What is a SNP?. Lecture topics What is a SNP? What use are they? SNP discovery SNP genotyping...
-
Upload
vivian-hoover -
Category
Documents
-
view
262 -
download
2
Transcript of What is a SNP?. Lecture topics What is a SNP? What use are they? SNP discovery SNP genotyping...
What is a SNP?
Lecture topics
• What is a SNP?
• What use are they?
• SNP discovery
• SNP genotyping
• Introduction to Linkage Disequilibrium
Readings in the text
• Pp 241-251, 271-291
Recognizing Heterozygotes for a SNP
SNP’s
• Non-Coding (5’ or 3’ UTR, regulatory regions or inter-genic)
• Coding
Synonymous
Non-Synonymous (Replacement)
• Non-coding, and synonymous SNP’s may be functional
Haplotypes: An Introduction
• A distinct collection of a number of (usually bi-allelic) SNP’s along a gene (or chromosome region)
• Certain alleles may segregate together
• Much more on this next lecture…
Why are we interested in SNP’s?
• Population genetics (population demography and evolution
• Quantitative Genetics (mapping allelic variants causing diseases)
• We often only use the SNP’s as markers, and we are not interested in them in particular
A little Population Genetics
• What causes SNP’s to be maintained in a population? Why do they vary?
• Mutation vs. Drift (Neutral)
• Positive or purifying selection (fixation)
• Balancing Selection
• P’s and q’s
• Hardy Weinberg Equilibrium
SNP discovery
• Currently re-sequencing is the major method for SNP discovery
• This can be coupled with database searches for putative SNP’s that need to be verified
• One major challenge is the frequency of the rare alleles
• P = 1 – (1-p)2N
Genotyping methods
• New methods are developing at an extremely rapid pace
• Cost, efficiency and error rate must all be considered carefully
• Depending upon the question, and organism being utilized, different approaches may be useful (Drosphila vs. humans)
Recognizing Heterozygotes for a SNP
Wild Type :CTCACTCTCACGCGCATACACAGTGAAATGTAAACACC
Mutant :CTCACTCTCACGCGCACACACAGTGAAATGTAAACACC
Wild Type :CTCACTCTCACGCGCATACACAGTGAAATGTAAACACC
Mutant :CTCACTCTCACGCGCACACACAGTGAAATGTAAACACC
DraIII Recognition site : CACNNNGTG
Mutant cuts, wild type does not
PCR-Restriction Fragment Length polymorphism (RFLP)
Also known as Cleaved Amplified Polymorphic Sequence (CAPS)
But, what if there is no restriction site???
You make one of course!!!• Derived CAPS (dCAPS)• Using Primer mismatch, you engineer a restriction site• Depending upon the length of your primer, the difference in size between the two fragments is usually ~20 bp.
ASO (Figure 5.20)Allele Specific oligo-hybridization
Single Base Extension (SBE)
Pyro-sequencing (5.23)