Wolbachia PCR: Discover the Microbes Within! -...

24
Wolbachia PCR: Discover the Microbes Within!

Transcript of Wolbachia PCR: Discover the Microbes Within! -...

Page 1: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

Wolbachia PCR: Discover the Microbes Within!

Page 2: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

Overview of the Wolbachia Lab

?

DNA extraction PCR

Gel electrophoresis

Insect identification

ACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGTAGTATTCTTGAATATCAAAAATTTTTGTTGGTTATTCA

DNA sequencing

Wolbachia lecture �

Images MBL courtesy of MBL

ACAGATGTC

TTGTAATCCG

GCCGTTGGT

GGCATAGGG

AAAGGACAT

TTAG

Bioinformatics

Page 3: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

Use Wolbachia to Teach Students About:

Ecology & Biodiversity Entomology

Systematics & Taxonomic Keys Cell Biology & Symbiosis

Developmental Biology & Reproduction Molecular Biology: DNA & PCR

Bioinformatics

Page 4: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

What is Symbiosis?

“Humans consist of approximately 10% human !cells and 90% prokaryotic cells, yet the idea of !studying the varied relationships between eukaryotic hosts and prokaryotic symbionts is largely ignored!in biology classes.” ! ! - Seth Bordenstein

Close interactions between different biological species !Mutualism - both species benefit !Commensalism - one species benefits, the other is unaffected !Parasitism - one species benefits, the other is harmed

Page 5: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

Symbiosis Examples

http://www.ucmp.berkeley.edu/fungi/lichens/lichens.html http://www.gettyimages.com/detail/sb10064683e-001/The-Image-Bank http://www.cbc.ca/gfx/images/news/photos/2010/01/07/tech-cleaner-fish.jpg http://www.futurity.org/wp-content/uploads/2010/09/cow-11.jpg http://en.wikipedia.org/wiki/File:Malaria.jpg

Page 6: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

What is Endosymbiosis?

http://www.caf.wvu.edu/~forage/johnsongrass/jgrassroot.jpg

Any symbiotic relationship in which one symbiont lives within the tissues of the other,

either in the intracellular space or extracellularly

FOME 2007 - Volume 14 No. 1, p. 4-5

http://serc.carleton.edu/microbelife/topics/wolbachia/resources.html

Page 7: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

What is Wolbachia? •  Obligate intracellular bacteria found in arthropods and nematodes !!•  Found in ~66% of arthropod species; among the most abundant intracellular bacterial genus so far discovered!!•  Responsible for the induction of a number of reproductive alterations; can alter host biology in diverse ways!!•  Transmitted vertically through host eggs; can also move horizontally across species boundaries!!•  Can have parasitic, mutualistic & commensal relationships with hosts

Nature 412, 12-14 (5 July 2001) http://www.rochester.edu/news/show.php?id=2963

Page 8: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

Wolbachia is a Reproductive Parasite

Nature Reviews Microbiology 6, 741-751 (October 2008)

Def: maternally inherited microbial infections of arthropods that manipulate the reproduction of their host species towards the production or survival of infected female hosts

- Resides mostly within reproductive tissues - Present in mature eggs but not mature sperm - Passed from mother to offspring vertically - Employs 4 strategies to increase # of infected females:

Page 9: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

Feminization

http://aces.nmsu.edu/academics/arthropods/living-arthropods-of-new.html

Land crustaceans, order Isopoda, exhibit feminization with Wolbachia infection

•  Wolbachia resides in androgen-producing glands and inhibits production of male hormones during development •  Causes genotypic males to have female phenotype •  First described in isopods

Page 10: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

Parthenogenesis

http://commons.wikimedia.org/wiki/File:European_wasp_white_bg02.jpg

Wasps, order Hymenoptera: one type of insect that exhibits Wolbachia-induced parthenogenesis

•  A form of asexual or clonal reproduction found females •  Growth & development of embryos occurs without male fertilization •  Caused by disruption of the cell cycle during oogenesis •  Results in diploid female without fertilization

http://commons.wikimedia.org/wiki/File:European_wasp_white_bg02.jpg

Wasps, order Hymenoptera: one type of insect that exhibits Wolbachia-induced parthenogenesis

•  A form of asexual or clonal reproduction found females •  Growth & development of embryos occurs without male fertilization •  Caused by disruption of the cell cycle during oogenesis •  Results in diploid female without fertilization

Page 11: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

Male Killing

http://berkeley.edu/news/media/releases/2007/07/12_butterfly.shtml

Wolbachia causes MK in some butterfly species, order Lepidoptera

•  Wolbachia causes abortion of male embryos during embryogenesis •  Ensures better access to food and resources for females

Page 12: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

Cytoplasmic Incompatibility

http://www.mbl.edu/news/press_releases/2006/2006_pr_05_19.html

Wolbachia causes CI in Nasonia wasps

•  CI is the most frequently found Wolbachia-induced phenotype •  Active area of research; mechanism not clearly known •  Uninfected males cannot produce viable offspring with infected females and vice-versa •  Sperm from Wolbachia-infected males is incompatible with eggs from females that do not harbor the same Wolbachia type

Page 13: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

Filarial Nematodes

•  Not parasitic but mutualistic in nematodes •  Host depends on Wolbachia for development & survival •  Horizontally transmissitted (infection)

Filaria Journal 2003, 2:10

Fliarial worm infected with Wolbachia

Page 14: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

Infections Disease Control using Wolbachia

Diseases caused by filarial worms: Filariasis, River blindness, Heartworms (dogs)

Kill Wolbachia: Patients treated with antibiotics!

Diseases caused by insect vectors of: West Nile virus, Dengue fever, Milaria!

Introduce Wolbachia: will control mosquito populations!

http://www.thehindu.com/multimedia/dynamic/00006/FILARIASIS_6739e.jpg

Page 15: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

Evolutionary Consequences

ABOVE: http://daily.swarthmore.edu/2009/2/19/gilbert-vatican/

•  Wolbachia is an important selective force behind evolution

•  It can accelerate & alter the evolution of it’s host in many ways

•  An current area of intensive research

•  How have Wolbachia induced evolutionary change?

Page 16: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

Lateral Gene Transfer

Approximately one-third of sequenced invertebrate genomes contain Wolbachia gene insertions

Widespread Lateral Gene Transfer from Intracellular Bacteria to Multicellular Eukaryotes

Hotopp et al., 317 (5845): 1753-1756, September 2007

•  Insertional events may contribute to host chromosomal rearrangements: - Acquisition of new genes (gain-of-function) - Disruption of existing genes (loss-of-function) •  May play a part in reproductive isolation and speciation •  Allow species to acquire new genes and functions extremely quickly http://www.rochester.edu/news/photos/hi_res/hi137.jpg

Page 17: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

Evidence of Wolbachia Induced Evolution

Mating behavior alteration Males are rarer Competition between females increases

Loss of sex

Parthenogenesis causes reproductive isolation Loss of functioning sex mechanisms Reduced genetic diversity

Speciation and Extinction

Accumulation of mutations between isolated groups Decreasing population productivity

Page 18: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

The Endosymbiotic Theory

Certain organelles originated as free-living bacteria that were taken inside another cell as endosymbionts

•  Mitochondria developed from α-proteobacteria •  Chloroplasts from cyanobacteria

What does this symbiosis tell us !about the nature of our own cells?!!Could Wolbachia be the next mitochondria? It is maternally inherited also a proteobacteria

Page 19: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

Wolbachia PCR

•  PCR reaction with Master and Primer mixes •  Duplex reaction with insect and Wolbachia-specific primers:

Cytochrome oxidase I: component of electron transport chain, 709 bp Wspec: 16s ribosomal subunit specific to Wolbachia, 438 bp

Students can expect a positive Wolbachia diagnosis in one out of five insects.!

1. 100bp Ladder 2. Fly from SJSU lab, ‘11 3. Ladybug from Mt. View, ‘09 4. Aphids from my tomato plant, ‘10 5. Ant from Sunnyvale, ‘09 6. Large mosquito from San Mateo, ‘09 7. Wol+ control, Nasonia, ‘10

1 2 3 4 5 6 7

709 bp

438 bp

Page 20: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

Sequencing and Bioinformatics 1.  Students submit positive Wolbachia PCR samples for ! DNA sequencing !!2. BLAST the results to see if they matches a known

sequence!!3. Upload the Wolbachia sequence with those in a national

database (http://discover.mbl.edu/search.php)!

Basic Local Alignment Search Tool

National Center for Biotechnology Information

Bioinformatics is like using Google for DNA sequences

Page 21: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

The Wolbachia Project http://discover.mbl.edu/

Encourage nationwide participation in the collection of new scientific data on bacterial endosymbionts (Wolbachia) Enhance student interest in science through an integrative lab series spanning biodiversity to molecular biology Professional development workshops for teachers: April 16-18 2011

Page 22: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

How Students Contribute

Students who collect their own insect will have a much greater interest in and ownership over the project!

•  The Wolbachia scientific community isn’t big enough to adequately ! sample the world’s arthropod populations for infection rates!!•  Students are potentially the biggest assets in helping scientists !!•  This is an effective motivator because it is publishable online ! at the project’s web site and is accessible by other students, ! teachers, families, and scientists.!

Student generates and uploads data on the infection !rate & geographic distribution of Wolbachia!

Page 23: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

Key Steps for Obtaining Sharable Data

•  Insect handling – Store insect in alcohol and freeze upon collection

•  Record keeping – Collection site, date, insect photos, identification

•  DNA handling – Use a very small portion of insect abdomen for DNA extraction – Store DNA and PCR products in the freezer

•  Send complete information – Gel image

•  BLAST new Wolbachia sequence – Information about “subgroup”

Page 24: Wolbachia PCR: Discover the Microbes Within! - babec.orgbabec.org/wp-content/uploads/2016/12/Wolbachia_PCR_Presentation.… · that exhibits Wolbachia-induced parthenogenesis ...

Acknowledgements

MBL and The Wolbachia Project Seth Bordenstein, Vanderbilt University John Werren, University of Rochester

The International Wolbachia Conference Group