WdChs4p, a Homolog of Chitin Synthase 3 in Saccharomyces

INFECTION AND IMMUNITY,0019-9567/99/$04.0010

Dec. 1999, p. 6619–6630 Vol. 67, No. 12

Copyright © 1999, American Society for Microbiology. All Rights Reserved.

WdChs4p, a Homolog of Chitin Synthase 3 in Saccharomyces cerevisiae,Alone Cannot Support Growth of Wangiella (Exophiala)

dermatitidis at the Temperature of InfectionZHENG WANG,1 LI ZHENG,1 MELINDA HAUSER,2 JEFFERY M. BECKER,2

AND PAUL J. SZANISZLO1*

Section of Molecular Genetics and Microbiology, School of Biological Science and Institute forCellular and Molecular Biology, The University of Texas at Austin, Austin, Texas 78712,1

and Microbiology Department, University of Tennessee, Knoxville, Tennessee 379192

Received 21 April 1999/Returned for modification 14 June 1999/Accepted 3 September 1999

By using improved transformation methods for Wangiella dermatitidis, and a cloned fragment of its chitinsynthase 4 structural gene (WdCHS4) as a marking sequence, the full-length gene was rescued from the genomeof this human pathogenic fungus. The encoded chitin synthase product (WdChs4p) showed high homology withChs3p of Saccharomyces cerevisiae and other class IV chitin synthases, and Northern blotting showed thatWdCHS4 was expressed at constitutive levels under all conditions tested. Reduced chitin content, abnormalyeast clumpiness and budding kinetics, and increased melanin secretion resulted from the disruption ofWdCHS4 suggesting that WdChs4p influences cell wall structure, cellular reproduction, and melanin deposi-tion, respectively. However, no significant loss of virulence was detected when the wdchs4D strain was tested inan acute mouse model. Using a wdchs1D wdchs2D wdchs3D triple mutant of W. dermatitidis, which grew poorlybut adequately at 25°C, we assayed WdChs4p activity in the absence of activities contributed by its three otherWdChs proteins. Maximal activity required trypsin activation, suggesting a zymogenic nature. The activity alsohad a pH optimum of 7.5, was most stimulated by Mg21, and was more inhibited by polyoxin D than bynikkomycin Z. Although the WdChs4p activity had a broad temperature optimum between 30 to 45°C in vitro,this activity alone did not support the growth of the wdchs1D wdchs2D wdchs3D triple mutant at 37°C, atemperature commensurate with infection.

Chitin, a linear molecule of b-(1-4)-linked N-acetylglucos-amine, is a major structural constituent of the fungal cell wall(16, 49). Chitin quantity varies in different fungi and in differ-ent cell types of the same fungus (3, 8, 59). It is a minor (1%)component of cell walls of most yeasts, but amounts are usuallyhigher in the cell walls of filamentous fungi (14). In Saccharo-myces cerevisiae, more than 90% of the chitin is located inthe region of the yeast cell bud scar (38). However, greateramounts of mislocalized chitin occur in a variety of cell divisioncycle mutants of S. cerevisiae, indicating that chitin synthesis istemporally and spatially regulated during the yeast cell cycle(44, 47). In vegetative hyphae of filamentous fungi, chitin dep-osition is most concentrated in septa and at the apexes ofgrowing hyphae (25, 59).

Chitin synthases are responsible for the polymerization ofchitin and are primarily zymogens associated with fungal plas-ma membranes (12). In both S. cerevisiae and Candida albi-cans, three chitin synthase structural genes (CHS) have beenidentified and characterized (10, 37). Numerous other CHSgenes have been identified in other fungi. Based on derivedamino acid sequences of PCR products, fungal chitin synthaseswere first grouped as three classes (7). Additional classes werethen defined, and now at least five isozyme classes are recog-nized (33). However, only in the case of S. cerevisiae has eachisozyme (Chs) been linked with some certainty to specific func-tions during cell growth and development (9, 11, 51, 57). In thisfungus, Chs3p, which belongs to the class IV group of chitin

synthases (7), produces 90% of the cell wall chitin in yeast cellsbudding normally, and this chitin is localized both in the lateralwall and in the chitin ring that serves as the bud emergencelocus (57). Although no single Chs enzyme is essential for theviability of S. cerevisiae, strains without functional class II(Chs2p) and class IV (Chs3p) isozymes lose viability (11, 16).In contrast to this central role for the class IV enzyme inS. cerevisiae, in filamentous fungi the class III chitin synthases,which have no homolog in yeast, are most often reported to beessential for normal hyphal growth (34, 61, 62). In fact, theclass IV chitin synthases identified in Neurospora crassa, Asper-gillus nidulans, and A. fumigatus have been regarded as redun-dant enzymes (1, 5, 40), even though additional genes encodingclass IV chitin synthase homologs were found in both Aspergil-lus species (33, 35, 52).

Wangiella (Exophiala) dermatitidis is an asexual fungalpathogen of humans that is associated with cutaneous andsubcutaneous phaeohyphomycosis (30). In vivo, this memberof the Fungi Imperfecti produces a variety of vegetative growthforms with dark, melanized (dematiaceous) cell walls, such asovoid yeasts, pseudohyphae, hyphae and isotropically en-larged, spherical cells, and multicellular forms (20, 32, 41). Invitro, yeast cells of W. dermatitidis are easily manipulated inways that allow morphological transitions to isotrophic multi-cellular forms and hyphae (18, 24, 28, 54). This inherent veg-etative polymorphism of W. dermatitidis allows it to serve as avaluable model for the study of the more than 100 other de-matiaceous fungi known to cause human infection (31, 55).The numerous new transformation and gene disruption sys-tems developed for the molecular manipulation of this organ-ism (31, 45, 64) also make it an unusually attractive model fordetermining the function of potential cell wall-related viru-

* Corresponding author. Mailing address: Section of Molecular Ge-netics and Microbiology, School of Biological Sciences, University ofTexas at Austin, Austin, TX 78712. Phone: (512) 471-3384. Fax: (512)471-7088. E-mail: [email protected].

6619

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 13

Nov

embe

r 20

21 b

y 21

1.22

7.15

7.54

.

lence factors, such as chitin, in dimorphic and polymorphicpathogenic fungi.

In yeast cells of W. dermatitidis, chitin is found in relativelylow amounts and is localized primarily in septal regions (19, 26,54, 56). Multicellular forms and hyphae also have chitin intheir septa but have considerable additional chitin in other cellwall areas (54–56). Because these morphological transitionsare accompanied not only by increases in chitin but also in-creases in cell wall 1,8-dihydroxynaphthalene melanin (19, 54),melanin biosynthesis has been studied extensively and shownto contribute significantly to the pathogenicity and virulence ofW. dermatitidis (21–23, 48). However, the specific role of chitinand its contribution to virulence have not been similarly estab-lished for this pathogen.

Three different genes (WdCHS) encoding class I, II, and IIIchitin synthases were initially identified in W. dermatitidis byPCR and Southern blotting and then cloned by screening ge-nomic and cDNA libraries (7, 31, 36, 56, 58, 63). In this study,we describe the cloning, characterization, and effects of dis-ruption of the fourth WdCHS gene (WdCHS4) of W. dermati-tidis, and we also characterize the enzymatic activity of its geneproduct (WdChs4p). Our results showed that this gene is mostlikely constitutively expressed, that its product is grouped toclass IV, and that the chitin contributed by WdChs4p influ-ences wall structure, cell surface properties, cellular reproduc-tion, and melanization but not virulence. Our results alsoshowed that WdChs4p could not alone support growth at 37°Cof a triple chitin synthase mutant of W. dermatitidis having onlyan intact WdCHS4 gene. However, because this triple mutantgrew adequately at 25°C, we were able to characterize theactivity of the class IV-type isozyme of W. dermatitidis in theabsence of any confounding influence of its other WdChs ac-tivities. Furthermore, our comparative studies of the wild-typestrain with strains having only WdCHS4 disrupted and with thetriple mutant derived by the sequential disruption of WdCHS1,WdCHS2, and WdCHS3 but not WdCHS4, allowed us to sug-gest why WdChs4p of W. dermatitidis may not be particularlyimportant to virulence.

MATERIALS AND METHODS

Strains and media. General propagation of the laboratory wild-type strain ofW. dermatitidis 8656 (ATCC 34100; E. dermatitidis CBS 527.6), the type strain(ATCC 28869), and the temperature-sensitive mutants Mc3 (wdcdc2; ATCC38716) and Hf1 was either in the rich medium YPD (1% yeast extract, 2%peptone, 2% glucose) or the synthetic medium CDN (19), which was prepared byadding the following components (grams per liter) to 0.05 M sodium succinatebuffer (pH 6.5): glucose, 30; NaNO3, 3; K2PO4, 1; MgSO4 z 7H2O, 0.5; FeSO4 z7H2O, 0.01; NH4Cl, 0.625; and thiamine, 0.003. The chitin synthase wdchs1Dwdchs2D double mutant and wdchs1D wdchs2D wdchs3D triple mutant of W.dermatitidis were obtained by consecutive gene disruptions using vectors withphleomycin, sulfonyl urea, and hygromycin resistance genes as selective markers(reference 63; details to be reported elsewhere). Escherichia coli XL1-Blue(Stratagene, La Jolla, Calif.), which was used for the subcloning and plasmidpreparation, was grown in LB medium supplemented with ampicillin (100 mg/ml)or chloramphenicol (25 mg/ml).

Preparation and analysis of nucleic acids. Genomic DNA was isolated byspheroplasting with Zymolyase-20T (ICN Biomedicals, Inc., Aurora, Ohio) fol-lowed by detergent lysis, phenol-chloroform extraction, and ethanol precipitationas previously described (39). Total RNA was isolated by the hot phenol method(2). Southern and Northern blotting were performed by standard methods (2)except for Southern blotting of the karyotype, which was done as previouslydescribed (64). DNA fragments (25 ng) used for probes in Southern and North-ern analysis were labeled with [a32P]dATP by using a Prime-a-Gene kit (Pro-mega, Madison, Wis.). Plasmids containing WdCHS4 gene fragments were au-tomatically sequenced by the Institute for Cellular and Molecular Biology of TheUniversity of Texas at Austin. Sequence analysis was performed with the Wis-consin Package G software (Genetics Computer Group, Inc.). PCR amplifica-tions, using Taq DNA polymerase and nucleotides obtained from Promega, werecarried out in a DNA thermal cycler (Perkin-Elmer, Norwalk, Conn.) for 1 cycleof 4 min at 94°C, then 29 cycles of 2 min at 94°C, 3 min at 50°C, and 4 min at72°C, and finally 1 cycle similar to the previous ones but with a 10-min elongationstep. The 366-bp PCR fragment of the WdCHS4 gene was amplified from W.

dermatitidis 8656 genomic DNA by using primers CAL1-1 (59 CAAGTGTTTGAGTACTATATTTCGCAT 39) and CAL1-2 (59 CGTAGAATTAATCCATCTTCGACGCTG 39). The 876-bp fragment was amplified from a truncatedWdCHS4 clone by using primers CAL1-1 and CAL1-3 (59 GTCATAGTCACGGTAGGG 39).

Plasmid construction. The marker rescue plasmid pPCS4 (Fig. 1A) was con-structed by inserting the 870-bp ApaI-SacI fragment from pBF4 (provided by B.Feng) containing the 39-end sequence of WdCHS4 into pCB1004 (provided by J.Sweigard, DuPont Co., Wilmington, Del.), which is a pBluescript SK(1)-basedvector that contains the hygromycin phosphotransferase gene (hph) from E. coli,which confers resistance to hygromycin B (HmB), and the tryptophan synthase(trpC) promoter from A. nidulans (13). The 870-bp fragment was originallycloned by library screening using the 366-bp PCR product as a probe (see above).The WdCHS4 disruption plasmid pDCS4 (see Fig. 4A) was constructed byinserting an 800-bp BamHI fragment from the rescued plasmid, pMRCHS4, intopAN7-1 (45), which, unlike pCB1004, contains the glyceraldehyde-3-phosphate

FIG. 1. Cloning WdCHS4 by a marker rescue technique. (A) The partialWdCHS4 gene fragment (876 bp) was used in a marker rescue method to clonethe whole gene by integrating this fragment with HmB resistance (hph) andchloramphenicol resistance (Cm) gene markers into the WdCHS4 locus. Therecombinant plasmid pPCS4, which carried this PCR fragment in the pCB1004vector, was linearized with EcoRV and transformed into W. dermatitidis 8656yeast cells. (B) Southern hybridization analysis of four transformants in whichpPCS4 was integrated into the W. dermatitidis genome. Genomic DNA of thewild type (wt) and transformants 1 to 4 was extracted, digested with BglII, andsubjected to Southern blotting using a 876-bp WdCHS4 PCR fragment as aprobe. Transformants 1, 2, and 3 showed hybridization consistent with site-specific integration into the WdCHS4 locus, whereas the plasmid was ectopicallyintegrated in transformant 4. (C) Restriction map of WdCHS4. The gray boxrepresents the 876-bp fragment used for marker rescue, the black box representsthe 800-bp BamHI-digested fragment used for gene disruption, and the hatchedbox represents the 366-bp PCR fragment used for library screening. Restrictionenzyme abbreviations: A, ApaI; B, BamHI; BX, BstXI; H, HindIII; S, SacI.

6620 WANG ET AL. INFECT. IMMUN.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 13

Nov

embe

r 20

21 b

y 21

1.22

7.15

7.54

.

dehydrogenase (gpd) promoter and the trpC terminator from A. nidulans, in ad-dition to the hph gene.

Transformations. Yeast cells of W. dermatitidis cultivated for 20 h in YPD at25°C were harvested and chilled on ice for 30 min, after which time the cells werewashed twice and resuspended in cold 10% glycerol. Plasmid (;5 mg) was thenmixed with this cell suspension (200 ml), and electroporation was conducted at1.45-kV field strength, 200-V resistance, and 25-mF capacitance, correspondingto a time range 4 to 6 ms. Transformed cells were incubated with YPD (1 ml)with shaking at 25°C for 3 h before being spread on HmB (40 mg/ml; Sigma, St.Louis, Mo.)-containing YPD plate medium, which was incubated at 25°C for 4 to6 days.

Microscopy. Cellular morphology was documented by using a Zeiss ICM 405inverted microscope (Carl Zeiss Inc., Oberkochen, Germany) with Nomarskidifferential interference, phase-contrast optics, a 633 oil immersion objective,and M35 automatic camera. The procedure for preparing specimens for scanningelectron microscopy (17) was modified as follows. Cells were harvested fromlog-phase CDN cultures and fixed overnight in sodium cacodylate-buffered 25%glutaraldehyde at 4°C. The fixed cells were washed twice with phosphate-bufferedsaline, attached to coverslips pretreated with 50 ml of poly-L-lysine (2 mg/ml;molecular weight, 4,000,000), and dehydrated in an ethanol-acetone (10, 25, 40,50%, and 100% ethanol) series followed by an acetone-amyl acetate (50, 40, 25,15, and 5% acetone) series. The dehydrated specimens were then submerged inamyl acetate for 15 min, critical-point dried (Tousimis Samdri-790), and sputtercoated (Ladd model 30800) with gold for 60 s at 2.5 kV and 20 mA. Specimenswere examined in a Philips 515 scanning electron microscope.

Chitin content and chitin synthase activity assays. Chitin contents were mea-sured by a modification of the procedure described by Yabe et al. (60). Log-phase yeast cells were harvested from 20-ml cultures, suspended in 4 M HCl (1ml), and boiled for 4 h. After dilution of hydrolysates with H2O (19 ml), theamount of hexosamine in a diluent (1 ml) was determined by the Elson-Morganmethod (6), using N-acetyl-D-glucosamine (GlcNAc) (Sigma) as a standard. Celldry weights for calculation of chitin content per milligram of cells were deter-mined by collection of cells from 20-ml cultures on preweighed 0.45-mm-pore-size membrane filters (type HA; Millipore Corp., Bedford, Mass.), which weresubsequently washed with distilled water and then dried at 65°C to a constantweight.

Cell membranes were prepared and activities of chitin synthase was deter-mined by the method of Orlean (43). Membrane proteins were dissolved in TMbuffer (50 mM Tris-HCl, 40 mM MgCl2) except for the membrane protein of thechitin synthase wdchs1D wdchs2D wdchs3D triple mutant, which was dissolved in50 mM Tris-HCl. Concentrations of membrane protein were measured by usingthe Coomassie protein assay reagent (Pierce, Rockford, Ill.). All chitin synthaseassays were carried out in 50-ml reaction mixtures consisting of 3 ml of 0.5 MTris-HCl (pH 7.5), 3 ml of 40 mM magnesium acetate, 2 ml of 0.8 M GlcNAc(Sigma), 5 ml of 10 mM UDP-N-acetyl-D-[U-14C]glucosamine (specific activity,271 mCi/mmol; Amersham, Arlington Heights, Ill.) and 10 mM UDP-GlcNAc(Sigma), and 30 mg of membrane protein. For trypsin-activated chitin synthaseactivity measurements, trypsin (2 ml of 1 mg/ml) from bovine pancreas (type III;Sigma) was added to the membrane preparations, which were subsequentlyincubated at 30°C for 15 min. Soybean trypsin inhibitor (2 ml of 1.5 mg/ml;Sigma) was then added to terminate trypsin digestion. The mixture was incu-bated at 30°C for 30 min, and reactions were stopped by adding 1% trichloro-acetic acid (1 ml). After the chitin precipitate was collected by filtration on25-mm-pore-size glass fiber filters (type A/E; Gelman Science, Ann Arbor,Mich.), the filters were washed with 95% ethanol (5 ml) and radioactivity wascounted with a model LS 6800 liquid scintillation counter (Beckman Inc., Irvine,Calif.).

Virulence studies of wdchs4D-1 in mice. Test strains (wdchs4D-1, the wild type,and the vector control strain with pAN7) of W. dermatitidis were cultured in 5 mlof YPD overnight at 30°C with shaking. An aliquot of the overnight culture wasused to inoculate 50-ml YPD cultures, which were then grown overnight tomid-log phase. Cultures were harvested and washed three times with sterilewater. Yeast forms were counted on a hemacytometer and adjusted to a finaldensity of 7 3 107 cells/ml. The virulence of these strains was then tested in aimmunocompetent (normal) mouse model system. Male ICR mice (22 to 25 g;Harlan Sprague-Dawley) were housed five per cage; food and water were sup-plied ad libitum, according to National Institutes of Health guidelines for theethical treatment of animals. Mice (10 per strain) were inoculated via the lateraltail vein with 100 ml of the cell suspension (7 3 107 cells/ml), such that eachmouse received a final dose of 7 3 106 cells. To determine the number of viableyeast forms injected into each mouse, an aliquot of the suspension used forinjection was diluted and plated in top agar (0.1% Noble agar) onto YPD plates.The plates were incubated at 30°C for 48 to 72 h, and percent viability was de-termined. Mice were checked three times daily for survival or signs of infection.Visible signs of infection were torticollis, ataxia, or lethargy. Infected mice wereconsidered moribund when they were unable to access food or water. Moribundmice were humanely sacrificed by cervical dislocation under anesthesia.

Statistics analysis. Differences in chitin and chitin synthase activities amonggroups were evaluated for statistical significance by the parametric one-wayanalysis of variance Newman-Keuls test for paired data. The analysis was per-formed with PRISM version 2.0 software (GraphPad Software, Inc., San Diego,Calif.). Probability values of ,0.05 were considered significant. Survival fractions

in virulence tests were calculated by the Kaplan-Meier method, and survivalcurves were tested for significant difference (P , 0.01) by the Mantel-Haenszeltest using GraphPad Prism version 3.00 for Windows.

Nucleotide sequence accession number. The nucleotide sequence of theWdCHS4 gene was assigned GenBank accession no. AF126146.

RESULTS

Cloning of the WdCHS4 gene by a marker rescue approach.The WdCHS4 gene was initially identified as a 366-bp fragmentby PCR amplifications (29, 46) using primers based on theconserved sequences of the CHS3 gene of S. cerevisiae, whichencodes the class IV isozyme Chs3p in that fungus. Becauseonly an 870-bp fragment of the 39 end of WdCHS4 gene couldbe cloned by the library screening approaches used previouslyfor WdCHS1, WdCHS2, and WdCHS3 (31), a marker rescuestrategy (27) was used to clone WdCHS4. Plasmid pPCS4 waslinearized with EcoRV and then transformed into W. derma-titidis by electroporation. Homologous recombination betweenthe plasmid and the genome resulted in an interrupted repeatthat contained one hybrid intact WdCHS4 gene and one hybrid876-bp sequence (Fig. 1A). Genomic DNA of four transfor-mants digested with BglII and subjected to Southern analysisshowed that three had the expected site-specific integrationpattern (Fig. 1B). Because Southern blotting suggested that noBglII site was present in the WdCHS4 gene or in pPCS4, aplasmid carrying the WdCHS4 gene was recovered by digestionof genomic DNA of one transformant (Fig. 1B, lane 1) withBglII, followed by ligation, transformation of E. coli XL1-Blue,and selection for chloramphenicol-resistant clones. Two trans-formants were obtained. The 14-kb plasmid pMRCHS4 fromone clone was isolated, and the 5.2-kb WdCHS4 gene waslocated by restriction enzyme mapping (Fig. 1C).

WdCHS4 is a homolog of CHS3 of S. cerevisiae. After a seriesof subclonings, the WdCHS4 gene was completely sequenced.Three in-frame ATGs were found at its 59 end. Two TA-richmotifs at positions 256 and 220 bp were identified upstreamof the first putative translation start site. The deduced 1,238amino acids, with a calculated mass of 138.8 Kda and a pI of9.07, encoded by the 3,714-bp open reading frame showed52.2% identity to Chs3p encoded by CHS3 of S. cerevisiae (9,57), and 68.8, 68.4, and 54.2% identity to the other class IVchitin synthases encoded by CHS4 of N. crassa (5), CHSD of A.nidulans (40), and CHS3 of C. albicans (53), respectively (Fig.2). Two highly conserved regions were identified as aminoacids 201 to 512 and 664 to 1183. The latter region has homol-ogy to corresponding regions in all members of the otherclasses of chitin synthases and is reported to contain the en-zyme’s catalytic domain (42). Hydropathy analysis (data notshown) indicated that WdChs4p is a seven-transmembraneprotein with hydrophilic regions located near both its aminoand carboxyl termini and a neutral region at its center, whichare similar to those of other class IV chitin synthases butdifferent from those of other chitin synthase classes. In contrastto the other three WdCHS genes of W. dermatitidis (unpub-lished data), no evidence for an intron was found in the singleopen reading frame of WdCHS4. Karyotypic analysis with thewild-type strain (ATCC 34100) and the type strain (ATCC28869) probed with the WdCHS4 366-bp PCR product showedstrong hybridization only with chromosome IV (data notshown), which has an estimated size of 3 to 3.5 Mb and is thesmallest of the four chromosomes resolved in both strains (64).

Expression levels of the WdCHS4 gene are not dramaticallyaffected by temperature shift, morphological transition, or dis-ruption of other WdCHS genes. The two temperature-sensitivemorphological mutants of W. dermatitidis, Mc3 (cdc2) and Hf1,convert to isotropic forms and hyphae with thicken cell walls,

VOL. 67, 1999 CHITIN SYNTHASE 4 OF W. DERMATITIDIS 6621

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 13

Nov

embe

r 20

21 b

y 21

1.22

7.15

7.54

.

FIG. 2. Multiple sequence comparison by CLUSTAL analysis of the deduced amino acid sequences of five class IV chitin synthases: WdChs4p, AnChsDp (ChsDpfrom A. nidulans), NcChs4p (Chs4p from N. crassa), CaChs3p (Chs3p from C. albicans), and ScChs3p (Chs3p from S. cerevisiae). p, identical or conserved residue inall sequences in the alignment; : , conserved substitution; . , semiconserved substitution.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 13

Nov

embe

r 20

21 b

y 21

1.22

7.15

7.54

.

FIG. 2—Continued.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 13

Nov

embe

r 20

21 b

y 21

1.22

7.15

7.54

.

respectively, when shifted from 25 to 37°C in YPD, whereasthe wild-type strain retains its ability to grow as a yeast whencultured identically. Total RNA extracted from these strains,grown at 25 and 37°C for 24 h, was subjected to Northernanalysis using a 0.8-kb BamHI fragment of WdCHS4 as aprobe. A single transcript of about 3.7 kb was detected in eachstrain cultured at both temperatures, and no dramatic increasein transcription level was apparent in cells of the same strainshifted from 25 to 37°C, using actin expression levels as con-trols (Fig. 3). Total RNA of the other chitin synthase singlegene disruption strains, the wdchs1D, wdchs2D, and wdchs3Dmutants (31, 58, 63), was also probed by Northern blotting(data not shown). The transcription levels of WdCHS4 in all ofthese single wdchsD strains were similar to that in the wild type,

indicating that defects in other chitin synthase genes in W.dermatitidis did not significantly affect the expression level ofWdCHS4. These data further suggested that neither the shift ofthese strains to high temperature nor the transitions of yeastcells to other vegetative phenotypes dramatically affectedWdCHS4 transcription.

The WdCHS4 gene is not essential for W. dermatitidis viabil-ity. Using a strategy similar to that used to clone WdCHS4, weused plasmid pDCS4, which contains an 800-bp BamHI frag-ment of WdCHS4, to disrupt this gene in such a way that site-specific integration at the wdchs4 locus by homologous recom-bination would result in two truncated fragments of WdCHS4separated by the vector sequence and the hph gene (Fig. 4A).Total DNA from three transformants obtained on YPD-HmBmedium was digested with ApaI or SacI and then subjected toSouthern blotting using a WdCHS4 BamHI 0.8-kb fragmentas a probe. The expected band shifts from 6.0 to 11.8 kb withApaI-digested DNA and from 3.5 to 9.3 kb with SacI-digestedDNA confirmed that these transformants were WdCHS4 dis-ruptants (Fig. 4B; data only for wdchs4D-1 are shown). North-ern blotting also indicated that the 3.6-kb transcript shifted tothe higher-molecular-weight position in the wdchs4D disrup-tion strain (data not shown). Disruption of WdCHS4 was alsoachieved by using plasmid pHY1, which contained the sameWdCHS4 800-bp fragment but with the sulfonyl urea resistancegene marker. Southern blotting proved that at least one viablesulfonyl urea-resistant WdCHS4 disruption strain has also beenobtained, which was named wdchs4D (sur) (62a).

The wdchs4D-1 disruptant strain grows slowly in poor me-dium and shows abnormal yeast clumping, budding kinetics,and pigmentation. At 25°C, the growth rates of wdchs4D-1 andwild-type strains were similar in both broth YPD and CDNmedia (data not shown). At 37°C, the growth rate of wdchs4D-1was close to that of the wild type in YPD but significantly lower

FIG. 2—Continued.

FIG. 3. Northern blot analysis of WdCHS4 expression. Total RNA (20 mg)was prepared from wild-type W. dermatitidis 8656 (lanes 1 and 4) and thetemperature-sensitive morphological mutants Mc3 (lanes 2 and 5) and Hf1(lanes 3 and 6) grown at 25 and 37°C, respectively, for 24 h and electrophoresedin a formaldehyde-containing 1.2% agarose gel before transfer to a nylon mem-brane. The membrane was probed with a 32P-labeled 0.8-kb BamHI fragment ofWdCHS4 and a 0.6-kb PCR fragment of the actin gene (WdACT1) of W. derma-titidis, as indicated.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 13

Nov

embe

r 20

21 b

y 21

1.22

7.15

7.54

.

than that of the wild type in CDN medium (Fig. 5), suggestingthat WdChs4p makes a significant contribution to the rate ofcell growth in W. dermatitidis under some nutrient-poor growthconditions. The wdchs4D-1 cells were also observed by lightmicroscopy to have a clumping tendency and a higher density(they tended to settle faster than the wild type) at both 25 and37°C when cultured in liquid medium (data not shown). Al-though calcofluor staining for chitin and fluorescence micros-copy showed no obvious differences in cell wall and septal re-gions between wdchs4D-1 and its wild-type parent, a largerpopulation of the multiply budding yeast cells was detectedamong the disruptant cells in CDN medium at 37°C (Table 1).Scanning electron microscopy showed that the wdchs4D-1 cellsnot only tended to clump but also had abnormal multiplebudding patterns among cells cultured in CDN at 37°C (Fig. 6).Furthermore, it was noted that colonies of the disruption straingrown on agar (Fig. 7), as well as cells cultured in liquidmedium and culture supernatant fluids after centrifugation(data not shown), were darker than those of the wild-typestrain after growth for only a few days at 25 or 37°C, indicatingthat more melanin was being incorporated into their cell wallsand being leaked from the wdchs4D-1 disruptant cells. How-

ever, the darker wdchs4D-1 strain could not cross-feed thewhite melanin-deficient wdpks4D-1 mutant (data not shown) inwhich the polyketide synthase gene was disrupted (23a), indi-cating that pigmented molecules secreted from this mutantwere not precursors of melanin polymers but were probablypolymerized melanin itself. Similar, if not identical, abnormalphenotypes have been observed with all other wdchs4D strains,including the wdchs4D (sur) strain, although none of these strainshave been characterized to the same extent as wdchs4D-1.Finally, no significant (P . 0.01) differences in survival rateswere detected in immunocompetent 4-week-old ICR mice in-oculated intravenously with the wild-type strain, a vector con-trol strain with pAN7-1 integrated ectopically, or the wdchs4D-1 mutant (data not shown).

Chitin content, but not chitin synthase activity, is reducedin the wdchs4D-1 disruptant at 37°C. The chitin content ofwdchs4D-1 was found to be significantly less than that of thewild-type strain at 37°C, but not at 25°C (Fig. 8A). This resultwas the first indication that any wdchsD in W. dermatitidis couldbe correlated with a significant reduction in cell wall chitin(references 58 and 63 and this work). Apparently our currentchitin assay method is not sensitive enough to detect minorchanges, if they exist, in the chitin contents of the wdchs4D-1mutant at 25°C or in other single wdchs1D, wdchs2D, andwdchs3D mutants at either 25 or 37°C. Surprisingly, however,the chitin synthase activity in the wdchs4D-1 strain did notdecrease like that of the other wdchs disruption mutants grownidentically (58, 63), but instead exhibited a consistent minorbut not statistically significant increase under the 37°C growthcondition (Fig. 8B and C). These contradictory data from as-saying chitin contents and chitin synthase activities may re-

FIG. 5. Comparison of the growth rates at 37°C of W. dermatitidis 8656 (wildtype [wt]) and its wdchs4D-1 mutant (chs4) in YPD or CDN medium. Late log-phase cultures were transferred to YPD or CDN medium to the final opticaldensity at 600 nm (OD600) of 0.06 (measured with a Beckman model 25 spec-trophotometer). Cells were grown at 37°C with shaking at 200 rpm. Results shownare the average of two independent experiments.

TABLE 1. Comparisons of yeast cell morphologies ofwild-type and wdchs4D-1 strains

StrainMean % of different morphologies 6 SEM

Unbudded Singly budded Multiply budded

Wild type 57.6 6 3.28 37.0 6 3.87 5.4 6 1.14wdchs4D 23.4 6 5.13 53.8 6 6.30 22.6 6 3.72

FIG. 4. Disruption of WdCHS4 gene in W. dermatitidis. (A) Predicted structure for integration of pDCS4-800 at the wdchs4 locus. (B) Southern hybridizationanalysis of the wdchs4D-1 disruptant strain. The recombinant plasmid pDCS4-800 linearized with BstXI was transformed into W. dermatitidis 8656. Southern blots ofgenomic DNA from W. dermatitidis 8656 (lanes 1 and 3) and wdchs4D-1 strain (lanes 2 and 4), digested with ApaI (lanes 1 and 2) and SacI (lanes 3 and 4), werehybridized with a 0.8-kb WdCHS4 BamHI fragment.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 13

Nov

embe

r 20

21 b

y 21

1.22

7.15

7.54

.

flect that other chitin synthases compensate for the loss ofWdChs4p.

WdChs4p is characterized in the wdchs1D wdchs2D wdchs3Dtriple mutant. Using three different selective markers, we ob-tained the wdchs1D, wdchs2D, wdchs3D triple mutant throughthree consecutive disruptions (63). Although this mutant grewmuch less vigorously, had an obviously abnormal phenotypecompared to the wild-type or even the wdchs4D-1 mutant, andwould not grow at all at 37°C, adequate growth could be ob-tained at 25°C (Fig. 9) for WdChs4p assays: since all four chitinsynthase structural genes are thought to have been identified inW. dermatitidis, WdChs4p was regarded as the only chitin syn-thase present in this triple mutant, and thus its activity could becharacterized directly in membrane protein samples by bio-chemical assay. Compared with the total chitin synthase activ-ities of the wild type and the wdchs4D-1 mutant (Fig. 8B),WdChs4p activity in the triple mutant was very low (Fig. 10A).As expected, it could be activated by trypsin treatment (Fig.10B), indicating that although WdChs4p was a zymogen, it didnot contribute the majority of chitin synthase activity in vitro.As also expected, certain divalent cations were found to berequired for stimulating the activity of the trypsin-treatedmembranes above basal levels. Among the six cations exam-

ined, Mg21 was more effective than either Co21 or Mn21 forstimulating WdChs4p activity, whereas Ca21, Cu21, and Zn21

were ineffective (Fig. 10A). Although the pH profile was foundto be stringent for WdChs4p, with the optimal pH for maximalactivity determined to be 7.5 (Fig. 10C), WdChs4p had loweractivity at 25°C and a broad temperature tolerance, from 30 to45°C (Fig. 10D). Moreover, WdChs4p was demonstrated to bemore sensitive in vitro to polyoxin D than to nikkomycin Z(Fig. 10E), which are two antifungal agents that are known tocompetitively inhibit chitin synthases (16).

DISCUSSION

Although a PCR fragment homologous to CAL1, the classIV chitin synthase-encoding gene of S. cerevisiae had beenidentified in W. dermatitidis some time ago (29, 46), thefull-length WdCHS4 gene was resistant to cloning by the li-brary screening approaches used for WdCHS1, WdCHS2, andWdCHS3. Therefore, a gene marker rescue approach involvingtransformation was used to clone this gene. One advantage ofthis method was that once a fragment of WdCHS4 was ob-tained, it was easily integrated with a shuttle vector into itsendogenous genomic locus by homologous recombination, andthen regions both upstream and downstream were recoveredby selectively digesting genomic DNA, transforming it intoE. coli, and isolating replicative plasmids. A second advantagewas that the two truncated gene copies derived from this inte-gration resulted in a gene disruption. Thus, insights into thefunction of the tagged gene were obtained even before thegene was cloned.

The deduced WdCHS4 gene product was found to have mosthomology to the class IV chitin synthases of the filamentousfungi N. crassa (5) and A. nidulans (40) and less homology tothose of the yeast species S. cerevisiae (9, 57) and C. albicans(53), confirming again that the essentially filamentous, butpolymorphic, asexual fungus W. dermatitidis is more closelyrelated to filamentous ascomycetes than to known or suspectedyeast ascomycete species (7, 29). Unlike members of otherclasses, which have four transmembrane domains at C-termi-nal regions, WdChs4p has seven transmembrane domains dis-tributed at both ends of the protein and between which arelocated putative catalytic regions. It also has a unique N-ter-

FIG. 6. Scanning electron micrograph showing morphology of wild-type (wt) and wdchs4D-1 cells grown in CDN liquid medium at 37°C for 24 h. Arrows point tomultiple budding yeast cells. Bars, 10 mm.

FIG. 7. Growth of wild-type and wdchs4D-1 strains on YPD agar mediumincubated at 37°C for 4 days. Colonies of the wdchs4D-1 strain are darker thanthose of the wild type. Arrows point to zones in the YPD agar where melanin hasaccumulated.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 13

Nov

embe

r 20

21 b

y 21

1.22

7.15

7.54

.

minal region, as is common to all class IV chitin synthasescharacterized to date, including Chs3p of S. cerevisiae.

The wdchs4D-1 strain is the only wdchs disruption mutantdetected to have a significantly reduced chitin content at 37°Caccording to our current measurement protocols, indicatingthat WdChs4p makes more chitin in W. dermatitidis, at least at37°C, than do the other isozymes. This is in agreement withthe finding that the class IV chitin synthase of S. cerevisiae isthe major producer of chitin in that fungus (9). Moreover, theclumping tendency and the multiple budding of the yeast cellsof all the wdchs4D mutants were similar to the phenotypereported for the CAL1 mutants of S. cerevisiae (50). We sus-pect that this phenotype is indicative of structural changes incell wall and in septal regions, although aberrant septation wasnot revealed by calcofluor staining. Also, the increased mela-nin released from wdchs4D cells suggests that melanin might

normally be deposited in the chitin matrix synthesized byWdChs4p. In this respect, we hypothesize that melanin inW. dermatitidis is bound or trapped by the cell wall matrixcontributed by WdChs4p but is not retained as efficiently in thecell walls of wdchs4D mutants. Alternatively, the regulation ofthe melanin biosynthesis pathway might be related to chitinsynthesis. In this scenario, the chitin in the cell wall synthesized

FIG. 8. (A) Comparison of chitin contents of the wild type (wt) andwdchs4D-1 mutant incubated at 25 and 37°C. Results are derived from threeindependent experiments. Standard deviations are shown. The significantly dif-ferent (P , 0.05) chitin content between the wild-type strain grown at 25 and at37°C is indicated by a single asterisk, whereas significant difference (P , 0.05)between the wild-type and wdchs4D-1 strains at 37°C is indicated by two asterisks.(B and C) WdChs activities of the wild type and wdchs4D-1 mutant incubated at25 or 37°C and assayed with (B) or without (C) trypsin treatment. Results foreach treatment are derived from three independent experiments. Standard de-viations are shown. No significantly different (P . 0.05) activities were foundbetween the wild-type and wdchs4D-1 strains at each temperature.

FIG. 9. Temperature sensitivity test for the wild-type (wt) and wdchs4D-1,wdchs1Dwdchs2D and wdchs1Dwdchs2Dwdchs3D mutant strains. The strainswere grown on YPD plates at 25 and 37°C, as indicated, for 3 days.

FIG. 10. Biochemical characteristics of WdChs4p activity of membranesfrom the wdchs1D chs2D chs3D triple mutant. Membrane proteins were isolatedfrom mutant cells grown in YPD liquid medium at 25°C for 40 h. The resultswere derived from two independent experiments, and the assay of each samplewas duplicated. Standard deviations are shown.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 13

Nov

embe

r 20

21 b

y 21

1.22

7.15

7.54

.

by WdChs4p might inhibit melanin synthesis by a feedbackregulation mechanism.

Total chitin synthase activity in the wdchs4D-1 mutant didnot show significant changes compared to that of the wild type,which is similar to the situation with wdchs1D mutants (63) butnot of wdchs2D or wdchs3D mutants (58). This may be due tothe fact that four classes of chitin synthases have been identi-fied in W. dermatitidis (31, 56). Possibly one or all of the otherchitin synthases, and most likely WdChs2p, which is a class Ichitin synthase and contributes most of the zymogenic activityassociated with membranes of W. dermatitidis (63, 64), com-pensates for the lost WdChs4p activity when WdCHS4 is de-leted. Alternatively, the lost WdChs4p activity is possibly com-pensated for by WdChs3p activity, which is induced to higherlevels of production at 37°C (58). Finally, this paradox mightsimply be explained by the minor amount of chitin synthaseactivity contributed by WdChs4p in the wild-type strain, whichcould not be shown to be reduced significantly in the wdchs4D-1 strain. Evidence for a low level of activity of WdChs4p comesfrom studies of the wdchs triple mutant, which has about 10-fold-lower total activity per milligram membrane protein thanthe wild-type strain (compare data in Fig. 10A with those inFig. 8B).

During the polymorphic transitions of W. dermatitidis, thetranscription levels of WdCHS4 did not appear to change sig-nificantly in comparisons between cells of the same strainshifted to 37°C, even though significantly more chitin is depos-ited in the cell walls of the multicellular forms and hyphae (19,26, 54). The expression level of WdCHS4 was also similar to thewild-type level in the wdchs1D, wdchs2D, and wdchs3D strainsgrown under standard growth conditions (58a). Thus, the ex-pression of this gene is probably constitutive during polymor-phic growth, even in the absence of one or another single chitinsynthase. These particular results argue against the possibil-ity introduced above, that the disruption of WdCHS4 mightinduce a higher expression of other WdCHS genes for com-pensation, and instead suggest that WdChs4p, like Chs3p inS. cerevisiae (15), is regulated at the translational or posttrans-lational level. However, it is still very possible that the expres-sion levels of WdCHS4 are correlated with specific events as-sociated with yeast cell cycle progression, particularly the eventof septation, which is a possibility not addressed in this study.

The successful use of multiple selective markers in ourWdCHS gene disruption experiments (31) allowed us to elim-inate the three other WdCHS genes in W. dermatitidis, which inturn permitted the measurement of only the class IV chitinsynthase activity of WdChs4p. The protein responsible for thisactivity was directly determined to be a zymogen, which couldbe activated in vitro when treated with trypsin, even withoutthe protection of substrate UDP-GlcNAc. Our direct assay ofthe WdChs4p activity also revealed its remarkable preferencefor certain divalent ions, suggesting that metal ions are essen-tial and specific for chitin synthase activity in vitro: the higherefficiency of Mg21 to stimulate the enzyme activity versus thatof Co21 suggests that the binding of Mg21 was stronger thanthat of Co21, which is in agreement with the study of Chs3p ofS. cerevisiae (57). The optimal pH (pH 7.5) of WdChs4p wasalso similar to Chs3p of yeast. However, the broad tempera-ture optimum for WdChs4p activity, unlike that for Chs3p(25°C) (10), which is probably a reflection of the thermotoler-ance known to be associated with W. dermatitidis, may suggestthat this enzyme is particularly well suited for functioning atthe higher temperatures associated with its poorly character-ized saprophic environment and with human infection. Likethe other chitin synthases of S. cerevisiae, WdChs4p was alsosensitive to polyoxin D and nikkomycin Z in vitro, indicating

that this chitin synthase shares domains that can be targeted bythese and other drugs.

The disruption of WdCHS4 produced cells that showed nosignificant reduction in virulence in an acute mouse model. Wespeculate that this absence of virulence loss after the disrup-tion of WdCHS4 is because its product, WdChs4p, is not aparticularly important contributor of the specific chitin(s) re-quired for the survival and growth of W. dermatitidis at tem-perature of infection. This speculation is based on our obser-vations that the wdchs1D wdchs2D wdchs3D triple mutant ofthis pathogen, which presumably has only WdChs4p activity,grew at 25°C (albeit poorly) but not at 37°C, even though chitinsynthase activity could be measured in vitro over a broad tem-perature range, including 37°C. Possibly at temperatures ofinfection, the WdChs4p zymogen is not activated in vivo or, ifactivated, does not function efficiently enough to compensatefor the loss of the chitin contributed normally by one or moreof the other chitin synthases. We further speculate that thechitin contributed by WdChs4p is not localized to positions incells necessary to compensate for the loss of the chitin productsof other chitin synthases of W. dermatitidis, which are mostimportant for normal yeast growth. We base this suggestion onour observation in this and other studies (63) that the cells ofthe triple mutant that survive at 25°C, like those of thewdchs1D wdchs2D double mutant, are very swollen, multinu-cleate, largely inhibited in cell separation, and defective innormal septum formation (reference 63 and results to be re-ported elsewhere). In contrast, as shown in the present work,the disruption of WdCHS4 alone results in only relatively mi-nor perturbations, which although more pronounced at 37°Care mainly manifested by clumpiness, multiple budding, andslower growth in poor but not rich medium, none of whichshould significantly alter virulence in the rich environmentsassociated with most infections. Thus, additional similar stud-ies, involving the cloning and disruption of each of the otherWdCHS genes of W. dermatitidis individually and in as manycombinations as possible, are required before the contributionsof each of their products to saprophytic and parasitic growthand survival of this pathogen can be satisfactorily defined. Suchstudies are in progress and are at very advanced stages (31, 58,63, 64).

ACKNOWLEDGMENTS

We thank S. M. Karuppayil and B. Feng for supplying PCR frag-ments of the WdCHS4 gene, Z. Yin for helping with the pulsed-fieldelectrophoresis, C. R. Cooper, Jr., for the use of a CHEF gel appara-tus, W. Chen for supplying the WdACT1 gene used for a probe inNorthern analysis, P. McIntosh for help with scanning electron micros-copy, and H. Yarbrough for constructing and characterizing wdchs4D(sur) mutant.

This work was supported by grant AI 33049 to P.J.S. from theNational Institute of Allergy and Infectious Diseases.

REFERENCES1. Aufauvre-Brown, A., E. Mellado, N. A. R. Gow, and D. W. Holden. 1997.

Aspergillus fumigatus chsE: a gene related to CHS3 of Saccharomyces cerevi-siae and important for hyphal growth and conidiophore development but notpathogenicity. Fungal Genet. Biol. 21:141–152.

2. Ausubel, F. M., R. Bent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A.Smith, and K. Struhl (ed.). 1989. Current protocols in molecular biology.John Wiley & Sons, New York, N.Y.

3. Bartnicki-Garcia, S., and E. Reyes. 1968. Chemical composition of sporan-giophore walls of Mucor rouxii. Biochim. Biophys. Acta 165:32–42.

4. Bell, A. A., and M. H. Wheeler. 1986. Biosynthesis and functions of fungalmelanins. Annu. Rev. Phytopathol. 24:411–451.

5. Beth Din, A., C. A. Specht, P. W. Robbins, and O. Yarden. 1996. chs-4, a classIV chitin synthase gene from Neurospora crassa. Mol. Gen. Genet. 250:214–222.

6. Boas, N. F. 1953. Method for the determination of hexosamines in tissues.J. Biol. Chem. 204:553–563.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 13

Nov

embe

r 20

21 b

y 21

1.22

7.15

7.54

.

7. Bowen, A. R., J. L. Chen-Wu, M. Momany, R. Young, P. J. Szaniszlo, andP. W. Robbins. 1992. Classification of fungal chitin synthases. Proc. Natl.Acad. Sci. USA 89:519–523.

8. Braun, P. C., and R. A. Calderone. 1978. Chitin synthesis in Candida albi-cans: comparison of yeast and hyphal forms. J. Bacteriol. 135:1472–1477.

9. Bulawa, C. E. 1992. CSD2, CSD3, and CSD4 genes required for chitinsynthesis in Saccharomyces cerevisiae: the CSD2 gene product is related tochitin synthases and to developmentally regulated proteins in Rhizobiumspecies and Xenopus laevis. Mol. Cell. Biol. 12:1764–1776.

10. Bulawa, C. E. 1993. Genetics and molecular biology of chitin synthase infungi. Annu. Rev. Microbiol. 47:505–534.

11. Bulawa, C. E., M. Slater, E. Cabib, J. Au-Young, A. Sburlati, W. L. Adair,and P. W. Robbins. 1986. The Saccharomyces cerevisiae structural gene forchitin synthase is not required for chitin synthase in vivo. Cell 46:213–215.

12. Cabib, E., S. J. Silverman, A. Sburlati, and M. L. Slater. 1990. Chitinsynthesis in yeast (Saccharomyces cerevisiae), p. 31–41. In P. J. Kuhn, A. P. J.Trinci, M. J. Jung, M. W. Goosey, and L. G. Copping (ed.), Biochemistry ofcell wall and membranes in fungi. Springer-Verlag, New York, N.Y.

13. Carroll, A. M., J. A. Sweigard, and B. Valent. 1994. Improved vectors forselecting resistance to hygromycin. Fungal Genet. Newsl. 41:22.

14. Cassone, A. 1986. Cell wall of pathogenic yeasts and implication for antimy-cotic therapy. Drugs Exp. Clin. Res. 12:635–643.

15. Choi, W., B. Santos, A. Duran, and E. Cabib. 1994. Are yeast chitin synthasesregulated at the transcriptional or the posttranscriptional level. Mol. Cell.Biol. 14:7685–7694.

16. Cid, V. J., A. Duran, F. del Rey, M. P. Synder, C. Nombela, and M. Sanchez.1995. Molecular basis of cell integrity and morphogenesis in Saccharomycescerevisiae. Microbiol. Rev. 59:345–386.

17. Cole, G. T. 1986. Preparation of microfungi for scanning electron micros-copy, p. 1–44. In H. C. Aldrich, and W. J. Todd (ed.), Ultrastructure tech-niques for microorganisms. Plenum Press, New York, N.Y.

18. Cooper, C. R., Jr., and P. J. Szaniszlo. 1993. Evidence for two cell divisioncycle (CDC) genes that govern yeast bud emergence in the pathogenicfungus Wangiella dermatitidis. Infect. Immun. 61:2069–2081.

19. Cooper, C. R., Jr., J. L. Harris, C. W. Jacobs, and P. J. Szaniszlo. 1984.Effects of polyoxin on cellular development in Wangiella dermatitidis. Exp.Mycol. 8:349–363.

20. de Hoog, G. S., K. Takeo, S. Yoshida, E. Gottlich, K. Nishimura, and M.Miyaji. 1994. Pleoanamorphic life cycle of Exophiala (Wangiella) dermatitidis.Antonie Leeuwenhoek 65:143–153.

21. Dixon, D. M., A. Polak, and P. J. Szaniszlo. 1991. Pathogenicity and viru-lence of wild-type and melanin-deficient Wangiella dermatitidis. J. Med. Vet.Mycol. 25:97–106.

22. Dixon, D. M., P. J. Szaniszlo, and A. Polak. 1991. Dihydroxynaphthalene(DHN) melanin and its relationship with virulence in the early stages ofphaeohyphomycosis, p. 297–318. In G. T. Cole, and H. C. Hoch (ed.), Thefungal spore and disease initiation in plants. Plenum Press, New York, N.Y.

23. Dixon, D. M., J. Migliozzi, C. R. Cooper, O. Solis, B. Breslin, and P. J.Szaniszlo. 1992. Melanized and non-melanized multicellular form mutantsof Wangiella dermatitidis in mice: mortality and histopathology studies. My-coses 35:17–21.

23a.Feng, B., and P. J. Szaniszlo. Unpublished data.24. Geis, P. A., and C. W. Jacobs. 1985. Polymorphism of Wangiella dermatitidis,

p. 205–233. In P. J. Szaniszlo (ed.), Fungal dimorphism: with emphasis onfungi pathogenic for humans. Plenum Press, New York, N.Y.

25. Gooday, G. W., and N. A. R. Gow. 1990. Enzymology of tip growth in fungi,p. 31–58. In I. B. Health, (ed.), Tip growth in plant and fungal cells. Aca-demic Press, Inc., San Diego, Calif.

26. Harris, J. L., and P. J. Szaniszlo. 1986. Localization of chitin in walls ofWangiella dermatitidis using colloidal gold-labeled chitinase. Mycologia 78:853–857.

27. Jung, M. K., and B. R. Oakley. 1990. Identification of an amino acid sub-stitution in the benA, b-tubulin gene of Aspergillus nidulans that confersthiabendazole resistance and benomyl supersensitivity. Cell Motil. Cytoskel.17:87–94.

28. Karuppayil, S. M., and P. J. Szaniszlo. 1997. Importance of calcium to theregulation of polymorphism in Wangiella (Exophiala) dermatitidis. J. Vet.Med. Mycol. 35:379–388.

29. Karuppayil, S. M., M. Peng, L. Mendoza, T. A. Levins, and P. J. Szaniszlo.1996. Identification of the conserved coding sequence of three chitin syn-thase genes in Fonsecaea pedrosoi. J. Med. Vet. Mycol. 34:117–125.

30. Kwon-Chung, K. J., and J. E. Bennet. 1992. Medical mycology, p. 337–555.Lea and Febiger, Philadelphia, Pa.

31. Kwon-Chung, K. J., W. E. Goldman, B. Klein, and P. J. Szaniszlo. 1998. Fateof transforming DNA in pathogenic fungi. Med. Mycol. 36:(Suppl. I):38–44.

32. Matsumoto, T., T. Matsuda, and M. R. McGinnis. 1993. Clinical and myco-logical spectra of Wangiella dermatitidis. Mycoses 36:145–155.

33. Mellado, E., A. Aufauvre-Brown, C. A. Specht, P. W. Robbins, and D. W.Holden. 1995. A multigene family related to chitin synthase genes of yeast inthe opportunistic pathogen Aspergillus fumigatus. Mol. Gen. Genet. 246:353–359.

34. Mellado, E., A. Aufauvre-Brown, N. A. R. Gow, and D. W. Holden. 1996. The

Aspergillus fumigatus chsC and chsG genes encode class III chitin synthaseswith different functions. Mol. Microbiol. 20:667–679.

35. Mellado, E., C. A. Specht, P. W. Robbins, and D. W. Holden. 1996. Cloningand characterization of chsD, a chitin synthase-like gene of Aspergillus fu-migatus. FEMS Microbiol. Lett. 143:69–76.

36. Mendoza, A. L. 1995. Cloning and molecular characterization of the chitinsynthase 1 (WdCHS1) gene of Wangiella dermatitidis. Ph.D. thesis. The Uni-versity of Texas at Austin.

37. Mio, T., T. Yabe, M. Sudoh, Y. Satoh, T. Nakajima, M. Arisawa, and H.Yamada-okabe. 1996. Role of three chitin synthase genes in the growth ofCandida albicans. J. Bacteriol. 178:2416–2419.

38. Molano, J. B., Bowers, and E. Cabib. 1980. Distribution of chitin in the yeastcell wall: an ultrastructural and chemical study. J. Cell Biol. 85:199–212.

39. Momany, M., and P. J. Szaniszlo. 1994. DNA isolation from Wangiella, p.519–520. In B. Maresca and G. S. Kobayashi (ed.), Molecular biology ofpathogenic fungi—a laboratory manual. Telos Press, New York, N.Y.

40. Motoyama, T., M. Fujiwara, N. Kojima, H. Horiuchi, A. Ohta, and M.Takagi. 1996. The Aspergillus nidulans genes chsA and chsD encode chitinsynthases which have redundant functions in conidia formation. Mol. Gen.Genet. 251:442–450.

41. Nachman, S. A., O. Alpan, R. Malowitz, and E. D. Spitzer. 1996. Catheter-associated fungemia due to Wangiella (Exophiala) dermatitidis. J. Clin. Mi-crobiol. 34:1011–1013.

42. Nagahashi, S., M. Sudoh, N. Ono, R. Saweda, E. Yamaguchi, Y. Uchida, T.Mio, M. Tagaki, M. Arisawa, and H. Yamada-Okabe. 1995. Characterizationof chitin synthase 2 of Saccharomyces cerevisiae. Implication of two highlyconserved domains as possible catalytic sites. J. Biol. Chem. 270:13961–13967.

43. Orlean, P. 1987. Two chitin synthases in Saccharomyces cerevisiae. J. Biol.Chem. 262:5732–5739.

44. Orlean, P. 1997. Yeast III, p. 229–362. Cold Spring Harbor Laboratory Press,Cold Spring Harbor, N.Y.

45. Peng, M., C. R. Cooper, Jr., and P. J. Szaniszlo. 1995. Genetic transforma-tion of the pathogenic fungus Wangiella dermatitidis. Appl. Microbiol. Bio-technol. 44:444–450.

46. Peng, M., S. M. Karuppayil, L. Mendoza, T. A. Levins, and P. J. Szaniszlo.1995. Use of the polymerase chain reaction to identify coding sequences forchitin synthase isozymes in Phialophora verrucosa. Curr. Genet. 27:517–523.

47. Roberts, R. L., B. Bowers, M. L. Slater, and E. Cabib. 1983. Chitin synthesisand localization in cell division cycle mutants of Saccharomyces cerevisiae.Mol. Cell. Biol. 3:922–930.

48. Schnitzler, N., H. Peltroche-Llacsahuanga, N. Bestier, J. Zundorf, R. Lut-ticken, and G. Haase. 1999. Effect of melanin and carotenoids of Exophala(Wangiella) dermatitidis on phagocytosis, oxidative burst, and killing by hu-man neutrophils. Infect. Immun. 67:94–101.

49. Sentandreu, R., E. Hettero, J. P. Martinez-Garcia, and G. Larriba. 1989.Biogenesis of the yeast cell walls, p. 193–235. In D. B. Roodyn (ed.), Sub-cellular biochemistry. Plenum Press, New York, N.Y.

50. Shaw, J. A., P. C. Mol, B. Bowers, S. J. Silverman, M. H. Valdivieso, A.Duran, and E. Cabib. 1991. The function of chitin synthases 2 and 3 in theSaccharomyces cerevisiae cell cycle. J. Cell Biol. 114:111–123.

51. Silverman, S. J., A. Sburlati, M. L. Slater, and E. Cabib. 1988. Chitinsynthase 2 is essential for septum formation and cell division in Saccharo-myces cerevisiae. Proc. Natl. Acad. Sci. USA 85:4735–4739.

52. Specht, C. A., Y. Liu, P. W. Robbins, C. E. Bulawa, N. Iartchouk, K. R.Winter, P. J. Riggle, J. C. Rhodes, C. L. Dodge, D. W. Culp, and P. T. Borgia.1996. The chsD and chsE genes of Aspergillus nidulans and their roles inchitin synthesis. Fungal Genet. Biol. 20:153–167.

53. Sudoh, M., S. Nagahashi, M. Doi, A. Ohta, M. Takagi, and M. Arisawa. 1993.Cloning of the chitin synthase 3 gene from Candida albicans and its expres-sion during yeast-hyphal transition. Mol. Gen. Genet. 241:351–358.

54. Szaniszlo, P. J., C. W. Jacobs, and P. A. Geis. 1983. Dimorphism: morpho-logical and biochemical aspects, p. 323–426. In D. H. Howard (ed.), Fungipathogenic for humans and animals, part A. Biology. Marcel Dekker, NewYork, N.Y.

55. Szaniszlo, P. J., L. Mendoza, and S. M. Karuppayil. 1993. Clues aboutchromoblastomycotic and other dematiaceous fungal pathogens based onWangiella as a model, p. 241–255. In H. Vanden Bossche, F. C. Odds, and D.Kerridge (ed.), Dimorphic fungi in biology and medicine. Plenum Press, NewYork, N.Y.

56. Szaniszlo, P. J., and M. Momany. 1993. Chitin, chitin synthase and chitinsynthase conserved region homologues in Wangiella dermatitidis, p. 229–242.In B. Maresca, G. Kobayashi, and H. Yamaguchi (ed.), NATO ASI series,vol. H69. Molecular biology and its application to medical mycology. Spring-er-Verlag, Berlin, Germany.

57. Valdivieso, M. H., P. C. Mol, J. A. Shaw, E. Cabib, and A. Duran. 1991.Cloning of CAL1, a gene required for activity of chitin synthase 3 in Sac-charomyces cerevisiae. J. Cell Biol. 114:101–109.

58. Wang, Z. 1998. Cloning and characterization of the chitin synthase 3(WdCHS3) and chitin synthase 4 (WdCHS4) genes of Wangiella dermatitidisand expression studies of WdCHS3. Ph.D. thesis. The University of Texas atAustin.

58a.Wang, Z. Unpublished data.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 13

Nov

embe

r 20

21 b

y 21

1.22

7.15

7.54

.

59. Wessels, J. G. H. 1986. Cell wall synthesis in apical hyphal growth. Int. Rev.Cytol. 104:38–79.

60. Yabe, T., T. Yamada-Okabe, S. Kasahara, Y. Furuichi, T. Nakajima, E.Ichishima, M. Arisawa, and H. Yamada-Okabe. 1996. HKR1 encodes a cellsurface protein that regulates both cell wall b-glucan synthesis and buddingpattern in the yeast Saccharomyces cerevisiae. J. Bacteriol. 178:477–483.

61. Yanai, K., N. Kojima, N. Takaya, H. Horiuchi, A. Ohta, and M. Takagi. 1994.Isolation and characterization of two chitin synthase genes from Aspergillusnidulans. Biosci. Biotechnol. Biochem. 58:1828–1835.

62. Yarden, O., and C. Yanofsky. 1991. Chitin synthase 1 plays a major role in

cell wall biogenesis in Neurospora crassa. Genes Dev. 5:2420–2430.62a.Yarbrough, H., and P. J. Szaniszlo. Unpublished data.63. Zheng, L. 1997. Establishment of genetic transformation systems in and

molecular cloning of the chitin synthase 2 (WdCHS2) gene, and character-ization of the WdCHS1 and WdCHS2 genes of Wangiella dermatitidis. Ph.D.thesis. The University of Texas at Austin.

64. Zheng, L., and P. J. Szaniszlo. 1999. Cloning and use of the WdURA5 geneas a hisG cassette selection marker for potentially disrupting multiple genesof Wangiella dermatitidis. Med. Mycol. 37:85–96.

Editor: T. R. Kozel


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/i

ai o

n 13

Nov

embe

r 20

21 b

y 21

1.22

7.15

7.54

.

WdChs4p, a Homolog of Chitin Synthase 3 in Saccharomyces

Documents

Transcript of WdChs4p, a Homolog of Chitin Synthase 3 in Saccharomyces