Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW...
-
Upload
daisy-harrington -
Category
Documents
-
view
222 -
download
0
Transcript of Welcome to Part 3 of Bio 219 Lecturer – David Ray Contact info: Office hours – 1:00-2:00 pm MTW...
Welcome to Part 3 of Bio 219Lecturer – David Ray
Contact info:Office hours – 1:00-2:00 pm MTW
Office location – LSB 5102Office phone – 293-5102 ext 31454E-mail – [email protected]
Lectures are available online athttp://www.as.wvu.edu/~dray
go to ‘Teaching’ link
How Genes and Genomes Evolve
Variation
• There is obviously variation among and within taxa.
• How does the variation arise in genomes?• Are there patterns to the variation?• How is the variation propagated?• What questions can be addressed using
the variation?• What patterns exist in humans with regard
to genomic variability?
Generating Genetic Variation
• Somatic vs. germ line cells– Somatic cells – “body” cells, no long term
descendants, live only to help germ cells perform their function.
– Germ cells – reproductive cells, give rise to descendants in the next generation of organisms.
Generating Genetic Variation
• Somatic vs. germ line mutations– Somatic mutations – occur in somatic cells
and will only effect those cells and their progeny, cannot not be passed on to subsequent generations of organisms.
– Germ mutations – can be passed on to subsequent generations.
Generating Genetic Variation
• Five types of change contribute to evolution.– Mutation within a gene– Gene duplication– Gene deletion– Exon shuffling– Horizontal transfer – rare in Eukaryotes
Generating Genetic Variation
• Most changes to a genome are caused by mistakes in the normal process of copying and maintaining genomic DNA.
• Mutations within genes– Point mutations – errors in replication at
individual nucleotide sites occur at a rate of about 10-10 in the human genome.
– Most point mutations have no effect on the function of the genome – are selectively neutral.
Generating Genetic Variation
• DNA duplications– Slipped strand mispairing– Unequal crossover during recombination
Generating Genetic Variation
• Gene duplication allows for the acquisition of new functional genes in the genome
Generating Genetic Variation
• Gene Duplication: the globin family– A classic example of gene duplication and evolution– Globin molecules are involved in carrying oxygen in
multicellular organisms– Ancestral globin gene (present in primitive animals)
was duplicated ~500 mya.– Mutations accumulated in both genes to differentiate
them - α and β present in all higher vertebrates– Further gene duplications produced alternative forms
in mammals and in primates
Generating Genetic Variation
Mammals
Primates
• Gene Duplication– Almost every gene in the vertebrate genome
exists in multiple copies– Gene duplication allows for new functions to
arise without having to start from scratch– Studies suggest the early in vertebrate
evolution the entire genome was duplicated at least twice
Generating Genetic Variation
• Exon Duplication– Duplications are not limited to entire genes– Proteins are often collections of distinct amino
acid domains that are encoded by individual exons in a gene
– The separation of exons by introns facilitates the duplication of exons and individual gene evolution
Generating Genetic Variation
• Exon Shuffling– The exons of genes can sometimes be
thought of as individual useful units that can be mixed and matched through exon shuffling to generate new, useful combinations
Generating Genetic Variation
Review from last week• Overall theme – There are lots of ways to create genetic variation.
Genetic variation is the basis of evolutionary change but the variation must be introduced into the germ line to contribute to evolutionary change.
• Two cell lines in multicellular organisms– Somatic – short term genetic repository– Germ line – long term genetic repository
• Variation that occurs in the germ line are the only ones that can contribute to evolutionary change
• Genetic variation can be accumulated through various events– Mutations in genes – point mutations– DNA duplications – microsatellites (small), unequal crossover (large)– Gene and exon duplications are the major method for generating new
gene functions– Exon shuffling can produce new gene functions by creating new
combinations of functional exons/protein domains
• Mobile elements contribute to genome evolution in several ways– Exon shuffling– Insertion mutagenesis– Homologous and non-homologous
recombination
Generating Genetic Variation
• What are mobile elements and how do they work?– Fragments of DNA that can copy itself and
insert those copies back into the genome– Found in most eukaryotic genomes– Humans – Alu (SINE); Ta, PreTa (LINEs);
SVA; plus several families that are no longer active
Generating Genetic Variation
Pol III transcription
Reverse transcription and insertion
1. Usually a single ‘master’ copy
2. Pol III transcription to an RNA intermediate
3. Target primed reverse transcription (TPRT) – enzymatic machinery provided by LINEs
Generating Genetic Variation:Normal SINE mobilization
Generating Genetic Variation
• Mobile elements contribute to genome evolution in several ways– Exon shuffling
Generating Genetic Variation:Exon shuffling via SINE mobilization
exon 1 SINE
intron
exon 2
SINE transcription can extend past the normal stop signal
Reverse transcription creates DNA copies of both the SINE and exon 2
DNA copy of transcript
Reinsertion occurs elsewhere in the genome
SINE exon 2
Generating Genetic Variation
• Mobile elements contribute to genome evolution in several ways– Exon shuffling– Insertion mutagenesis
• The insertion of mobile elements can disrupt gene structure and function
Generating Genetic Variation
ALU INSERTIONS AND DISEASE
LOCUS DISTRIBUTION SUBFAMILY DISEASE REFERENCE
BRCA2 de novo Y Breast cancer Miki et al, 1996Mlvi-2 de novo (somatic?) Ya5 Associated with
leukemiaEconomou-Pachnis andTsichlis, 1985
NF1 de novo Ya5 Neurofibromatosis Wallace et al, 1991APC Familial Yb8 Hereditary desmoid
diseaseHalling et al, 1997
PROGINS about 50% Ya5 Linked with ovariancarcinoma
Rowe et al, 1995
Btk Familial Y X-linkedagammaglobulinaemia
Lester et al, 1997
IL2RG Familial Ya5 XSCID Lester et al, 1997Cholinesterase one Japanese family Yb8 Cholinesterase
deficiencyMuratani et al, 1991
CaR familial Ya4 Hypocalciurichypercalcemia and
neonatal severehyperparathyroidism
Janicic et al, 1995
C1 inhibitor de novo Y Complement deficiency Stoppa Lyonnet et al, 1990ACE about 50% Ya5 Linked with protection
from heart diseaseCambien et al, 1992
Factor IX a grandparent Ya5 Hemophilia Vidaud et al, 19932 x FGFR2 De novo Ya5 Apert’s Syndrome Oldridge et al, 1997GK ? Sx Glycerol kinase
deficiencyMcCabe et al, (personalcomm.)
Generating Genetic Variation
• Gene expression alteration via a P-element mobilization in Drosophila
Generating Genetic Variation
• Mobile elements contribute to genome evolution in several ways– Exon shuffling– Insertion mutagenesis
• The insertion of mobile elements can disrupt gene structure and function
– Homologous and non homologous recombination
• 10,000 – 1,000,000 + nearly identical DNA fragments scattered throughout the genome
Generating Genetic Variation
Unequal crossover due to non-homologous recombination
ALU/ALU RECOMBINATION AND GERM-LINE DISEASE
LOCUS DISTRIBUTION DISEASE REFERENCE
8 x LDLR
Kindreds Hypercholesterolemia Lehrman et al, 1985, 1987 Yamakawa et al, 1989 Rudiger et al, 1991 Chae et al, 1997
5 x -globin Kindreds -thalassaemia Nicholls et al, 1987 Flint et al, 1996 Harteveld et al, 1997 Ko et al, 1997
5 x C1 inhibitor
Kindreds Angioneurotic adema Stoppa-Lyonnet et al, 1990 Ariga et al, 1990
C3 Kindred C3 deficiency Botto et al, 1992 HPRT Individual
Lesch-Nyhan
syndrome Marcus et al, 1993
DMD Kindred Duchenne’s muscular dystrophy
Hu et al, 1991
ADA Individual ADA deficiency-SCID Markert et al, 1988
Ins. Rec. Individual Insulin-independent diabetes
Shimada et al, 1990
Antithrombin Individual Thrombophilia Olds et al, 1993 XY Individual XX male Rouyer et al, 1987 Lysyl hydroxylase Kindreds Ehlers-Danlos
syndrome Pousi et al, 1994
ALU/ALU RECOMBINATION AND CANCER
LOCUS DISTRIBUTION MECHANISM DISEASE REFERENCE
10 xALL-1
Somatic Alu-Alu recombDup. intron 1-6
Acutemyelogenous
leukemia
Strout et al, 1998So et al, 1997;Schichman et al,1994
7 xBCR/Abl
Somatic X-Alu recomb. CML Jeffs et al, 1998Chen et al, 1989de Klein et al, 1986
All-1/AF9 Somatic Alu-Alutranslocation
Acutemyelogenous
leukemia
Super et al, 1997
2 xBRCA1
Somatic &A kindred
Alu-Alu recomb(del exon 17; del.
Promoter)
Breast cancer Puget et al, 1997Swensen et al,1997
2 xMLH1
2 kindreds Alu-Alu recomb.(del exon 16)(exons 13-16)
HNPCC Nystrom-Lahti etal, 1995Mauillon et al,1996
TRE Somatic InterchromosomalAlu-Alu recomb
Ewing's sarcoma Onno et al, 1992
RB Common Alu-Alu recomb.(799 bp del.)
Association withglioma
Rothberg et al,1997
EWS Subset of Africans Alu-Alu recomb.(del 2 kb)
Protective againstEwing Sarcoma?
Zucman-Rossi etal, 1997
Generating Genetic Variation
• Gene transfer can move genes between entire genomes– Horizontal gene transfer
– Main problem with the development of drug resistant strains of bacteria
Generating Genetic Variation• Bacterial conjugation
Reconstructing Life’s Tree
• Evolutionary theory predicts that organisms that are derived from a common ancestor will share genetic signatures
• Organisms that shared an ancestor more recently will be more similar than those that shared a more distant common ancestor
• Similarity can include sequence composition, genome organization, presence/absence of mobile elements, presence/absence of gene families, etc.
09_15_Phylogen.trees.jpg
09_16_Ancestral.gene.jpg
09_22_genetic.info.jpg
09_17_Human_chimp.jpg
Chromosome 1
Review from last time• Overall themes: Genetic variation can be introduced due to the
activities and presence of mobile elements (MEs); Genetic information can be introduced into organisms through horizontal transfer.
• MEs are fragments of DNA that can make copies of themselves and insert those copies back into the genome– MEs can lead to variation through exon shuffling, insertion mutagenisis,
and recombination– Many human diseases are the result of MEs
• Horizontal transfer can introduce genetic variation into bacteria via the process of conjugation
• Introduction of concepts for discussion of “Reconstructing life’s tree”– All sorts of variation provide information on the relationships among
organisms– Homology – derived from the same ancestral source– Phylogeny – a reconstruction of relationships based on observations
• Basic terms – Homologous – derived from a common
ancestral source– Phylogeny – a reconstruction of relationships
based on observed patterns
Reconstructing Life’s Tree
• Homologous genes can be recognized over large amounts of evolutionary time
Reconstructing Life’s Tree
• Homologous genes can be recognized over large amounts of evolutionary time
• Why?– Selectively advantageous genes and
sequences tend to be conserved (preserved)– Selectively disadvantageous genes and
sequences are tend not to be passed on to offspring
Reconstructing Life’s Tree
Reconstructing Life’s Tree
• Most DNA of most genomes is non-coding– Changes to much of this DNA are selectively neutral –
cause no harm or good to the genome– Different portions of the genome will therefore diverge
at different rates depending on their function
The neutral regions tend to change in a clock-like fashion– We can estimate divergence times for certain groups
09_19_human_mouse1.jpg
• Most DNA of most genomes is non-coding– Changes to much of this DNA are selectively neutral –
cause no harm or good to the genome– Different portions of the genome will therefore diverge
at different rates depending on their function
• The neutral regions tend to change in a clock-like fashion– We can estimate divergence times for certain groups
Reconstructing Life’s Tree
• The accumulation of changes can be quantified by several logical methods– Parsimony – the best hypothesis is the one
requiring the fewest steps (i.e. Occam’s razor)– Distance – count the number of differences
between things, the ones with the fewest numbers of differences are most closely related
– Sequence based models – take into account what we know about the ways sequences change over time
Reconstructing Life’s Tree
• These slides and the sequence files used to produce them are available as a supplement on the class website:
• DNA sequence from six taxa
Reconstructing Life’s Tree: An example using distance
human
Sumatran orangBornean orang
bonobo chimpcommon chimp
gorilla
ATGGCT AAGACG AAGACTCAGGCTCAGGCT
T-A
A-C
A-C
Reconstructing Life’s Tree: An example using parsimony
ATGGCT AAGACG AAGACTCAGGCTCAGGCTATGGCT AAGACG AAGACTCAGGCTCAGGCTATGGCT AAGACG AAGACTCAGGCTCAGGCT
T-G
G-AG-A
6 steps
ATGGCT AAGACG AAGACTCAGGCT CAGGCT
T-A
G-A
T-G
A-C
G-A
5 steps
Reconstructing Life’s Tree: An example using parsimony
ATGGCT AAGACGAAGACT CAGGCT CAGGCT
T-A
G-A
T-G
A-C
4 steps
Reconstructing Life’s Tree: An example using parsimony
• The accumulation of changes can be quantified by several logical methods
• The accumulation of mobile elements provides a nearly perfect record of evolutionary relationships
Reconstructing Life’s Tree
Phylogenetic Inference Using SINEs
Species A Species DSpecies CSpecies B
Phylogenetic Inference Using SINEs
Resolution of the Human:Chimp:Gorilla Trichotomy
(H,C)G
(H,G)C
(C,G)H
(H,C,G)
Phylogenetic Analysis
PCR of 133 Alu loci 117 Ye5 13 Yc1 1 Yi6 1 Yd3 1 undefined subfamily
PNAS (2003) 22:12787-91
Alu Elements and Hominid Phylogeny
PNAS (2003) 22:12787-91
Review from last time
• The variation that is present in genomes allows us to make determinations about the relationships among living things
• Different parts of the genome accumulate variation at different rates depending on their function (or lack thereof)
• The presence of different rates allows for different questions to be addressed depending on the level of divergence
• Several methods are available to analyze variation for phylogenetic signal– Parsimony, distance, sequence based models
• Patterns of mobile element insertion can be used to infer relationships among taxa
• Much of the “junk” DNA is dispensible– The Fugu (Takifugu rubripes) genome is
almost completely devoid of unnecessary sequences
– Exon number and organization is similar to mammals
– Compared to other vertebrates• Intron size (not number) is reduced• Intergenic regions are reduced in size• No mobile elements
Reconstructing Life’s Tree
09_21_Fugu.introns.jpg
• Using all of the available information, we can reconstruct relationships between organisms back to the earliest forms of life
Reconstructing Life’s Tree
• The human genome is large and complex– 23 pairs of chromosomes– ~3.2 x 109 (3.2 billion) nucleotide pairs– Human genome composition
Our Own Genome
09_26_noncoding.jpg
09_25_Chromosome22.jpg
• Nuclear genome–3300 Mb–23 (XX) or 24 (XY) linear chromosomes–30-35,000 genes–1 gene/40kb–Introns–3% coding–Repetitive DNA sequences (45%)
Our Own Genome
• The human genome is large and complex– 23 pairs of chromosomes– ~3.2 x 109 (3.2 billion) nucleotide pairs– Human genome composition– The human genome project was one of the
largest undertakings in human history
Our Own Genome
• Progress in human genome sequencing– Hierarchical vs. whole genome shotgun
(WGS) sequencing– Repetitive DNA represents a significant
problem for WGS sequencing in particular
Our Own Genome
10_09_Shotgun.sequenc.jpg
08_03.jpg
• Progress in human genome sequencing– Hierarchical vs. whole genome shotgun
(WGS) sequencing– Repetitive DNA represents a significant
problem for WGS sequencing in particular
Our Own Genome
10_10_Repetit.sequence.jpg
• Progress in human genome sequencing– Hierarchical vs whole genome shotgun
sequencing– Repetitive DNA represents a significant
problem for WGS sequencing in particular–Landmark papers in Nature and Science
(2001)• Venter et al Science 16 February 2001; 291: 1304-
1351 • Lander et al Nature 409 (6822): 860-921
Our Own Genome
• A typical high-throughput genomics facility
Our Own Genome
• Exploring and exploiting the genome sequences
• BLAST/BLAT and other tools– BLAST - Basic local alignment search tool
• Input a sequence and find matches to human or other organisms
– publication information– DNA and protein sequence (if applicable)
Our Own Genome
• Exploring and exploiting the genome sequences
• BLAST/BLAT and other tools– BLAT – BLAST-like alignment tool
• A “genome browser”• Genomes available :
– human, chimp, rhesus monkey, dog, cow, mouse, opossum, rat, chicken, Xenopus, Zebrafish, Tetraodon, Fugu, nematode (x3), Drosophila (x10), Apis (x3), Saccharomyces (yeast), SARS
• example: chr6:121,387,504-121,720,836
Our Own Genome
Query sequence - Callithrix Human ortholog
Our Own Genome• BLAT can be used to make direct comparisons between
our genome and others.
• Comparisons with other genomes inform us about our own–Important genes and regulatory sequences
can easily be identified if they are conserved between genomes
Our Own Genome
• Human variation–~0.1% difference in nucleotide sequence
between any two individual humans–Translates to about 3 million differences in the
genome–Most of these differences are Single
Nucleotide Polymorphisms (SNPs)–We can use these differences to investigate
human variation, population structure and evolution
Our Own Genome
• Human evolution–Coalescence analyses (mtDNA and Y
chromosome)–Mutiregional vs. Out of Africa
• Predictions of the Multiregional Hypothesis– Equal diversity in human subpopulations– No obvious root to the human tree
• Predictions of the Out of Africa Hypothesis– Higher diversity in African subpopulations– Root of the human tree in Africa
Our Own Genome
Population Relationships Based on 100 Autosomal
Alu Elements
Africa
Asia
Europe
S. India
• Human evolution–Higher diversity in African subpopulations
• Insulin minisatellite Table 12.6 in text• 22 divergent lineages exist in the human
population• All are found in Africa. Only 3 are found outside of
Africa.
Our Own Genome
• Interpreting the information generated by the human genome project–The complexity of genome function makes
interpretation difficult–Ex. What are the regulatory sequences?–Ex. Exons can be spliced together in different
ways in different tissues
Our Own Genome
09_30_alt.splice.RNA.jpg