Tiffany Fleming, Boyce Thompson InstituteCharles Bender, Guilderland High SchoolKim LaCelle, Wheatland-Chili Central School
Tom Brutnell, Associate Scientist, BTIAmanda Romag, Research TechnicianHugues Barbier, Postdoctoral AssociateYing Rong, Research Technician
BRACHYBIO! LINKING TEACHERS, STUDENTS AND SCIENTISTS IN PLANT RESEARCH
BrachyBio! Linking Teachers, Students and Scientists in Plant Research
BrachyBio! Goals:
Bring real scientific research to science classrooms using plants
Create a mutually-beneficial partnership where all groups are able to learn with and from one another to advance scientific understanding of plants
Demonstrate to students and teachers that scientific inquiry is relevant and can be used to solve important social and environmental problems
BrachyBio! Goals Bring real scientific topics to the classroom
Students can understand the importance of plant science by relating to the roles that plants play in their daily lives as sources of food and energy.
Maize WheatRice Barley
BrachyBio! Goals Partnership: Teachers, Scientists, Students
Students Learning Objectives
Scientist Research Objectives
• Students make Discoveries!
• Standardize experimental conditions
• Make observations and collect data
• Record and share results
• Topics: Biology, genetics, environmental science, agriculture
• Create a library of brachy data
• Share data with the research community
• Use data as a tool for investigating cereal crops
BrachyBio! Goals Scientific inquiry can help solve important social &
environmental problems
Current Plant Science Research ChallengeMeet the population’s demand for food
Meeting Agricultural Research Goals
Maize WheatRice Barley
Large plants
Long growing seasons with specific growth requirements
Regulated food crops
Brachypodium distachyonA Model System
• Brachypodium distachyon, is a small, fast-growing grass related to rice, wheat, barley, oats and other important grain crops.
• Self fertilizing; goes form seed to seed in 6-8 weeks
• Requires minimal care• One of the smallest of all of the
grass species genomes sequenced to date (only 272 million base pairs)
• DNA can be easily mutated through standard plant breeding methods
• Model system for engineering C4 photosystem traits into C3 plants
CC44
CC
33
CommCommon on
descendescentt
MaizeMaize 2.5 billion bp
Rice Rice 420 million bp
WheatWheat 17 billion bp
BrachyBrachy 270 million bp
Setaria Setaria 510 million bp
Phylogeny of the grasses
Phylogeny of the grasses
Slide courtesy of Toby Kellogg
DNA: The Molecule of Life
DNA Sequence Observable Phenotype
Genes Color, Architecture, Disease Resistance, Etc
DNA: The Molecule of Life
DNA Sequence Observable Phenotype
Genes Color, Architecture, Disease Resistance, Etc
CCCTTGATATGCTGCACGACGT Plant trait?
GATCGTCGACCGGTGCCTAGCAGCTGGCCACG
GATCGTCGACCAGTGCCTAGCAGCTGGTCACG
Mutagenesis
Ethyl Methanesulfonate (EMS) CH3SO3C2H5
Produces random mutations in genetic material by nucleotide
substitution
BTI Scientists Treat Seeds with EMS and build mutant seed populations
Generation 1 Brachy
Seeds
Generations 1 Plant
Gerations 3 seed
population
Grow M1 & HarvestGrow M1 & Harvest
Overnight EMS
Treatment + GA
Overnight EMS
Treatment + GA
Plant M2 Harvest seeds
Plant M2 Harvest seeds
Generations 2 plants
BrachyBio! Seed StockBrachyBio! Seed Stock
Students Find and Catalogue MutantsFam
ily #
000931
Phenotype Category
Phenotype Subcategory
MutantDescriptions
First Screen
Family # #mutants
#germinatedColor White Albino 00931 3/12
Architecture Size Small 00931 3/12
Students find and Catalog Mutants
Pale Green Mutant Variegated Mutant & Early Flowering
•Pigmentation related to photosynthetic pathways may be applied towards understanding photosynthetic development.
• Increased branching may contribute towards increased plant yields with potential applications in biofuel development.
Wild Type Pale Green Highly Branched
• A majority of the plants will be wild type. These plants can be used for many additional lessons in the classroom.
Discuss Applications of Mutant Phenotypes
Students observe and record physical characteristics
•Size
•Coloration
•Architecture
•Flowering time
• Tool for future gene discovery
• Applicable to related cereal crops
Record and Share Data in the Mutant Library
Students Upload pictures in the Mutant Library
000874 VirescentClass/School name
Scientists Can Access Library and
Order Seeds
Search: Virescent
Results: 000874
Students join the Research Community
Professional Development for Science Teachers
•Develop content knowledge in hard-to-teach topics like genetics, heredity, and photosynthesis
•Work as an annual cohort to develop lesson plans that integrate new content knowledge into the existing curricula•Receive classroom support, web-based resources, and equipment to implement new lessons into their classrooms•Access to an online database where students can upload their data and compare it to data generated in classrooms across New York State.
Students: making discoveries that extend beyond the classroom
•Students are making discoveries! • They work to standardize growth
conditions and collect meta-data on environmental conditions like temperature, light, humidity.
• They observe and catalog unique phenotypes caused by random genetic mutations in the DNA of Brachypodium plants.
• Through a shared database, they have the opportunity to compare their results with other classrooms. They may discover how environmental differences influence phenotypic expression.
Wheatland Chili Middle School
Connecting to BTI Scientists
•Student work is generating data that scientists will use to continue to breed and develop important food crops.
•Students are exposed to agricultural issues and research in ways that are relevant and timely.
How do teachers bring BrachyBio! To their classrooms?
•The BrachyBio! website (www.bti.cornell.edu/brachybio) and curriculum materials have been developed by teachers, scientists and science educators for use in the middle and high school science classroom. The curriculum may be taught as a stand-along unit, or integrated into existing units including genetics and heredity, photosynthesis, or growth and development, all using scientific inquiry.
Acknowledgements
Tom Brutnell, ScientistAmanda Romag, Research TechnicianHugues Barbier, Postdoctoral AssociateYing Rong, Research Technician
Tiffany Fleming, Boyce Thompson InstituteCharles Bender, Guilderland High SchoolKim LaCelle, Wheatland-Chili Central School
Top Related