Download - Chapter 10 Gene Sequencing and DNA repair. DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?

Transcript
Page 1: Chapter 10 Gene Sequencing and DNA repair. DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?

Nature, Structure and Organisation of the Genetic Material

Chapter 10Gene Sequencing and DNA repair

Page 2: Chapter 10 Gene Sequencing and DNA repair. DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?

DNA

How is the sequence of bases (nucleotides)on a piece of DNA determined?

Page 3: Chapter 10 Gene Sequencing and DNA repair. DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?

Gene SequencingGene sequencing is a process in which the

individual nucleotides in an organism's DNA are identified.

This technique is used to learn more about the genome of the organism as a whole, and to identify specific areas of interest and concern.

Page 4: Chapter 10 Gene Sequencing and DNA repair. DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?

Gene SequencingMedical researchers are very interested in

gene sequencing because the process can be used to identify genetic abnormalities at the base level.

Gene sequencing tests are used today to test samples of material from foetuses to check for common genetic conditions and to test samples from parents who are concerned about passing down hereditary diseases to their future children.

Page 5: Chapter 10 Gene Sequencing and DNA repair. DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?

Gene SequencingA T G G T G C A C C T G A C T C C T G A G G A G A A

This is part of the nucleotide sequence of the template strand for the human HBB gene which controls the production of one of the protein chains found in haemoglobin.What is the sequence of the complementary DNA strand?What is the mRNA sequence?

Page 6: Chapter 10 Gene Sequencing and DNA repair. DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?

DNA Sequencer

gel

door open toshow inside

computer display showing results

Scanning laser

Page 7: Chapter 10 Gene Sequencing and DNA repair. DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?

Gene Sequencing

Results from a DNA Sequencer

Computer Output

gelLaser signal

Page 8: Chapter 10 Gene Sequencing and DNA repair. DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?

Gene SequencingDNA Sequencers are automated.They use four different coloured fluorescent

dyes (one for each base).A piece of DNA is heated to 90°C for two

minutes breaking the hydrogen bonds between the two strands (dissociation) to form two single chains of DNA.

The single chain of template DNA is placed in the sequencer and bases are added one base at a time to match the complementary base (A – T and G – C).

Page 9: Chapter 10 Gene Sequencing and DNA repair. DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?

Gene SequencingDNA template CTCTCCGCCAAACGCATAACC1st copy G*2nd copy GA*3rd copy GAG*4th copy GAGA*…21st copy GAGAGGCGGTTTGCGTATTGG*

Page 10: Chapter 10 Gene Sequencing and DNA repair. DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?

Gene SequencingIn each case the nucleotide at the end of the sequence is labelled with the fluorescent dye (shown as a ‘*’). The different colours are interpreted by the computer into a series of letters denoting the bases.

Page 11: Chapter 10 Gene Sequencing and DNA repair. DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?

Gene Sequencing

Page 12: Chapter 10 Gene Sequencing and DNA repair. DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?

Gene SequencingOld style DNA sequencing gel that used ethidium bromide (etBr) to stain the agarose gel. Then the gel is placed under UV light to make the etBR fluoresce and a X-ray sheet is placed over the top of the gel to be exposed.

Page 13: Chapter 10 Gene Sequencing and DNA repair. DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?

Gene SequencingGene sequences are used to compare changes and conserved portions of genes between different organisms

WEHI

Page 14: Chapter 10 Gene Sequencing and DNA repair. DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?

What is a Genome?A genome contains all of the biological

information needed to build and maintain a living organism.

The biological information contained in a genome is encoded in its deoxyribonucleic acid (DNA) and is divided into discrete units called genes.

Page 15: Chapter 10 Gene Sequencing and DNA repair. DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?

The Human Genome Project (HGP)Sequencing of the human genome, officially

began as the Human Genome Project in 1990. After sequencing of the human genome was

largely completed in 2003, the sequence of each chromosome was carefully analysed.

Page 16: Chapter 10 Gene Sequencing and DNA repair. DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?

Other sequenced genomesOver 180 genomes have been sequenced since

1995.Some examples of species whose genomes have

been sequenced include:Bacillus anthracis – bacteria that causes

anthraxApis mellifera – honeybeeCanis familiaris – domesticated dogChlamydia trachomatis – bacteria that cause

chlamydia Drosophila melanogaster – fruit fly

Page 17: Chapter 10 Gene Sequencing and DNA repair. DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?

Genetic material and mutationsMutations can be caused by various means

including:RadiationVirusesMutagenic chemicalsErrors during meiosis and mitosis

The affects of mutations ranges from no affect at all, alter the gene, but not the product to prevent the gene from functioning properly.

Page 18: Chapter 10 Gene Sequencing and DNA repair. DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?
Page 19: Chapter 10 Gene Sequencing and DNA repair. DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?

DNA RepairRepair of damaged

DNA is so important to the survival of an organism, it is no surprise therefore that many different DNA repair enzymes have evolved.

Almost 100 are known in E. coli

About 130 have been identified in humans so far.