Vinita Radhakrishnan

PATENT SYSTEM RIGHTS v. DUTY DUTY

◦ SPECIFICATION DESCRIPTION

SUFFICIENCY ENABLEMENT BEST MODE

CLAIMS CLEAR AND UNAMBIGUOUS

Claims define the metes and bounds of an invention

Claim Limits the extent of protection What is not claimed is disclaimed! Claims determine the value of your patent Each claim is a representation of your

invention. Single sentence ending with a period.

Implications of◦ Claiming too broadly ◦ Claiming too narrow

Claiming just right: ◦ This is an art and requires lots of imagination◦ Claim must be adequately supported by the

description Must avoid

◦ Not claiming what the client wants◦ Claiming what the client does not use or need

Cannot broaden the claims of a granted patent

Cannot broaden the disclosure and the claims beyond what has been included when drafting the application that was filed

You are responsible for getting the scope of protection the inventor deserves

You do not get a second chance

Three parts ◦Introductory Phrase

Introduces the subject matter of the invention

◦Body defines a particular embodiment of the

invention ◦Transition Phrase

joins the introductory phrase and the body of claim

Open ended v. close ended claims

“I claim a pencil having an eraser fastened to one end.”

Introductory phrase - “a pencil” Transition phrase – “having” Body – “an eraser fastened to one end”

Independent Claims◦ Do not depend on any other claim ◦ Generally defines the essential novel features of

the most preferred embodiments of a product or a process. A pencil having an eraser fastened to one end.

Dependent Claims◦Depend on either an independent claim or

another dependent claim◦Multiple-dependent claims

The pencil as in claim 1, where said eraser is fastened to said pencil on one end using an adhesive.

The pencil as claimed in claim 1 and 2 wherein the said adhesive is glue.

Process Claims◦ A Process Claim is used for process inventions

and has to clearly define the steps involved in the process.

Product Claims◦ A product claim may be claimed as an apparatus,

a system, a device, an article or any other product.

Markush Claims Product by process claims Fingerprint claims

Structure Claim Composition Claim Gene Sequence claim Diagnostic method claim

To Generalize is the Key

“The feline mammal occupying, a wholly if not entirely sedentary position, a horizontally-spread woven textile floor-covering, as is sometimes but not always the case".

Generalize to such an extent that your patent is close to prior art but can be clearly differentiated from the prior art

Product claims Process claims

New Chemical entity including a molecule or a compound

Combination Compositions

A chemical molecule developed in the early discovery stage which later translates into a drug product is generally referred to as a new chemical entity. ◦Actual molecular structure of the NCE in the

claim

A compound having the formula

Scope of protection rendered by the claim stated in the illustration is limited to the compound bearing the molecular structure.

Include a chemical entity along with the various variants of the same

Close ended claims Claim by grouping

A compound having the formula

Wherein X is selected from a group consisting of Cl, Br, F and I.

When the exact structure is not known but the characteristics of the structure is sufficient to distinguish the compound from existing prior art.

e.g.:What is claimed is

A chemical entity characterized by molecular weight of 280, having a pH of 6.5, which has a melting point of 123 degree Celsius and a boiling point of 180 degree Celsius.

When the product cannot be clearly defined and is best defined by the process of preparing the same

Polyjuice potion: ◦A potion that transforms one person to

another person he desires to look and sound like

What is claimed is a potion prepared by: Mixing 12 lacewing flies that have been stewed

for 21 days; 1 ounce of crude Antimony; 4 leeches that have been “unsucculated”; 1 pinch of powdered horn of a Bicorn that has

been "lunar extracted“; and Extract of The-Transfigured-Being-To-Be followed by 21 days of brewing in a oak barrel.

Reference is made to the specification Usually not allowed in most jurisdiction It’s a play safe claiming strategy

A compound for treating Hemophilia, wherein the compound is substantially as discussed in the specification.

Novel Combination product patents including two or more already known chemical compounds.

These compounds may be available in the public domain. But so long as the combination is novel, they can be patented.

A composition claim usually shall include several components both essential and non essential for the invention.

What is claimed isA shampoo composition comprising a. 25 % of Alkyl ether sulphate; b. 10% of Dimethicone; c. 2% of imidazole and d. 63% water.

What is claimed is1. A shampoo composition comprising

20- 30% of at least one Surfactant; 5-15% of at least one conditioning agent; 1-3% of at least one anti fungal agent and water.

2. The shampoo composition as claimed in claim 1, wherein the antifungal agent is selected from a group consisting of pyrazole, imidazole, triazole, tetrazole and pentazole.

3. The shampoo composition in claim 1 wherein said anti fungal agent is imidazole.

A shampoo composition comprising 20- 30% of at least one Surfactant; 5-15% of at least one conditioning agent; 1-3% of at least one anti fungal agent and Water

wherein the antifungal agent is selected from a group consisting of pyrazole, imidazole, triazole, tetrazole and pentazole.

A process claim enumerates the step wise process for manufacturing the compound or formulation

Steps to be enumerated in the logical order.

A process for preparing a modified phosphocalcic compound comprising:

a) adding a gem-biphosphonic acid or an alkali metal or alkaline-earth metal salt thereof to a suspension of a precursor phosphocalcic compound in ultrapure water;

b) stirring the reaction medium at room temperature and

c) recovering the formed compound there from by centrifugation.

Biphenyl Propionic acid

A compound wherein the compound is

What is claimed is a compound wherein ring P is an aromatic ring optionally having substituent(s), ring Q is an aromatic ring optionally further having substituent(s) besides —Y—COOH, and X and Y are each independently a spacer, or a salt thereof or a prodrug thereof.

Nothing is unfair when you define the scope of your invention.

Examiners are always stingy

Product related claims Process related claims

Gene sequence Amino Acid sequence Vector and host used for expression of the

gene An antibody against the protein / sequence

and a kit made from the antibody / sequence

What is claimed is ◦ An isolated nucleic acid comprising a nucleic acid

sequenceATGGGCCTAACGTGAGGGAATTCGAAATT

Or What is claimed is

◦ An isolated nucleic acid molecule comprising a nucleic acid Sequence of SEQ ID no. 1.

A nucleic acid molecule comprising a nucleic acid sequence that hybridizes to SEQ ID no.1 under stringent conditions.

A nucleic acid molecule comprising1) SEQ ID no.1 OR2) a nucleic acid sequence that hybridizes

to SEQ ID no.1 under stringent conditions

What is claimed is An isolated nucleic acid molecule which

encodes a polypeptide comprising the amino acid sequence Met Ala Asp Asp Cys Glu Phe Val Gly Ser Ala Val

Or

An isolated nucleic acid molecule which encodes a polypeptide comprising the amino acid sequence of SEQ ID NO 2.

Vector:◦ A vector comprising a nucleic acid molecule as

claimed in Claim 1.

Host Cell:◦ A transgenic host cell that contains the vector

comprising a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID no.1.

Isolated Antibody:◦An isolated antibody or fragment thereof

comprising the amino acid sequence of of SEQ ID no. 2.

Antibody Kit:◦A kit comprising the antibody or

fragment thereof of claim 1.

Method of expression claims Biotechnological process claims

A method of expressing a target protein or polypeptide comprising the steps of:

◦ A) transfecting a host cell with the expression vector of claim 2;

◦ B) culturing the host cell transfected with the expression vector under conditions that permit expression of the target protein or polypeptide; and

◦ C) isolating the target protein or polypeptide.

A process for making an insulin precursor or an insulin analog precursor, said method comprising

(i) culturing a host cell comprising a polynucleotide sequence encoding an insulin precursor or an insulin analog precursor according to claim 1 under suitable culture conditions for expression of said precursor; and

(ii) isolating the expressed precursor.

Product Process

A diagnostic kit used for detecting malaria antibodies in a biological sample comprising of the protein encoded by SEQ ID NO.1 where the said protein is brought in contact with the biological sample under appropriate conditions which allow the formation of an immune complex, wherein said peptide is labeled with a detectable label.

A method for in vitro diagnosis of malaria antibodies in a biological sample, comprising

(i) contacting said biological sample with a composition comprising a protein encoded by SEQ ID no1 under appropriate conditions which allow the formation of an immune complex, wherein said peptide is labeled with a detectable label, and

(ii) detecting the presence of said immune complexes visually or mechanically.

An isolated nucleic acid encoding a flavonoid methyltransferase molecule bearing the SEQ ID no 1 and its amino acid sequence bearing SEQ ID no 2

An isolated nucleic acid molecule according to any one of claims 1 to 3 having the nucleotide sequence comprising:

(i) a nucleotide sequence set forth in SEQ ID NO:1;

(ii) a nucleotide sequence capable of hybridizing under low stringency conditions to SEQ ID NO: 1 or its complementary form;

(iv) a nucleotide sequence capable of encoding the amino acid sequence set forth in SEQ ID NO:2;

wherein said nucleotide sequence encodes a FMT molecule or a mutant, part, fragment or portion thereof or a functional and/or structural equivalent or homolog thereof.

Claim Dependency First Medical Use Second Medical Indication/Swiss

Claim/New Use claim Process Claims Product by process Gene Sequence: Isolated and

Purified/Synthetic Method of treatment, Diagnosis Combination Claim

Pre drafting Understand the invention Identify the crux of the invention Consider all possible embodiments Plan the structure Play the role of a devils advocate

While Drafting Keep the inventor informed. Draft Claim outline before starting to draft

the description. Finalize the claim after specification is drafted

Avoid Unnecessary information Keep in mind the level of PHOSITA while

drafting the claim.

Be frugal with words Clarity Every word Anchored Be greedy, But do not lose focus of what

your invention is

PRECISION!

CLARITY!

IMAGINATION!

FORESIGHT!

Herbal formulation with melon extract:

Herbal Preparation The medicinal preparation comprises of:

◦ 1. Melon Extract (40%)◦ 2. Aloe Vera Extract (10%)◦ 3. Saffron (5%)◦ 4. Papaya extract (20%)◦ 5. Water

1. A personal care composition comprising ofa) 20-60% of melon extract;b) 0-10% of moisturizing agent;c) 3-7% of anti oxidative agent;d)10-30% of cleansing agent; ande) a suitable solvent.

2. The personal care composition claimed in claim 1 where in the said cleansing agent is selected from a group consisting of papaya extract, cucumber extract and strawberry extract.

3. The personal care composition claimed in claim 1 and 2 where in the cleansing agent is papaya extract.

4. The personal care composition claimed in claim 1, where in the composition is administered as a serum.

5. The personal care composition claimed in claim 1, where in the composition is used for treatment of vitiligo.

For More Details VisitWeb: www.bananaip.com

Blog:www.bananaip.com/sinapse-blog