Wolbachia Infection and Cytoplasmic Incompatibility in ...Wolbachia Infection and Cytoplasmic...

Copyright 6 1996 by the Genetics Society of America

Wolbachia Infection and Cytoplasmic Incompatibility in Drosophila Species

Kostas Bourtzis,* Androniki Nirgianaki,*9t George Markakis* and Charalambos Savakis*"

*Insect Molecular Genetics Group, Institute of Molecular Biology and Biotechnology, Foundation for Research and Technology - Hellas, Heraklion, Crete, Greece, and tDiuision of Medical Sciences and :Department of Biology, University of Crete, Heraklion, Crete, Greece

Manuscript received November 6, 1995 Accepted for publication July 29, 1996

ABSTRACT Forty-one stocks from 30 Drosophila species were surveyed for Wolbachia infection using PCR technol-

ogy. D. sechellia and two strains of D. auraria were found to be infected and were tested for the expression of cytoplasmic incompatibility, along with D. ananassae and D. melanogaster strains, which are already known to be infected. D. ananassae and D. melanogaster show levels of incompatibility up to 25%, while D. auraria and D. sechellia exhibit levels of egg mortality -60%. A dot-blot assay using the d n d sequence as probe was developed to assess the infection levels in individual males that were used in incompatibility crosses. A positive correlation between bacterial density and cytoplasmic incompatibility was observed. The stocks examined can be clustered into at least two groups, depending on the levels of infection relative to the degree of cytoplasmic incompatibility exhibited. One group, containing D. simuluns Hawaii, D. sechellia, and D. auraria, exhibits high levels of cytoplasmic incompatibility relative to levels of infection; all the other species and D. simulans Riverside exhibit significantly lower levels of cytoplasmic incompatibility relative to levels of infection. These data show that, in addition to bacterial density, bacterial and/ or host factors also affect the expression of cytoplasmic incompatibility.

w OLBACHIA, a maternally inherited microorganism, was first described in the Culex pipiens com-

plex (HERTIG 1936) and it has since been associated with cytoplasmic incompatibility, thelytoky and feminization phenomena in a variety of arthropods. Cyto- plasmic incompatibility in insects results in either em- bryo mortality or production of all-male progeny from a cross between an infected male and an uninfected female and it has been reported in diverse insect taxa, i.e., Coleoptera (HSIAO and HSIAO 1985; WADE and STE- VENS 1985), Diptera (YEN and BARR 1973; TRPIS et al. 1981; HOFFMANN and TURELLI 1988; BINNINGTON and HOFFMANN 1989; LOUIS and NIGRO 1989; O'NEILL and KARR 1990; KAMBHAMPATI et al. 1993; BOURTZIS et al. 1994; HOFFMANN et al. 1994; SOLIGNAC et al. 1994), Ho- moptera (NODA 1984), Hymenoptera (RICHARDSON et al. 1987; BREEUWER and WERREN 1990), Lepidoptera (BROWER 1976; KELLEN et al. 1981) and in the terrestrial isopod Porcellio dilatatus (LEGRAND and JUCHAULT 1986). Thelytoky is the term used to describe female- to-female parthenogenesis. This mode of reproduction has been shown to be the result of the presence of Wolbachia symbionts in several Hymenoptera (STOU-

Finally, feminization is the phenomenon described in the terrestrial isopods of the genus Armadillidium where the presence of Wolbachia is responsible for the conversion of genetic males to functional females (Rr- GAUD et al. 1991; RlGAUD and JUCHAULT 1993).

THAMER et al. 1990, 1993; ZCORI-FEIN et al. 1992, 1995).

Currespunding author: Charalambos Savakis, Institute of Molecular Biology & Biotechnology, Foundation for Research and Technology - Hellas, P.O. Box 1527, Heraklion 711 10, Crete, Greece. E-mail: [email protected]

Genetics 144: 1063-1073 (November, 1996)

Sequence analysis of the genes encoding 16s rDNA of Wolbachia from diverse insect taxa has indicated that all of them are very closely related and belong to the alpha subdivision of proteobacteria forming a mono- phyletic group, assigned to the type species W. pipientis (BREEUWER et al. 1992; O'NEILL et al. 1992; ROUSSET et al. 1992; STOUTHAMER et al. 1993). However, the 16s rDNA sequence is too conserved for the classification of related endoparasites infecting different host species. Recently, two other potentially useful markers for such studies have been cloned from Wolbachia-infected D. melanogaster strains, the cognates of the bacterial d n d and ftsZ genes (HOLDEN et al. 1993a; BOURTZIS et al. 1994). Compared with the 16s rDNA, both dnuA and ftsZ sequences are far less conserved and could be useful for the clarification of phylogenies within the W, pipientis complex.

Although it can not be cultured outside the host or- ganism, Wolbachia can be detected with the use of elec- tron microscopy (YEN and BARR 1971, 1973; WRIGHT et al. 1978; WRIGHT and WANG 1980; WRIGHT and BARR 1980, 1981; TRPIS et al. 1981; KELLEN et al. 1981; HSIAO and HSIAO 1985; BINNINGTON and HOFFMANN 1989; LOUIS and NIGRO 1989; O'NEILL 1989), fluorescent stains of DNA (O'NEILL and KARR 1990; BOYLE et al. 1993; BRESSAC and ROUSSET 1993; BRAIG et al. 1994) and by conventional stains like Giemsa, Lacmoid and Gimenez (HERTIG 1936; BREEUWER and WERREN 1990; BOURTZIS et al. 1994). Eradication of Wolbachia from insect tissue is possible with antibiotic treatment or ele- vated rearing temperatures. The resulting cured strains are useful in reciprocal crosses to determine the cause

1064 K. Bourtzis et al.

and nature of parasite action and transmission (YEN and BARR 1971, 1973; PORTARO and BARR 1975; TRPIS et al. 1981; KELLEN et al. 1981; WADE and STEVENS 1985; &CHARDSON et al. 1987; HOFFMANN and TURELLI 1988; HOFFMANN 1988; O'NEILL and KARR 1990; STOUTHAMER et al. 1990; BREEUWER and WERREN 1990, 1993; MONT- CHAMP-MOREAU et al. 1991; BOURTZIS et al. 1994). It has also been shown that the severity of cytoplasmic incompatibility is significantly reduced in crosses involving aged males (SINGH et al. 1976; HOFFMANN et al. 1986; GIORDANO et al. 1995) and it is probably due to egg fertilization by sperm developed in spermatocysts lack- ing Wolbachia (BINNINGTON and HOFFMANN 1989; BRESSAC and ROUSSET 1993). However, the mecha- nism(s) of the reproductive alterations caused by Wol- bachia is not well understood. In incompatible crosses in C. pipiens, the egg is activated by the sperm and the meiotic divisions begin but the sperm does not fuse with the pronucleus. Most of the embryos die but the developing ones (0.1%) are haploid ( JOST 1970a,b, 1971). Aberrant DNA structures are found in fertilized eggs of incompatible crosses in D. simulans (O'NEILL and KARR 1990). In incompatible crosses in Nasonia genus, it was shown cytogenetically that the paternal chromosomes fail to condense properly, forming a tan- gled mass, and are lost. Because of haplodiploid sex determination, these crosses produce all-male progeny (RYAN and SAUL 1968; BREEUWER and WERREN 1990; REED and WERREN 1995). Thus in insects, the net result in incompatible crosses is paternal chromosome elimi- nation during early embryogenesis. On the other hand, in Crustacea, sex differentiation of males is normally determined by hormones released from the androgenic gland. In Wolbachia-infected males, the bacteria some- how alter the function of this gland, thus converting normal males to functional females ( JUCHAULT and LE-

Bidirectional incompatibility, occurring in crosses between infected males and females of different strains of the same species or between species, has been described first in C. pipiens (YEN and BARR 1973), and subse- quently observed also in D. simulans (O'NEILL and KARR 1990; MONTCHAMP-MOREAU et al. 1991; NIGRO 1991) and between species of the parasitoid wasp Nasonia (BREEUWER and WERREN 1990). Although the mecha- nism of cytoplasmic incompatibility is still unclear, it is believed that bidirectional incompatibility is the result of the presence of different infective Wolbachia strains ( NIGRO 1991; ROUSSET et al. 1992; BREEUWER and WER- KEN 1993; BRAIG et al. 1994).

There have been a number of studies showing that D. melanogasterand D. simulans infected with Wolbachia display partial and almost complete cytoplasmic incompatibility, respectively (HOFFMANN et al. 1986, 1994; HOFFMANN 1988; O'NEILL and KARR 1990; MONT- CHAMP-MOREAU et al. 1991; BOURTZIS et al. 1994; SOLIG NAC et al. 1994). Variation in bacterial density has been recently considered as an important determinant for

GRAND 1981).

the variation of the levels of cytoplasmic incompatibility (BOYLE et al. 1993; BREEUWER and WERREN 1993). In this report we present data showing that D. sechellia, D. ananassue, two strains of D. auram'a and several strains of D. rnelanogaster infected with Wolbachia express low to high levels of cytoplasmic incompatibility. We also present a method for quantification of infection levels in individual flies and show that there is strong correlation between Wolbachia levels and severity of cytoplasmic incompatibility. We also show that, in addition to bacterial density, host and/or bacterial factors play a major role in determining the levels of cytoplasmic incompatibility.

MATERIALS AND METHODS

Flies: Sources of the Drosophila species used are listed in Table 1. Flies were used for DNA extraction upon their arrival. The IMBB D. melanogaster strains presented in Table 2 were obtained from several sources and have been kept at the laboratory for many generations. D. simulans Riverside (DSR) flies (infected and cured) were provided by Dr. T. KARR and D. simuluns Hawaii (DSH) flies were provided by Dr. S. O'NEILL. Flies were routinely grown at 25" on cornflour/sugar/yeast medium (10 g agar, 20 g sugar, 50 g yeast, 60 g cornflour, 0.15 g Nipogin made up to 1 liter with water). Tetracycline- treated strains were established by rearing flies for two generations on standard medium containing tetracycline 0.025% (w/v) final concentration.

Testing for incompatibility: Matings to test for the presence of cytoplasmic incompatibility were performed in bottles upturned on agar/molasses plastic Petri dishes. The dishes were replaced daily to monitor the number of eggs laid. Hatching rates were scored 36 hr after egg collection. For each species/strain tested, the following four types of crosses were set up: infected female X infected male, infected female X uninfected male, uninfected female X infected male, uninfected female X uninfected male. A tetracycline-treated Ore- gon-R strain (ORT) was used as the reference Wolbachia-free strain for all the D. melunogaster strains tested. All matings were set up with one female and one male (both 2 to 4 day- old virgins). The parents of each cross were tested by PCR for the presence of Wolbachia. The females from the crosses that did not produce any larval progeny were tested for insem- ination. Crosses from noninseminated females were excluded from further analysis. Compatibility was assessed by the ratio of larvae hatched over the total egg count of each cross. Pairs of crosses were compared using the t-test after arcsine trans- formation of the data (SOKAL and ROHLF 1995 p. 419). In the case of multiple comparisons, correction of the significance levels was done according to the Bonferroni method (SOW and ROHLF 1995 p. 240).

Fecundity was measured in D. ananassue and D. sechellia, to test whether the presence of Wolbachia alters the productivity of these species. Crosses for the productivity tests were set up as described above and progeny were collected for 3 days from D. ananussue and 14 days from D. sechellia. Comparisons were performed using an one-tail t-test.

General methods: DNA for the survey presented in Table 1 was prepared from 10 flies of each stock as follows: flies were homogenized with a clean sterile polypropylene pestle using 50 pl of STE per fly (100 mM NaCl/10 mM Tris C1 pH 8.0/1 mM EDTA pH 8.0) and incubated with 2 p1 per fly of proteinase K (10 mg/ml) for 30 min at 37" followed by 5 min, at 95". Samples were briefly centrifuged and 1 pl of the supernatant was used as template for PCRs (O'NEILI. et al. 1992).

Cytoplasmic Incompatibility 1065

Nucleic acids from single flies were dot-blotted to zeta- probe blotting membranes (Biorad) according to manufac- turer's instruction manual. DNA probes were prepared by random hexanucleotide riming (FEINBERG and VOGELSTEIN 1983). Hybridizations of 'P-labeled probes to blotted nucleic acids were performed using standard procedures (CHURCH and GILBERT 1984; SAMBROOK et al. 1989).

PCR The presence of Wolbachia was determined by PCR using both dnaA and 16s rDNA Wolbachia-specific primers. The dnaA primers were designed according to BOURTZIset al. (1994) and were as follows: 5'-GTCATCTTGATGGAG TGGAA-3' (symbiont positions 74-93 forward) and 5'-GAT- CTCGACCGCCGAAGTTT-3' (symbiont positions 553-534 reverse); these primers amplify a 480-bp fragment. The 16.5 rDNA primers were designed according to O'NEILLet al. (1992) and were as follows: 5'-TTGTAGCCTGCTATGGTA- TAA CT-3' (Escherichia coli positions 76-99 forward) and 5'- GAATAGGTATGATMTCATGT-3' (E. coli positions 1012- 994 reverse); these primers amplify a 896-bp fragment. A Dro- sophila mitochondrial gene was used as positive control for amplification; the primers cytbl (5'primer) 5'-ACCAGCTCG AATTAATATTTCAAGATGA TGA-3 and cytb2 (3' primer) 5'- TACAGTTGCTCCTCAAAATGATATT TGTCCTCA-3' were used, which amplify a 373bp fragment of the mitochondrial gene encoding cytochrome b (CLARY and WOLSTENHOLME 1985). All PCR analyses involved an initial denaturation for 5 min at 94" and 30 cycles of denaturation at 94" for 1 min, annealing at 50" for the dnuA and q t b and 52" for the 16s rDNA for 1 min, and extension at 72" for 2 min. The PCR conditions included 1.5 mM MgC12, all four dNTPs (each at 200 y ~ ) , 1.25 units of Taq polymerase (Promega), and 400 nmol of each primer.

Cloning and sequencing of dnuA and 16SrDNA PCR fragments were cloned into pGEM-T vector (Promega). These clones were used to prepare double-stranded sequencing template (SAMBROOK et al. 1989). DNAsequencing of both strands using the dideoxynucleotide chain termination method was carried out using vector-specific or gene-specific primers.

DNA and protein sequence analysis: DNA and protein sequences were analyzed with the University of Wisconsin Ge- netics Computer Group programs (DEVEREUX et al. 1984).

Density of Wolbachia in individual flies: DNA was extracted by the STE method from single flies. One microliter of the supernatant (out of 50 y1) was used as template for PCR analysis with Wolbachia-specific primers for the dnuA gene. The rest (49 yl) was dot-blotted to zeta-probe blotting membrane that was hybridized with the PCR-derived dn.aA fragment (480 bp). The autoradiograms were scanned and then analyzed using the NIH Zmageimage analysis software (version 1.52). In each membrane there was a series of eight standards, consisting of twofold dilutions of the plasmid carrying the dnaA gene (3444 bp), starting from 128 pg of plasmid. To keep a constant DNA concentration in all the standard samples, the dilutions were done in DNA solution extracted by the STE method from uninfected flies. The autoradiographic signal in the standards was linear with amount of plasmid DNA, after subtraction of background. Bacterial densities, expressed as bacterial equivalents per male, were calculated from the autoradiographic intensities using linear regression (see Figure 1). No corrections were made for overall DNA recovery.

For statistical analysis, the bacterial densities (bacterial equivalents per male) were square root transformed because the group variances were proportional to means, and analyzed by ANOVA followed by a multiple comparison technique (Tu- key test, SOKAL and ROHLF, 1995 p. 240-260).

Cytoplasmic incompatibility us. bacterial density: For the purpose of this analysis, we use the Cytoplasmic Incompati- bility Quotient (CIQ) as a measure of the severity of cyto-

plasmic incompatibility. CIQ is defined as the ratio of egg mortality of an incompatible cross divided by the mean egg mortality of the respective reciprocal cross. For each infected species or strain tested, the mean bacterial equivalents per male used in incompatible crosses was plotted against the corresponding mean CIQ. Possible clustering of the strains was explored using the chord distances between all possible pairs of crosses (PIELOU 1984 pp. 47-49). The chord distance between a pair of oints in the two dimensional space is defined by d = + 2( 1 - cos@, where 0 is the angle between the lines connecting each of the two points with the origin. In this approach, points are close to each other when the corresponding angle (and therefore, the chord distance) is small. These chord distances were used for constructing a UPGMA dendrogram (SNEATH and SOUL 1973 pp. 230- 234). To determine whether the groups revealed by the dendrogram are significantly different, the data were analyzed by an ANOVA of logarithmically transformed ratios (CIQ divided by bacterial equivalents per male), followed by the orthogonal decomposition of the sum of squares (SOKAL and ROHLF 1995 p. 229-236).

RESULTS

Wolbachia infection in Drosophila species: PCR amplification of dnaA and 16SrDNA sequences was used to survey 30 Drosophila species including three stocks of D. serrata, three stocks of D. auraria, two stocks of D. jambulina, four stocks of D. mojauensis and four stocks of D. arizonensis. In total, 41 stocks from various collections were screened. As shown in Table 1, infection was detected only in D. sechellia and in two stocks of D. auraria. In all cases, the results were consistent with both sets of primers. Positive amplification signals were obtained from all samples in control PCR reactions using primers specific for cytochrome b DNA. Based on the PCR data of the present and other studies only eight out of 48 Drosophila species tested have been found infected. These are as follows: D. melanogaster, D. simulans, D. sechellia and D. mauritiana belonging to the melanogaster subgroup, D. auraria from the montium subgroup, D. ananassae from the ananassae subgroup, D. recens from the quinaria species group and D. orientacea from testacea species group (O'NEILL et al. 1992; BOURTZIS et al. 1994; GIORDANO et al. 1995; WERREN andJmNIm 1995).

The amplified fragments of the dnaA (480 bp) and 16SrDNA (896 bp) sequences from the infected D. auraria, D. sechellia and D. ananassue stocks were cloned and several clones were sequenced. Two dnaA clones from D. auraria and two from D. ananassae, derived from independent PCR reactions, and one clone from D. sechellia that were sequenced were found to be identical to each other and to the dnaA sequence of Wol- bachia from D. simulansRiverside (BOURTZIS et al. 1994) (data not shown). Thus, this part of the d n d gene appears to be too conservative to reveal any possible differences between Wolbachia strains infecting different insect species/strains.

Moreover, five 16SrDNA clones from D. auraria, three from D. ananassae and two from D. sechellia, derived from two independent PCR reactions from each spe-

1066 K Bourtzis el al.

standards ORT y, ~ 6 7 ~ 2 3

dp, b, en, bw P[MHC-lac21 ORT v , w; TM3/D,gP

16 T 8

8

TM3/Ly, e2 d

CyO/Bc, Elp; n ) 2 8 .

DSRT

8

y, w67~23 0

o ? I

0 so 100 I50

plasmid DNA, pg FIGURE 1.-The dot-blot assay used to determine the Wolbachia infection levels. (Left) An example of an autoradiogram of

a dot-blot. Each dot contains homogenate from one male. Standards are twofold dilutions of the plasmid carrying the amplified dnaA fragment (128-1 pg DNA). (Right) Plot of optical density us. amount of plasmid DNA. Data are from the eight standard dots of the blot on the left.

cies, were sequenced and found to be identical to each other and to the 16SrDNA sequence of Wolbachia found in D. melanogaster, but different in two positions from the 16SrDNA sequence found in D. simulans River- side (BOURTZIS et al. 1994) (data not shown). We con- clude from these results that the bacteria infecting the several Drosophila species are very highly related, if not identical.

Wolbachia-induced cytoplasmic incompatibility among D. melanoguster strains and other Drosophila species: In a previous study we found several laboratory strains of D. mhnogaskrinfected with Wolbachia and showed that one of them (Oregon-R) presents partial cytoplasmic incompatibility in crosses of infected males to cured females of the same strain (BOURTZIS et al. 1994). To test whether other infected laboratory strains of D. melanogaster express cytoplasmic incompatibility similarly, we set up single-pair crosses between Wolbachia-infected flies from the strains y,w67c23, T M ~ / L Y , ~ ~ ~ ~ , y,w;TMS/D gt', dp,b,cn,bw, P[MHGlacZ] and CyO/BcElp;?y, and a cured Oregon-R strain obtained by tetracycline treatment (ORT). The results presented in Table 2 show a statistically significant reduction in egg hatching in all crosses between infected males and ORT females, compared to the control cross between uninfected flies (t-test, P 5 0.001).

To determine whether the infected strains of D. sechellia, D. ananassm and D. auraria also express cytoplasmic incompatibility, we used tetracycline treatment to produce Wolbachia-free strains. Cured strains were obtained from D. sechellia and D. ananassm. No Wolbachia- free flies were recovered from either of the D. auraria strains, even after treatment with concentrations of tetracycline five times higher than usual. A similar phe-

nomenon has been observed with a strain of Tribolium confusum (O'NEILL 1989). Therefore, the incompatibility in D. auraria was tested with the uninfected strain D. auraria#0471.0 (see Table 1). The results presented in Table 3 indicate that the three infected Drosophila species express cytoplasmic incompatibility. The crosses of infected males with uninfected females showed a significant decrease in egg viability when compared to the control crosses between uninfected flies (Table 3).

Wolbachia infection and fecundity: It has been shown previously that Wolbachia infection can reduce fecundity in infected D. simuhns females but not in infected D. melanogaster (HOFFMANN et al. 1990, 1994). To test the infected D. ananassm and D. sechellia stocks for a similar Wolbachia-induced effect, their fecundity was compared with that of the uninfected strains derived after tetracycline treatment. The D. aururia stocks were not tested in this way, because cured strains could not be generated. The mean number of eggs produced by infected D. ananassm females over 3 days was 63.3 (S.E. = 6.01, n = 28), while the mean number of eggs from uninfected females was 52.4 (S.E. = 4.27, n = 26). A one-tailed t-test showed that the difference between these means was not significant ( t = 1.47, d.f. = 52, P = 0.074). The mean hatch rate of the infected D. anan- assmstrain was 17.5% (S.E. = 2.9%, n = 28), while the mean hatch rate of the uninfected strain was 14.76% (S.E. = 2.7%, n = 26). A t-test showed that the difference between these means was not significant ( P = 0.49). Infected D. sechellia females produced over 14 days a mean of 27.8 eggs (S.E. = 2.73, n = 24), while the mean from uninfected females was 32.9 eggs (S.E. = 3.05, n = 26). The difference between these means was also not significant ( t = 0.61, d.f. = 48, P = 0.27).

Cytoplasmic Incompatibility

TABLE 1

Drosophila species tested for presence of Wolbachia DNA sequences by PCR

1067

Subgenus Species group Subgroup Species Stock no. Wolbachia Source“

Sophophma melanogaster melanogaster

elegans montium

takahashii obscura obscura willistoni willistoni

saltans saltans bocainensis

sturtevanti

Drosophila virilis virilis repleta mulleri

repleta mercatorum hydei

immigrans immigrans

nasuta

sechellia erecta ekgans bocqueti sarata serrata serrata auraria auraria auraria bicornuta jambulina jambulina kikkawai seguyi takahashii pseudoobscura willistoni capncorni saltans posaltans sturteuanti palladosa virilis arizonensis arizonensis arizonensis arizonensis mojauensis mojauensis mojavensis mojauensis mullen’ mercatorum hydei eohydei albomicans immigrans nasuta amm’cana

$9 S18

14027-0461.0 S 3

3019.7 3022.1

2 17.8

14028-0471.0 3146.9 3116.11 3120.5

14028-0671 .O 14028-0056.0

14011-0121.0 14030-0811.0

14045-0911.0 14045-0901.0 14043-0871.0 140240433.0

14030-0721.0

15010-1051.0 15081-1271.0

435 874 875

15081-1351.0 757 868 871

15081-1371.0 15082-1511.0

150851631.0 140241751.2

140241781.0 15010-0951.0

15085-1641.0

15111-1731.0

A A

BG A S S S S S

BG S S S S S A

BG BG BG BG Z

BG Z Z

BG Z Z Z

BG Z Z Z

BG BG BG BG Z

BG Z 2

Scaptodrosophila victoria lebanonensis kbanonensis 11010-0021.0 - BG

Sources of species: A, M. ASHBURNER stock collection, Cambridge, UK; BG, Bowling Green Stock Center, Bowling Green, Ohio; S, Z. SKOURAS, University of Thessaloniki, Greece; Z, E. ZOUROS, University of Crete, Greece. All strains were used for DNA extraction upon arrival at the laboratory. At least five separate DNA extractions followed by PCR were performed.

The mean hatch rate of the infected D. sechellia strain was 6.50% (S.E. = 0.85%, n = 24), while the mean hatch rate of the uninfected strain was 9.19% (S.E. = 1.30 %, n = 26). A t-test showed that the difference between these means was not significant ( P = 0.39). These results show that Wolbachia infection does not have any detectable effect on fecundity in D. ananassae and D. sechellia.

Bacterial density and cytoplasmic incompatibility: For a comparison of the degrees of cytoplasmic incompatibility expressed by the strains and species examined we have calculated the mean CIQ, which was

defined as the ratio of egg mortality of an incompatible cross, divided by the mean egg mortality of the respective reciprocal cross. We have included in this analysis the two D. simulans strains, DSR and DSH. The mean egg mortality above the “background” mortality of the respective reciprocal crosses was 82.04% in D. simulans Riverside and 80.58% in D. simulans Hawaii (data not shown). As shown in Table 4, the levels of cytoplasmic incompatibility, expressed as CIQ, differed widely among the species and strains examined. The multiple comparison analysis suggested the presence of two distinct groups of strains, a “high C I Q ’ group consisting


TABLE 2 Cytoplasmic incompatibility in single-pair crosses between infected D. rnelunogastm

strains and a tetracycline-treated Oregon-R strain

Percentage Cross (female X male) Eggs Females mortality Comparison''

1, y,Wh7(:23 X y,w47(:23

2. y,wh7'"' X ORT 3. ORT X y,wh7"' 4. ORT X ORT 5. y,w;TM3/D g13 X y,w;TMS/D gl'

6. y,w;TM3/D gl' X ORT 7. ORT X y,w;TMS/D gl' 8. dp,b,cn,bw X dp,b,cn,bw 9. dp,b,cn,bw X ORT

10. ORT X dp,b,cn,bru 11. P(MHC-lacZ) X P[MHC-lacZ) 12. P(MHC-lacZ) X ORT 13. ORT X P[MHC-lacZ] 14. CyO/Bc,E&;ry X CyO/Bc,Elp;ry

15. CyO/Bc,Elp;ry X ORT 16. ORT X CyO/Bc,Elp;ry 17. TM3/Ly;ry4' X TM3/Ly,ly4'

18. TMS/Ly,ry" X ORT 19. ORT X TM3/Ly,7y4'

1221 1438 2093 848

1294

1312 1557 1462 1161 1442 1321 1169 1645 1174

885 1686 1125

21 24 29 19 21

21 19 25 22 23 18 18 23 25

21 24 25

13.46 2 1.87 11.69 2 1.84 31.52 t 3.39 9.43 rt 1.58

53.93 2 1.47 (7.86 2.94)" 16.96 2 2.14 27.49 ? 3.48 26.13 t 3.31 26.27 2 3.47 39.48 2 4.36 17.57 t 3.45 14.17 f 3.36 22.71 t 3.22

a58.40 2 2.08 (16.08 2 4.16) 16.00 2 2.15 12.06 2 2.78

a50.89 2 1.80 (1.77 2 3.59)

1 us. 2 (NS)

3 us. 4 (<0.001)

5 us. 6 (NS)

7 us. 4 (<0.001)

8 us. 9 (NS) 10 us. 4 (<0.001

11 us. 12 (NS) 13 us. 4 (<0.001

14 us. 15 (NS)

16 us. 4 (0.001)

17 us. 18 (NS)

888 19 8.81 f 1.96 19 us. 4 (<0.001) 1523 24 29.34 2 4.54

Incompatibility is reported as percentage mortality I+_ SE. ORT, Oregon-R strain; NS, not significant. I' The expected mortality of these crosses is 50%. The numbers into the parentheses are the corrected mean mortalities of

these crosses, which were estimated for each replicate cross by subtracting the expected 50% mortality and then multiplied by two. This correction was done to facilitate the statistical analysis.

"Pairs of crosses were compared using the t-test. Values in parentheses are Pvalues.

of D. sechellia, D. auraria and D. simulans strains, and a density is an important parameter for the variation of "low CIQ" group, consisting of D. ananussue and the the levels of cytoplasmic incompatibility (BOYLE et al. D. melanoguster strains. 1993; BREEUWER and WERREN 1993). To test this hy-

It has been suggested that variation in Wolbachia pothesis, we developed a dot-blot assay that allows deter-

TABLE 3

Cytoplasmic incompatibility in single-pair crosses between infected strains of D. sechellia, D. ananassae, and D. auraria, and cured (tet) or uninfected ones

Cross Eggs Females Percentage mortality

1. D. sechellia X D. sechellia 2. D. sechellia X D. sechellia tet 3. D. sechellia tet X D. sechellia tet 4. D. sechellia tet X D. sechellia 5. D. ananassae X D. ananassae 6. D. ananassue X D. ananassae tet 7. D. ananassae tet X D. ananassue tet 8. D. ananassue tet X D. ananassae 9. D. auraria #2 X D. auraria #2

10. D. auraria #2 X D. auraria #0471.0 11. D. auraria #0471.0 X D. auraria #0471.0 12. D. auraria #0471.0 X D. auraria #2 13. D. auraria#17.8 X D. auraria #17.8 14. D. auraria #17.8 X D. auraria M471.0 15. D. auraria #0471.0 X D. auraria #17.8

669 24 857 26 839 26 854 19

2845 35 2943 37 1495 17 2061 21 1159 20 951 20

1102 21 1087 21 1361 26 1099 23 1116 24

5.42 t 1.08 7.30 t 1.41

10.20 t 1.55 69.69 t 5.82 19.65 t 3.86 17.58 t 4.01 16.92 t 5.04 42.00 t 3.65 21.82 2 4.21 18.98 t 2.90 18.80 2 2.94 96.35 t 1.03 15.49 2 2.34 18.23 2 3.58 97.46 t 0.91

Comparison"

1 us. 2 (NS)

3 us. 4 (<0.001)

5 us. 6 (NS)

7 us. 8 (<0.001)

9 us. 10 (NS)

11 us. 12 (<0.001)

13 us. 14 (NS)

15 us. 11 (<0.001)

Incompatibility is reported as percentage mortality f SE. NS not significant. " Pairs of crosses were compared using the t-test. Values in parentheses are P values.

~~ ~


TABLE 4 male presented in Figure 2A suggests a possible group- M~~ of c y t o p l a s ~ c i n c o m p a ~ b ~ ~ quotient bacterial ing of the strains, with different dependence of CIQ equivalents per m& in infected Drosophih ~Eanogaster and on bacterial equivalents per male. One group (named

other Drosophila species analyzed by ANOVA group A) includes DSR, D. ananassue, and the six strains of D. melanogaster, while the other (group B) includes

Strain or species N CIQ To test whether these data are indeed clustered, the DSR 22 10.12 t 0.24 36.58 ? 7.17 chord distances between all pairs of strains were calcu- DSH 16 9.78 ? 0.20 5.79 ? 1.09 lated, and a UPGMA dendrogram was constructed from

29 2.70 ? 0.29 7.28 ’ these distances. The dendrogram (Figure 2B) revealed TM3/Ly ~y~~ y w;TM3/D g? 19 24 3’33 ’ 0’52 10‘59 ’ two main groups that are identical with those suggested 1.62 ? 0.21 8.71 2 1.38 dp b cn bw 23 1.50 ? 0.17 9.58 by the plot. To find if this clustering is statistically sig-

P{MHC-lacZ] 18 1.78 ? 0.27 7.84 ? 1.60 crosses (n = 249) was performed, followed by the or-

Bacteria/ma1e DSH, D. sechellia, and the two stocks of D. auraria. (X IO6)

Y47c23

CyO/Bc E&;Ty 13 1.56 2 0.29 5.48 i- 1.46 nificant, an ANOVA using all data from the individual

D. ananassae 21 2.39 ? 0.21 9.51 +. 1.68 D. auraria #2 21 5.08 2 0.05 4.09 ? 0.85 D. auraria # I 7 3 24 5.35 ? 0.05 2.58 +. 0.49 D. sechellia 19 9.55 2 0.80 1.17 ? 0.22

Sum of Mean d.f. squares square Fratio P

CIQ Strains 11 144.18 13.11 39.92 <0.0001 Residual 237 77.81 0.233

Bacteria/male

Strains 11 264.8 24.07 13.22 <0.0001 Residual 237 431.5 1.82

mination of Wolbachia equivalents in individual flies. Using this assay, we screened the 265 male flies used in the CI crosses that were Wolbachia-positive by PCR. Of these males, 249 had measurable levels of Wol- bachia. The 16 males that did not show any hybridiza- tion above background (1 1 from strain CyO/Bc,E&;ly, and five from strain P(MHC:lacZ)) were excluded from further analysis. Representative data obtained with the dot-blot assay are presented in Figure 1. The results of this analysis, summarized in Table 4, show that levels of bacterial infection vary widely among the strains examined; the highest Wolbachia mean density is detected in males of the DSR strain (36.58 X lo6 bacterial equivalents per male). The D. melunogaster strains, as well as the D. ananassue, D. sechellia DSH and D. auraria stocks, show mean densities between 1 to 10 X lo6 bacterial equivalents per male. Tukey’s multiple comparison test (Table 5) indicates that the DSR strain differs significantly from all other strains examined ( P < 0.0001). The other strains form a more or less continu- ous group.

To test whether there is correlation between degree of CI and levels of Wolbachia infection, we plotted the means of the bacterial equivalents of the males used in the potentially incompatible crosses presented in Ta- bles 2 and 3 with the means of CIQ in the corresponding crosses. In this comparison, we only used the males with bacterial densities above the detection levels of our method. The plot of CIQ us. bacterial equivalents per

thogonal decomposition of the sum of squares (SS) . This showed that there are statistically significant differences between the strains (SS = 341.66, d.f. = 1 1 , F = 25.9, P < 0.0001). Following this, the two main branches of the dendrogram were contrasted and a statistically significant difference was found (SS = 280.1 1, d.f. = 1, P < 0.001). The next contrast was between D. sechellia and the subbranch that includes the two strains of D. auraria and DSH; this was also statistically significant (SS = 32.85, d.f. = 1, P < 0.001). The remaining between-strains variation is not significant at 1% level (among the D. auraria strains and DSH, SS = 4.14, d.f. = 2, P = 0.18 and among DSR, D. ananassae, and the six strains of D. melanogasto, SS = 21.15, d.€. = 7, P = 0.02). The statistical significance of this clustering was not affected when the two “extreme” samples (DSR and DSH) were omitted from the analysis (data not shown).

An analysis of the entire data set (n = 269) showed no statistically significant correlation between CIQ and bacterial density. However, a statistically significant correlation exists between levels of infection and severity of incompatibility within group A ( r = 0.539, n = 169, P < 0.001). Within group B there is no statistically significant correlation ( r = 0.021, n = 80, P > 0.05) but excluding D. sechellia, there is statistically significant correlation ( r = 0.27, n = 61, P = 0.035). This analysis strongly supports the hypothesis that two distinct groups are present, and suggests the possible existence of a third. Taken together, these results clearly indicate that Wolbachia density is an important factor affecting the levels of cytoplasmic incompatibility; in addition, the severity of CI is strongly depended upon host and/ or bacterial factors.

DISCUSSION

We have examined several stocks of Drosophila species for the presence of Wolbachia infection using a sensitive PCR assay. The majority of the stocks (38 of 41), belonging to 30 different species, did not contain detectable levels of the bacterium. Only two of the species examined (D. auraria and D. sechellia) were found to be infected. These Wolbachia-positive stocks, along


TABLE 5

Means of cytoplasmic incompatibility quotient and bacterial equivalents per male in infected Drosophila melunagaster and other Drosophila species analyzed by the a posteriuri Tukey test

Strain or TM3/ y,w;TM3/ cyo/ D. auraria D. auraria $pecks DSR DSH y,711"~"' Lyq" Dgl' dp,b,cn,hu Br,Elp;ly P(MHGlacZ) D. ananassue #2 # 178 D. sechellia

DSR NS <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 ~ 0 . 0 0 0 1 <0.0001 0.006 0.013 DSH

NS <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 <0.0001 NS NS NS

TM3/Ly,qJZ <0.0001 NS NS NS 0.006 NS NS NS <0.0001 <0.0001 <0.0001 y,zu;TMS/D,gl' <0.0001 NS NS NS NS NS NS NS <0.0001 <0.0001 <0.0001 dp,b,cn,bw <0.0001 NS NS NS NS NS NS 0.044 <0.0001 <0.0001 <0.0001 CyO/Bc,Elp;q <0.0001 NS NS NS NS NS NS NS <0.0001 <0.0001 <0.0001 P(MHC2acZ) <O.OOOl NS NS NS NS NS NS NS <0.0001 <0.0001 <0.0001 I). ananassne <0.0001 NS NS NS NS NS NS NS <0.0001 <0.0001 <0.0001 D . nuraria#2 <0.0001 NS NS NS NS NS NS NS NS NS NS D. auraria#17.8 <0.0001 NS NS 0.001 NS 0.047 NS NS NS NS NS D. surhullia <0.0001 NS NS <0.0001 0.003 0.003 NS 0.026 0.002 NS NS

YJJJ6""' <0.0001 NS NS NS 0.032 NS NS NS <0.0001 <0.0001 co.ooo1

Values are Pvalues; NS, not significant. CIQ values are above the diagonal; bacterial equivalent values are below the diagonal.

with six D. rnelanogaster strains and one D. ananassae stock that were known to be infected from our previous work, were tested and found to express varying levels of cytoplasmic incompatibility. Using a dot-blot assay that allows Wolbachia quantification in the male parents of individual incompatible crosses, we have shown a strong correlation between CI and infection levels, and have obtained evidence for the existence of at least two groups of infected strains that exhibit different dependence of CI on levels of infection.

The survey presented in Table 1 shows that only three out of the 41 stocks of Drosophila species examined are infected with Wolbachia. Summarizing the results of the present and previous surveys, only eight out of 48 Drosophila species tested have been shown to be Wolbachia-infected. Four of them, D. rnelanogaster, D. sirnulans, D. sechellia and D. rnauritiana, belong to the melanogaster species subgroup, and the rest belong to

15

IO

P U

5

0

m -

different subgroups or groups; D. auraria to the montium subgroup, D. ananassae to the ananassae subgroup, D. recens to the quinaria species group, and D. orientacea to the testacea species group. (O'NEILL et al. 1992; BOURTZIS et al. 1994; GIORDANO et al. 1995; WERREN and JAENIKE 1995).

Sequence analysis of the Wolbachia dnaA (480 bp) and 16s rDNA (896 bp) genes from the infected stocks of D. ananassae, D. sechellia and D. auraria did not show any evidence for different Wolbachia strains present in these stocks. The sequences were >99% identical to each other and to the corresponding sequences from infected stocks of D. sirnulans and D. rnelanogaster. Until recently, the only diagnostic criterion for different Wol- bachia strains has come from observations of bidirectional incompatibility in crosses involving two infected strains of the same species (O'NEILL and KARR 1990). Based on this phenomenon, identification of new Wol-

I Dsimulans Riverside

e Cyo/B~W;ry

,."- 0 TM3/Ly,ry42

P[MHC-lacz/ - A D.ananassae

0 Y,W

m dp,b,m,bw

m y,w;TM3/ D g I

67C23

0 D.simulans Hawaii

D D.aumria #2

D D.auraria #17.8

0 D.sechellia 10 20 30

Bacterial equivalents per male X 10 -6

40

FIGURE 2.-Correlation betweeen degree of cytoplasmic incompatibility and levels of Wolbachia infection in different Drosoph- ila species stocks. (A) Plot of CIQ us. bacterial equivalents per male. (B) UPGMA-dendrogram based on the chord distances between all pairs of strains.


bachia strains is possible by transinfection experiments (BOYLE et al. 1993; BRAIG et al. 1994; GIORDANO et al. 1995; ROUSSET and SOLIGNAC 1995). Recent work has shown that 16s rDNA sequences may be useful for lim- ited phylogenetic analysis of Wolbachia strains infecting diverse arthropods (GIORDANO et al. 1995; ROUSSET and SOLICNAC 1995). These data and our results suggest that the 16s rDNA (and the d n d ) sequences used are not divergent enough to be utilized for distinguishing among different Wolbachia variants. However, two major divisions of Wolbachia were determined based on f tsZ sequence analysis (WERREN et al. 1995), indicating that this gene may be a good marker for resolving Wol- bachia phylogenies.

Cytoplasmic incompatibility, expressed as CIQ was detected in all strains that were positive for Wolbachia, although the degree of incompatibility varied greatly. Tukey’s multiple comparison analysis indicated the existence of two groups of strains, a low CIQ group, consisting of D. ananassae and D. melanogaster strains, and a high CIQ group, consisting of D. simulans, D. auraria, and D. sechelliastrains. Other infected strains of D. sechellia have also been shown to induce cytoplasmic incompatibility of comparable levels (GIORDANO et al. 1995; ROUSSET and SOLICNAC 1995). We do not know whether the differences in the degree of CJ are the result of different Wolbachia strains, different host genotypes, or a combination of the above. Evidence for both bacterial- and host-dependent factors already exists. First, Wolbachia infection does not always cause CI phenomena. A laboratory stock of D. melanogasterand a number of infected natural populations of D. simulans do not express detectable CI (HOLDEN et al. 1993b; TURELLI and HOFFMANN 1995). Second, a Wolbachia strain that cannot induce CI was detected recently by GIORDANO et al. (1995) in D. mauritiana. This Wolbachia was un- able to induce the incompatibility phenotype either in its original host or after being transferred into an uninfected strain of D. simulans. Third, transfer of Wol- bachia from a D. simulans strain showing very high levels of CI to D. melanogaster has resulted in low CI (BOYLE et al. 1993).

Previous studies have indicated that fecundity is the fitness component most affected in Wolbachia-infected D. simulans populations, where egg production is reduced between 10-20% (HOFFMANN et al. 1990). Simi- lar experiments could not detect any significant effect of infection on fecundity in D. melanogasterand D. mauritiana (HOFFMANN et al. 1994; GIORDANO et al. 1995). Our results suggest that the infection has no effect on fecundity in D. ananassue and D, sechellia.

BOYLE et al. (1993) and BREEUWER and WERREN (1993) have presented evidence that variation in bacterial density can influence the severity of cytoplasmic incompatibility. In these and previous studies the Wol- bachia density was determined either with 4’,6-diamid- ino-2-phenylindole (DAF’I) staining of embryos or spermatocysts of Drosophila (BOYLE et al. 1993; BRESSAC

and ROUSSET 1993), or with Lacmoid staining of embryos of Nasonia (BREEUWER and WERREN 1993). We have developed a dot-blot method for quantification of bacteria in individual flies that allows the determination of bacterial densities (expressed as bacterial equivalents per fly) in infected males used for individual crosses. The sensitivity of this method, using a 480-bp dnaA fragment as probe, is comparable to that of PCR for the detection of infections. About 6% (16/265) of PCR- positive flies scored negative by the dot-blot method, while no PCR-negative flies scored positive with the dot blots. The use of larger fragments as probes might in- crease the sensitivity of the method.

Our data (Table 4) showed that the levels of bacterial infection in the fly strains analyzed varied by a factor of 35. The stock with the highest infection levels was DSR (-36.58 X lo6 bacterial equivalents per male), followed by the D. melanogaster strains, D. ananassue, DSH and D. auraria (from -10 X lo6 to -2.5 X lo6 bacterial equivalents per male). D. sechellia showed the lowest infection levels (-1.1 X lo6 bacterial equivalents per male). Using DAF’I staining of embryos, GIORDANO et al. (1995) have obtained similar results, showing that DSR is the most highly infected strain, and D. sechellia is the least infected. DAF’I staining in spermatocysts has also indicated that D. simulans Riverside and Hawaii stocks have different Wolbachia levels (ROUSSET and DE STORDEUR 1994). A fivefold difference between DSR and DSH infection levels has also been shown by a quantitative PCR assay (SINKINS et al. 1995). Morever, it has been shown by DAPI staining that one mature egg of DSR contains -500,000 bacteria (T. KARR, personal communication) ; assuming 10-20 egg equivalents in the ovaries, these numbers are close to our estimates.

Are the differences in the expression of cytoplasmic incompatibility observed between the species compati- ble with the bacterial density hypothesis? Our data allow a test of this hypothesis, because Wolbachia levels were quantified in the individual males that were used in the CI crosses, rather than in embryos or in spermatocysts of their siblings. However, the fact that we are almost wholely ignorant of the molecular mechanisms of CI, and when and where the bacteria exert their effects on the sperm, measuring bacterial densities in adult males may not be relevant to the expression of CI. For example, bacterial densities within individual spermatocyte cells in third instar larvae may be the most important parameter to know. By the time the adult fly is measured for bacterial levels, these levels may have changed in nonspecific ways for different reasons in different species. In this manner, measurement of bacterial levels in eggs from infected females might be a more reliable estimate of the relationship between CI levels and bacterial densities (T. KARR, personal communication).

In a first examination, our results appear to be incon- sistent with the bacterial density hypothesis. First, although there is no significant difference in the numbers of bacteria found in DSH and in D. melanogaster,


D. ananassae, D. sechellia, and D. auraria, these strains exhibit significantly different levels of incompatibility. Second, some stocks of D. melanogaster and D. ananassae contain significantly more bacteria per single male than D. sechellia, although they show significantly lower levels of egg mortality. Third, the mean numbers of bacteria found in DSH males are significantly lower than those in DSR, yet both strains show about the same levels of incompatibility. Finally, the D. melanogaster TM3/Ly,ry4’ strain shows significantly higher levels of bacterial infection than the D. auraria stocks, but it displays significantly lower levels of CI.

However, our analysis (Figure 2 and Tables 4 and 5) suggests that two main groups of stocks exist, differing in the dependence of CIQ on bacterial equivalents per male. The existence of two groups is strongly supported by the statistical analysis. Group A, consisting of the D. melanogasterstrains, D. ananassae, and DSR, is character- ized by lower CIQ values relative to infection levels. Group B, containing the D. auraria strains, D. sechellia, and DSH, shows higher CIQ values relative to infection levels. Within group B a significant difference was found between D. sechellia and the D. auraria strains plus DSH, suggesting that D. sechellia may belong to a third, as yet unidentified, group. Within group A a strong correlation was observed between GI levels and bacterial densities. Agood correlation was also observed in group B, but only after excluding the D. sechellia data.

These results provide strong support for the bacterial density hypothesis. In addition, they demonstrate that factors other than numbers of bacteria may influence the severity of cytoplasmic incompatibility. These factors could be of bacterial or host origin, or could result from an interaction between host and bacteria. We fa- vor the hypothesis that the difference between groups A and B results from bacterial rather than host factors, for the following reasons: First, two strains of the same species, DSH and DSR, belong to different groups; second, phylogenetically more distant species, such as D. melanogaster and D. ananassae, belong to the same group; finally, there is evidence that strains DSH and DSR harbor different Wolbachia variants that cause bidirectional incompatibility (O’NEILL and KARR 1990). An alternative explanation could be that the difference observed between the groups is due to the length of time that the hosts have been associated and interacted with Wolbachia, as suggested by G I o m m o e t al. (1995). These hypotheses can be tested by transinfection experiments in which Wolbachia is transferred to hosts within and between groups.

We thank T. L. KARR, S. L. O’NEILL, J. ROOT, Z. SKOURAS, E. ZOUROS, and the Bowling Green stock centre for insect strains. We thank T. L. KARR for communicating unpublished results, and two anonymous reviewers for valuable comments on the manuscript. We express special thanks to A. BABARATSA~ and J. ROLJVEIM for technical help, and N. KEIAIDI for secretarial assistance.

LITERATURE CITED BINNINGTON, K. C., and A. A. HOFFMANN, 1989 Wolbachielike organ-

isms and cytoplasmic incompatibility in Drosophila simulans. J. Invertebr. Pathol. 54: 344-352.

BOURTZIS, IC, A. NIRGIANAKI, P. ONYANGO and C. SAVAKIS, 1994 A prokaryotic d n d sequence in Drosophila melanagaster: Wolbachia infection and cytoplasmic incompatibility among laboratory strains. Insect Mol. Biol. 3: 131-142.

BOYLE, L., S. L. O’NEILI., H. M. ROBERTSON and T. L. KARR, 1993 Interspecific and intraspecific horizontal transfer of Wolbachia in Drosophila. Science 260 1796-1799.

BRAIG, H. R., H. GUZMAN, R. B. TESH and S. L. O’NEILL, 1994 Replace- ment of the natural Wolbachia symbiont of Drosophila simulans with a mosquito counterpart. Nature 367: 453-455.

BREEUWER, J. A. J., and J. H. WERREN, 1990 Microorganisms associated with chromosome destruction and reproductive isolation between two insect species. Nature 346: 558-560.

BREEUWER, J. A. J., and J. H. WERREN, 1993 Cytoplasmic incompatibility and bacterial density in Nasonia vitripennis. Genetics 135:

BREEUWER, J. A. J., R. STOUTHAMER, S. M. BARNS, D. A. PELLETIER, w. G. WElSBLJRGet ul., 1992 Phylogeny of cytoplasmic incompatibility microorganisms in the parasitoid wasp genus Nusonia (Hy- menoptera: Pteromalidae) based on 16s ribosomal DNA sequences. Insect Mol. Biol. 1: 25-36.

BRESSAC, C., and F. ROUSSET, 1993 The reproductive incompatibility system in Drosophila simuluns: Dapi-staining analysis of the Wol- bachiu symbionts in sperm cysts. J. Invertebr. Path. 61: 226-230.

BROWER, J. H., 1976 Cytoplasmic incompatibility: occurence in a stored-product pest Ephestia cautella. Ann. Entomol. Soc. Amer.

CHURCH, G. M., and W. GILBERT, 1984 Genomic sequencing. Proc. Natl. Acad. Sci USA 81: 1991-1995.

CLARY, D. O., and D. R. WOISTENHOLME, 1985 The mitochondrial DNA molecule of Drosophila yakuba: gene organization, and genetic code. J. Mol. Evol. 22: 252-271.

DEVEREUX, J., M. HAEBERT and 0. SMITHIES, 1984 A comprehensive set of set of sequence analysis programs for the VAX. Nucleic Acids Res. 12: 387-395.

FEINBERG, A. P., and B. VOGELSTEIN, 1983 A technique for radiola- belling DNA restriction endonuclease fragments to high specific activity. Analyt. Biochem. 132: 6-13.

GIORDANO, R., S. L. O’NEILL and H. M. ROBERTSON, 1995 Wolbuchia infections and the expression of cytoplasmic incompatibility in Drosophila sechellia and D. mauritiana. Genetics 140: 1307-1317.

HERTIG, M., 1936 The Richettsia, Wolbachia pipientis (gen. et sp. n.) and associated inclusions in the mosquito, Culexpzpiens. Parasitol-

HOFFMANN, A. A,, 1988 Partial cytoplasmic incompatibility between two Australian populations of Drosophila melanogaster. Entomol. Exp. Appl. 48: 61-67.

HOFFMANN, A. A,, and M. TUREI.I.I, 1988 Unidirectional incompatibility in Drosophila simulans: inheritance, geographic variation and fitness effects. Genetics 119 435-444.

HOFFMANN, A. A,, M. TURELLI and G. M. SIMMONS, 1986 Unidirec- tional incompatibility between populations of Drosophila simulans. Evolution 40: 692-701.

HOFFMANN, A. A,, D. J. CLANCV and E. MERTON, 1994 Cytoplasmic incompatibility in Australian populations of Drosophila melunogas- tpr. Genetics 136 993-999.

HOLDEN, P. R., J. F. Y. BROOKFIELD and P. JONES, 1993a Cloning and characterization of an@? homologue from a bacterial symbiont of Drosophila melanogaster. Mol. Gen. Genet. 240: 213-220.

HOLDEN, P. R., P. JONES and J. F. Y. BROOKFIELD, 1993b Evidence for a Wolbachia symbiont in Drosophila melanogaster. Genet. Res. Camb. 62: 23-29.

HSIAO, C., and T. H. HSIAO, 1985 Rickettsia as the cause of cytoplasmic incompatibility in the alfalfa weevil, Hypera postica. J. Invertebr. Pathol. 4 5 244-246.

JOST, E., 1970a Untersuchungen zur Kreuzungs Sterilitst im Culex pipiens Komplex. Wilhelm Roux Arch. Entwicklungsmech. Org.

JOST, E., 1970b Genetische Untersuchungen zur Inkompatibilitat im Culex pipiens Komplex. Theor. Appl. Genet. 40: 251 -256.

JOST, E., 1971 Meiosis in the male of Cukxpipiens and Aedes alpobictus and fertilization in the Culex p i p i a s complex. Can. J. Genet.

JUCHAULT, P., and J. J. LEGRAND, 1981 Contribution a l’etude quali- tative et quantitative des facteurs controlant le sexe dans les populations du Crustrack Isopode terrestre Amadillidium vulgure latreille 111. Populations n’hkhergeant pas le facteur feminisant

565-574.

6 9 1011-1015.

O ~ Y 28: 453-486.

166: 173-178.

Cytol. 13: 237-250.


F (Bacteroide intracytoplasmique). Arch. Zool. Exp. Gen. 122: 117-131.

KAMBHAMPATI, S., K. S. R41 and S. J. BURGUN, 1993 Unidirectional cytoplasmic incompatibility in the mosquito, Aedes albopictus. Evo- lution 47: 673-677.

KELLEN, W. R., D. F. HOFFMANN and R. A. KWOCK, 1981 Wolbachia sp. (Rickettsiales: Rickettsiaceae) a symbiont of the almond moth, Ephestia cautella: ultrastructure and influence on host fertility. J. Invertebr. Pathol. 37: 273-283.

LEGRAND, J. J., and P. JUCHAULT, 1986 Role de bacteria symbic- tiques dans 1’ intersexualite, la monogenie et la speciation chez des Crustaces Oniscoides. Boll. Zool. 53: 161-172.

LOUIS, C., and L. NIGRO, 1989 Ultrastructural evidence of Wolbachia rickettsiales in Drosophila simulans and their relationships with unidirectional cross-incompatibility. J. Invertebr. Pathol. 5 4 39- 44.

MONTHCHAMP-MOREAU, C., J.-F. FERVEURand M. JACQUES, 1991 Gec- graphic distribution and inheritance of three cytoplasmic incompatibility types in Drosophila simulans. Genetics 129: 399-407.

NIGRO, L., 1991 The effect of heteroplasmy on cytoplasmic incompatibility in transplasmic lines of Drosophila simulans showing a complete replacement of the mitochondrial DNA. Heredity 66:

NODA, H., 1984 Cytoplasmic incompatibility in allopatric field populations of the small brown planthopper, Laodelphax striatellus, in Japan. Entomol. Exp. Appl. 35: 263-267.

O’NEILL, S. L., 1989 Cytoplasmic symbionts in Tribolium confusum. J. Invertebr. Path. 53: 132-134.

O’NEILL, S. L., and T. L. KARR, 1990 Bidirectional incompatibility between conspecific populations of Drosophila simulans. Nature

O’NEILI., S. L., R. GIORDANO, A. M. E. COLBERT, T. L. KARR and H. M. ROBERTSON, 1992 16SrRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects. Proc. Natl. Acad. Sci. USA 89: 2699-2702.

PIELOU, E. C., 1984 The Interpetation of Ecobgacal Data. J. Wiley & Sons, New York.

PORTARO, J. R, and R. A. BARR, 1975 “Curing” Wolbachia infections in Culex pipiens. J. Med. Ent. 12: 265.

REED, K. M., and J. H. WERREN, 1995 Induction of paternal genome loss by the paternal-sex-ratio chromosome and cytoplasmic incompatibility bacteria ( Wolbachia): a comparative study of early embryonic events. Mol. Reprod. Dev. 40: 408-418.

RICHARDSON, P. M., W. P. HOLMES and G. B. SAUL 11, 1987 The effect of tetracycline on nonreciprocal incompatibility in hfor- moniella [= Nmonia] nitripenis. J. Invertebr. Path. 50: 176-183.

&GAUD, T., and P. JUCHAULT, 1993 Conflict between feminizing sex ratio distorders and an autosomal masculinizing gene in the terrestrial isopod Annadillidium vulgare Latr. Genetics 133: 247- 252.

RIGAUD. T., C. SOUTY-GROSSET, R. RAIMOND, J. P. MOCQUARLI and P. JUCHAULT, 1991 Feminizing endocytobiosis in the terrestrial crustacean Annadillidium rulgare Lab. (Isopoda): recent acquisi- tions. Endocytobiosis Cell Res. 7: 259-273.

ROUSSET, F., and M. SOLIGNAC, 1995 Evolution of single and double Wolbachia symbioses during speciation in the Drosophila simulans complex. Proc. Natl. Acad. Sci USA 9 2 6389-6393.

ROUSSET, F., and E. DE STORDEUR, 1994 Properties of Drosophila simulans strains experimentally infected by different clones of the bacterium Wolbachia. Heredity 7 2 325-331.

ROUSSET, F., D. BOUCHON, B. PINTUREAU, P. JUCHAULT and M. SOLIG NAG, 1992 Wolbachia endosymbionts responsible for various alterations of sexuality in arthropods. Proc. R. SOC. London B. 250: 91 -98.

41-45.

348: 178-180.

RYAN, S. L., and G. B. SAUL, 1968 Post-fertilization effect of incompatibility factors in Monnoniella. Mol. Gen. Genet. 103: 29-36.

SAMBROOK, J., E. F. FRITSCH and T. MANIATIS, 1989 Molecular Cbn- ing: A Laburatoly Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SINGH, K. R. P., C. F. CURTIS and B. S. KRISHNAMURTY, 1976 Partial loss of cytoplasmic incompatibility with age in males of Culex fatigans. Ann. Trop. Med. Parasitol. 70: 463-466.

SINKINS, S. P., H. R. BRAIG and S. L. O’NEILL, 1995 Wolbachia pipientis: bacterial density and unidirectional cytoplasmic incompatibility between infected populations of Aedes albopictus. Exp. Paras. 81: 284-291.

SNEATH, P. H., and R .R. SOW, 1973 Numerical Taxonomy. W. H. Freeman and Company, San Francisco.

SOW., R. R., and F. J. ROHLF, 1995 Biometry. The Principles and Prac- tice ofStatistics in Biologtcal Research. W. H. Freeman and Company, San Francisco.

SOLIGNAC, M., D. VAUTRIN and F. ROUSSET, 1994 Widespread occurence of the proteobacteria Wolbachia and partial cytoplasmic incompatibility in Drosophila melanogaster. C.R. Acad. Sci. Paris 317: 461-470.

STOUTHAMER, R., R. F. LUCK and W. D. HAMILTON, 1990 Antibiotics cause parthenogenetic Trichogramma (Hymenoptera/Trichor- grammatidae) to revert to sex. Proc. Natl. Acad. Sci. USA 87:

STOUTHAMER, R., J. A. J. BREEUWER, R. F. LUCK and J. H. WERREN, 1993 Molecular identification of microorganisms associated with parthenogenesis. Nature 361: 247-252.

TRPIS, M., J. B. PERRONE, M. REISSIG and K. L. PARKER, 1981 Control

Hered. 72: 313-317. of cytoplasmic incompatibility in the Aedes scutellaris complex. J.

TURELLI, M., and A. A. HOFFMANN, 1995 Cytoplasmic incompatibility in Drosophila simulans: dynamics and parameter estimates from populations. Genetics 140: 1319-1338.

WADE, M. J., and L. STEVENS, 1985 Microorganism mediated reprc- ductive isolation in flour beetles (genus Tribolium). Science 278

WERREN, J. H., and J. JAENIKE, 1995 Wolbachia and cytoplasmic incompatibility in mycophagous Drosophila and their relatives. He- redity 75: 320-326.

WRIGHT, J. D., and R. A. BARR, 1980 The ultrastructure and symbi- otic relationships of Wolbachia of mosquitoes of the Aedes scutellaris group. J. Ultrastruct. Res. 72: 52-64.

WRIGHT, J. D., and R. A. BARR, 1981 Wolbachia and the normal and incompatible eggs of Aedes polynesiensis (Diptera: Culicidae). J. Invertebr. Pathol. 38: 409-418.

WRIGHT, J. D., and B.-T. W ~ G , 1980 Observations on Wolbachiae in mosquitoes. J. Invertebr. Pathol. 35: 200-208.

WRIGHT, J. D., F. S. SJOSTRAND, J. K. PORTARO and R. A. BARR, 1978 The ultra-structure of the rickettsia-like microorganism Wolbachia pzpientis and associated virus-like bodies in the mosquito Culex pipiens J. Ultrastruct. Res. 63: 79-85.

YEN, J. H., and R. A. BARR, 1971 New hypothesis of the cause of cytoplasmic incompatibility in Culexpipiens L. Nature 232: 657- 658.

YEN, J. H., and R. A. BARR, 1973 The etiological agent of cytoplasmic incompatibility in Culexpzpims. J. Invertebr. Pathol. 2 2 242-250.

ZCHORI-FEIN, E., R. T. ROUSH and M. S. HUNTER, 1992 Male production influenced by antibiotic treatment in Encarsia fonnosa, an asexual species. Experientia 48: 102-105.

ZCHORI-FEIN, E., 0. FACTOR, M. ZEIDAN, Y. GOTTLIEB, H. CROSNEK et al., 1995 Parthenogenesis-inducing microorganisms in Aphytis (Hymen0ptera:Aphelinidae). Insect Mol. Biol. 4 173-178.

2424-2427.

527-528.

Communicating editor: R. E. DENELL

Wolbachia Infection and Cytoplasmic Incompatibility in ...Wolbachia Infection and Cytoplasmic...

Documents

Transcript of Wolbachia Infection and Cytoplasmic Incompatibility in ...Wolbachia Infection and Cytoplasmic...