-associated and multicellular-structured communities of 53
microorganisms. Biofilm formation is a complex process that involves many factors such 54
as the production of extracellular polymeric substances, quorum sensing (QS) signals, 55
and bacterial motilities. However, how bacteria coordinate these multiple factors remains 56
elusive. 57
58
Exopolysaccharide is an important biofilm matrix component. Studies have shown that 59
the production of exopolysaccharides impacts the formation of biofilm (3-5). In P. 60
aeruginosa, Psl and Pel are two major exopolysaccharides that serve as biofilm matrix 61
components (4, 6-8). Psl is a repeating pentasaccharide containing D-mannose, D-glucose 62
and L-rhamnose and is an essential matrix component for P. aeruginosa to initiate biofilm 63
and maintain biofilm structure (3, 4, 8, 9). Loss of Psl production greatly attenuates the 64
biofilm formation of P. aeruginosa, yet enhanced Psl production results in a 65
hyper-biofilm with many mushroom-like microcolonies (3). In addition, Psl can also 66
function as a signal to stimulate the biofilm formation of P. aeruginosa (10). Pel is a 67
4
glucose-rich exopolysaccharide that promotes bacterial cell-cell aggregation and is 68
required for the formation of pellicles at the air-liquid interface of standing cultures (5-7). 69
Ma et al. (11) has reported that the biosynthesis of Psl and Pel both require AlgC, a 70
bifunctional enzyme with both phosphomannomutase and phosphoglucomutase activities, 71
which provides the common sugar precursors mannose-1-phosphate (Man-1-P) and 72
glucose-1-phosphate (Glc-1-P). Glc-1-P is shunt into distinct metabolic pathway to 73
synthesize more immediate precursors, UDP-D-Glc and TDP-L-Rha for the biosynthesis 74
of Psl and UDP-D-Glc for the biosynthesis of Pel (9, 12, 13). It was suggested that there 75
was a competition for common sugar precursors between the biosynthesis pathways of 76
Psl and Pel according to the phenomena that induction of Pel resulted in a reduction of 77
Psl levels at post-transcriptional level (11). 78
79
Bacterial motilities also contribute to the biofilm formation and architecture. P. 80
aeruginosa has at least three types of motilities, including flagella-driven swimming, 81
Type-IV Pili (T4P)-mediated twitching along surfaces, and swarming on semisolid 82
surfaces. Flagella and T4P both contribute to the initial attachment of P. aeruginosa, the 83
first step in biofilm formation (14). Shrout et al. (15) showed that swarming motility 84
affects the biofilm architecture. Hyper-swarming motility results in a flat and uniform 85
biofilm, while lower swarming motility leads to bacterial aggregates and the formation of 86
microcolonies. Swarming motility is a result of complex multi-cellular activity that 87
requires flagella and T4P as well as the presence of biosurfactants (16-18). The 88
biosurfactant produced by P. aeruginosa is mainly rhamnolipids (RL), which contains 89
mono-rhamnolipids (mono-RL), di-rhamnolipids (di-RL) and 3-(3-hydroxyalkanoyloxy) 90
5
alkanoic acids (HAA) (19, 20). The biosynthesis of RL is a sequential process. The RhlA 91
(acyltransferase) is involved in the synthesis of HAA (19, 21). The rhamnosyl transferase, 92
RhlB catalyzes the transfer of TDP-L-Rha to a molecular of HAA to form a mono-RL. 93
The second rhamnosyltransferase, RhlC sequentially transfers the rhamnosyl group to 94
mono-RL to form di-RL (22). The transcription of rhlAB operon and rhlC are both 95
regulated by the RhlI/RhlR QS system (23, 24). Deletion of either rhlI or rhlR results in 96
the loss of RL production. The biosynthesis of RL also requires AlgC because TDP-L-Rha 97
is converted from the sugar precursor Glc-1-P, which is catalyzed by AlgC (25). 98
99
It has been known that the concentration of intracellular second messenger 100
cyclic-di-GMP (c-di-GMP) can regulate the production of exopolysaccharide and 101
bacterial motilities. High level of intracellular c-di-GMP reduces motilities and elevates 102
the biosynthesis of exopolysaccharides including Psl and Pel. In contrast, low level of 103
c-di-GMP increases motilities and reduces exopolysaccharides production. The bacterial 104
motilities regulated by c-di-GMP usually affect the activities of flagellum and T4P (10, 105
26-28). However, it is unclear whether there are any c-di-GMP-independent mechanisms 106
to balance the motilities and exopolysaccharides production. Recently, Wang et al. (29) 107
reported that bacterial migration mediated by T4P led to the formation of a Psl 108
polysaccharide fiber matrix, which plays a significant role to ensure efficient biofilm 109
formation, especially at high shear flow conditions. In the present study, we showed that 110
the production of exopolysaccharides affected the swarming motility of P. aeruginosa by 111
controlling RL production. At the same time, our data also implied a plausible indirect 112
way for P. aeruginosa to coordinate the production of exopolysaccharides via the QS 113
6
system. 114
115
MATERIAL AND METHODS 116
Bacterial strains and media. P. aeruginosa strains used in the study are shown in Table 117
1. Unless otherwise indicated, P. aeruginosa was typically cultured in Luria-Bertani 118
medium without sodium chloride (LBNS). For rhamnolipids extraction, rhlAB-lacZ 119
transcriptional analysis, and Psl polysaccharide preparation, corresponding strains were 120
grown in nutrient broth (8 g/L of Oxoid Nutrient Broth and 5 g/L of D-glucose) at 37°C. 121
122
Motility assay. Twitching (1.2% agar) and swimming (0.3% agar) motility assay were 123
performed as previously described by using LBNS or Jensen’s media (30, 31). Swarming 124
motility assay were performed as previously described by using Nutrient Broth with 0.5% 125
Difco Bacto agar and different concentrations of arabinose. After inoculation, swarming 126
plates were incubated for another 12-24 h at 37°C until swarming zones formed. The 127
images were captured by Chemidoc XRS+, MAGELAB (Bio-Rad, USA). The diameter 128
of swarming zone was calculated by average of the longest and shortest diameter of 129
corresponding swarming colony. At least three replicates were measured for each sample. 130
131
Construction of transcriptional fusion strains, rhlAB deletion mutant and rhlRI 132
inducible strains. For transcriptional fusion strains construction, a 432-bp DNA 133
fragment containing the promoter of the rhlAB operon was amplified from the genomic 134
DNA of PAO1 by PCR using the primer pair PrhlAF1 (italic letters denote restriction 135
enzyme sites) (5’-GGGGTACCAAAGCCTGACGCCAGAGC-3’) and PrhlAR1 136
7
(5’-CGGGATCCTTCACACCTCCCAAAAATTTTC-3’). The PCR product was digested 137
with Kpn I and BamH I, and then ligated to Kpn I/BamH I-cut mini-CTX-lacZ vector to 138
generate the plasmid pSW4 (a fusion of rhlAB with lacZ). pSW4 was conjugated into the 139
chromosomal attB sites of the P. aeruginosa strains as described previously (32). For 140
rhlAB in-frame deletion, the following PCR primers were used (italic letters denote 141
restriction enzyme sites): primer 1 (F1-del-rhlAB, 142
5’-CCCAAGCTTGCACGCTGAGCAAATTGTTC-3’), primer 2 (R1-del-rhlAB, 143
5’-GAGTATCCATATGAACGGTGCTGGCATAACAG-3’), primer 3 (F2-del-rhlAB, 144
5’-GAGTATCCATATGGAACGGCAGACAAGTAAC-3’), and primer 4 (R2-del-rhlAB, 145
5’-CCGGAATTCTCCAATACCACCAACCTG-3’). Deletion alleles were cloned into 146
pEX18Gm vector and the resulting plasmid was used to knock out rhlAB by allelic 147
exchange (33). For rhlRI inducible strains construction, a pair of primer were used (italic 148
letters denote restriction enzyme sites): primer 5 149
(CTAGTCTAGAATGAGGAATGACGGAGGC) and primer 6 150
(CCCAAGCTTTCACACCGCCATCGACAG) to amplify the 1.5 kb rhlRI fragment. The 151
rhlRI were cloned into pHerd20T vector to get PBAD-rhlRI Plasmid. The plasmid was 152
transformed into PAO1 and its isogenic ΔrhlR mutant respectively to obtain the 153
rhlRI-inducible strains PAO/rhlRI and ΔrhlR/rhlRI. 154
155
β-galactosidase assays. β-galactosidase activity was quantitatively assayed as previously 156
described with modifications (34). P. aeruginosa strains were grown in nutrient broth 157
with or without arabinose at 37°C to middle-log phase (OD600 ≈0.5). One milliliter 158
culture aliquots were re-suspended in 200 μL Z-buffer and subjected to three 159
8
frozen/thawed cycles. Cell lysates were assayed for β-galactosidase activity, and also for 160
total protein concentration using a BCA assay kit (Pierce, USA). All β-galactosidase 161
activity units (Miller Unit) were normalized by total protein per mL aliquots. All samples 162
were done in triplicates. 163
164
Biofilm growth and microscopy image acquisition. The air-liquid interface biofilm 165
growth was referred to the previous method (29). Fluorescent images were acquired by an 166
Olympus FV1000 (Olympus, Tokyo, Japan). Images were obtained using 63×/1.3 167
objective. A Fluoview image browser generated the 3D images and optical Z-sections. 168
CLSM-captured images were subjected to quantitative image analysis using COMSTAT 169
software as previously described (35). 170
171
Rhamnolipids extraction, quantitation and TLC detection. After 2-day growth in 172
nutrient broth with or without arabinose, rhamnolipids was extracted as previously 173
described (36). Briefly, cells were removed from the culture by centrifugation (10 min at 174
6,000×g), and the supernatant was acidified with concentrated HCl until it reached pH 2.0. 175
Equal volume of chloroform-methanol mixture was added to the acidified supernatant 176
and then the sample was vortexed for 1 min. The lower organic phase was collected and 177
evaporated to dryness, and then re-suspended in 3 mL methanol. The rhamnolipids in the 178
extract were measured by using the anthrone colorimetric assay and the concentration 179
was obtained by using a rhamnose standard curve (21). The rhamnolipids produced by 180
different strains were normalized to the level of rhamnolipids obtained from PAO1. The 181
samples were also analyzed by TLC on silica gel G plates with a mobile phase consisting 182
9
of 80% chloroform, 18% methanol and 2% acetic acid, and rhamnolipids were examined 183
with a 25 mg/mL solution of α–naphthol. Rhamnolipids standards were obtained from 184
Huzhou Zijin Co. (China) (the main m/z peaks of mono-RL and di-RL are 503 and 649 185
respectively). 186
187
LC/MS analysis of rhamnolipids. Quantification comparison of mono-RL (Rha-C10-C10) 188
and di-RL (Rha-Rha-C10-C10) was furthermore performed by using liquid 189
chromatograph/mass spectroscopy as previously described with modification (19, 37). 190
The analyses were performed with triple-quadrupole mass spectrometer Agilent 191
1260/6460 LC/MSD (Agilent Technologies USA, Santa Clara) using electrospray 192
ionization in negative mode. The 3,000-fold diluted samples (5 uL) were introduced by 193
HPLC with an 100 mm×2.1 mm Agilent ZORBAX SB-Aq reverse phase column 194
(particle size 5 μm). Runs were carried out in 5 mM HCOONH4, using a multi-step 195
gradient of acetonitrile, 0-3 min (20%), 3-20 min (20%-90% linear gradient), 20-26 min 196
(90%), 26-28 min (90%-20%), and 28-40 min (20%). The HPLC flow rate was 0.3 197
mL/min. The MS-conditions were: Nebulizer gas (N2) 35 psi, dry gas (N2) 12 L/min, dry 198
temperature 350°C and capillary voltage 4,000 V. The scanning mass range was from 200 199
to 900 Da. Mono-RL (m/z=503) and di-RL (m/z=649) relative abundance of different 200
samples were respectively normalized to the level of PAO1. 201
202
Drop collapse assay. Drop collapse assays were performed as previously described with 203
minor modification (19, 38). Briefly, after two days incubation at 37°C in liquid nutrient 204
broth medium with or without arabinose, culture samples were centrifuged at 6,000×g for 205
10
10 min to remove the bacteria. The supernatant was filtered through a 0.22-μm membrane 206
and serially diluted with Milli-Q dH2O. Aliquots (10 μL) of the diluted supernatant were 207
spotted on the lid surface of a Nunc 96-well plate to detect bead formation. Samples that 208
did not form a bead were defined as having drop collapse activity. 209
210
Immunoblot analysis to detect Psl polysaccharide and PelC protein. Psl 211
polysaccharide was extracted from 5 OD overnight culture. Psl extracts were detected by 212
immunoblotting with anti-Psl serum as described previously (9). The induction of Pel was 213
assayed by immunoblotting with anti-PelC serum with modifications (5). Briefly, one 214
milliliter of culture (OD600 of 0.5) was harvested and re-suspended in 200 μL PBS. After 215
mixing with an equal volume of 2× Laemmli buffer and boiled for 5 min, protein 216
concentration was measured using the BCA assay (Pierce, USA). Equal total protein 217
was loaded on PVDF membrane for Immunoblotting.. Psl and Pel polysaccharide were 218
relatively quantified according to the gray value calculation after dotblotting experiment 219
and normalized to corresponding reference strains. 220
221
RESULTS 222
Increased Psl and Pel production reduces swarming motility of P. aeruginosa 223
To investigate whether the production of Psl and/or Pel polysaccharides affects motility 224
of P. aeruginosa, we used several arabinose-inducible strains derived from P. aeruginosa 225
PAO1, in which the promoter of Psl and/or Pel gene operon was replaced by PBAD 226
promoter on chromosome (Table 1). Thus the production of Psl and/or Pel can be induced 227
by arabinose (the inducer). The induction of Psl/Pel was tested by immunoblotting and 228
11
1% arabinose displayed a maximum induction (Polysaccaride Psl and PelC were 229
increased approximately three to four-fold in addition of 1% arabinose )(11 and data not 230
shown). The swarming assay showed that increase of either Psl and/or Pel production 231
significantly reduced swarming ability (Fig. 1). Addition of arabinose from 0.005% to 232
0.5% (W/V) caused a gradual reduction of swarming zones in the three 233
polysaccharide-inducible strains, Psl-inducible strain WFPA801, Pel-inducible strain 234
WFPA831 as well as Psl and Pel double-inducible strain WFPA833. WFPA801 exhibited 235
more severe effect than WFPA831, as the swarming zone of WFPA801 was totally 236
abolished with 0.5% arabinose while WFPA831 still had a visible swarming zone at the 237
same condition (Fig. 1A). For wild type PAO1 strain, arabinose had little effect on its 238
swarming zone even at the concentration of 1% (Fig. 2B). Furthermore, 1% arabinose 239
had no impact on the motilities of negative control strains, ΔfliC strain (flagella-deficient 240
strain), ΔpilA (T4P-deficient strain) and ΔalgC strain (RL synthesis-deficient strain) (data 241
not shown). These results indicated that increase of Psl/Pel production reduced bacterial 242
swarming motility. Since swarming motility requires the presence of flagella and T4P 243
(16-18), we examined the effect of Psl and/or Pel production on flagella-mediated 244
swimming and T4P-driven twitching motilities. The results showed that swimming (Fig. 245
1B) and twitching (Fig. 1C) abilities of these three strains were similar at the condition 246
with 1% arabinose or 0% arabinose, suggesting that Psl/Pel production did not affect the 247
function of flagella and T4P. These results indicated that reduction of swarming ability by 248
Psl and/or Pel production may occur through a different mechanism other than 249
controlling the activities of flagella and T4P. 250
251
12
Overproduction of Psl and/or Pel decreases rhamnolipids production. 252
Swarming motility requires the presence of biosurfactant in addition to flagellum and T4P 253
(16-18). Thus we hypothesized that the effect of Psl/Pel production on swarming may be 254
through the control of biosurfactant synthesis. Surface tension of liquid drops correlates 255
with biosurfactant concentration (38). Thus drop collapse on a hydrophobic surface 256
provides a quick way to estimate the biosurfactant concentration of the fermentation 257
broth. In the assay, culture supernatants were serially diluted with water and the drops 258
containing higher amounts of biosurfactants would require more dilution to reach the 259
point to prevent the collapse. We utilized this assay to examine the culture supernatant of 260
wild-type strain (PAO1) and Psl/Pel-inducible strains grown with and without arabinose. 261
The culture supernatant of PAO1 showed a similar pattern of drop collapse in the 262
presence of 0% or 1% arabinose (Fig. 2A), suggesting that addition of arabinose did not 263
affect the drop collapse and that the concentrations of biosurfactant were similar in the 264
PAO1 cultures with/without arabinose. In contrast, the drop collapse of WFPA801 and 265
WFPA831 appeared different while comparing the cultures grown with and without 266
arabinose (Fig. 2A). Without arabinose, all the cultures exhibited similar drop collapse 267
patterns and their drop collapse was inhibited at eight-fold dilution. With 1% arabinose , 268
four-fold dilution did not lead to drop collapse of WFPA831 and even two-fold dilution 269
did not collapse the culture drop of WFPA801 (Fig. 2A). This result suggested that there 270
were less biosurfactants in Psl/Pel-overproduced condition (1% arabinose) than Psl/Pel 271
non-induced condition (0% arabinose). 272
273
To quantify the amount of biosurfactants, we extracted and compared the total RL from 274
13
cultures of three Psl/Pel-inducible strains grown with 0% or 1% arabinose. The 275
corresponding swarming zone of these strains was also shown under each corresponding 276
image (Fig. 2B). The wild type strain PAO1 showed similar swarming zone and RL 277
production in the presence of 0% or 1% arabinose (indicated by the number under the 278
corresponding images in Fig. 2B). In contrast, the swarming of the three inducible strains 279
was totally inhibited by 1% arabinose (Fig. 2B, compare the upper panel with the lower 280
panel). Consistently, the total amount of RL extracted from three inducible strains was 281
also significantly decreased with 1% arabinose (the lower panel in Fig. 2B). The total RL 282
in strain WFPA801, WFPA831, and WFPA833 were reduced to 48%, 65% and 46% 283
relative to the PAO1 level respectively. The results were consistent with the drop collapse 284
assay and indicated that elevated Psl/Pel production reduced the biosynthesis of RL. 285
286
RL produced by P. aeruginosa usually contains a mixture of mono-RL and di-RL (39). To 287
further investigate the effect of Psl/Pel on the RL production, we first used thin-layer 288
chromatography (TLC) to examine the total RL for separation of the mono-RL and 289
di-RL based on their different retention factors (Fig. 3A). The TLC results showed 290
mono-RL and di-RL remarkably reduced in the Psl-induced condition (WFPA801+1% 291
arabinose) as well as the Psl and Pel double-induced condition (WFPA833+1% arabinose) 292
(Fig. 3A). As for the Pel-inducible strain WFPA831, only mono-RL showed a visible 293
reduction with 1% arabinose (Fig. 3A). The corresponding RL extracts were also 294
quantified by LC/MS (Fig. 3B-E) and the results further confirmed our conclusion from 295
TLC analysis. The Rha-C10-C10 and Rha-Rha-C10-C10 were the main peaks of mono-RL 296
and di-RL (15, 19, 37). The corresponding quantification of the two peaks was shown in 297
14
Fig. 3B-E. The LC/MS results showed that there was a remarkable reduction compared to 298
PAO1 for the Rha-C10-C10 from three inducible strains with 1% arabinose (more than 299
50% reduction) (Fig. 3C). The Rha-Rha-C10-C10 from WFPA801 and WFPA833 also 300
showed 50% reduction compared to PAO1 with 1% arabinose, but WFPA831 only 301
showed 25% reduction at the same condition (Fig. 3E). Interestingly, the Rha-C10-C10 and 302
Rha-Rha-C10-C10 from three inducible strains grown without arabinose were increased in 303
different degrees compared to PAO1 (Fig. 3C and E). This was consistent with the results 304
of the total RL extract shown in the upper panel of Fig. 2B, in which RL of three 305
Pel/Pel-inducible strains without inducer exhibited approximately 30% increase 306
compared to PAO1 level . Taken together, our data indicateded that enhanced Psl or Pel 307
production reduced the synthesis of the biosurfactant RL, which could be the reason why 308
over-produced Psl/Pel decreased swarming motility of P. aeruginosa. 309
310
In order to know whether the reduction of rhamnolipids occurred at the gene 311
transcriptional level, we constructed PrhlAB-lacZ transcriptional fusion in wild type and the 312
Psl and/or Pel-inducible strains to detect the transcription of rhlAB operon. The 313
β-galactosidase analysis showed that the transcription of rhlAB was similar in all tested 314
strains regardless of the concentration of arabinose supplemented in cultures (Fig. 2B), 315
indicating that the production of Psl and Pel do not affect the transcription of rhlAB and 316
suggesting that RL reduction by polysaccharides occurs post-transcriptionally. 317
318
RL-deficient strains produced more Psl. 319
15
To investigate whether the production of RL impact the Psl synthesis, we examined two 320
RL-deficient strains, rhlR and rhlAB mutants. Both mutants lost the ability to synthesize 321
RL, thus cannot swarm (Fig. 4A). The detection of Psl by anti-Psl serum showed that the 322
two mutants both produced more Psl than PAO1 (Fig. 4A). This data indicated that 323
abolishing the RL synthesis in P. aeruginosa can increase Psl production. 324
325
Psl-negative strains had a hyper-swarming phenotype. 326
To test whether loss of Psl also affect swarming, we have used several Psl-negative 327
strains. Deletion of pslA, the first gene of psl operon, resulted in the loss of Psl production 328
(9). Thus we first tested the swarming of ΔpslA, which exhibited a hyper-swarming 329
phenotype. Its swarming was 2.4-fold larger than that of PAO1 (Fig. 4A). Consistently, 330
the total RL of ΔpslA had 20% increase compared to PAO1 (Fig. 4A). 331
332
Growth of P. aeruginosa in biofilms and chronic CF airway infections generates rugose 333
small-colony variants (RSCVs) (41). Both clinic- and in vitro-derived biofilm RSCVs 334
display increased production of the Pel and Psl polysaccharides and loss of motility due 335
to elevated cellular c-di-GMP level (41). To investigate whether the effect of 336
polysaccharide production on swarming holds true in RSCVs, we examined a RSCV 337
derived from a laboratory-grown biofilm of PAO1, MJK8 and its isogenic pel and psl 338
mutants (Table 1) (42). MJK8 and its pel or psl single deletion mutant could not swarm, 339
however pel and psl double mutant did recover the swarming to 70% of PAO1 level 340
(Fig. 4B). It is a remarkable change because the biosynthesis and activity of flagellum are 341
inhibited by high level of c-di-GMP in MJK8 (42). Strikingly, the total RL of 342
16
MJK8ΔpelΔpsl was more than PAO1, and similar to PAO1ΔpslA strain (Fig.4A). 343
Moreover, the total RL production of MJK8 were also similar to that of WFPA833 344
(PBAD-psl and PBAD-pel) with 1% arabinose (Fig. 2B, lower panel). These data indicated 345
the impact of Psl/Pel production on swarming and the biosynthesis of RL were not only 346
found in the artificial PBAD-induced system, it also occurred in physiologically relevant 347
polysaccharide overproducing strain. 348
349
Coordination between synthesis of exopolysaccharides and rhamnolipids is likely 350
mediated by competitions for common sugar precursors. 351
Over-produced Psl/Pel decreased the synthesis of RL, yet lacking of RL synthesis 352
increased the production of Psl. This phenomena was similar to the previous report about 353
the biosynthesis of Psl, alginate and lipopolysaccharide, which competed with each other 354
for the common sugar precursor Man-1-P converted by AlgC (11). It has been suggested 355
that the synthesis pathways of Psl and Pel compete for the sugar precursor Glc-1-P 356
catalyzed by AlgC (11). As the synthesis of rhamnolipids also requires AlgC to provide 357
the common sugar precursor Glc-1-P (25) and the above data indicated there was 358
coordination between the biosynthesis of Psl/Pel and RL, this suggested that there was 359
very likely a competition for common sugar precursors among the biosynthesis pathways 360
of RL, Psl, and Pel (Fig. 5A). Since AlgC is the only enzyme in P. aeruginosa to catalyze 361
the Glc-1-P for Psl, RL, and Pel, we assumed that an additional copy of algC expressed in 362
plasmid should increase the production of Psl and RL. To test this hypothesis, we 363
compared the production of Psl, RL, andthe swarming of PAO1 containing plasmid 364
pLPS188 with constitutively expressed algC(PAO1/algC) and PAO1 with vector 365
17
(PAO1/vector ). In support of the hypothesis, PAO1/algC showed a hyper-swarming 366
pattern and produced more RL and Psl than PAO1/vector (Fig. 5B-D). In summary, our 367
data suggested that the bio-synthesis of Psl, Pel and rhamnolipids shared the common 368
sugar precursors and led to the coordination between swarming motility and biosynthesis 369
of exopolysaccharide Psl and Pel. 370
371
Enhanced expression of RhlR/RhlI can decrease the Psl production. 372
RL production is strictly regulated by RhlR/RhlI QS system. Once RhlR binds the QS 373
signal molecule synthesized by RhlI, it activates the transcription of rhlAB to synthesize 374
RL. Based on the precursors competition theory proposed above (Fig. 5A), increasing RL 375
would reduce the Psl production if more common sugar precursors were used for the RL 376
biosynthesis. Then enhanced expression of RhlR/RhlI would decrease the synthesis of Psl. 377
To test this hypothesis, we constructed the PBAD-rhlRI by using pHerd20T as vector. The 378
PBAD-rhlRI plasmid was transformed into PAO1 and rhlR mutant respectively to obtain 379
two rhlRI-inducible strains PAO1/rhlRI and ΔrhlR/rhlRI. Psl synthesis of both strains 380
reduced gradually while the expression of rhlRI was induced by various concentration of 381
arabinose (from 0.2% to 1%) (Fig. 6B). The swarming zone (Fig. 6A) and RL production 382
(Fig.6B) were also increased accordingly. This data suggested that the RhlR/RhlI QS 383
system can influence the Psl production through the regulation of RL expression. The 384
results also confirmed that there was a competition for the common sugar precursors 385
between the biosynthesis pathway of Psl and RL, given that increasing of RL biosynthesis 386
reduced the production of Psl (Fig.6B) and vise versa (Fig.2B). 387
388
18
DISCUSSION 389
Exopolysaccharides and motility are significant contributing factors to the formation of 390
bacterial biofilms. Understanding how exopolysaccharides and motility cooperate to 391
shape the architecture of biofilm will shed lights on the development of strategies against 392
biofilm-related concerns, such as chronic and persistent infections. In this study, we 393
demonstrated that the production of exopolysaccharides Psl and Pel affected bacterial 394
swarming, but not swimming and twitching. This was accomplished by control of 395
rhamnolipids production . 396
397
Recently, it was discovered that Psl can also function as a signaling molecule to stimulate 398
diguanylate cyclases to produce more intracellular second messenger cyclic-di-GMP 399
(c-di-GMP) (10), which is known to regulate the production of polysaccharide and 400
bacterial motilities. Elevated intracellular concentrations of c-di-GMP reduced bacterial 401
motilities by affecting the activities of flagellum and T4P (10, 26-28). Our data showed 402
that the production of Psl and Pel had little impacts on bacterial swimming and twitching 403
motilities (Fig. 1B and C), indicating that activities of flagellum and T4P was not 404
inhibited. This also suggested that c-di-GMP had little contribution on the effect of Psl 405
and/or Pel on swarming motility and RL production. More evidences were come from the 406
results of MJK8. This RSCV strain has high level cellular c-di-GMP (42), even so, 407
delettion of psl and pel in MJK8 recovers its RL production and some swarming motility 408
(Fig. 4B). 409
410
We proposed that biosynthesis of Psl, Pel and rhamnolipids competes for common 411
19
sugar precursors. Psl is a repeating pentasaccharide containing D-Man, D-Glc and 412
L-rhamnose (9). The rhamnose and glucose precursor are both converted from Glc-1-P 413
synthesized by AlgC (Fig. 6A). D-Man is converted from Man-1-P (which is also 414
catalyzed by AlgC) and is shared by the biosynthesis pathways of Psl, alginate, and LPS. 415
We showed in this study that Psl production led to more severe inhibition on swarming 416
motility and RL synthesis than the glucose-rich exopolysaccharide Pel (Fig. 1-3). One 417
explanation for this phenomenon is that the synthesis of Psl may use more sugar 418
precursors catalyzed by AlgC than that of Pel. P. aeruginosa RL usually contains a 419
mixture of mono-RL and di-RL. Various RLs play different roles in swarming motility. 420
Mono-RL acts as wetting agents, di-RL promotes tendril formation and migration, and 421
they work together to form swarming pattern of P. aeruginosa (39). Our TLC and LC/MS 422
results indicated that Pel production had a similar decreasing effect on mono-RL as that 423
of Psl, yet had little effect on di-RL. This can be a fine tune for the ratio of mono-RL and 424
di-RL. RLs not only play critical roles in the biofilm formation of P. aeruginosa (43, 44), 425
but also serve as an important biosurfactant due to their wide applications in oil recovery, 426
cosmetic, and environmental protection, etc. (20). Thus, our results could also provide 427
potential strategies for industry to upgrade RL production. 428
429
Quorum-sensing (QS) circuits allow bacteria to coordinate their gene expression in a cell 430
density-dependent manner. P. aeruginosa employs three QS signaling systems 431
(LasR/LasI, RhlR/RhlI and PQS). So far, little is known about the involvement of QS in 432
the regulation of exopolysaccharides in P. aeruginosa. Our data suggested that the 433
RhlR/RhlI signaling system may indirectly control Psl and/or Pel production by 434
20
coordinating RL production. The synthesis of RL is regulated by the RhlR/RhlI system, 435
which is activated during the maturation stage of P. aeruginosa biofilm development (45). 436
It has been reported that little Psl is found in the center of the microcolony at the 437
maturation stage, which is associated with the preparation of future seeding dispersal (4). 438
The center of the microcolony is the micro-environment with the densest bacterial 439
population and the up-regulated RhlR/RhlI, which activates the synthesis of RL. 440
Increasing the synthesis of RL enhances swarming and may further reduce the production 441
of exopolysaccharide. This may be a strategy in which P. aeruginosa balances the 442
polysaccharide production and bacterial motility during biofilm development to allow 443
seeding dispersal to occur. Consistent with this scenario, the biofilm of a hyper-RL 444
producer yields an earlier seeding dispersal compared to the wild-type strain PAO1 (44). 445
446
Swarming is the fastest known bacterial mode of surface translocation and enables the 447
rapid colonization of a nutrient-rich environment and host tissues. In this study, we 448
revealed how P. aeruginosa coordinate the production of biofilm exopolysaccharides and 449
the swarming motility without affecting the flagella and T4P. This was accomplished by 450
competition for common sugar precursors between the biosynthesis pathway of 451
exopolysaccharides and the biosurfactant RL. Since RL synthesis in P. aeruginosa is 452
regulated by the QS signaling system and the reduction or increase of RL and RhlRI can 453
impact the production of exopolysaccharides, our data suggested a plausible strategy how 454
QS signals may regulate biofilm matrix exopolysaccharides and swarming motilities in 455
bacterial communities in a coordinating manner. 456
457
ACKNOWLEDGEMENTS 458
21
The authors thank Dr. Alan K Chang at Liaoning University, Dr. Di Wang at Institute of 459
Microbiology, Chinese Academy of Sciences for their contribution to the revision of the 460
manuscript and Dr. Matthew Parsek at University of Washington for providing the 461
anti-PelC serum and MJK8 strains. This work was supported by Chinese Academy of 462
Science grant KSCXZ-YW-BR-5 (L.M.) and National Natural Science Foundation of 463
China grant 31270177 (L.M.), National Basic Research Program of China (973 Program, 464
grant 2014CB846002)(L.M.). 465
466
REFERENCE 467
1. Costerton JW, Stewart PS, Greenberg EP. 1999. Bacterial biofilms: A common 468
cause of persistent infections. Science 284:1318-1322. 469
2. Wei Q, Ma L. 2013. Biofilm matrix and its regulation in Pseudomonas aeruginosa. 470
Int. J. Mol. Sci. 14:20983-21005. 471
3. Ma L-Y, Jackson K, Landry RM, Parsek MR, Wozniak DJ. 2006. Analysis of 472
Pseudomonas aeruginosa conditional Psl variants reveals roles for the Psl 473
polysaccharide in adhesion and maintaining biofilm structure postattachment. J. 474
Bacteriol. 188:8213-8221. 475
4. Ma L, Conover M, Lu H, Parsek MR, Bayles K, Wozniak DJ. 2009. Assembly 476
and development of the Pseudomonas aeruginosa biofilm matrix. PLoS Pathog. 477
5:e1000354. 478
5. Colvin KM, Irie Y, Tart CS, Urbano R, Whitney JC, Ryder C, Howell PL, 479
Wozniak DJ, Parsek MR. 2011. The Pel and Psl polysaccharides provide 480
Pseudomonas aeruginosa structural redundancy within the biofilm matrix. Environ. 481
22
Microbiol. 14:1913-1928. 482
6. Friedman L, Kolter R. 2004. Two genetic loci produce distinct carbohydrate-rich 483
structural components of the Pseudomonas aerguinosa biofilm matrix. J. Bacteriol. 484
186:4457-4465. 485
7. Friedman L, Kolter R. 2004. Genes involved in matrix formation in Pseudomonas 486
aeruginosa PA14 biofilms. Mol. Microbiol. 51:675-690. 487
8. Ma L, Wang S, Wang D, Parsek MR, Wozniak DJ 2012. The roles of biofilm 488
matrix polysaccharide Psl in mucoid Pseudomonas aeruginosa biofilms. FEMS 489
Immunol. Med. Micriol. 65:377-380. 490
9. Byrd MS, Sadovskaya I, Vinogradov E, Lu H, Sprinkle AB, Richardson SH, Ma 491
L, Ralston B, Parsek MR, Anderson EM, Lam JS, Wozniak DJ. 2009. Genetic 492
and biochemical analyses of the Pseudomonas aeruginosa Psl exopolysaccharide 493
reveal overlapping roles for polysaccharide synthesis enzymes in Psl and LPS 494
production. Mol. Microbiol. 73:622-638. 495
10. Irie Y, Borlee BR, O’Connor JR, Hill PJ, Harwood CS, Wozniak DJ, Parsek 496
MR. 2012. Self-produced exopolysaccharide is a signal that stimulates biofilm 497
formation in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. U. S. A. 498
109:20632-20636. 499
11. Ma L, Wang J, Wang S, Anderson EM, Lam JS, Parsek MR, Wozniak DJ. 2012. 500
Synthesis of multiple Pseudomonas aeruginosa biofilm matrix exopolysaccharides 501
is post-transcriptionally regulated. Environ. Microbiol. 14:1995-2005. 502
12. Rocchetta HL, Burrows LL, Lam JS. 1999. Genetics of O-Antigen biosynthesis in 503
Pseudomonas aeruginosa. Microbiol. Mol. Biol. Rev. 63:523-553. 504
23
13. Ghafoor A, Jordens Z, Rehm BHA. 2013. Role of PelF in Pel polysaccharide 505
biosynthesis in Pseudomonas aeruginosa. Appl. Environ. Microbiol. 79:2968-2978. 506
14. O'Toole GA, Kolter R. 1998. Flagellar and twitching motility are necessary for 507
Pseudomonas aeruginosa biofilm development. Mol. Microbiol. 30:295-304. 508
15. Shrout JD, Chopp DL, Just CL, Hentzer M, Givskov M, Parsek MR. 2006. The 509
impact of quorum sensing and swarming motility on Pseudomonas aeruginosa 510
biofilm formation is nutritionally conditional. Mol. Microbiol. 62:1264-1277. 511
16. Köhler T, Curty LK, Barja F, van Delden C, Pechère J-C. 2000. Swarming of 512
Pseudomonas aeruginosa is dependent on cell-to-cell signaling and requires flagella 513
and pili. J. Bacteriol. 182:5990-5996. 514
17. Burrows LL. 2012. Pseudomonas aeruginosa twitching motility: type IV pili in 515
action. Annu. Rev. Microbiol. 66:493-520. 516
18. Leech AJ, Mattick JS. 2006. Effect of site-specific mutations in different 517
phosphotransfer domains of the chemosensory protein ChpA on Pseudomonas 518
aeruginosa motility. J. Bacteriol. 188:8479-8486. 519
19. Déziel E, Lépine F, Milot S, Villemur R. 2003. rhlA is required for the production 520
of a novel biosurfactant promoting swarming motility in Pseudomonas aeruginosa: 521
3-(3-hydroxyalkanoyloxy)alkanoic acids (HAAs), the precursors of rhamnolipids. 522
Microbiology 149:2005-2013. 523
20. Soberón-Chávez G, Lépine F, Déziel E. 2005. Production of rhamnolipids by 524
Pseudomonas aeruginosa. Appl. Microbiol. and Biotechnol. 68:718-725. 525
21. Zhu K, Rock CO. 2008. RhlA converts β-hydroxyacyl-acyl carrier protein 526
intermediates in fatty acid synthesis to the β-hydroxydecanoyl-β-hydroxydecanoate 527
24
component of rhamnolipids in Pseudomonas aeruginosa. J. Bacteriol. 528
190:3147-3154. 529
22. Ochsner UA, Fiechter A, Reiser J. 1994. Isolation, characterization, and 530
expression in Escherichia coli of the Pseudomonas aeruginosa rhlAB genes 531
encoding a rhamnosyltransferase involved in rhamnolipid biosurfactant synthesis. J. 532
Biol. Chem. 269:19787-19795. 533
23. Ochsner UA, Reiser J. 1995. Autoinducer-mediated regulation of rhamnolipid 534
biosurfactant synthesis in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. U. S. A. 535
92:6424-6428. 536
24. Rahim R, Ochsner UA, Olvera C, Graninger M, Messner P, Lam JS, 537
Soberón-Chávez G. 2001. Cloning and functional characterization of the 538
Pseudomonas aeruginosa rhlC gene that encodes rhamnosyltransferase 2, an 539
enzyme responsible for di-rhamnolipid biosynthesis. Mol. Microbiol. 40:708-718. 540
25. Olvera C, Goldberg JB, Sánchez R, Soberón-Chávez G. 1999. The 541
Pseudomonas aeruginosa algC gene product participates in rhamnolipid 542
biosynthesis. FEMS Microbiol. Lett. 179:85-90. 543
26. Kuchma SL, Ballok AE, Merritt JH, Hammond JH, Lu W, Rabinowitz JD, 544
O'Toole GA. 2010. Cyclic-di-GMP-mediated repression of swarming motility by 545
Pseudomonas aeruginosa: the pilY1 gene and its impact on surface-associated 546
behaviors. J. Bacteriol. 192:2950-2964. 547
27. Romling U. 2013. Microbiology: Bacterial communities as capitalist economies. 548
Nature 497:321-322. 549
28. Baraquet C, Harwood CS. 2013. Cyclic diguanosine monophosphate represses 550
25
bacterial flagella synthesis by interacting with the Walker A motif of the 551
enhancer-binding protein FleQ. Proc. Natl. Acad. Sci. U. S. A. 110:18478-18483. 552
29. Wang S, Parsek MR, Wozniak DJ, Ma LZ. 2013. A spider web strategy of type IV 553
pili-mediated migration to build a fibre-like Psl polysaccharide matrix in 554
Pseudomonas aeruginosa biofilms. Environ. Microbiol. 15:2238-2253. 555
30. Rashid MH, Kornberg A. 2000. Inorganic polyphosphate is needed for swimming, 556
swarming, and twitching motilities of Pseudomonas aeruginosa. Proc. Natl. Acad. 557
Sci. U. S. A. 97:4885-4890. 558
31. Jensen SE, Fecycz IT, Campbell JN. 1980. Nutritional factors controlling 559
exocellular protease production by Pseudomonas aeruginosa. J. Bacteriol. 560
144:844-847. 561
32. Hoang T, Kutchma A, Becher A, Schweizer H. 2000. Integration-proficient 562
plasmids for Pseudomonas aeruginosa: site-specific integration and use for 563
engineering of reporter and expression strains. Plasmid 43:59-71. 564
33. Hoang T, Karkhoff-Schweizer R, Kutchma A, Schweizer H. 1998. A 565
broad-host-range Flp-FRT recombination system for site-specific excision of 566
chromosomally-located DNA sequences: application for isolation of unmarked 567
Pseudomonas aeruginosa mutants. Gene 28:77-86. 568
34. Hassett DJ, Woodruff W, Wozniak DJ, Vasil ML, Cohen MS, Ohman DE. 1993. 569
Cloning and characterization of the Pseudomonas aeruginosa sodA and sodB genes 570
encoding iron- and mangangese- cofactored superoxide dismutase: Demonstration of 571
increased manganese superoxide dismutase activity in alginate-producing bacteria. J. 572
Bacteriol. 175:7658-7665. 573
26
35. Heydorn A, Nielsen AT, Hentzer M, Sternberg C, Givskov M, Ersbøll BK, 574
Molin S. 2000. Quantification of biofilm structures by the novel computer program 575
COMSTAT. Microbiology 146:2395-2407. 576
36. Hori K, Marsudi S, Unno H. 2002. Simultaneous production of 577
polyhydroxyalkanoates and rhamnolipids by Pseudomonas aeruginosa. Biotechnol. 578
Bioeng. 78:699-707. 579
37. Déziel E, Lépine F, Dennie D, Boismenu D, Mamer OA, Villemur R. 1999. 580
Liquid chromatography/mass spectrometry analysis of mixtures of rhamnolipids 581
produced by Pseudomonas aeruginosa strain 57RP grown on mannitol or 582
naphthalene. Biochim.Biophy. Acta. 1440:244-252. 583
38. Jain DK, Collins-Thompson DL, Lee H, Trevors JT. 1991. A drop-collapsing test 584
for screening surfactant-producing microorganisms. J. Microbiol. Meth. 13:271-279. 585
39. Tremblay J, Richardson A-P, Lépine F, Déziel E. 2007. Self-produced 586
extracellular stimuli modulate the Pseudomonas aeruginosa swarming motility 587
behaviour. Environ. Microbiol. 9:2622-2630. 588
40. Kukavica-Ibrulj I, Bragonzi A, Paroni M, Winstanley C, Sanschagrin F, 589
O'Toole GA, Levesque RC. 2008. In vivo growth of Pseudomonas aeruginosa 590
strains PAO1 and PA14 and the hypervirulent strain LESB58 in a rat model of 591
chronic lung infection. J. Bacteriol. 190:2804-2813. 592
41. Starkey M, Hickman JH, Ma L, Zhang N, De Long S, Hinz A, Palacios S, 593
Manoil C, Kirisits MJ, Starner TD, Wozniak DJ, Harwood CS, Parsek MR. 594
2009. Pseudomonas aeruginosa rugose small-colony variants have adaptations that 595
likely promote persistence in the cystic fibrosis lung. J. Bacteriol. 191:3492-3503. 596
27
42. Kirisits MJ, Prost L, Starkey M, Parsek MR. 2005. Characterization of colony 597
morphology variants isolated from Pseudomonas aeruginosa biofilms. Appl. 598
Environ. Microbiol. 71:4809-4821. 599
43. Davey ME, Caiazza NC, O'Toole GA. 2003. Rhamnolipid surfactant production 600
affects biofilm architecture in Pseudomonas aeruginosa PAO1. J. Bacteriol. 601
185:1027-1036. 602
44. Boles BR, Thoendel M, Singh PK. 2005. Rhamnolipids mediate detachment of 603
Pseudomonas aeruginosa from biofilms. Mol. Microbiol. 57:1210-1223. 604
45. Sauer K, Camper AK, Ehrlich GD, Costerton JW, Davies DG. 2002. 605
Pseudomonas aeruginosa displays multiple phenotypes during development as a 606
biofilm. J. Bacteriol. 184:1140-1154. 607
46. Stover CK, Pham XQ, Erwin AL, Mizoguchi SD, Warrener P, Hickey MJ, 608
Brinkman FSL, Hufnagle WO, Kowalik DJ, Lagrou M, Garber RL, Goltry L, 609
Tolentino E, Westbrock-Wadman S, Yuan Y, Brody LL, Coulter SN, Folger KR, 610
Kas A, Larbig K, Lim R, Smith K, Spencer D, Wong GKS, Wu Z, Paulsen IT, 611
Reizer J, Saier MH, Hancock REW, Lory S, Olson MV. 2000. Complete genome 612
sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature 613
406:959-964. 614
47. Coyne MJ, Russell KS, Coyle CL, Goldberg JB. 1994. The Pseudomonas 615
aeruginosa algC gene encodes phosphoglucomutase required for the synthesis of a 616
complete lipopolysaccharide core. J. Bacteriol. 176:3500-3507. 617
48. Schuster M, Greenberg EP. 2007. Early activation of quorum sensing in 618
Pseudomonas aeruginosa reveals the architecture of a complex regulon. BMC 619
28
Genomics 8:287. 620
621
622
623
624
625
626
627
29
Table 1. P. aeruginosa strains used in this study 628
Strains Relevant charateristic(s)a or sequence Reference/source
PAO1 Wild type, Psl+, Pel+ (46)
PA14 An isolate commonly used in the laboratory, Psl-, Pel+ (7)
WFPA801 Psl-inducible strain, PBAD-psl, PAO1 (3)
WFPA831 Pel-inducible strain, PBAD-pel, PAO1 (11)
WFPA833 Psl and Pel double-inducible strain,
PBAD-psl and PBAD-pel, PAO1 This study
IMPA114 PrhlAB-lacZ integrated into attB site of PAO1 This study
IMPA115 PrhlAB-lacZ integrated into attB site of WFPA801 This study
IMPA116 PrhlAB-lacZ integrated into attB site of WFPA831 This study
IMPA117 PrhlAB-lacZ integrated into attB site of WFPA833 This study
PAO1/pUCP18 PAO1 containing pUCP18 vector, Apr This study
PAO1/pLPS188 PAO1 containing pLPS188, a plasmid has constitutively
expressed algC, Apr (11)
PAO1/rhlRI PAO1 containing the plasmid with PBAD-rhlRI in
pHerd20T vector, Apr This study
ΔrhlR/rhlRI PAO1ΔrhlR the plasmid with PBAD-rhlRI in pHerd20T
vector, Apr, Apr This study
PAO1ΔrhlAB PAO1, rhlAB in-frame deletion This study
PAO1ΔfliC PAO1, fliC (encoded flagellin) in-frame deletion (11)
PAO1ΔpilA PAO1, pilA (encoded pilin) in-frame deletion (11)
PAO1ΔalgC PAO1, algC::Tc, Tcr (47)
WFPA803 PAO1, ΔalgC, PBAD-psl (11)
CIM1 PAO1, ΔalgC, PBAD-pel (11)
PAO1ΔrhlR PAO1, rhlR::Gm, Gmr (48)
PAO1ΔgalU PAO1, galU::Gm, Gmr (9)
PAO1ΔpslA PAO1, pslA in-frame deletion (9)
MJK8 Rugose small-colony variant, isolated from aged
biofilm of PAO1 (42)
MJK8Δpsl MJK8, pslBCDE in-frame deletion (42)
30
MJK8Δpel MJK8, pelA in-frame deletion (42)
MJK8ΔpslΔpel MJK8, pslBCDE and pelA in-frame deletion (42)
a: Abbreviations: Tcr, tetracycline resistant; Gmr, gentamicin resistant; Apr, ampicillin resistant. 629
630
31
631
Figure legends 632
FIG 1 The motilities of the Psl/Pel-inducible strains (WFPA801, 831, and 833) under 633
various concentrations of arabinose (inducer). (A) Swarming patterns at 0% to 0.5% 634
arabinose. (B) Swimming zone with 0% or 1% arabinose. (C) Twitching zone with 0% or 635
1% arabinose. The numbers on images indicated the diameter of corresponding 636
swimming or twitching zone; PAO1ΔfliC and PAO ΔpilA were used as negative control 637
for swimming and twitching motility respectively. 638
639
FIG 2 Overproduction of Psl and/or Pel polysaccharide decreases RL production. (A) The 640
drop collapse assay showed a reduction of rhamnolipids in the Psl/Pel-induced strains. 641
The image showed that the bead formation of the culture supernatants from the 642
Psl/Pel-inducible strains grown with/without arabinose. CS, culture supernatants; DW, 643
distilled water; +, 1% arabinose; -, no arabinose. (B) Swarming patterns, swarming zone, 644
total RL production, and the corresponding rhlAB transcription of PAO1, WFPA801, 645
WFPA831 and WFPA833 with 0% or 1% arabinose. Shown under each image were the 646
corresponding quantitative value of swarming zone (the average diameter,cm), total 647
rhamnolipids (RL) and rhlAB-lacZ transcription. The RL extracts were normalized to the 648
level of PAO1 in the absence of arabinose (1=4.9 g/L total RL by dry weight calculation 649
or 284.3 mg/l RL by the anthrone colorimetric assay). The transcription of rhlAB was 650
determined by β-galactosidase activity of PrhlAB-lacZ fusion integrated in chromosome of 651
the corresponding strains. The values were also normalized to PAO1 without arabinose 652
(1=116 Miller Unit). 0, no swarming zone. 653
32
654
FIG 3 TLC and LC/MS analysis of the total RL extracts from PAO1 and Psl/Pel-inducible 655
strains. (A) TLC analysis of RL extracted from the culture of the corresponding strains 656
grown in the absence (-) or presence (+) of 1% arabinose. (B) LC/MS peak of 657
Rha-C10-C10 (m/z 503) (mono-RL). (C) The relative abundance values of Rha-C10-C10 in 658
corresponding RL extract analyzed by LC/MS. (D) LC/MS peak of Rha-Rha-C10-C10 659
(m/z 649) (di-RL). (E) The relative abundance values of Rha-Rha-C10-C10 in 660
corresponding RL extract analyzed by LC/MS. The relative abundance values of 661
Rha-C10-C10 and Rha-Rha-C10-C10 were normalized to PAO1 level (respectively 662
3,646,111 and 1,653,883 without arabinose and 2,722,080 and 2,223,691 with 1% 663
arabinose). Arrows indicated the corresponding peak for mono-RL and di-RL 664
665
666
FIG 4 The swarming ability, total RL and/or Psl production of RL-deficient mutants and 667
psl/pel mutant strains. (A) Shown are the swarming pattern, corresponding swarming 668
zone, Psl level and total RL of PAO1, the PAO1 isogenic rhlR, rhlAB, pslA and galU 669
mutants; (B) The swarming and RL production of MJK8, its isogenic psl and/or pel 670
mutant, and the native Psl-negative strain PA14. The mean diameter of swarming zone 671
and total RL were presented under each corresponding image. The RL extracts were 672
normalized to the level of PAO1 (214 mg/l). Psl was detected by immunoblotting with Psl 673
antiserum. ++++ indicated that Psl level was 4-fold higher than PAO1. -, Psl negative;0, 674
no swarming zone. ND, not determined. 675
676
33
FIG 5 The biosynthesis pathways of RL, Psl, and Pel share the common sugar precursor 677
Glc-1-P catalyzed by AlgC. (A) Schematic representation of the P. aeruginosa PAO1 678
metabolic routes for the biosynthesis of Psl, Pel and RL. Solid lines represent known 679
metabolic routes and dashed line represents hypothetic route. (B) Swarming zone of 680
PAO1/algC (algC was constitutively expressed in plasmid pLPS188.) and control strain 681
PAO1/vector. (C) Comparison of RL production in PAO1/algC and PAO1/vector. The 682
amount of RL was normalized to PAO1/vector level (261 mg/l). (D) Comparison of Psl in 683
PAO1/algC and PAO1/vector. 684
685
FIG 6 The effect of rhlR/rhlI QS system on the biosynthesis of Psl polysaccharide. (A) 686
Swarming zone of rhlRI inducible strains PAO/rhlRI and ΔrhlR/rhlRI grown with/ 687
without arabinose. (B) The Psl and RL production of PAO/rhlRI and ΔrhlR/rhlRI under 688
various concentrations of arabinose. The amount of RL was normalized to PAO1/vector 689
level (214±3 mg/l) 690
691
*
Top Related