What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that...

32

Transcript of What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that...

Page 1: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.
Page 2: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

What is DNA

DNA is also know as

DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that is you?

Perhaps when you think of DNA, you think of something out of a sci fi film. Like poor Bryant here…

Page 3: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.
Page 4: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

So let’s Look at the Basic’s DNA is held in your nucleus. It never leaves (copies get

sent out to do the dirty work but NEVER the DNA itself.)

The subunit of DNA is made of a

Page 5: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

Basic’s

There are 4 Nitrogenous Bases:

Adenine (____)

Guanine (____)

Thymine (____)

Cytosine (____)

A always bonds with T

G always bonds with C

Think – “A Tall Girl Called”

G C

T A

C G

A T

Page 6: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

How is DNA kept in your Cells?

You have roughly 3’ of DNA in each of your billions of cells.

They need to be tightly coiled like a phone cord (remember those things) then coiled around protein.

These are the structures you see as chromosomes.

Page 7: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

Chromosomes

Page 8: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

Karyotype

When a women has a child they can do what is called a _______________ This is a picture of the baby’s DNA before they are born. They pair up all the Chromosomes to see if there are any abnormalities.

Page 9: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

DNA fingerprints?

Everyone’s DNA is unique to them. Unless, they are an identical twin.

I’m sure you’ve seen on CSI, they take DNA evidence.

They do this by doing a DNA Gel Electrophoresis. (we will be doing one too)

On the following slide you will see a picture of several twin’s DNA fingerprints.

Page 10: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

Twin DNA Fingerprints

Page 11: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

How do you make more?

Well we know you are more then the one cell you started at.

And every cell you have has the same DNA, so how do you make more DNA?

It’s called DNA Replication.

You’re DNA is in the shape of a Double Helix – like a twisted ladder. This shape is not really the best in aiding the replication process.

What to do, what to do …

Page 12: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

Replication

First you ______________ a section

Then you must ______________

This is done by breaking the ____________ bonds

between the nitrogenous bases.

Now you find a new “______________________”

partner (A with T, G with C)

Once a section has been partnered up it

____________________

Page 13: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

Replication

Page 14: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

Closer look at

Replication This is a

_________________ replication because each new strand has half of the old strand.

The old strand is used as a ____________or guide of where to put the new bases

Page 15: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

But how does DNA control Cell functions?

Well like any building site – there are a set of

blue prints. You don’t want to hand out the

original, you have to make a copy to give the

plumber, electrician, mason, etc.

So we make a messenger molecule called RNA.

RNA is kind of like DNA in that it is made up of

nucleotides (remember – sugar, phosphate,

base)

Page 16: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

RNA

However, RNA’s bases areAdenine (____)

Guanine (____)

Cytosine (____)

URACIL (____)

Also RNA is single Stranded, that’s how it can fit out of the nuclear pores.

The process in which we make RNA from DNA is like replication but the RNA strand leaves, and the DNA just retwists

Page 17: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

Transcription

Page 18: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

Transcription

So now you keep the original In the nucleus,

and the copy goes out into the cytoplasm.

The code is an exact copy of the DNA’s code

(with the exception of U’s instead of T’s)

So it looks something like -

AUGUUUAAAGGGCCCUAGCGCUUAAGGUUAAGGCCUUUGUAUUAAUAG

Page 19: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

OK so how does that RNA tell our cells what to do?

So now the RNA code is in the cytoplasm. A

ribosome bonds to an initiation site.

The ribosome “reads” this code and figures out

what amino acids to put together to make a

protein.

The proteins made are what influences the cells

behavior.

So let’s look at TRANSLATION in detail.

Page 20: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

The Ribosome reads the RNA three letters at

a time. This is called the codon.

If you look at the amino acid chart you will

see there are 20 amino acids but 64 different

codon possibilities. That means that several

codons code for the same amino acid.

A T-RNA with the anti-codon brings the

appropriate amino acid to the M-RNA and

links the amino acids together.

Page 21: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

Codon - Amino Acid Chart

Page 22: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

Translation

Page 23: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

In the codon chart, you saw the amino acid

sequences. The ribosome knows where to start

reading based on the initiation codon AUG, and

where to end based on three termination

sequences: UAA, UGA, UAG

You saw in that second picture that the ribosome

held two T-RNA. The first one holds the chain of

amino acids, while the second one brings in the

new amino acid.

The following is an animation of the ribosome

traveling down the Messenger RNA

Page 24: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

Translation

Page 25: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

Here’s an animation of translation I found online

Page 26: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.
Page 27: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

Many ribosomes can read the RNA strand at one time.

Page 28: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

What’s the big deal making proteins?

Proteins are what controls the activities going on in your cells.

Remember, enzymes are protein too.

IMPORTANT :

the sequence of the amino acids determines the SHAPE of the protein

The SHAPE determines the FUNCTION of the protein

Page 29: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

If the DNA changes (a mutation), the AMINO ACID could change, which WOULD change the shape, which WOULD change the function.

Remember since some codons code for the same amino acid, substituting one letter for another MAY change the amino acid. It is not a guarantee. However, If you delete or add a letter that would change the reading frame and would change almost all the amino acids.

Page 30: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

Overview of Transcription and Translation

Page 31: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

Types of Mutations

• Point mutations – occurs when a single nucleotide is substituted by another nucleotide.

• THE CAT ATE THE RAT – original

• THE BAT ATE THE RAT - mutation

• THE CAT ATE THE BAT - mutation

Page 32: What is DNA DNA is also know as DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that.

• Frame Shift Mutation – addition or deletion that involves the loss or addition of a single nucleotide

• THE CAT ATE THE BAT – original

• THC ATA TET HEB AT – mutation

• THE CAA THT HEB AT – mutation

• THG ECA TAT ETH EBA T - mutation