TT

VAa

Cb

c

d

e

f

g

a

ARRAA

KCBERI

1

soW

et

h0

Zoologischer Anzeiger 266 (2017) 71–88

Contents lists available at ScienceDirect

Zoologischer Anzeiger

journa l homepage: www.e lsev ier .com/ locate / j cz

he Iberian genus Paraphaenops Jeannel, 1916 (Coleoptera: Carabidae:rechini): Morphology, phylogeny and geographical distribution

icente M. Ortuno a,∗, Alberto Sendra a,b,e, Ana Sofia P.S. Reboleira c,d, Floren Fadrique e,f,rnaud Faille g

Grupo de Investigación de Biología del Suelo y de los Ecosistemas Subterráneos, Departamento de Ciencias de la Vida, Facultad de Biología, Química yiencias Ambientales, Universidad de Alcalá, A.P. 20 Campus Universitario, Alcalá de Henares, Madrid E-28805, SpainMuseo de Ciencias Naturales, Servicio de Patrimonio Histórico, Ayuntamiento de Valencia, Valencia E-46010, SpainNatural History Museum of Denmark (Zoological Museum), University of Copenhagen, Universitetsparken 15, DK-2100, København Ø, DenmarkCentro de Estudos do Ambiente e do Mar‘ Universidade de Aveiro, 3810-193 Aveiro, PortugalAssociació Catalana de Biospeleologia (BIOSP)‘ C/Moreres 3, LıHospitalet de lıInfant, Tarragona E-43890, SpainMuseu de Ciencies Naturals de Barcelona, Passeig Picasso, s/n, Barcelona E-08003, SpainZoologische Staatsammlung, Muenchhausenstrasse 21, 81247 Munich, Germany

r t i c l e i n f o

rticle history:eceived 23 July 2015eceived in revised form 16 May 2016ccepted 28 October 2016vailable online 1 November 2016

eywords:ave beetleiospeleologyndemismelict

berian Peninsula

a b s t r a c t

The species Paraphaenops breuilianus (Jeannel, 1916) is an Iberian iconic cave beetle with “aphaenopsian”facies, monospecific until now. An extensive field work over the last years allowed the revision of thispeculiar genus using the combinations of morphological, molecular and ecological approaches and led tothe description of new taxa Paraphaenops fadriquei Ortuno and Faille sp. nov., Paraphaenops breuilianusespanoli Ortuno and Faille ssp. nov. and the full larval diagnosis of the third larval instar of the typespecies. The sequencing of two mitochondrial (cox1, rrnl + tRNA-Leu + nad1) and one nuclear (LSU) genefragments evidenced a strong divergence for all markers considered between P. breuilianus and the newspecies P. fadriquei sp. nov. The strong genetic differences between the two taxa contrast singularly withthe extreme morphological homogeneity of the genus. The ecological data recorded for ParaphaenopsJeannel, 1916 species show that they are stenotherms and stenohygrobionts, perfectly adapted to thesubterranean environment, living at temperatures between 4.4 and 10 ◦C with high relative humidity. Thenew localities and taxa enlarge the former distribution area from 72 to 5091 square kilometres sprinkledbetween twelve caves: six in the Mola de Catí (P. breuilianus breuilianus); three in the aforementioned

karst region towards the south, crossing the geographical barrier “Barranc de Regatxol” (P. breuilianusespanoli ssp. nov.); and three, 60 km towards the west, in a different karst region: the “Sierra de la Dehesas”(P. fadriquei sp. nov.) This geographical range overlaps a geostructural area quoted as “junction area”between the Iberian System and the Catalan coastal Mountain range, an area up to 1000 meters abovesea level.

© 2016 Elsevier GmbH. All rights reserved.

. Introduction

The Ibero–balearic entomofauna is rich in Trechini beetles (110pp.: Serrano, 2013), although it is less speciose than the faunaf Italy (130 spp.: a team of authors, 2007-2013/Carabidae of theorld) or France (142 spp.: Coulon et al., 2011.

Several of the clades of Trechini from the Ibero-balearic area are

xclusively hypogean and share important morphological adap-ations (Bellés, 1987), a syndrome known as troglomorphism or

∗ Corresponding author.E-mail address: vicente.ortuno@uah.es (V.M. Ortuno).

ttp://dx.doi.org/10.1016/j.jcz.2016.10.009044-5231/© 2016 Elsevier GmbH. All rights reserved.

troglobiomorphism (Barr, 1968; Ginet and Decu, 1977; Howarth,1983; Juberthie and Decu, 1994; Desutter-Grandcolas, 1997;Desutter-Grandcolas et al., 2003). Among the spectacular Trechinifrom the Iberian Peninsula the genus Aphaenops Bonvouloir, 1861,endemic to the Pyrenean and prepyrenean chains, reaching theeastern Basque Mounts (subgenus Hydraphaenops Jeannel, 1926),assumes a particular importance. The term “Aphaenops” (withoutvisible eye), was used to name the anatomic model towards whichdifferent hypogean Carabidae converge: the so-called “aphaenop-

sian” shape characterized mainly by a lengthening of body, legs andantennae (Jeannel, 1943; Casale et al., 1998; Faille et al., 2011).

The enigmatic genus Paraphaenops Jeannel (1916); was longconsidered phylogenetically close to Aphaenops, in spite of the

7 scher A

gobtpftavaPri1oevf1blIClp“aRttpCPrnpbti

2

ascBoClcPuIudm

tS

owws

2 V.M. Ortuno et al. / Zoologi

eographical split between the two genera and the occurrencef the barrier provided by the Ebro basin delimiting the twoiospeleological districts of the “Cuadrante noreste Catalán” andhe North-Levantine subdistrict (Ortuno and Gilgado, 2010). Para-haenops breuilianus (Jeannel, 1916) distributed in the northeasternoothills of the Iberian System, south of the Ebro river, in an areahat could be quoted as “junction area” of the Iberian Systemnd the coastal Cordillera of Catalonia (Guimerà, 1992), was pre-iously included in the “série phylétique de Aphaenops” (Casalend Laneyrie, 1982). However, recent genetic studies unveiled thataraphaenops is not related to Aphaenops and the other closelyelated genera (Faille et al., 2010, 2011, 2013). Paraphaenops breuil-anus, was found in 1914 by Henri Breuil (Jeannel and Racovitza,918) and described from the “Cova Cambra” cave (Jeannel, 1916),n the top of the “Mola de Catí” massif (Tarragona). The frenchntomologist René Jeannel together with the spanish Candido Boli-ar collected in 1920 several specimens from the type locality androm Cova del Gerret and Forat del Rastre (Jeannel and Racovitza,929). Some characters of the P. breuilianus breuilianus larvae haseen briefly described by Jeannel (1920, 1926). This species was

ater found in other caves of that massif (Espanol, 1965, 1977b).t took more than half a century for P. breuilianus to be found inova Trobada (La Senia), another cave a bit far from the previous

ocalities. The discovery of a single specimen with different mor-hological characters from the ones from the type locality in theCova Trobada” cave (Espanol, 1977a) led Espanol to consider it as

new taxon, an opinion that he rapidly rejected (Espanol, 1977b).ecent collections in this locality allow us to confirm Espanol’s ini-ial observations regarding the morphological differences betweenhe two populations. Furthermore, three new populations of Para-haenops, two in the province of Teruel, the third in the province ofastellón, allowed us to clarify its taxonomic status. We redescribe. breuilianus presenting a detailed study of the imago, and theedescription of the third larval instar from the type locality. Twoew taxa (one species and one subspecies) of the genus Para-haenops are proposed, based on the combination of morphological,iometrical and molecular approaches, and we outline the impor-ance of the geological and the ecological features of the area in thesolation of the populations in their current distribution.

. Material and methods

Several caves in the area of distribution of the genus and nearbyreas were sampled and we have studied a series of Paraphaenopspecimens deposited in the scientific collection of the Zoologi-al Museum of Barcelona, Spain (Museu de Ciències Naturals dearcelona, MCNB). This geographical area includes a major partf the karstic areas of El Maestrazgo, in the Spanish provinces ofastellón, Teruel and Tarragona. The information regarding the

ocation of the explored caves was provided by local speleologi-al groups (unpublished data), or by the Tinenc a (Castellón) andorts Natural Parks (Tarragona). The caves were georeferencedsing a GPS (Garmin Etrex Legend CX), and the maps of the

nstituto Geográfico Nacional de Espana (http://www.ign.es). Wesed the Magna 50 edition of the Instituto Geológico y Mineroe Espana (http://www.igme.es/internet/cartografia/cartografia/agna50.asp).

The distribution area of Paraphaenops is calculated by applyinghe Red List Guidelines (see http://intranet.iucn.org/webfiles/doc/SC/RedList/RedListGuidelines.pdf).

Some specimens were fixed and pinned (glued on a card) in

rder to measure with a calibrated micrometric ocular, while othersere fixed in 96% ethanol for molecular analysis. Eight specimensere coated with gold-palladium for scanning electron microscope

tudy (Hitachi S-4100). Imagoes illustrations were made using a

nzeiger 266 (2017) 71–88

stereomicroscope NIKON SMZ 1000 with drawing tube. Genitaliaswere dissected and included in Dimethyl Hydantoin Formaldehyde(DMHF), a water-soluble resin (Steedman, 1958) and studied with alight microscope ZEISS 474620-9900 with drawing tube and ocularcalibrated micrometer. Female genitalia were previously treatedwith a saturated solution of KOH in order to remove soft tissuesand then stained with Chlorazol black E® (Ortuno et al., 2005).

Head length was measured from the anterior margin of clypeusto post-ocular constriction and elytra length from the apex tothe sharp end of the scutellum. The slenderness of the 58 ima-goes (36 males and 22 females) was evaluated by combining thewidth/length ratio with the average of the measurement resultsof both humeral angles compared to the sagittal plane (HA(left) +HA(right)/2) (Table 1). A non-hierarchical k-means cluster analysiswas run to assess the consistency of the groups that were visu-ally identified after plotting pronotum length vs. body slenderness.The k-means cluster analysis was done with the vegan package(Oksanen et al., 2014) for R (R Core Team, 2014).

The larva was collected together with 4 imagoes of P. breuilianusin a deep part of Cambra cave (=Cova Cambra), the type locality ofthe species (Jeannel, 1916) and preserved in Scheerpeltz solution(70% ethanol, 29% distilled water, 1% acetic acid and glycerine).In the laboratory it was mounted on a microscope slide includedin Hoyer’s solution (30 g gum arabic, 20 ml glycerine, 50 ml dis-tilled water, 200 g chloral hydrate). Notation of the primary setaeand pores follow the homology method proposed by Bousquet andGoulet (1984) and used by Makarow (1994) in the key to the generaof the ground beetle larvae of the Palearctic region. The presenceof additional setae and pores, according to the archetypal modelof Bousquet and Goulet (1984), was coded using Roman numbers(setae) and Greek letters (pores), following the same terminologyof Ortuno and Reboleira (2010) and Reboleira and Ortuno (2011).

DNA was extracted from whole specimens using DNeasy Tis-sue Kit (Qiagen GmbH, Hilden, Germany). DNA extraction isnon-destructive, to preserve voucher specimens for subsequentmorphological studies (Faille, 2006; Rowley et al., 2007). Speci-mens were incubated overnight in a mix of 180 �l of Lysis bufferand 20 �l of proteinase K solution at 56 ◦C, with the abdominalventrites slightly opened to facilitate the action of the digestionenzyme. After DNA extraction the specimens were mounted oncards and genitalia stored in water-soluble dimethyl hydantoinformaldehyde resin (DMHF) on transparent slide pinned beneaththe specimen. Vouchers and DNA samples are kept in the collectionsof the Zoologische Staatssammlung of Munich (ZSM), the MuséumNational d’Histoire Naturelle, Paris (MNHN) and author’s collec-tions. All sequences were edited using the Sequencher 4.8 software.Every specimen was assigned an individual number which linkthe voucher with the DNA samples and new sequences havebeen deposited in EMBL database with Accession Numbers XX–XX.Localities and voucher number of specimens extracted are listed inTable 2.

We sequenced two mitochondrial (Barcode fragment ofcytochrome c oxidase subunit 1, cox1; 5′ end of large ribosomal unitplus the Leucine transfer plus the 3′ end of NADH dehydrogenasesubunit 1, rrnl + tRNA-Leu + nad1) and one nuclear (Large ribosomalunit, LSU) gene fragments which we successfully used in previousstudies on Trechini (i.e. Faille et al., 2010, 2011) (see Table 3 forprimers used).

We have aligned the sequences using the MAFFT online v.6and the Q–INS–i algorithm (Katoh and Toh, 2008), a progressivepair–wise method with secondary refinement. We used RAxML-GUI 0.93 for Maximum Likelihood analyses (Stamatakis et al.,

2008; Silvestro and Michalak, 2012), using GTR + G + I as the evo-lutionary model and three partitions corresponding to the cox1,rrnL + trnL + nad1 and LSU fragments, with 1000 fast bootstrap repli-cates.

V.M. Ortuno et al. / Zoologischer Anzeiger 266 (2017) 71–88 73

Table 1Specimens analysed morphometrically.

Locality Specimen and sex Humeral angle (HA)HA(left) + HA(right)/2

Pronotum(width/length index)

Cova Cambra (Mola Catí, Tarragona)

♂ 138.0 0.865♂ 139.5 0.833♀ 139.5 0.857♂ 140.2 0.824♂ 141.0 0.837♀ 139.2 0.831♂ 140.2 0.828Forat del Rastre (Mola Catí,Tarragona)

♂ 139.0 0.833♀ 141.0 0.839Avenc del Pèndol (Mola Catí, Tarragona) ♂ 137.5 0.839Avenc Salany (Mola Catí, Tarragona) ♂ 140.5 0.824

Cova Trobada(Valcaneres, La Senia, Tarragona)

♂ 136.0 0.826♂ 133.5 0.796♂ 135.5 0.855♀ 132.0 0.815♂ 135.5 0.807♂ 135.75 0.815♂ 134.0 0.805♂ 133.0 0.815♀ 135.0 0.814♀ 136.5 0.830♂ 135.5 0.833

Mina dels Ports(Mas Barberans, Tarragona)

♀ 132.25 0.820♂ 134.5 0.810♀ 135.5 0.819♀ 133.0 0.843♂ 133.5 0.818♂ 134.5 0.807♀ 133.5 0.812♀ 135.0 0.793♀ 132.0 0.830♀ 134.25 0.810

La Cija (Fortanete, Teruel)

♂ 138.0 0.776♂ 137.5 0.790♂ 137.75 0.780♂ 138.5 0.809♂ 136.5 0.756♂ 136.0 0.767♀ 136.5 0.758♂ 136.2 0.772♀ 137.2 0.771♀ 136.5 0.761♀ 136.0 0.750

Sima San Víctor (Fortanete, Teruel)

♂ 138.75 0.747♂ 139.0 0.743♂ 137.5 0.755♀ 137.25 0.750♂ 138.5 0.750♂ 138.75 0.740

Engolidor de la Bassa d’en Quinyó(Vistabella del Maestrat, Castellón)

♂ 139.0 0.787♀ 137.75 0.785♂ 138.0 0.767♀ 136.75 0.772♂ 136.5 0.795♀ 136.0 0.785

w1

iB(CDMP(

♀ ♂ ♂

Trees were rooted in Trechus quadristriatus (Schrank, 1781),hich is known to belong to another group of Trechini (Jeannel,

928; Faille et al., 2010, 2011).Specimens studied for this work are deposited in the following

nstitutions or private collections: Museu de Ciències Naturals dearcelona (MCNB); Museo Nacional de Ciencias Naturales, MadridMNCNM); Zoologische Staatssammlung Munich (ZSM); Museo deiencias Naturales de Valencia, collection Torres Sala (MCNV-CTS);

epartamento de Ciencias de la Vida de la Universidad de Alcalá,adrid, collection V.M. Ortuno, (DCCV-UAH); collection A. Faille,

aris (CAF); collection J. Fresneda, Llesp-El Pont de Suert, LleidaCJF).

135.5 0.769137.5 0.785137.5 0.800

3. Results

3.1. Systematics or taxonomy

Based on qualitative and quantitative characters, two new taxaof Paraphaenops are recognized in this study, one new subspeciesand a new species. Here we formalize the description of these taxaafter redescribing the genus and the nominal species in order to

complete the descriptions of Jeannel (1916).

3.1.1. Redescription of the genus Paraphaenops Jeannel, 1916 andthe type species

74

V.M

. O

rtuno et

al. /

Zoologischer A

nzeiger 266

(2017) 71–88

Table 2Sequenced specimens, with localities, collectors, codes and sequence accession numbers (unpublished sequences in bold).

sp locality collector code LSU cox1 rrnL Trna-Leu NAD1

Trechus Clairville, 1806Trechus quadristriatus (Schrank,

1781)Collau de la Plana delTurbón − Egea(Spain–Huesca)

P. Déliot, A. Faille, J.Fresneda

MNHN–AF96 GQ293619 FR733908 GQ293743 GQ293745 GQ293841

Trechus fulvus Dejean 1831 Cueva del Pis − Penilla,Santiurde de Toranzo(Spain–Cantabria)

C. Bourdeau, P. Déliot,A. Faille

MNHN–AF98 GQ293613 LT669815 GQ293729

Paraphaenops Jeannel, 1916Paraphaenops breuilianus

breuilianus (Jeannel, 1916)Cova Cambra − Tortosa(Tarragona)

C. Bourdeau, P. Déliot,A. Faille

MNHN–AF108 GQ293551 GQ293685 FR729587 FR729587 FR729587

Paraphaenops breuilianusbreuilianus (Jeannel, 1916)

Cova Cambra − Tortosa(Tarragona)

F. Fadrique, A. Sendra ZSM–L215 LT669823 LT669816 LT669831 LT669831 LT669831

Paraphaenops breuilianusbreuilianus (Jeannel, 1916)

Cova Cambra − Tortosa(Tarragona)

F. Fadrique, A. Sendra ZSM–L215bis LT669817

Paraphaenops breuilianusespanoli ssp. nov.

Cova Trobada,(Tarragona)

F. Fadrique, A. Sendra ZSM–L149 LT669824 LT669818 LT669832 LT669832 LT669832

Paraphaenops breuilianusespanoli ssp. nov.

Cova Trobada,(Tarragona)

F. Fadrique, A. Sendra ZSM– L149bis LT669825 LT669819 LT669833

Paraphaenops breuilianusespanoli ssp. nov.

Mina dels Ports F. Fadrique ZSM–L214bis LT669826 LT669820 LT669834

Paraphaenops fadriquei sp. nov. La Cija − Fortanete(Teruel)

F. Fadrique ZSM–L202 LT669827 LT669835

Paraphaenops fadriquei sp. nov. La Cija − Fortanete(Teruel)

F. Fadrique ZSM–L202bis LT669828 LT669821 LT669836

Paraphaenops fadriquei sp. nov. Engolidor de la Bassad’en Quinyó, Vistabelladel Maestrat

F. Fadrique ZSM–L296 LT669829 LT669822 LT669837 LT669837 LT669837

Paraphaenops fadriquei sp. nov. Engolidor de la Bassad’en Quinyó, Vistabelladel Maestrat

F. Fadrique ZSM–L296bis LT669830 LT669838

V.M. Ortuno et al. / Zoologischer Anzeiger 266 (2017) 71–88 75

Table 3Primers used in the study. F, forward; R, reverse.

Gene Name Sense Sequence Reference

cox1 Jerry (M202) F CAACATTTATTTTGATTTTTTGG Simon et al. (1994)Pat (M70) R TCCA(A)TGCACTAATCTGCCATATTA Simon et al. (1994)Chy F T(A/T)GTAGCCCA(T/C)TTTCATTA(T/C)GT Ribera et al. (2010)Tom R AC(A/G)TAATGAAA(A/G)TGGGCTAC(T/A)A Ribera et al. (2010)LCO1490 F GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994)HCO2198 R TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994)

rrnL–nad1 16saR (M14) F CGCCTGTTTA(A/T)CAAAAACAT Simon et al. (1994)ND1A (M223) R GGTCCCTTACGAATTTGAATATATCCT Simon et al. (1994)

LSU D1 F GGGAGGAAAAGAAACTAAC Ober (2002)D3 R GCATAGTTCACCATCTTTC Ober (2002)

Fig. 1. Paraphaenops in situ. (A) P. breuilianus espanoli ssp. nov. from Cova Trobada;(st

32

lmtia

mFrcsaoitapw(

B) P. breuilianus breuilianus (larva) from Cova Cambra; (C, D) P. breuilianus espanolisp. nov. from Cova Corral del Quiso. Sergio Montagud is the author of the pho-ographs of this figure.

.1.1.1. Paraphaenops Jeannel, 1916. Bull. Soc. entomol. Fr., 1916:82.

3.1.1.1.1. Diagnosis. Medium-sized Trechini. Coloration yel-owish testaceous, glabrous, with reticulate microsculpture weakly

arked; sensorial setae hypertrophied. Aphaenopsian body, dueo the gracility of the three tagma, to the marked constrictionn the base of the elytra and the considerable elongation of theppendages (Fig. 1A, C and D, Fig. 2A–C).

3.1.1.1.2. Description. Length: 4.8–5.5 mm (from tip ofandible to elytron apex). Head (Fig. 2, Fig. 3C, Fig. 4C, Fig. 5C,

ig. 6): long, ellipsoidal. Ocular and post-ocular area drawing aegular and open curve. Neck visible, preceded by a well definedonstriction. Ocular area without ommatidia or traces of ocularcar. Frontal furrow incomplete, subparallel, slightly sinuousnd well marked in its anterior part up to exceeding the levelf the first supraocular pore, then blurred. Clypeus wide, briefly

mpressed by the prolongation of the frontal furrows. Labrumransverse, more or less incised in the center, giving a bilobate

spect. Mandibles long and sharp. Labium with a simple, nonrominent, truncated tooth, interpreted as bifid by Jeannel (1916)ith two punctuate areas (potentially sensorial). Submentum

=prebasilar) prolonged in a long gular area, and separated from

Fig. 2. Habitus of Paraphaenops. (A) P. breuilianus breuilianus; (B) P. breuilianusespanoli ssp. nov.; (C) P. fadriquei sp. nov. Scale bar: 1 mm.

the labium by a well-defined suture line. Antennae filiform andvery long (reaching 3/4 of the body length). Cephalic chaetotaxy:two supraocular setae (anterior and posterior) and a posteriordiscal seta (odd and slightly advanced from the two supraocularposterior) which can be reduced or lacking; two clypeal setae oneach sides; labrum with six setae; one seta on the mandibularfurrow; two labial setae located in the central part of the labium,six submentum setae forming a curve, two long setae on the ligula;maxillary palps without setae and labial palps with three longsetae in the penultimate palpomere; antennae densely setuloseexcept in the 1st antennomere.

Pronotum (Figs. 2, 3D, 4D, 5D): longer than wide, doliform andwith the episternal area well visible in dorsal view. Anterior anglesnot salient. Sides regularly arched up to the proximities of the pos-terior angles, where they become slightly sinuous. Lateral channelof the pronotum very narrow, almost imperceptible, and incom-plete. Posterior angles slightly obtuse and not prominent. Pronotaldisc marked by a thin longitudinal line. Basal part not impressed,with only a slight impression on the post-angular area. Pronotalchaetotaxy: one pronotal seta close to the margin, approximatelyin the anterior quarter. No postangular seta.

Elytra (Figs. 2, 3E, 5E): piriforms or ovals, base pedunculate, withalmost indiscernible shoulders; the previous section of the elytraoutline describes a humeral angle very obtuse with regard to thesagittal plane. Maximum width after the middle of the elytra. The

elytral disc convex with obsolete striae (some of them vaguely per-ceptible). Marginal edge slightly sinuate in the apical area. Lateralchannel of the elytra very narrow, almost imperceptible. Scutellum

76 V.M. Ortuno et al. / Zoologischer Anzeiger 266 (2017) 71–88

Fig. 3. Paraphaenops breuilianus breuilianus from Cova Cambra, SEM photos. (A) distal region of the head in dorsal view and detail of the labrum; (B) last labial and maxillarypalpomeres; (C) cephalic capsule in dorsal view (arrow indicates the larger odd seta); (D) pronotum in dorsal view (arrow indicates the end of the lateral groove); (E) elytrain dorsal view.

Fig. 4. Paraphaenops breuilianus espanoli ssp. nov. from Cova Trobada, SEM photos. (A) labial region and two details (labial tooth and sensorial porous area); (B) headmicrosculpture and detail of microsetation; (C) cephalic capsule in dorsolateral view (arrow indicates the shorter odd seta); (D) pronotum in dorsal view (arrow indicatesthe end of the lateral groove); (E) humeral region of the left elytron.

V.M. Ortuno et al. / Zoologischer Anzeiger 266 (2017) 71–88 77

Fig. 5. Paraphaenops fadriquei sp. nov. from L’Engolidor, SEM photos. (A) antenomere XI adetail of the labrum; (C) cephalic capsule in dorsal view (arrow indicates the shorter odd(E) elytra in dorsal view.

FC

tctscpagab2t

margin. Internal genitalia membranous. Vagina tubular, enlarged

ig. 6. Anatomical details of the imagoes of Paraphaenops fadriquei sp. nov. from Laija. (A) head in lateral view; (B) head in ventral view. Scale bar: 0.5 mm.

riangular, elongated, occupying a good part of the peduncle. Elytralhaetotaxy: two discal setae on each elytra, located on the area ofhe third interstria, one subapical seta present on the area of theecond stria of the apical third of elytra, and two setae near api-al margin (the larger seta, close to the 3rd interstria); umbilicatedore series more or less continuous from the shoulder to subapicalrea, formed of 8 setae (however three groups of setae are distin-uishable: humeral group with 4 setae; median group with 2 setae;nd apical group with 2 setae), most of them distant from the elytral

order: the 1st humeral seta located behind the 1st discal one, thend seta, hypertrophied, close to the humeral border and almosthe same level as the 1st umbilicated seta; the 3rd–5th setae more

nd detail of the sensilla coeloconica; (B) distal region of the head in dorsal view and seta); (D) pronotum in dorsal view (arrow indicates the end of the lateral groove);

or less equidistant; the 6th seta hypertrophied and much closer tothe 5th than to the 7th; the 8th seta, hypertrophied and located atthe same level than the slight sinuosity of the elytra.

Legs (Fig. 1A, C and D): long, slender and hairy (including the dor-sal surface of the protibia); protibial cleaning organ with internalnotch and one long guide seta; mesotibial cleaning organ similar tocomb model (sensu Ortuno, 1988); tarsi short with long claws in theonychium; two first protarsomeres of the males strongly dilated.

Abdomen following the harpalidian type (sensu Deuve, 1988)with setose sternites. Last sternite of the male and female withsimilar morphology but different number of setae, four in malesand six in females.

Male genitalia (Fig. 7A–D, Fig. 8A–D, Fig. 9A–D, Fig. 10): medianlobe of the aedeagus roughly falciform. Basal bulb with a smallsagittal aileron. Internal sac of the edeagus presenting a scaly areapartially strongly sclerotized. Paramera subsymmetric, the left oneslightly broader than the right one, both with four setae, sometimeswith a small supernumerary seta.

Female genitalia (Fig. 7F–I): genital shield trimerous, formedby gonopods IX dimerous (gonocoxite and gonosubcoxite) and thelaterotergite IX. Gonocoxite unguiform, slightly sclerotized, with alarge spiniform seta inserted in the dorsal surface, near the inter-nal margin (sometimes with a second smaller seta); ventral surfacewith small setae (2 or 3) and an ogival groove carrying a sensoryseta. Gonosubcoxite poorly sclerotized, slightly longer than wide,with six setae bordering an area near the basal margin. Lateroter-gite IX hyaline except the anterior and external margin which isslightly sclerotized with about 12 setae located close to the basal

in a final sac (bursa copulatrix), with a sacciform spermatheca atthe right in ventral vision. Oviduct odd opened at right in the final

78 V.M. Ortuno et al. / Zoologischer Anzeiger 266 (2017) 71–88

Fig. 7. Male and female genitalia of Paraphaenops breuilianus breuilianus from CovaCambra. (A) median lobe in lateral view; (B) median lobe in dorsal view; (C) leftparamer in lateral view; (D) right paramer in lateral view; (E) aedeagal ring; (F)genital shield; (G) gonocoxite; (H) genital shield and spermathecal complex in ven-tral view; (I) spermathecal complex in lateral view. Scale bars: A-D, 0.2 mm; E,H,I,0.3 mm; F-G, 0.1 mm.

Fig. 8. Male genitalia of Paraphaenops breuilianus espanoli ssp. nov. from CovaTpb

pt

3(b

Fig. 9. Male genitalia of Paraphaenops fadriquei sp. nov. from La Cija. (A) median lobe

robada. (A) median lobe in lateral view; (B) aedeagus in dorsal view; (C) leftaramer in lateral view; (D) right paramer in lateral view; (E) aedeagal ring. Scalears: A-D, 0.2 mm; E, 0.3 mm.

art of the vagina, with numerous microvillosities in the internalract. No spermathecal or accessory gland.

.1.1.2. Redescription of Paraphaenops breuilianus breuilianusJeannel, 1916) (Figs. 2A, 3, 7, 10A and B). Trechus (Paraphaenops)reuilianus Jeannel, 1916; Bull. Soc. entomol. Fr., 1916: 282.

in lateral view; (B) median lobe in dorsal view; (C) left paramer in lateral view; (D)right paramere in lateral view; (E) aedeagal ring. Scale bars: A-D, 0.2 mm; E, 0.3 mm.

3.1.1.2.1. Specimens studied. 1 ♂, SPAIN, Tarragona, Mola deCatí, Cova Cambra, 1300 ma.s.l., 02.IV.1970, D. Schibi leg. (MCNB); 1♂, Idem, 14.VIII.1972, O. Escolá leg. (MCNB); 1 ♀, Idem, 11.IV.1974,O. Escolá leg. (MCNB); 1 ♂, Idem, 07.VI.1976, O. Escolá leg. (MCNB);2 ♂♂, 2 ♀♀, Idem, 29.X.2005, V.M. Ortuno, A. Sendra and S. Montagudleg. (DCCV-UAH); 2 ♂♂, Idem, 02.VII.2007, Fadrique and Sendraleg. (ZSM) with voucher numbers ZSM–L215 and ZSM–L215bis. 1♂, SPAIN, Tarragona, Mola de Catí, Forat del Rastre, 1237 ma.s.l.,VIII.1934, F. Espanol leg. (MCNB); 1 ♀, Idem, 25.III.1967, F. Espanolleg. (MCNB); 4 ♂♂, 1 ♀, Idem, 02–04.XII.2002, Bourdeau, Déliot andFaille leg. (CAF). 1 ♂, SPAIN, Tarragona, Mola de Catí, Avenc delPèndol, 1262 ma.s.l., 12.IV.1974, O. Escolá leg. (MCNB). 1 ♂, SPAIN,Tarragona, Mola de Catí, Avenc Salany, 1243 ma.s.l., 12.IV.1974, O.Escolá leg. (MCNB).

3.1.1.2.2. Description. Length: 5.0–5.5 mm (from tip ofmandible to elytron apex). Head long (A/L ≈ 0.82–0.85). Cephalicchaetotaxy: posterior discal seta (odd) usually well developed andvisible. Pronotum longer than wide (A/L ≈ 0.82–0.87) with the lat-eral channel visible from the anterior part and interrupted after thesetigerous pore. Elytra width/length: (A/L ≈ 0.57–0.58). Humeralangle obtuse (≈ 137.5◦–141◦). Male genitalia: median lobe of theaedeagus with approximate length of 0.62 mm, describing an opencurve that, in the distal third, towards a slight ascending path witha thick and blunt apex. Female genitalia: same as described for thegenus.

3.1.2. Description of new taxa3.1.2.1. Paraphaenops breuilianus espanoli Ortuno and Faille ssp.nov. (Figs. 1A, C and D, 2B, 4, 8, 10C and D).

3.1.2.1.1 Type series. Holotype, 1 ♂, SPAIN, Tarragona, Val-caneres, La Senia, Cova Trobada, 1128 ma.s.l., 08.IX.1976, F. Espanolleg. (MCNB). Paratypes, 1 ♂, Idem, 24.XII.1992, F. Fadrique leg.(MCNB); 1 ♂, Idem, 01.I.1993, O. Escolá leg. (MCNB); 5 ♂♂, 3♀♀, Idem, 30.X.2005, V.M. Ortuno, A. Sendra and S. Montagudleg. (DCCV-UAH, MNCNM-n◦ 2583); 1 ♂, 1 ♀, Idem, 10.IV.2009,Fadrique and Sendra leg. (ZSM) with voucher numbers ZSM–L149and ZSM–L149bis; 1 ♀, SPAIN, Tarragona, Mas Barberans, Mina delsPorts, 1067 ma.s.l., 08.VI.1980, O. Escolá leg. (MCNB); 1 ♀, Idem,14.IV.1984, O. Escolá leg. (MCNB); 1 ♀, Idem, 17.VI.1984, O. Escoláleg. (MCNB); 1 ♀, Idem, 24.IV.1988, O. Escolá leg. (MCNB); 1 ♀,Idem, 15.IX.1993, F. Fadrique leg. (MCNB); 1 ♂, Idem, 16.X.1993,F. Fadrique leg. (MCNB); 1 ♀, Idem, 30-IV-1995, F. Fadrique leg.

(MCNB); 1 ♂, Idem, 21.X.1996, O. Escolá leg. (MCNB); 1 ♂, Idem,21.IV.1997, Montesinos leg. (MCNB); 2 ♂♂, 3 ♀♀, Idem, 14.V.2003,Déliot, Faille and Fadrique leg. (CAF); 1 ♀, Idem, 10.VI.2006, A.

cher A

S(

Cpn

mwmsltcPtaennpamcpppP

E

35

L19nF(♀LF1Iv(dlt0SC

mielsoawepsp

V.M. Ortuno et al. / Zoologis

endra leg. (MCNV-CTS); 2 ♂♂, Idem, 12.VI.2009, Fadrique leg.ZSM) with voucher numbers ZSM–L214 and ZSM–L214bis.

3.1.2.1.2. Other specimens. 1 ♂, SPAIN, Tarragona, La Senia,ova del Corral del Quiso, 1165 ma.s.l., 25.III.2006, observed andhotographed (Fig. 1C and D) by A. Sendra and S. Montagud, butot collected.

3.1.2.1.3. Description. Length: 4.4–5.5 mm (from tip ofandible to elytron apex). Similar to the type subspecies fromhich it differs clearly by the more elliptical elytra outline and aore pronounced humeri (Fig. 2B). Head long (A/L ≈ 0.81–0.83);

hape and chaetotaxy similar to the type subspecies. Pronotumonger than wide (A/L ≈ 0.79–0.86); shape and chaetotaxy similaro the type subspecies, from which it differs by the pronotal lateralhannel obviously longer, exceeding notably the setigerous pore.osterior angles slightly obtuse and not prominent. Elytra withhe topology of the setae (umbilical series, discal setae, scutellarnd apical setae) identical to that of the type subspecies, butlytra more convex, with the outline distinctly different: oval,ot piriform (A/L ≈ 0.60–0.62) humeral area wider and more pro-ounced, describing a less obtuse angle regarding to the sagittallan (132◦–136.5◦) (Fig. 13 ). Male genitalia: median lobe of theedeagus smaller (approximate length of 0.58 mm), describing aoderately convex curve; the outline describes a much opened

urve that changes at the distal third towards a slightly ascendingath to finish in a thick and blunt apex; the basal bulb clearlyrojecting in the posterior part; internal sac of the edeagus andarameres similar to type subspecies. Female genitalia: similar to. breuilianus breuilianus.

3.1.2.1.4. Etymology. The subspecies is dedicated to Dr. F.spanol, one of the main figures of the Iberian Biospeleology.

.1.2.2. Paraphaenops fadriquei Ortuno and Faille sp. nov. (Figs. 2C,, 6, 9, 10E-J).

3.1.2.2.1. Type series. Holotype, 1 ♂, SPAIN, Teruel, Fortanete,a Cija, 1583 ma.s.l., 22.X.2009, F. Fadrique leg. (MCNB). Paratypes,

♀, Idem, 11.VIII.2009, F. Fadrique leg. (MNHN), spare in ethanol5; 1 ♂, 2 ♀♀, Idem, 13.VIII.2009, F. Fadrique leg. (ZSM) with voucherumbers ZSM–L202 and ZSM–L202bis; 1 ♂, Idem, 22.X.2009, F.adrique leg. (DCCV-UAH); 1 ♀, Idem, 02.IV.2010, F. Fadrique leg.MCNB); 2 ♂♂, 1 ♀, Idem, 01.V.2010, F. Fadrique leg. (DCCV-UAH); 1, Idem, 01.XI.2010, F. Fadrique leg. (MCNB); 1 ♀, Idem, 01.XII.2011,. Auroux and F. Fadrique leg. (CJF); 1 ♂, Idem, 11.XI.2011, F.adrique leg. 2 ♂♂, 1 ♀, SPAIN, Teruel, Fortanete, Sima San Víctor,605 ma.s.l., 19.VI.2014, J. Pastor leg. (MCNB, DCCV-UAH); 3 ♂♂,

dem, 21.VI.2014, F. Fadrique leg. (MCNB, CAF) one specimen withoucher number ZSM–L1078; 1 ♂, Idem, 27.IX.2014, F. Fadrique leg.DCCV-UAH). 2 ♀♀, SPAIN, Castellón, Vistabella del Maestrat, Engoli-or de la Bassa d’en Quinyó, 1029 ma.s.l., 05.VII.2010, F. Fadrique

eg. (ZSM) with voucher numbers ZSM–L296 and ZSM–L296bis; ely-ra of one exemplar 05.VII.2010, F. Fadrique leg. (CAF); 1 ♂, 1 ♀, Idem,5.VII.2010, L. Auroux leg. (MCNB); 4 ♂♂, 3 ♀♀, Idem, 05.IX.2010,. Teruel and A. Sendra leg. (DCCV-UAH, MNCNM-n◦ 2584, MCNV-TS).

3.1.2.2.2. Description. Length: 5.0–5.5 mm (from tip ofandible to elytron apex). Close to P. breuilianus but differ-

ng by the general shape of the body with elytral outline morelliptical, with humeral area more pronounced (Fig. 2C) and theabrum strongly indented (Fig. 5B). Head long (A/L ≈ 0.78–0.81);hape and chaetotaxy similar to P. breuilianus, with the exceptionf the odd discal seta usually missing or, more rarely, vestigial (like

reduced pore, or a pore with a small seta). Pronotum longer thanide (A/L ≈ 0.74–0.81); doliform like in P. breuilianus and with the

pisternal region well visible in dorsal view. Sinuosity very slightlyronounced, close to the posterior angles. Pronotal lateral channelimilar to P. breuilianus espanoli ssp. nov., exceeding the setigerousore and stopping near the middle of the pronotum. Posterior

nzeiger 266 (2017) 71–88 79

angles slightly obtuse, inconspicuous. Chaetotaxy similar to P.breuilianus. Elytra: topology of the setae (umbilical series, discalsetae, scutellar and apical setae) identical to P. breuilianus. Outlineof the elytra more elliptical, proportionally wider (A/L ≈ 0.57–0.60).Angle of the humeral area obtuse (≈ 135.5◦–139◦). Male genitalia:median lobe of the aedeagus bigger (approximate length of0.67 mm), describing a moderately convex curve. The outline issimilar to the aedeagus of P. breuilianus but describes a biggercurve with the basal bulb more projecting in the posterior part;the anterior part of the median lobe slightly ascending path tofinish in a thick and blunt apex (dorsal view); internal sac of theaedeagus similar to the two subspecies of P. breuilianus; parameressubsymmetrical, the left one slightly longer than the right one,usually with four setae. Female genitalia: similar to P. breuilianus.

3.1.2.2.3. Etymology. The new species is dedicated to our col-league and friend F. Fadrique who discovered the new taxon.

3.1.3. Redescription of the larva of Paraphaenops breuilianusbreuilianus (Jeannel, 1916) (Figs. 1B, 11, 12)3.1.3.1. Specimen studied. 1 ex, SPAIN, Tarragona, Mola de Catí,Cova Cambra, 1300 ma.s.l., 29.X.2005, V.M. Ortuno, A. Sendra andS. Montagud leg. (DCCV-UAH).

3.1.3.2. Description. Third instar larva. Habitus (Fig. 1B): Campode-iform larva slightly sclerotized; whitish with testaceous head; bodyshape very slender, subparallel-sided; larval length 7 mm (frommandible to urogomphi apex, macrosetae excluded) and legs withonly one claw.

Cephalic capsule (=head) (Fig. 11A and B): subquadrate; 1.11 xlonger than wide in ventral view; flattened; narrowing at the upperlateral region; stemmata absent. Epicranial suture long (epicra-nial suture length/head length ratio = 0.16). Frontale sutures clearlyvisible, deeply curved and sinuous. Anterior margin of epistome(nasal) (Fig. 11C) triangular; slightly asymmetrical; with variablenumber of teeth on each lobe.

Chaetotaxy of cephalic capsule (=head): frontale [FR](Fig. 11A–C): with 10 setae (FR1-FR10; FR7-FR10) and 8 pores(FRa-FRe; FR�-FR�) on each side; FR1 and FR3 longer than thearchetypal model, on each side. Parietal [PA] (Fig. 11A and B): with24 setae (PA1-PA19) + 5 setae (PAI-PAV); 10 pores (PAa-PAd; PAk;PAm-PAo; PA�-PA�) on each side; PA4, PA5 slightly longer than thearchetypal model and PA17 well developed.

Mandible [MN] (Fig. 11D): falciform without additional teethon terebra; interior margin of the mandible crenulated above theteeth; moderately curved; with 2 setae (MN1-MN2) and 3 pores(MNa-MNc); penicillum developed.

Labium [LA] (Fig. 11E): with weakly elongate mentum (1.2 xlonger as wide) and well-developed ligula, second segment of thelabial palp with 3 pseudo-segments. Prementum with 6 setae (LA1-LA6) and one pore (LAa) on each side; setae LA3 LA4 very small andLA6 shorter than the first segment of labial palp. First segment 1.58 xlonger than the second, with one pore LAb. Second segment of thelabial palp with 2 pores (LAc; LA�); first pseudo-segment with aplacoid sensillum around LAc and one small setae in the superiorjoint; last pseudo-segment with a sensorial apex.

Maxilla [MX] (Fig. 11F): lacinia absent. Cardo with one setaeMX1. Stipes with 7 setae (MX2-MX5) + 3 setae (MXI-MXIII) and3 pores (MXa-MXc) and several setae (gMX); setae MX5 elongate,related to the archetypal model and usual arrangement of placoidsensilla (as in Makarov and Koval, 2003) below MXI. Galea with 2segments about the same length; first segment with 1 setae (MX8)

and 1 pore (MXd); second segment with 1 setae (MX9) and an api-cal sensorial apex. Maxillary palps with 3 segments; first segment isthe largest with 2 pores (MXe-MXf); second segment with one poreMXg and 2 setae MX11-MX12; third segment divided in 2 pseudo-

80 V.M. Ortuno et al. / Zoologischer Anzeiger 266 (2017) 71–88

F us breuf ja, (G,

sw

fi(aA

ttn7maep

(s5((

s

ig. 10. Paraphaenops aedeagus in lateral view. (A, B) two specimens of P. breuilianrom Cova Trobada; (E, J) six specimens of P. fadriquei sp. nov.: (E-F) two from La Ci

egments with 1 pore (MX�) surrounded by a placoid sensillum andith an apical membranous sensorial apex.

Antenna [AN] (Fig. 11G): with 4 segments, all longer than wide;rst segment with 5 pores (ANa-ANe); second segment with 2 setae

ANI-ANII); third segment with 3 setae (AN1-AN3), 1 pore (AN�) and conic sensorial appendage; fourth article with 5 setae (AN4-AN7;NIII), one pore (ANg) and a sensorial appendage on the apex.

Thorax: with a heavily sclerotized area with numerous addi-ional setae; prothorax subquadrate; mesothorax and metathoraxransverse. Pronotum [PR] (Fig. 12A): 1.02 x longer than wide;otum with 13 setae (PR1-PR6 and PR7-PR9 and PR10-PR14) and

pores (PRa-PRb; PRg, PRi-PRl) on each side. Mesonotum [MS] andetanotum [MT] (Fig. 12B and C) wider than long. Mesonotum with

ll primary setae (MS1-MS14) and 3 pores (MEa, MEf and MEg) onach side. Metanotum with all primary setae (MT1-MT14) and 4ores (MEa, MEc, MEf and MEg) on each side.

Leg (Fig. 12D) long, with one claw; claw [CL] with one short setaCL1); tarsus [TA] with 3 setae (TA1-TA2 and TA7); tibia [TI] with 11etae (TI1-TI7) + 4 setae (TII-TIIV) and 1 pore (TIa); femur [FE] with

setae (FE1-FE5) + 5 setae (FEI-FEV); trochanter [TR] with 6 setaeTR1-TR2, TR4-TR7) and 4 pores (TRa-TRc, TRe); coxa with 11 setae

CO5 CO10, CO14 CO17, COI) and 4 pores (COa COc, CO�).

Abdomen: urogomphi [UR] (Fig. 12E), in dorsal view, with 9etae (UR1-UR9) + 1 setae (URI) with several uncoded small setae,

ilianus from Cova Cambra; (C, D) two specimens of P. breuilianus espanoli ssp. nov.H) two from Engolidor de la Bassa d’en Quinyó, (I, J) two from Sima San Víctor.

and 4 pores (URa-URb, URe-URg) + 2 pores (UR�-UR�) on each side;UR9 larger than the archetypical.

Pygidium [PY] (Fig. 12F) with conical shape; in ventral view with3 setae (PY1 and PY6-PY7) + 4 setae (PYI-PYIV); pores not observed.

3.2. Imagoes morphometry

The different known populations of Paraphaenops may be sep-arated into three different groups (Table 1; Figs. 2, 13). Thespecimens found in Teruel and west Castellón (P. fadriquei sp.nov.), have generally, proportionally longer pronotum than thosefrom Mola de Catí in Tarragona (P. breuilianus). However, the val-ues provided by the width/length index of the pronotum mayoverlap among some specimens of P. fadriquei sp. nov. and P. breuil-ianus, specifically those from localities southern of the “Barranc deRegatxol” (P. breuilianus espanoli ssp. nov.). The specimens from thenorthern localities in the anticline of Mola de Catí (P. breuilianusbreuilianus) show index values of pronotum that do not overlapwith those of the new species.

Furthermore, the evaluation of the angle described by thehumeral margin of elytra (HA (left) + HA (right)/2) and the sagit-

tal plane, show that there is a clear segregation of the specimensfrom the two populations separated by the “Barranc de Regatxol”:the populations of Mola de Catí (P. breuilianus breuilianus) andthe populations located at S-SW of the same massif (P. breuilianus

V.M. Ortuno et al. / Zoologischer Anzeiger 266 (2017) 71–88 81

F a. (A)(

eoipesmebe

3

oio

ig. 11. Paraphaenops breuilianus breuilianus larva in dorsal view from Cova CambrD) mandible; (E) labium; (F) maxilla; (G) antenna. Scale bar: 0.1 mm.

spanoli). The measurement of the specimens did not reveal overlapf humeral angle (Fig. 13). The different angles of the humeral area

s related to two different models of elytral outline, being clearlyiriform in P. breuilianus breuilianus and more oval in P. breuilianusspanoli (Fig. 2A and B). The same type of analysis performed onpecimens from Teruel and Castellón (P. fadriquei) revealed inter-ediate values between the two taxa mentioned above (Fig. 13);

lytra have an oval outline, differentiating it from P. breuilianusreuilianus, but clearly more elongated than those of P. breuilianusspanoli (Fig. 2).

.3. Molecular analysis

The new species P. fadriquei is distinct from the two subspeciesf P. breuilianus for all the genes considered. It differs from P. breuil-

anus by 3 nucleotide changes on the LSU sequence, 15 base pairsn the 16S fragment and 29 bp on the cox1. This difference of more

cephalic capsule; (B) idem in ventral view; (C) nasal and anterior margin of front;

than 4% pairwise sequence divergence for the cox1 only are signif-icant at the species level (Hebert et al., 2003). On the other hand,the two subspecies of P. breuilianus are differing by only few basespairs of the cox1 gene (Table 3; Fig. 14).

4. Discussion

Combining morphometric values, transversality index (ratiowidth/length) of pronotum and humeral angle, and despite of thevariability shown by specimens of Paraphaenops in each population,three morphometric trends are well distinguishable (Figs. 2, 13)and consistent with the chorological and geographical data. Thespecimens with less elongated pronotum and very obtuse humeral

angle (piriform elytra) correspond to P. breuilianus breuilianus, typ-ical from localities on the Mola de Catí anticlinal (Tarragona) atnorth of the “Barranc de Regatxol”. A group of populations is char-acterized by a pronotum longer than in the typical subspecies, and

82 V.M. Ortuno et al. / Zoologischer Anzeiger 266 (2017) 71–88

F a. (A)

S

tmdhbhooacssd

l

ig. 12. Paraphaenops breuilianus breuilianus larva in dorsal view from Cova Cambrcale bar: 0.1 mm.

he humeral angle less obtuse (oval elytra but less elongated). Thisorphotype is observed in populations at the south of the “Barranc

e Regatxol”, in the S-SW of Mola de Catí (Tarragona) and describedere as a new subspecies, P. breuilianus espanoli. Finally, a num-er of specimens have the pronotum proportionally longer and theumeral angle with intermediate values between the taxa previ-usly quoted; the outline of the elytra also differs and although it isval, it is more elongated than in P. breuilianus. These specimenslso have other distinctive features from P. breuilianus: labrumlearly notched at the anterior margin and with the discal cephaliceta often lacking or very small when present (vestigial). Thesepecimens from the new localities of Teruel and west Castellón are

escribed here as the new species P. fadriquei.

The genus Paraphaenops is extremely homogeneous morpho-ogically, and there is some divergence between molecular and

pronotum; (B) mesonotum; (C) metanotum; (D) leg; (E) urogomphi; (F) pygidium.

morphological evolution. It is really surprising to observe that thestrong geographical and genetic isolation was not followed bystronger morphological differentiation between P. fadriquei and P.breuilianus breuilianus. On the contrary, the rather evident mor-phological differences between P. breuilianus breuilianus and P.breuilianus espanoli contrast with the weak molecular divergence. Itwould be therefore interesting to add specimens from other local-ities to confirm these results. A study at a finer scale using efficientmarkers for population genetics might allow understanding thepopulation structure of P. breuilianus.

Jeannel (1926: 395–397) provided some information regard-ing very basic morphology of P. breulianus larvae and illustrating

briefly its anterior part of the cephalic capsule and nasale. Thesecharacters that per se do not enable the species recognition, how-ever Jeannel (1926) suggested its close relation with the larva

V.M. Ortuno et al. / Zoologischer Anzeiger 266 (2017) 71–88 83

Fig. 13. Morphometric results of the specimens studied of Paraphaenops. Circles group individuals according to a k-means cluster analysis.

F

ov

ig. 14. Phylogram obtained in RAxML, using the combined data matrix. Number in node

f the genus Duvalius Delarouzée, 1859. We provide a full lar-al diagnosis, showing that it exhibits the general characteristics

s, ML bootstrap (>75) obtained in RAxML (see Material and methods for details).

of Trechini, i.e., the absence of lacinia in the maxilla, only oneclaw with a short seta on the leg and the presence of secondary

8 scher A

sGOfbhTitMtrloit(cWbl12d1ao2(wpk

4

lfpHbstdHBfpPtsm

bc(adgt(seB(c

4 V.M. Ortuno et al. / Zoologi

etae on the frontale part of the cephalic capsule (Bousquet andoulet, 1984; Grebennikov and Maddison, 2005; Reboleira andrtuno, 2011). Paraphaenops breuilianus is geographically isolated

rom the other aphaenopsian Trechini species but it seems toe phylogenetically closer to Sardaphaenops than to any otherypogean Trechini (Casale and Giachino, 1988; Casale and Vignaaglianti, 1996; Casale, 2004; Faille et al., 2010, 2013), justify-

ng the interest of the study of its pre-imaginal stages, knowno be phylogenetically informative in Trechitae (Grebennikov and

addison, 2005). In fact, larvae of P. breulianus are more close tohose of the genus Sardaphaenops than to Aphaenops, with someesembling differences lying on the hypertrophy of FR7 in P. breu-ianus and different shape and chaetotaxy of the anterior marginf epistome, among others (Casale and Marcia, 2007). The third

nstar larva of P. breuilianus breuilianus differs from the morpho-ype of Aphaenops, known only for the three species: AphaenopsCerbaphaenops) cerberus Dieck, 1869; A. (Cerbaphaenops) crypti-ola (Linder, 1859) and A. (Hydraphaenops) ehlersi (Abeille, 1872).

hereas the larva of Hydraphaenops seems to be active, the Cer-aphaenops larva differs, among other characters, in having shorteregs than the larvae of other cave Trechini genera (see Jeannel,920, 1926; Bouillon, 1964; Makarow, 1994; Makarov and Koval,003; Casale and Marcia, 2007; Monguzzi, 2011), such as Sar-aphaenops; Typhlotrechus J. Müller, 1913; Orotrechus J. Müller,913; Neaphaenops Jeannel, 1920 or Jeannelius Kurnakov, 1959nd Paraphaenops. This peculiar morphology combined with otherbservations (Deleurance-Glac on, 1963; Faille and Pluot-Sigwalt,015), suggest the presence of a contracted life cycle in AphaenopsDeleurance-Glac on, 1963; Deleurance and Deleurance, 1964),hereas the known larvae of other “aphaenopsian” Trechini, Para-

haenops included, exhibit an active lifestyle similar to the onenown for other larvae of epigean Trechini.

.1. Habitat and biocenosis

The chorological data available for Paraphaenops spp. (unpub-ished and bibliographic data) indicate that this taxon is exclusivelyound in the deep underground environment (“Milieu souterrainrofond”, MSP) at elevations above one thousand meters (Fig. 15).owever the mesovoid shallow substratum (MSS), in the distri-ution area of the genus was never sampled. The Paraphaenopspecimens occur always in the deep zone of caves where theemperature is stable and ranges between 4.4 ◦C and 10 ◦C in theifferent sampled caves (Table 4) and with high humidity (98–100%R), between 10 and 200 m from the entrance. In Engolidor de laassa d’en Quinyó, these conditions are present only ten meters

rom the entrance of the cave, allowing the presence of Para-haenops very close to the entrance. In all our observations, thearaphaenops specimens were walking on substrates covered by ahin layer of water, indicating that this genus is stenotherm andtenohygrobiont, perfectly adapted to the subterranean environ-ent.

In the subterranean ecosystems of Mola de Catí, P. breuilianusreuilianus shares its predator trophic level with one species ofhilopod (genus Lithobius Leach, 1814) and the carabid LaemostenusAntisphodrus) sp., all of them enduring this cold environment with

handful of secondary consumers formed mainly by: small acari,iplopoda, collembola, diplura Campodeidae (Campodea maestraz-oensis Sendra and Escolà, 2004) and several species of diptera ofhe families Sciaridae, Phoridae, Trichoceroidae and Lauxaniidaeunpublished information). The collembola are represented by fourpecies (Bellés, 1987): Heteromurus nitidus (Templeton, 1835); Het-

romurus absoloni (Kseneman, 1938); Pseudosinella tarraconensisonet, 1929 and P. duodecimoculata Bonet, 1931; and the millipedesBellés, 1987): Paratyphloiulus bolivari Ceuca, 1973 and Typhlopsy-hrosoma tarraconense (Mauriès, 1971). Cova Trobada, the type

nzeiger 266 (2017) 71–88

locality of P. breuilianus espanoli is also inhabited by mites, cam-podeids (C. maestrazgoensis), collembola and diptera from differentfamilies: Heleomyzidae, Limoniidae, Mycetophilidae, Phoridae,Sciaridae and Trichoceridae (unpublished informations).

In the cave Cija de Fortanete, P. fadriquei sp. nov. cooccurswith mites, campodeids (C. maestrazgoensis), several species ofCollembola: Pygmarrhopalites maestrazgoensis Jordana, Fadriqueand Baquero, 2012; Megalothorax minimus Willem, 1900; Hetero-murus nitidus (Templeton, 1835); Schaefferia decemoculata (Stach,1939); Oncopodura fadriquei Jordana and Baquero, 2012 (in Jordanaet al., 2012); Pseudosinella encrusae Gisin and da Gama, 1969; andDiptera of different families: Sciaroidea, Platypezoidea, Lauxani-idae and Phoridae (Jordana et al., 2012; unpublished informations).

The subterranean communities change completely in the caveslocated below one thousand meters, in the subterranean environ-ment of the coastal mountains of the geostructural unit known as“coastal alignments” (see distribution part and geostructural impli-cations) it harbours a distinct and diverse community of predatorsand consumers of cave invertebrates, with about 30 subterraneanspecies (Ortuno et al., 2005), among which five predators of thesame size as Paraphaenops spp. (0.5 mm) or bigger: ColeopteraCarabidae (2 species), Diplura Japygidae (1 species), spider Dys-deridae (1 species) and pseudoscorpions (1 species).

4.2. Geostructural implications of Paraphaenops’s distribution

This contribution notably increases the distribution area ofthe genus Paraphaenops, previously known from five caves inthe National Park of Ports, in sierras located close to the SWof Tarragona, protected by its recognized environmental value.The genus is now recorded from 14 caves, with a distribu-tion area of the genus Paraphaenops increasing from 72 km2 tomore than 5091 km2 (the area was calculated using Red ListGuidelines; see http://intranet.iucn.org/webfiles/doc/SSC/RedList/RedListGuidelines.pdf). Today we know that its distribution area isextended up to the sierras of El Maestrazgo of Teruel and Castel-lón (Fig. 15). Another result of the study is the increase from one tothree of the number of Paraphaenops taxa (Figs. 2, 13, 14). Neverthe-less, Paraphaenops should still be considered as a poorly diversifiedgroup with a small distribution area like the genus SardaphaenopsCerruti and Henrot, 1956, confined to the subterranean environ-ment of a small part of Sardinia Island (Casale and Giachino, 1988;Casale, 2004; Faille et al., 2011). Both genera share some othercharacteristics: they are considered by several authors as closelyrelated taxa, isolated from other clades of troglobiont Trechini, e.g.the Pyrenean hypogean clade, with a remote origin (e.g. Casale andVigna Taglianti, 1996; Faille et al., 2010, 2013), and they sharestrong ecological requirements marked by their exclusive sub-terranean lifestyle, their stenothermy and their stenohygroby. Inaddition, they occupy precise locations within the caves, gener-ally walking on a thin layer of water during the whole year, as itseems to be the case for Sardaphaenops (Casale and Giachino, 1988).From a geostructural point of view, the distribution of Paraphaenopsspp. draws a triangular edge in the area of transition between theIberian System and the Catalan coastal Mountain range, the “linkzone” (sensu Guimerà, 1992). This area is formed by the intersectionof big faults oriented NE-SW and NW-SE that cross the hercinianplatform of Paleozoic rock and affect the Mesozoic cover reaching athickness of 6.000 m. This area is extended from the Jurassic reliefsof the Ports de Beseit to the cretaceous basin of El Maestrazgo. Thelithological potential of the link zone allows the existence of anunderground environment largely surrounded by non karstifica-

ble areas like the extensive Ebro basin or the tectonic depressionsfilled with quaternary materials separating it from the “coastalalignments”. These are characterized by coastal sierras of low alti-tude (300–500 ma.s.l.), composed of mesozoic limestones of about

V.M

. O

rtuno et

al. /

Zoologischer A

nzeiger 266

(2017) 71–88

85

Table 4Caves inhabited by Paraphaenops. Paraphaenops breuilianus breuilianus (Jeannel, 1916), all caves are located in Tortosa in the southeast of Tarragona province into the Natural Parc dels Ports in Mola Catí Mountain. Paraphaenopsbreuilianus espanoli ssp. nov., all caves are located in La Sènia, in the southeast of Tarragona province into the Natural Parc dels Ports. Paraphaenops fadriquei sp. nov., all caves are in central area of El Maestrazgo Mountains,between Teruel and Castellón provinces.(*) Data of length and depth of each cave in meters; (**) deep zone indicates the meters to reach this zone from the entrance, for pits these meters are in depth; (+) temperature at the deep zone in degree Celsius; (#) referenceindicated if the material have been studied in this article or not; the reference of non-studied material is taken from an unpublished survey: “Biodiversitat d’Artròpods de les cavitats del Parc Natural dels Ports (2012)” −unpublishedwork- by Equip tècnic del Departament d’Artròpodes del Museu de Ciències Naturals de Barcelona and Associació Catalana de Biospeleologia. Data from La Cija and Sima de San Víctor from the survey: “Proyecto BioespeleologíaMaestrazgo. Inventario de Fauna Entomológica de varias cavidades del Maestrazgo Turolense (2012)” −unpublished work- by F. Fadrique from the Associació Catalana de Biospeleologia.

Cave UTM (ED50) m.a.s.l. Lenght(*) Depth(*) Deep zone(**) Temperature(+) Reference (#)

P. breuilianusbreuilianus

Cova Cambra 31N2716794520991

1300 300 ? 50 8 ◦C Studied material

Forat del Rastre 31N2709234520291

1237 80 8 60 – Studied material

Avenc del Pèndol 31N2716794520556

1262 80 31 −20 – Studied material

Avenc del Salany 31N2713664520495

1243 132 26 −20 – Studied material

Cova Gerret 31N2746974522688

1200 100 17 30 – Non studied material

Avenc dels Mamelons 31N2710724521104

1222 700 167 −30 9.4 ◦C Non studied material

Avenc de la Crisi 31N2727334521790

1268 1215 148 −35 9.1 ◦C Non studied material

Avenc Sabarin or Cova de l’Orgui 31N2738764522143

1264 517 56 −30 9.3 ◦C Non studied material

P. breuilianus espanolissp. nov.

Cova Trobada 31N2674564514950

1128 290 98 35 9.2 ◦C Studied material

Mina dels Ports 31N2724304517128

1067 250 0 200 10.0 ◦C Studied material

Cova del Corral del Quiso 31N2635534514851

1165 80 31 20 8.0 ◦C Studied material

P. fadriquei sp. nov.La Cija 30T0706642

44951341583 1343 113 −30 8.2 ◦C Studied material

Sima de San Victor 30T07109744480491

1605 388 29 −20 – Studied material

Engolidor de la Bassa d’en Quinyó 30T7309474469744

1029 15 12 10 – Studied material

86 V.M. Ortuno et al. / Zoologischer Anzeiger 266 (2017) 71–88

Fig. 15. Geostructural and altitudinal areas of the Paraphaenops spp. distribution. Paraphaenops breuilianus breuilianus: 1, Cova Gerret and Avenc Sabarin; 2, Cova Cambraand Avenc de la Crisi; 3, Avenc del Pèndol, Avenc del Salany and Avenc del Mamelons; 4, Forat del Rastre. Paraphaenops breuilianus espanoli ssp. nov.: 5, Mina dels Ports; 6,Cova Trobada. Paraphaenops fadriquei sp. nov.: 7, La Cija; 8, Sima de San Víctor; 9, L’Engolidor de la Bassa d’en Quinyó.

F ributioC l MamP

2icAm

ig. 16. Geological and altitudinal areas in Paraphaenops breuilianus subspecies distambra and Avenc de la Crisi; 3, Avenc del Pèndol, Avenc del Salany and Avenc deorts; 6, Cova Trobada; 7, Cova Corral del Quiso.

0 kilometres of width, parallel to the coastal line and separated by

ntermediate valleys of graben type (tectonic pits) along 80 km ofoast from Castellón to the mouth of the Ebro river (Garay, 1995).s already said, the underground community of the “coastal align-ents” is distinct from the one associated with Paraphaenops spp.

n. Paraphaenops breuilianus breuilianus: 1, Cova Guerret and Avenc Sabarin; 2, Covaelons; 4, Forat del Rastre. Paraphaenops breuilianus espanoli ssp. nov.: 5, Mina dels

This community lives in warmer cavities, over 14 ◦C, conditions that

seem not supported by Paraphaenops. The reasons of the absenceof Paraphaenops towards the SW of its current area of distributionare not clear, since the subterranean environment spreads withoutlithological discontinuity with similar conditions of temperature. It

cher A

iVtlgtsOcmCPEtbmtsswzMwTtCf

dmggwb

skbv

A

sSFcWBoAtloaNEpfdAam

V.M. Ortuno et al. / Zoologis

s possible that the lack of information reflects a lack of sampling.ery few is known regarding the terrestrial subterranean fauna in

he area occupied by the Gúdar to Penyagolosa Mountain. A detailedook at the distribution of the different taxa of Paraphaenops sug-ests that P. breuilianus is distributed in the area of thrust faults ofhe north of the “link zone”, in the Ports area, and its populationsegregated in two subspecies with notable biometric differences.n one hand, P. breuilianus breuilianus is known in eight naturalavities located in the anticlinal of the Mola de Catí, a wide karsticassif of massive dolomites of the Lower Jurassic, including the

ova Cambra, type locality of this taxon (Fig. 16). On the other hand,. breuilianus espanoli is known from three other cavities of thels Ports Natural Park located more than three kilometres S-SW ofhe Mola de Catí. The two subspecies are isolated by geographicalarriers like the “Barranc de Regatxol” which falls below thousandeters of altitude. One should add to this an altitudinal barrier of

he interposition of thrust faults and faults that caused the expo-ure of Cretaceous limestones, in which are formed the three cavesheltering P. breuilianus espanoli (Fig. 16). Paraphaenops fadriqueias found in three cavities located in the areas south of the “link

one”, more than sixty kilometres in the karstic central area of Elaestrazgo, separated from P. breuilianus by a band of 5–10 km ofidth of marly areas of the Albiense, in the area of Morella (Fig. 15).

he three caves are open in materials of the Upper Cretaceous and,hough 30 kilometres separate two caves of Teruel from the cave ofastellón, all are excavated at the extremities of the same anticlinal

orming the Sierra de las Dehesas.The sister relationships between Paraphaenops and Sar-

aphaenops, although not well supported, was obtained by recentolecular analyses which include most of the Western Palearctic

enera of Trechini (Faille et al., 2013). This work dates the diver-ence between the two genera from the Oligocene, in accordanceith a vicariant origin of Sardaphaenops due to the separation

etween Sardinia and continent.The unexpected discovery of a new species of Paraphaenops

uggests that the subterranean fauna of this area remains poorlynown and that important sampling efforts would be necessaryefore having an exhaustive knowledge of the subterranean biodi-ersity of this part of the Iberian Peninsula.

cknowledgements

The I3 program of “Incentivation of the Incorporation and Inten-ification on Research Activity” of the Ministry of Education andcience of Spain provided support to VMO, the German Researchoundation (DFG project FA1042/1-1) to AF and the Danish Coun-il for Independent Research (ref. DFF–FNU 4002-00269) to ASR.

e thank the support in the field work to: Luis Auroux, Charlesourdeau, Carles Fontgivell, Josep Pastor and Agustí Meseguer andthers members of the Associació Catalana de Biospeologia, tolmela brothers, speleologists from Speleo Club of Castelló. Also

o Sergio Montagud for providing the pictures of live imagoes andarva. We are also grateful to Rafael Jordana for the informationn Collembola and to Alberto Jiménez-Valverde for the clusternalysis. We thank the logistic support of the “Museu de Ciènciasaturals” of Barcelona, Berta Caballero and Gloria Masó; “Centro destudios del Maestrazgo Turolense (CEMAT)”, “Instituto Aragonésara la Gestión Ambiental (INAGA)”, “Parc de la Tinenc a de Beni-

assà” and the “Servicio de Vida Silvestre” of the “Direcció General

e Medi Natural, Conselleria d’Infraestructures, Territori y Medimbient de la Generalitat Valenciana”. We acknowledge also thenonymous reviewers for kind contributions that improved theanuscript.

nzeiger 266 (2017) 71–88 87

References

A Team of Authors, 2007–2013. Carabidae of the World, 2007–2013. http://www.carabidae.pro [consultation date: 20-05-2013].

Abeille E., EEtudes sur les coléoptères cavernicoles suivies de la description de 27coléoptères nouveaux franc ais, 1872, Olive, Marseille.

Barr, T.C., 1968. Cave ecology and the evolution of troglobites. Evol. Biol. 2, 35–102.Bellés, X., 1987. Fauna cavernícola i intersticial de la Península Ibèrica i les Illes

Balears. CSIC, Editorial Moll, Mallorca.Bonet, F., 1929. Colémbolos cavernícolas de Espana. Eos 5, 5–32.Bonet, F., 1931. Estudios sobre los colémbolos cavernícolas con especial referencia

a los de la fauna espanola. Mem. Soc. Esp. Hist. Nat. 14 (4), 231–403.Bouillon, M., 1964. Description de la larve de l’Aphaenops crypticola Linder

(Coléoptère Trechinae). Ann. Spéléol. 19, 751–758.Bousquet, Y., Goulet, H., 1984. Notation of primary setae and pores on larvae of

Carabidae (Coleoptera: Adephaga). Can. J. Zool. 62, 573–588.Casale, A., 2004. Due nuovi Coleotteri ipogei di Sardegna, Sardaphaenops adelphus

n. sp. (Coleoptera Carabidae) e Patriziella muceddai n. sp. (ColeopteraCholevidae), e loro significato biogeografico. Boll. Soc. ent. ital. 136, 3–31.

Casale, A., Giachino, P.M., 1988. Note su Sardaphaenops supramontanus cerruti &henrot 1956 (Col. Carabidae), e descrizione di S. supramontanus grafittii n.subsp. Boll. Mus. Reg. Sci. Nat. Torino 6, 585–601.

Casale, A., Laneyrie, R., 1982. Trechodinae et Trechinae du monde tableau dessous-familles, tribus, séries phylétiques, genres, et catalogue général desespèces. Mem. Biospeol. 9, 1–226.

Casale, A., Marcia, P., 2007. Larval morphology of Sardaphaenops adelphus Casale,2004, a highly specialized troglobitic beetle endemic to Sardinia (Coleoptera,Carabidae). Subterr. Biol. 5, 35–42.

Casale, A., Vigna Taglianti, A., 1996. Coleotteri Carabidi di Sardegna e delle piccoleisole circumsarde e loro significato biogeografico (Coleoptera, Carabidae).Biogeographia. Lav. Soc. ital. Biogeogr. (N.S.) 18, 391–427.

Casale, A., Vigna Taglianti, A., Juberthie, C., 1998. Coleoptera Carabidae. In:Juberthie, C., Decu, V. (Eds.), Encyclopaedia Biospéologica, Vol. 2. Société deBiospéologie, Moulis-Bucarest, pp. 1047–1081.

Ceuca, T., 1973. D’autres iulides cavernicoles nouveaux d’Espagne (Diplopoda).Speleon 19–29, 31.

Coulon, J., Pupier, R., Quéinnec, E., Ollivier, E., Richoux, P., 2011. ColéoptèresCarabiques, compléments et mise à jour, Vol. 2. Fédération Franc aise desSociétés de Sciences Naturelles, Paris.

Delarouzée, C., 1859. Description de deux coléoptères nouveaux. Ann. Soc. ent. Fr.7, 65–69.

Deleurance-Glac on, S., 1963. Contribution à l’étude des coléoptères cavernicoles dela sous-famille des Trechinae. Ann. Spéléol. 18, 227–265.

Deleurance, S., Deleurance, E.-P., 1964. Reproduction et cycle évolutif larvaire desAphaenops (A. cerberus Dieck, A. crypticola Linder), Insectes Coléoptèrescavernicoles. C. R. Acad. Sci. Paris 258, 4369–4370.

Desutter-Grandcolas, L., 1997. Are troglobitic taxa troglobiomorphic? A test usingphylogenetic inference. Int. J. Speleol. 26, 1–19.

Desutter-Grandcolas, L., D’Haese, C., Robillard, T., 2003. The problem of characterssusceptible to parallel evolution in phylogenetic analysis: a reply to Marquèsand Gnaspini (2001) with emphasis on cave life phenotypic evolution.Cladistics 19, 131–137.

Deuve, T., 1988. Etude phylogénétique des Coléoptères Adephaga: redefinition dela famille des Harpalidae, sensu novo, et position systématique desPseudomorphinae et Brachinidae. Bull. Soc. Entomol. Fr. 92, 161–182.

Dieck, G., 1869. Beiträge zur subterranen Käferfauna Südeuropas und Maroccos.Berl. Ent. Zeits. 23, 337–360.

Espanol, F., 1965. Los tréquidos cavernícolas de la península ibérica e islas baleares(Col. caraboidea). Publ. Inst. Biol. Apl. Barcelona 38, 123–151.

Espanol, F., 1977a. Nuevas localizaciones de carábidos cavernícolas ibéricos (Col.Adephaga). Graellsia 33, 107–112.

Espanol, F., 1977b. Sobre algunos trechinae cavernícolas del museo de zoología debarcelona (Col. caraboidea). Speleon 23, 27–31.

Faille, A., 2006. Endémisme et adaptation à la vie cavernicole chez les Trechinaepyrénéens (Coleoptera: Carabidae). In: Approches moléculaire etmorphométrique. Ph.D. dissertation. Muséum National d’Histoire Naturelle,Paris.

Faille, A., Pluot-Sigwalt, D., 2015. Convergent evolution in the reduction of ovariolenumber associated with subterranean life in cave beetles. PLoS One 10 (7),e0131986.

Faille, A., Casale, A., Balke, M., Ribera, I., 2013. A molecular phylogeny of alpinesubterranean trechini (Coleoptera: Carabidae). BMC Evol. Biol. 13, 248.

Faille, A., Casale, A., Ribera, I., 2011. Phylogenetic relationships of westernmediterranean subterranean Trechini groundbeetles (Coleoptera: Carabidae).Zool. Scr. 40, 282–295.

Faille, A., Ribera, I., Deharveng, L., Bourdeau, C., Garnery, L., Queinnec, E., Deuve, T.,2010. A molecular phylogeny shows the single origin of the Pyreneansubterranean Trechini ground beetles (Coleoptera: Carabidae). Mol.Phylogenet. Evol. 54, 67–106.

Folmer, O., Black, M., Hoeh, W., Lutz, R., Vriejenhoek, R., 1994. DNA primers foramplification of mitochondrial cytochrome c oxidase subunit I from diverse

metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 3, 294–299.

Garay, P., 1995. Marco geológico estructural y geotectónica. El Cuaternario del PaísValenciano. Universitat de València & Asociación Espanola para Estudio delCuaternario, Valencia.

8 scher A

G

G

G

G

H

HJ

J

J

J

JJ

J

J

J

K

K

K

L

L

M

M

M

M

8 V.M. Ortuno et al. / Zoologi

inet, R., Decu, V., 1977. Initiation à la biologie et à l’écologie souterraines.Jean-Pierre Delarge ed., Paris.

isin, H., da Gama, M., 1969. Deux espèces nouvelles de Pseudosinella cavernicoles(Insecta, Collembola). Rev. suisse Zool. 76 (2), 289–295.

rebennikov, V.V., Maddison, D.R., 2005. Phylogenetic analysis of Trechitae(Coleoptera: Carabidae) based on larval morphology, with a description offirst-instar Phrypeus and a key to genera. Syst. Entomol. 30, 38–59.

uimerà, J., 1992. Història natural dels Països catalans. Geologia (II), vol. 2.Fundació Enciclopdia Catalana, Barcelona.

ebert, P.D.N., Ratnasingham, S., de Waard, J.R., 2003. Barcoding animal life:cytochrome c oxidase subunit 1 divergences among closely related species. P.Roy. Soc. Lond. B: Bio. Sci. 270, 596–599.

owarth, F.G., 1983. Ecology of cave arthropods. Ann. Rev. Entomol. 28, 365–389.eannel, R., 1916. Deux nouveaux Trechus cavernicoles de France et d’Espagne. Bull.

Soc. Entomol. Fr. 1916, 280–283.eannel, R., 1920. Les larves des Trechini (Coleoptera, Carabidae). Arch. Zool. Exp.

Gén. 59, 509–542.eannel R., 1926. Monographie des Trechinae. Morphologie comparée et

distribution d’un groupe de Coléoptères. Première Livraison. L’Abeille 32,221–550.

eannel R., 1928. Monographie des Trechinae. Morphologie comparée etdistribution d’un groupe de Coléoptères. Troisième Livraison: les Trechinicavernicoles. L’Abeille, 35, 1–808.

eannel, R., 1943. Les fossiles vivants des cavernes. Gallimard, Paris.eannel, R., Racovitza, E.G., 1918. Biospeologica n(XXXIX, enumération des grottes

visitées, 1913–1917 (6a série). Arch. Zool. Exp. Gén. 57, 203–470.eannel, R., Racovitza, E.G., 1929. Biospeologica n(LIX, enumération des grottes

visitées, 1918–1927 (7a série). Arch. Zool. Exp. Gén. 68, 293–608.ordana, R., Fadrique, F., Baquero, E., 2012. The collembolan fauna of Maestrazgo

caves (Teruel, Spain) with description of three new species. Zootaxa 3502,49–71.

uberthie, C., Decu, V., 1994. Encyclopaedia biospeologica, Vol 1. Sociéte deBiospéologie, Moulis-Bucarest.

atoh, K., Toh, H., 2008. Recent developments in the MAFFT multiple sequencealignment program. Brief. Bioinform. 9, 286–298.

seneman, M., 1938. Vorläufige Mitteilung über eine neue Collembolenart aus denHöhlen des Dinarischen Karstes und über die Gattung Typhlopodura Absolon.Ent. Listy. (Fol. ent.) Brno. 1, 69–70.

urnakov, V.N., 1959. Les Trechini de la faune souterrame de l’Abkhasie. Rev. Fr.Ent. 26, 231–236.

each, W.E., 1814. A tabular view of the external characters of four classes ofanimals, which Linné arranged under Insecta; with the distribution of generacomposing three of these classes into orders, & c. and description of severalnew genera and species. Trans. Linn. Soc. London 11, 306–400.

inder, J., 1859. Description de trois nouvelles espèces d’Anophthalmus trouvés enFrance. Ann. Soc. Entomol. Fr. 7, 71–73.

akarow, K.V., 1994. A key to the genera of the Groundbeetle larvae (Coleoptera,Carabidae) of the Palearctic region. Boll. Mus. Reg. Sci. Nat. Torino 12, 221–254.

akarov, K.V., Koval, A.G., 2003. A contribution to the knowledge of the biology ofa Troglobiont Carabid species, Jeannelius birsteini Ljovuschkin, 1963(Coleoptera, Carabidae, Trechini). Entomol. Rev. 83, 819–826.

auriès, J.P., 1971. Diplopodes èpigès et cavernicoles des Pyrènèes espagnoles et

des Monts cantabriques. IéIII. Introduction, Polyzonides et Craspedosomides.Bull. Soc. Hist. Nat. Toulouse 106, 401–422.

onguzzi, R., 2011. Sintesi delle attuali conoscenze sul genere Allegrettia jeannel,1928 (Coleoptera, Carabidae, Trechinae). Ann. Mus. Civ. Stor. Nat. ‘GiacomoDoria’ 103, 1–70.

View publication statsView publication stats

nzeiger 266 (2017) 71–88

Müller, J., 1913. Beitrage zur Kenntnis der Hühlenfauna der Ostalpen und derBalkanhalbinsel. I. und II. Teil. Anz. Kaiserl. Akad. Wiss. Wien, math. -naurwiss.Kl. 50, 179–181.

Ober, K.A., 2002. Phylogenetic relationships of the carabid subfamily Harpalinae(Coleoptera) based on molecular sequence data. Mol. Phylogenet. Evol. 24,228–248.

Oksanen, J., Guillaume Blanchet, F., Kindt, R., Legendre, P., Minchin, P.R., O’Hara, R.B., Simpson, G.L., Solymos, P., Stevens, M.H.H., Wagner, H., 2014. vegan:Community Ecology Package. R package version 2. 2-0. Available at: http://CRAN.R-project.org/package=vegan.

Ortuno, V.M., 1988. Importancia de los caracteres tibiales en la sistemática deHarpalidae (Col. Caraboidea). Actas III Congr. Ibér. Entomol. Granada pp,263–270.

Ortuno, V.M., Gilgado, J.D., 2010. Update of the knowledge of the Ibero-Balearichypogean Carabidae (Coleoptera) Faunistics, biology and distribution.Entomol. Bl. 106, 233–264.

Ortuno, V.M., Reboleira, A.S.P.S., 2010. Description of the third instar larva of ahypogean ground beetle, Trechus alicantinus (Coleoptera: Carabidae:Trechinae). Entomol. Fenn. 21, 33–42.

Ortuno, V.M., Sendra, A., Montagud, S., Teruel, S., 2005. Systématique et biologied’une espèce paléoendémique hypogée de la péninsule Ibérique: Ildobatesneboti Espanol 1966 (Coleoptera: Carabidae: Dryptinae). Ann. Soc. Entomol. Fr.(N.S.) 2004 (40), 459–475.

R Core Team, 2014. R: A Language and Environment for Statistical Computing. RFoundation for Statistical Computing, Vienna, Austria URLhttp://www.R-project.org/.

Reboleira, A.S.P.S., Ortuno, V.M., 2011. Description of the larva and female genitaliaof Trechus gamae (Coleoptera: Carabidae) with data on its ecology. Bull.Insectol. 64, 43–52.

Ribera, I., Fresneda, J., Bucur, R., Izquierdo, A., Vogler, A.P., Salgado, J.M., Cieslak, A.,2010. Ancient origin of a Western Mediterranean radiation of subterraneanbeetles. BMC Evol. Biol. 10, 29.

Rowley, D.L., Coddington, J.A., Gates, M.W., Norrbom, A.L., Ochoa, R.A., Vandenberg,N.J., Greenstone, M.H., 2007. Vouchering DNA-barcoded specimens: test of anon-destructive extraction protocol for terrestrial arthropods. Mol. Ecol. Notes7, 915–925.

Schrank P., Enumeratio Insectorum Austriae Indigenorum, 1781, AugustaeVindelicorum.

Sendra, A., Escolà, O., 2004. Campodàidàs cavernicoles du nord-est de la pàninsuleIbàrique (Diplura: Campodeidae). Rev. suisse Zool. 111 (4), 889–914.

Serrano, J., 2013. New Catalogue of the Family Carabidae of the Iberian Península(Coleoptera). Servicio de Publicaciones de la Universidad de Murcia, Murcia.

Silvestro, D., Michalak, I., 2012. RaxmlGUI: a graphical front-end for RAxML. Organ.Divers. Evol. 12, 335–337, http://dx.doi.org/10.1007/s13127-011-0056-0.

Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., Flook, P., 1994. Evolution,weighting and phylogenetic utility of mitochondrial gene sequences and acompilation of conserved polymerase chain reaction primers. Ann. Entomol.Soc. Am. 87, 651–701.

Stach, J., 1939. Die Höhlenfauna des Glatzer Schneeberges. II Die Collembolenfaunader Salzlocher bei Seitendorf. Beitr. Biol. Glatzer Schneeberg 5, 395–415.

Stamatakis, A., Hoover, P., Rougemont, J., 2008. A rapid bootstrap algorithm for theRAxML Web servers. Syst. Biol. 57, 758–771.

Steedman, H.F., 1958. Dimethyl Hydantoin Formaldehyde: a new water-soluble

resin for use as a mounting medium. Q. J. Microsc. Sci. 99, 451–452.

Templeton, R., 1835. Descriptions of the Irish Species of Thysanura. Trans. Ent. Soc.London 1 (2), 92–98.

Willem, V., 1900. Un type nouveau de Sminthuride: Megalothorax. Ann. Soc. ent.Belgique 44, 7–10.

dilluns, 14 de novembre de 2016

Nous Paraphaenops a Ports i Terol

Una de les noves espècies: Paraphaenops fadriquei, del Maestrat Turolenc Foto en viu: Agustí Meseguer

L'any 2009, en Floren Fadrique va trobar un extraordinari coleòpter a l'avenc La Cijade Fortanete, Terol, que ha resultat ser una nova espècie. Han passat molts anys imoltes situacions problemàtiques abans que l'estudi fos publicat. Bé, de moment s'haeditat oficialment el resum a la prestigiosa revista digital alamana ZoologischerAnzeiger, http://authors.elsevier.com/sd/article/S0044523116301255 al'espera d'assignar-li el nº del volum a on ho publicaran sencer. Esperem que en uncurt termini ja podrem donar a conèixer el treball complet.

Els autors del treball són: Vicente M. Ortuño; Alberto Sendra; Ana Sofia Reboleira;Floren Fadrique i Arnaud Faille.

Traducció de la publicació del resum (traduït al català, amb algunarranjament):

L'espècie Paraphaenops breuilianus (Jeannel de 1916) és un escarabat cavernícolaque és una icona (1) de la fauna ibèrica. Té una fàcies "aphaenopsiana" (2) i fins araera un gènere monoespecífic (3). Un extens treball de camp en els últims anys vapermetre la revisió d'aquest peculiar gènere utilitzant les combinacions de mètodesmorfològics, moleculars i ecològics i ha donat lloc a la descripció de dos nous tàxons;Paraphaenops fadriquei Ortuño i Faille sp. nov., i Paraphaenops breuilianusespanoli Ortuño i Faille ssp. nov., així com la descripció del tercer estadi larval (4) del'espècie tipus (P. fadriquei). La seqüenciació de dos segments dels gensmitocondrials (cox1, rrnl + tRNA-Leu + nad1) i un nuclear (LSU) (5) ha evidenciatuna forta divergència per a tots els marcadors considerats entre P. breuilianus i lanova espècie P. fadriquei sp. nov. Les fortes diferències genètiques entre els dos

ÀLBUM DEL MÓNSUBTERRANI

Traducció

Agustin

Lluís Auroux

Victor

Contribuïdors

Estadistiques

Seguidores (39)Siguiente

Seguidors

2016 (13)

11/13 - 11/20(1)

NousParaphaenops a Ports iTerol

10/30 - 11/06(1)

09/25 - 10/02(1)

09/18 - 09/25(1)

07/10 - 07/17(1)

Arxiu del blog

http://biosp.blogspot.com.es/2016/11/nous-paraphaenops-ports-i-terol.html

1 de 3

taxons contrasta amb la gran homogeneïtat morfològica (6) del gènere. Les dadesecològiques registrades del Paraphaenops Jeannel, 1916 mostren que són espècies"stenotherms" i "stenohygrobionts" (7), perfectament adaptades al medi subterrani,que viuen a temperatures entre 4,4 i 10 ° C i amb una humitat relativa molt alta. Lesnoves localitats han permès engrandir l'antiga àrea de distribució dels 72 als 5.091km², colonitzant un total de dotze cavitats: sis a la Mola de Catí (P. breuilianusbreuilianus); tres a la regió càrstica més cap al sud, creuant la barrera geogràfica"Barranc de Regatxol" (P. breuilianus espanoli ssp nov.)., i 3 a 60 km cap a l'oest, enuna regió de diferent carst: la "Serra de la Deveses" (P. fadriquei sp. nov.). Aquestazona geogràfica es superposa a una àrea geoestructural citada com a "zona d'unió"entre el Sistema Ibèric i la serralada costanera catalana, una àrea de fins a 1000 md'altura sobre el nivell del mar.

1: P. breuilianus breuilianus; 2: P. breuilianus espanoli; 3:P. fadriquei de la localitat castellonenca;

4: P. fadriquei de les dues localitats del Maestrat Turolenc

Comentaris de l'autor d'aquest article:

1: Es refereix a què l'espècie inicial, P. breuilianus, és una icona dins la faunasubterrània peninsular. Trobada per l'abat H. Breuil l'any 1914 a la cova Cambra, alParc Natural dels Ports, Tarragona i descrita per R. Jeannel l'any 1916. Emparentatamb el gènere Sardaphaenops, confinat a l'illa de Cerdenya i, tot i la semblança,separat dels Aphaenops pirinencs.

2: Aspecte aphaenopsià significa que la morfologia externa s'assembla a la del gènereAphaenops, caracteritzat per un cos llarg i estret; un tòrax extremadament estret; unabdomen el·líptic; unes potes molt allargades i unes antenes que, solen ser mésllargues que tot el cos.

3: Monoespecífic es refereix a què un gènere només té una espècie.

4: Els coleòpters (així com tots els insectes), abans de presentar el seu aspecte tal comels recordem, a partir de l'ou passen per diversos estats de larves, canviant de formaen cada una d'elles.

5: L'anàlisi de l'ADN es pot portar a terme partint de diferent material genètic iseqüenciant diferents porcions de les llargues cadenes. En aquest cas ens concretenquins segments han analitzat.

6: Es refereix a què les dues espècies, més una subespècie de Paraphaenopsconegudes, presenten una morfologia externa molt semblant entre ells, tret de petitsdetalls que també han ajudat a independitzar-los. En canvi, el que sí que ha resultatben diferenciat ha estat cada ADN.

07/03 - 07/10(1)

06/19 - 06/26(1)

06/05 - 06/12(1)

04/17 - 04/24(1)

04/10 - 04/17(1)

02/21 - 02/28(1)

01/17 - 01/24(1)

01/10 - 01/17(1)

2015 (22)

2014 (20)

2013 (38)

2012 (36)

2011 (28)

2010 (38)

2009 (53)

http://biosp.blogspot.com.es/2016/11/nous-paraphaenops-ports-i-terol.html

2 de 3

Entrada més antigaPàgina d'inici

Subscriure's a: Comentaris del missatge (Atom)

Publicat per Lluís Auroux a 7:00

Etiquetes de comentaris: Biospeleologia, Cavitats catalanes, Ecologia, Noves espècies, Recerca científica

7: Stenotherms es refereix a què es tracta d'espècies que només toleren petitesvariacions de temperatura. Stenohygrobionts es refereix a què les condicionsd'humitat del seu hàbitat han de ser molt constants i amb alta humitat ambientpropera a la saturació (100% d'humitat relativa).

Fins que tinguem el treball complet!

Envia'm una notificació

Comenta com a:

Publica

Cap comentari:

Publica un comentari a l'entrada

Plantilla Senzill. Amb la tecnologia de Blogger

http://biosp.blogspot.com.es/2016/11/nous-paraphaenops-ports-i-terol.html

3 de 3

dissabte, 24 de desembre de 2016 Fent camí

Cercar a l'Espeleobloc

EspeleoTemes

Arxiu del blog

Agustin

Felicitacions Lluis unbon treball

Lluís Auroux

Estic d'acord en quel'article és una verssió person…

Jordi Lloret

Marc, home, no t'hoprenguis tant a la tremenda!.Que no…

Marc Navarro

Aquest article és unaopinió personal i moltsubjectiva, i a…

F. Miret

Encara que me n’hagistrepitjat el terreny i la mànigaespel…

Josep Herrerías

Gràcies a aquestsexcel·lents fotògrafs, podemtenir una alt…

teresa

Il·luminació perfecta !!!

Le Long

Hola companys, per lafoto : http://les-trogloxenes.blogspot…

Darrers comentaris

Visitants

1 3 2 8 4 5 1

http://espeleobloc.blogspot.com.es/2016/12/nous-coleopters-cavernicoles-ports-i.html#comment-form

1 de 12

Estadistiques

La nova espècie:Paraphaenops fadriquei, de LaCija de Fortanete,TerolS’acaben...24 Desembre 2016

23 Desembre 2016

22 Desembre 2016

21 Desembre 2016

20 Desembre 2016

Nota preliminar:Aquest escrites va fer tot just acabarl'EspeleoCat-Tallers...19 Desembre 2016

L'any 1993 començaren aelaborar, sobre el terreny, un

Darrers apunts

NOUS COLEÒPTERSCAVERNÍCOLES A PORTSI TEROL

SISTEMÀTICA IADAPTACIÓ DE LA VIDASUBTERRÀNIA

NORTE PERÚ 2016. (3 DE3)

NORTE PERÚ 2016. (2 DE3)

NORTE PERÚ 2016. (1 DE3)

VIVÈNCIES PER NOOBLIDAR... O MILLOR SÍ?

ALTA GARROTXA.EXPLORACIONSESPELEOLÒGIQUES, 1994- 1999

http://espeleobloc.blogspot.com.es/2016/12/nous-coleopters-cavernicoles-ports-i.html#comment-form

2 de 12

catàleg espeleològic...18 Desembre 2016

10 blocs a Catalunyarecentment actualitzats

espeleovictorAvencMontserratUbach.Odèn(Lleida)

Fa 10 hores

GEBEscuain 2016. Memòriad’ExploracionsFa 14 hores

Grup Espeleo 15d'Abril

AVENCD'ENPASSANT

Fa 1 dia

Avenc MontserratUbach

Imatges delapresentaciódel llibre aVallirana

Fa 1 dia

Som de l'EGANsuscripcionFa 3 dies

Espeleologia icartofilia

Cova d'Artà

(Capdepera, Mallorca) (I)Fa 4 dies

GES-CMTerrassa.LesCascadesd'eauxchaudes(Gorges TheThues)

barranco termalFa 4 dies

Espeleo Club deGracia

TravesiaGouffre deBurtetch-Grotte deRiusec(Arbas)

Fa 4 dies

Bibliografiaespeleologica

Cueva de

Malalmuerzo y otrascavidades. (GranadaSubterránea IX)Fa 1 setmana

Espeleo Club deTortosaZona Toll i Figuerasses

http://espeleobloc.blogspot.com.es/2016/12/nous-coleopters-cavernicoles-ports-i.html#comment-form

3 de 12

Mostra-ho tot

Fa 1setmana

Blocs d'altres terresgermanes

EntenteSpéléologique duRoussillon | Le clubspéléo du Roussillon...Balade à l'aven GabyFa 12 hores

SociétéSpéléologique duPlantaureljeudi 15 decembre auTerryFa 6 dies

ExplorextremFa 1 setmana

HydrospelFa 5 setmanes

Les TrogloxènesExplorationsSpéléologiquesProspection à l'étrangerFa 1 mes

Spéléophotographiessouterraines -OpenflashspeleoLes Aragonites en fêteFa 7 mesos

Espeleologia enBaleares

Speleo Club Mallorca

Cavitats-Subterrànies

SC des Garrotxes(Pir.Or.)

Nom

Correu electrònic *

Missatge *

Envia

Formulari de contacte

http://espeleobloc.blogspot.com.es/2016/12/nous-coleopters-cavernicoles-ports-i.html#comment-form

4 de 12

http://espeleobloc.blogspot.com.es/2016/12/nous-coleopters-cavernicoles-ports-i.html#comment-form

5 de 12

http://espeleobloc.blogspot.com.es/2016/12/nous-coleopters-cavernicoles-ports-i.html#comment-form

6 de 12

http://espeleobloc.blogspot.com.es/2016/12/nous-coleopters-cavernicoles-ports-i.html#comment-form

7 de 12

http://espeleobloc.blogspot.com.es/2016/12/nous-coleopters-cavernicoles-ports-i.html#comment-form

8 de 12

http://espeleobloc.blogspot.com.es/2016/12/nous-coleopters-cavernicoles-ports-i.html#comment-form

9 de 12

http://espeleobloc.blogspot.com.es/2016/12/nous-coleopters-cavernicoles-ports-i.html#comment-form

10 de 12

http://espeleobloc.blogspot.com.es/2016/12/nous-coleopters-cavernicoles-ports-i.html#comment-form

11 de 12

Entrada més antigaPàgina d'inici

Subscriure's a: Comentaris del missatge (Atom)

http://espeleobloc.blogspot.com.es/2016/12/nous-coleopters-cavernicoles-ports-i.html#comment-form

12 de 12